help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shetty, G.
Right arrow Articles by Meistrich, M. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shetty, G.
Right arrow Articles by Meistrich, M. L.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*UniGene
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*TESTOSTERONE
Endocrinology Vol. 142, No. 7 2789-2795
Copyright © 2001 by The Endocrine Society


ARTICLES

Testosterone Inhibits Spermatogonial Differentiation in Juvenile Spermatogonial Depletion Mice1

Gunapala Shetty, Gene Wilson, Ilpo Huhtaniemi, Holly Boettger-Tong2 and Marvin L. Meistrich

Department of Experimental Radiation Oncology, University of Texas M. D. Anderson Cancer Center (G.S., G.W., M.L.M.), Houston, Texas 77030; Department of Physiology, University of Turku (I.H.), 20520 Turku, Finland; and Department of Obstetrics and Gynecology, Baylor College of Medicine (H.B.-T.), Houston, Texas 77030.

Address all correspondence and requests for reprints to: Dr. Gunapala Shetty, Department of Experimental Radiation Oncology, University of Texas M. D. Anderson Cancer Center, Houston, Texas 77030. E-mail: gshetty{at}audumla.mdacc.tmc.edu


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The juvenile spermatogonial depletion (jsd) mutation results in spermatogonial arrest after the first wave of spermatogenesis. In homozygous jsd mice in a hybrid background (C3HxB6) that were identified with microsatellite markers, the percentage of tubules showing differentiating germ cells [tubule differentiation index (TDI)] rapidly decreased after 7 weeks of age with a correlative increase in the intratesticular testosterone (ITT) levels. Treatment with a GnRH antagonist, Cetrorelix, suppressed ITT and stimulated spermatogonial differentiation at the end of treatment. When treated mice were killed 5–13.3 weeks after the end of treatment, the ITT progressively increased, and the TDI progressively declined, but there was a transient appearance of tubules with mature spermatids. To delineate the role of testosterone (T) in spermatogonial arrest, we gave 7.6-week-old jsd mice exogenous T and/or the androgen receptor antagonist flutamide with or without GnRH antagonist for 4 weeks. Flutamide alone moderately stimulated spermatogonial differentiation (TDI = 30%). GnRH antagonist increased the TDI to 73%, and the addition of flutamide to the GnRH antagonist treatment further increased it to 95%. When T was combined with GnRH antagonist treatment, ITT was increased, and the TDI was reduced to 7%. Addition of flutamide to this combination reversed the T inhibition of GnRH antagonist stimulation of spermatogonial differentiation to a TDI of 57%. ITT levels showed a good negative correlation to the TDI obtained with various treatments, but no such correlation was observed for FSH or LH levels. The results indicate that T inhibits the ability of spermatogonia to differentiate in jsd mice through an androgen receptor-mediated process.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
THE CONTINUOUS production of male gametes in mammals is dependent on uninterrupted stem spermatogonial proliferation and the differentiation of some of their progeny through the various stages of spermatogenesis into mature sperm. The process requires precise interplay of factors within the hypothlamo-hypophysial-testicular axis. At the testicular level, Sertoli cells, the nongametic cells within the seminiferous epithelium, regulate many of the events of spermatogenesis through paracrine interactions with the germ cells. Peritubular myoid and Leydig cells may also affect germ cell development. Defects in gene expression in either germ cells or nongerminal cells may block specific steps of spermatogenesis. If the proliferation of spermatogonia or the viability/differentiation of a particular germ cell type is affected, spermatogenic arrest may result. (Here the term arrest is used to indicate not that the cells are kinetically arrested but, rather, that they are arrested from differentiation past a certain point.)

Both genetic and external factors can influence the regulation of spermatogenesis. In LBNF1 rats, such cytotoxic agents as radiation and chemosterilants eliminate the differentiating germ cells, and the remaining A spermatogonia proliferate, but do not differentiate, for a prolonged period of time (1, 2, 3). Likewise, male mice homozygous for the mutant juvenile spermatogonial depletion (jsd) gene are sterile and have very small testes due to the cessation of spermatogonial differentiation, which occurs after the first spermatogenic wave (4, 5). The jsd/jsd males are otherwise phenotypically normal, and jsd/jsd females are fully fertile.

Whole mounts of seminiferous tubules showed that the A spermatogonia in jsd testes were topographically arranged in clones of 1–16 cells; larger clones were rarely observed (6). The clonal sizes of these cells were comparable to those seen in stages VII–VIII in the normal epithelium, indicating that spermatogenesis can develop only to the point at which Aal cells should differentiate into A1 spermatogonia, but not further. The observation of mitotic and apoptotic figures indicated that these cells underwent proliferation, but did not accumulate, as apoptosis also occurred preferentially in the larger clones. It is not known, however, whether the inhibitory mechanism is one that causes apoptosis or fails to support differentiation.

In both the cytotoxicity-induced (7, 8) and genetically determined (9) A spermatogonia-only models, suppression of gonadotropins and testosterone (T) production with GnRH analogs and/or steroids stimulated differentiation of the spermatogonia. Further, it has been shown that inhibition of spermatogonial differentiation in the irradiated rat model was largely due to the androgen receptor-mediated action of T, although we could not rule out possible inhibitory effects of FSH (10).

The present study was undertaken to determine whether the inhibition of spermatogonial differentiation in jsd/jsd mice also occurs through the androgen receptor-mediated action of T. In addition, we examined whether spermatogonial differentiation was maintained after the cessation of GnRH antagonist treatment in jsd mice, as was the case in the rat. The studies in the jsd mouse may also elucidate the relative importance of genetic and hormonal elements in the regulation of spermatogenesis and the interaction between these elements.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animals
A hybrid stock of mice, developed by crossing C3H mice with mutant jsd gene-carrying C57BL/6J (B6) mice (obtained from The Jackson Laboratory, Bar Harbor, ME), was used unless otherwise indicated. The advantage of using the hybrid mice is that they can be screened for the presence of the jsd mutant gene by PCR analysis of the C3H- and B6-specific alleles closely flanking the jsd locus. In some preliminary studies, jsd mutants on a B6 background were used and identified by palpation of the testes at 5 weeks of age. The mice were housed in animal facilities approved by the American Association for Accreditation of Laboratory Animal Care in accordance with current regulations and standards of the USDA and the DHHS, NIH. They were maintained on a 12-h light, 12-h dark cycle and were allowed food and water ad libitum.

The heterozygous jsd (+/-) males and either jsd (+/-) or, preferentially, homozygous jsd/jsd females were used for breeding to produce the homozygous mutant jsd/jsd male mice. These jsd mutant mice were used for all experiments.

Screening the mice for the jsd mutation
At 4–5 weeks of age, approximately 1 cm tissue was chipped from the end of the tail and digested overnight in 465 µl lysis buffer (containing 50 mM Tris-HCl, 0.5% SDS, 100 mM EDTA, and 0.086% proteinase K, pH 8). The dissolved tail was vortexed and centrifuged at 12,000 rpm for 5 min. An aliquot of supernatant was diluted 1:100 and heated at 95 C for 15 min to inactivate proteinase K.

The loci D1Mit 415 and D1Mit 181 encoding microsatellite DNA sequences close to the jsd locus were used for screening. The forward and reverse sequences of the primer for D1Mit 181 are AGCCCACAGCCATCTACAAC and AACCATGTTCTGGGATTCG, respectively, and the forward and reverse primer sequences for D1Mit 415 are TTGGCACATGCCTACAACTC and AGAACACCATATATTGTGCCCC, respectively. Each 25-µl reaction mixture contained 0.1 mM deoxy-NTPs (Promega Corp., Madison, WI), 1 x PCR buffer with 2 mM MgCl2 (Promega Corp.), 50 ng each of forward and reverse primers, 0.5 U Taq polymerase (Promega Corp.), and 1 µl DNA. The PCR was performed with a pre-dwell at 94 C for 3 min, followed by 35 cycles of 94 C for 30 sec, 57.5 C for 45 sec, and 72 C for 5 sec, and ending with a post-dwell at 72 C for 5 min. The amplified DNA was fractionated electrophoretically in 4% NuSieve (BioWhittaker Molecular Applications, Rockland, ME) agarose and then stained with ethidium bromide, visualized with UV light, and photographed.

Hormone treatment
Preliminary studies were undertaken to select a dose of the GnRH antagonist Cetrorelix ([Ac-D-Nal(2)1,D-Phe(4Cl)2,D-pal(3)3, D-Cit6,D-Ala10]- LH-RH, SB-75; provided by ASTA Medica, Frankfurt, Germany) and a time and duration of treatment that were effective. To produce an immediate and prolonged effect, mice were injected simultaneously with equal doses of Cetrorelix acetate (acetate salt of Cetrorelix, dissolved in bacteriostatic water) and Cetrorelix pamoate (pamoate salt of Cetrorelix, suspended in a medium containing 0.5% Tween 80 and 2% sodium carboxymethylcellulose, provided by ASTA Medica), respectively. Single sc injections each of the acetate and pamoate forms given to 8-week-old normal B6 mice at a dose of 6 or 20 mg/kg BW suppressed intratesticular testosterone (ITT) to 50% or 13%, respectively, of the control levels at 3 weeks after injection. The latter dose also significantly reduced the sperm head count to 19% of the control value and was chosen for all experiments. The dose of 20 mg/kg BW each of Cetrorelix acetate and pamoate given to jsd mice on the hybrid background at 7.6 weeks of age kept the ITT suppressed to 12 ng/g testis after 4 weeks compared with 280 ng/g testis in untreated mice at that age. A similar dose of Cetrorelix at 5 weeks of age followed by the pamoate form (again in 20 mg/kg BW) at week 8.3 suppressed the ITT to 39 ng/g testis at 11.6 weeks of age. When similarly treated mice were killed at week 16.6, the ITT levels further increased to 55 ng/g testis, although this level is lower than the value of 493 ng/g testis in untreated age-matched jsd mice. Thus, the treatment is sufficient to suppress ITT for 4 weeks in jsd mice, and gradual recovery of T production is observed after this period.

The schedules of treatment for the initial studies (protocols 1, 2, and 3) and the main study (protocol 4) are represented in Fig. 1Go. Protocols 1 and 2 were designed to compare the ability to stimulate spermatogonial differentiation at different phases of the spontaneous degeneration process. Protocol 3 was designed to investigate the maintenance of spermatogonial differentiation after stopping GnRH antagonist treatment.



View larger version (26K):
[in this window]
[in a new window]
 
Figure 1. Schematic representation of experimental design. Soluble and depot forms of GnRH antagonist, Cetrorelix acetate, and pamoate, respectively, were injected sc at a dose of 20 mg/kg BW each. T was administered in capsules that were 0.5 cm long, and flutamide was given in pellets (33.6 mg); both were implanted sc and left in mice until they were killed.

 
Based on the results of these experiments, protocol 4 was standardized to examine effects of exogenous T and/or an antiandrogen flutamide in jsd mice with or without GnRH antagonist treatment. Male mutant mice were treated at the age of 7.6 weeks with 20 mg/kg BW each of Cetrorelix acetate and Cetrorelix pamoate with or without 0.5 cm of T-containing SILASTIC brand capsules (Dow Corning Corp., Midland, MI) implanted sc. Some of the untreated, Cetrorelix-treated, and Cetrorelix- plus 0.5 cm T-treated mice were given flutamide (obtained from Innovative Research of America, Sarasota, FL) in the form of sc pellets delivering a dose of 40 mg/kg BW·day over a period of 4 weeks.

Hormone measurements
At the time of death, the mice were anesthetized with sodium pentobarbital, and blood was collected by cutting the axillary vein. The serum was separated and stored at -20 C until analysis of gonadotropin levels. The right testis was removed, weighed, and stored in liquid nitrogen. It was then homogenized in 0.5 ml deionized water using a Teflon homogenizer that fits into a microfuge tube. The sample was centrifuged at 10,000 rpm at room temperature for 10 min. The supernatant was frozen for later assay of ITT with a DSL-4000 coated tube RIA kit (Diagostics Systems Laboratories, Webster, TX) as described previously (9, 10). T standards were dissolved in 0.1% gelatin PBS, and all dilutions were made in the same solution. The lower limit of detection for T by this method was 0.041 ng/ml sample.

Serum levels of FSH and LH were measured using in-house immunofluorometric assays (Delfia, Wallac, Inc., Turku, Finland) as previously described (11, 12, 13). The antibodies used in the FSH assay were a monoclonal antibody against recombinant human FSHß (FSH 56A) and a polyclonal antibody against recombinant human FSH{alpha} (R93–2705), both donated by Organon (Oss, The Netherlands). The minimum levels of detection for LH and FSH by these assays were 0.04 and 0.1 ng/ml, respectively.

Histological analysis
The left testis was weighed and fixed in Bouin’s fluid, and paraffin sections were stained in hematoxylin. All seminiferous tubules (~100–150) in the testis section were categorized as either differentiating (containing germ cells at stage B spermatogonia or beyond) or not, and the tubule differentiation index (TDI) was calculated as the percentage of differentiating tubules. We propose that the term TDI is a more convenient abbreviation than the percentage of differentiated tubules and is more reflective of the situation than the term repopulation index, which was used to define spermatogenesis in toxicant-treated rats.

Spermatogonial cells, mitoses, and apoptotic spermatogonia were counted in untreated jsd mice in nondifferentiating seminiferous tubular cross-sections. Only those Sertoli cell nuclei with visible nucleoli were counted in every fifth cross-section. The mitotic index was calculated by dividing the number of mitotic cells by the sum of the A spermatogonia plus mitotic cells. The criterion for apoptosis was the appearance of densely stained chromatin, in some cases being fragmented bodies (14) but more often uniformly distributed in the cell nucleus (15). The apoptotic index was calculated by dividing the number of apoptotic A spermatogonia by the total number of A spermatogonia, including mitoses and apoptotic spermatogonia, scored in the same tubules.

Statistical analysis
The data were represented as the arithmetic mean ± SEM, except for LH and ITT, for which the averages and SEM were calculated on log-transformed data. In experiments in which there were only two groups being compared, a t test was performed to analyze the significance of the difference. In the major experiment having multiple treatment groups, the differences between the treatment groups were first analyzed by one-way ANOVA. If the differences were significant (P < 0.05), Dunnett’s post-hoc test for multiple comparisons was performed to determine the significance of differences between the treated groups and the untreated jsd/jsd control group. An independent samples t test was also performed to specifically test the effects of T and flutamide. A computer-assisted statistics program (SPSS, Inc., Chicago, IL) was used.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In jsd/jsd-C3HxB6 male mice spermatogenesis proceeded through one wave, and at 5 weeks of age the TDI was 100%, but then owing to rapid loss of germ cells after about 7–8 weeks of age, the TDI declined to 10% or less at the age of 11.6 weeks and beyond (Fig. 2AGo). This decline was slower than that in jsd/jsd-B6 mice, which already had a TDI of only 0.3 ± 0.3% (n = 9) by 11.6 weeks of age. The ITT levels in the jsd (+/-) and jsd/jsd males were 41 and 78 ng/g testis, respectively, at week 5. In jsd/jsd mice these levels subsequently showed a sharp increase concomitant with depletion of germ cells and drastic reduction in testis weight (Fig. 2BGo). Thus, the jsd/jsd mice had ITT values of 284, 493, and 532 ng/g testis, respectively, at weeks 11.6, 16.6, and 25. In contrast, the heterozygous males showed no significant differences in ITT with age and maintained a normal value of 24 ng/g testis at 11.6 weeks. Surprisingly, the ITT levels in these adult C3HxB6 hybrid jsd (+/-) males (24 ng/g testis) were low compared with those in age-matched C3H (48 ng/g testis) and B6 (100 ng/g testis) mice.



View larger version (23K):
[in this window]
[in a new window]
 
Figure 2. A, ITT levels ({blacktriangleup}) and the respective tubule differentiation indexes (•) for jsd/jsd male mice at different ages. The ITT levels for jsd (+/-) males during weeks 5–11.6 are indicated ({triangleup}). B, Testis weights in jsd/jsd ({blacktriangleup}) and jsd (+/-) ({triangleup}) mice at different ages. Significance of the differences between the jsd (+/-) and jsd/jsd males at the respective ages (by t test): *, P < 0.05; ***, P < 0.001. The numbers in parentheses indicate the number of mice in each group.

 
The mitotic indexes of A spermatogonia in these jsd/jsd-C3HxB6 mice at 11.6, 16.6, and 25 weeks of age were 28.5 ± 6.1, 20.6 ± 3.5, and 21.1 ± 1.7, respectively, indicating that these cells are proliferating. The respective apoptotic indexes at these ages were 14.3 ± 1.9, 11.6 ± 1.5, and 8.6 ± 3.2, confirming that apoptosis is actively occurring in the jsd mice on a hybrid background.

When GnRH antagonist treatment was given to jsd/jsd-C3HxB6 mice during weeks 5–11.6 of age (protocol 1) and during weeks 10–16.6 (protocol 2), the TDIs were 95% and 92%, respectively (Fig. 3AGo). In these treated mice the ITT levels were suppressed to 17% and 4.5%, respectively, of the age-matched jsd control levels (Fig. 3BGo). Treatment of jsd/jsd-B6 males with Cetrorelix during 5–11.6 weeks (protocol 1) also stimulated spermatogenic differentiation when the treatment was given as described above (TDI = 60 ± 10.9%; n = 9), but the ability of Cetrorelix to stimulate differentiation was reduced drastically when treatment was given during weeks 10–16.6 in these mice (TDI = 0.4%; n = 2). These observations are consistent with earlier studies of these mice treated with the GnRH antagonist Nal-Glu (9). Thus, compared with age-matched B6 mice the stimulatory effect of GnRH antagonist was significantly greater in C3HxB6 mice. However, even in the hybrid mice when the initiation of treatment was delayed until 25 weeks of age, the recovery appeared to be reduced (TDI = 45%; n = 2) despite treatment for a period of 10 weeks.



View larger version (21K):
[in this window]
[in a new window]
 
Figure 3. Tubule differentiation indexes (A) and ITT levels (B) in jsd/jsd male mice treated with GnRH antagonist during weeks 5–11.6 (protocol 1) or weeks 10–16.6 of age (protocol 2). Significance of the differences between the treated (•) and untreated jsd/jsd controls ({blacktriangleup}; by t test): **, P < 0.01; ***, P < 0.001. The numbers in parentheses indicate the number of mice in each group.

 
When hybrid experimental mice were treated according to protocol 3, at the end of the GnRH antagonist treatment at 11.6 weeks of age the ITT levels fell to 39 ng/g testis, and the TDI was 95%. Pachytene spermatocytes were observed to be the most advanced type of germ cells present in majority of the differentiated tubules, although some of the tubules also showed round spermatids. With the discontinuation of GnRH antagonist treatment, the ITT levels increased to 55 and 210 ng/g testis at 16.6 and 25 weeks, respectively (Fig. 4BGo). The TDI values were reduced to 76% at 16.6 weeks (Fig. 4AGo). However, five of six mice in this group showed stages beyond pachytene spermatocytes, of which four had variable amounts of elongated spermatids in 25 ± 19% of tubules (Fig. 5Go) due to the facilitation of spermiogenesis with the moderate increase in ITT levels. With the further increase in ITT levels at week 25, the TDI decreased to levels not significantly different from those in the untreated mice.



View larger version (23K):
[in this window]
[in a new window]
 
Figure 4. TDI (A) and ITT (B) levels in jsd/jsd mice treated with GnRH antagonist during weeks 5–11.6 and killed at 11.6, 16.6, and 25 weeks of age (protocols 1 and 3). Significance of the differences between the treated (•) and untreated ({blacktriangleup}) jsd/jsd mice: **, P < 0.01; ***, P < 0.001. The numbers in parentheses indicate the number of mice used in each group.

 


View larger version (166K):
[in this window]
[in a new window]
 
Figure 5. Photomicrograph of jsd/jsd-C3HxB6 mouse testis treated with GnRH antagonist according to protocol 3 and killed at 16.6 weeks of age, showing elongated spermatids in some of the tubules (magnification, x200). The portion of a tubule with elongated spermatids has been magnified in the inset (magnification, x800).

 
To further study the role of T in spermatogonial inhibition, a shorter, but efficient, treatment regimen (protocol 4) was employed. Single injections each of soluble and depot forms of Cetrorelix at the age of 7.6 weeks stimulated differentiation in 73% of tubules. Implantation of 0.5-cm capsules containing T inhibited the GnRH antagonist-stimulated differentiation of tubules in these mice, reducing the TDI to 7% (Fig. 6AGo). In mice given T alone during weeks 7.6–11.6, differentiation occurred in 18% of tubules; however, this was not significantly different from values in either the untreated jsd mice or the GnRH antagonist- plus T-treated jsd mice.



View larger version (38K):
[in this window]
[in a new window]
 
Figure 6. Tubule differentiation indexes (A), ITT (B), LH (C), and FSH (D) levels for jsd (+/-) mice, jsd/jsd mice given no hormone treatment, and jsd/jsd mice treated with combinations of GnRH antagonist, T, and flutamide according to protocol 4. Significance of differences for jsd (+/-) and hormone-treated mice compared with untreated jsd/jsd mice (by Dunnett’s test): ***, P < 0.001; **, P < 0.01. Significance of the differences among hormone-treated mice (by t test): {dagger}, P < 0.05; {dagger}{dagger}, P < 0.01. The dotted line shows the lower limit of detection for LH assay. The numbers in parentheses indicate the number of mice used in each group. ND, Assay not done.

 
Whereas exogenous T had an inhibitory effect on spermatogonial differentiation, the antiandrogen flutamide stimulated differentiation. Flutamide alone stimulated differentiation in 30% of tubules (Fig. 6AGo). However, the more total androgen blockade by treatment with the GnRH antagonist and flutamide produced the highest TDI value of 95%. Most significant, addition of flutamide to the regimen employing GnRH antagonist and 0.5 cm T reversed the exogenous T-induced suppression of spermatogenic differentiation stimulated by GnRH antagonist (TDI = 57%).

To further understand the endocrine basis of these changes, serum FSH and LH levels were measured in addition to ITT. As was observed with ITT, serum LH and FSH levels were also elevated in jsd mice compared with the age-matched heterozygous males (Fig. 6Go, B–D). Treatment with GnRH antagonist reduced the LH in jsd mice to undetectable levels, and the ITT and serum FSH levels were reduced to 10 ng/g testis (4% of the age-matched jsd control) and 2.4 ng/ml (5% of the jsd control), respectively. Treatment with 0.5 cm T raised the serum T levels to 6 ng/ml, but reduced ITT to 19 ng/g testis, a value intermediate between the control value and the GnRH-suppressed value of 10 ng/g testis. Combined treatment with T and GnRH antagonist resulted in ITT concentrations identical to the levels observed in mice treated with T alone, undetectable serum LH levels, and unaltered serum FSH levels compared with those in GnRH antagonist-suppressed mice.

Treatment with flutamide alone did not significantly alter the LH, ITT, and FSH levels in jsd mice (Fig. 6Go, B–D), although the effectiveness of flutamide was demonstrated by a reduction of seminal vesicle weight to 65% of the value in age-matched jsd/jsd mice. The addition of flutamide to either the Cetrorelix or Cetrorelix plus T treatments slightly increased the ITT concentrations to about 30 ng/g testis. Serum FSH levels were not changed. Inhibition of the effects of exogenous T in the Cetrorelix- plus T-treated mice by flutamide was manifested by a reduction in the weight of the seminal vesicle to 50% of that observed in mice treated only with Cetrorelix plus T.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The results reported here for jsd-C3HxB6 mice qualitatively confirm our earlier findings in jsd-B6 mice that GnRH antagonist treatment stimulates the differentiation of spermatogonia. The results further show that, as was observed with radiation-induced spermatogonial arrest in the rat, T inhibits spermatogonial differentiation in jsd/jsd mice through an androgen receptor-mediated action.

The jsd mice on the hybrid background show a slower decline in spermatogenesis compared with B6 mice. The low levels of ITT in adult normal hybrid mice (24 ng/g testis) compared with a high ITT (100 ng/g testis) in B6 mice may have been responsible for the delayed expression of the jsd phenotype. Furthermore, the jsd mice on the hybrid background were more responsive to hormone stimulation, especially after the depletion of germ cells. It is also possible that the lowered severity of inhibition of spermatogonial differentiation by T in hybrid mice is the reason why they recover better with suppression of ITT by the GnRH antagonist.

GnRH antagonist stimulation of spermatogonial differentiation in jsd mice is not sustained once treatment is stopped. A rise in T levels with the discontinuation of treatment inhibited the differentiation of spermatogonia once again. The results are unlike those in rats treated with moderate doses of toxicants (e.g. 3.5 Gy of radiation) in which stimulation of spermatogonial differentiation by 4- to 10-week treatments with GnRH analogs continued even after the cessation of treatment (3, 10). This may be due to the fact that damage induced by toxicants in rats on a normal genetic background is epigenetic and therefore could be reversible, unlike the case in jsd mice, in which there is a permanent genetic defect.

In the present study flutamide, an androgen receptor antagonist, enhanced the GnRH antagonist-stimulated repopulation of the tubules and reversed the T inhibition of repopulation, supporting our hypothesis that T directly inhibits spermatogonial differentiation through androgen receptor-mediated action. Recently, we obtained additional evidence to confirm this observation using jsd mice with Tfm mutation (Shetty, G., et al., unpublished data). Although flutamide alone stimulated recovery in jsd mice, in the irradiated rats no such stimulation was observed. This was due to the fact that the ITT levels were unchanged by flutamide treatment in jsd mice, but were increased in the irradiated rats, which counterbalanced the protective effect of flutamide. The difference between the rat and mouse appears to be at the level of the hypothalamus or the pituitary, in that the blockade of T action achieved in the present study in mice did not cause an increase in gonadotropin (LH) secretion as was the case in the rat.

The degree of spermatogonial differentiation negatively correlated with the ITT levels in jsd mice that were untreated or treated with GnRH antagonist, GnRH antagonist plus T, and GnRH antagonist, T, and flutamide (Fig. 7AGo). Among these, in the mice that did not receive flutamide this correlation was very good (r2 = 0.98). In those mice that received flutamide the curve shifted up and to the right as expected, because flutamide was antagonizing T action. The correlation in the presence of flutamide was not as high (r2 = 0.71), indicating that other factors in addition to ITT contributed to inhibition of spermatogonial differentiation. Radiation- induced spermatogenic arrest in rats also showed a similar correlation with ITT levels, indicating T to be the major element inhibiting spermatogonial differentiation.



View larger version (14K):
[in this window]
[in a new window]
 
Figure 7. Scatter plots to examine correlations between the tubule differentiation index vs. intratesticular testosterone (A) and vs. serum FSH (B) levels. Points represent data from untreated jsd mice ({circ}) and jsd mice treated with flutamide ({blacktriangleup}); GnRH antagonist ({square}); GnRH antagonist plus flutamide ({diamondsuit}); GnRH antagonist plus T (); GnRH antagonist, T, and flutamide ({blacktriangledown}); and T alone ({diamond}). Bars represent the SEM. All curves were drawn using three-parameter fits. Two separate curves were fitted to analyze the correlation between tubule differentiation index and ITT, because flutamide competes against the androgenic activity of T. The solid curve is through the values for the jsd mice that did not receive flutamide (all open symbols), and the dashed curve is through the values for the mice that received flutamide (all filled symbols).

 
No correlation between FSH levels and TDI was observed in jsd mice (r2 = 0.35; Fig. 7BGo). In the case of irradiated rats, an inhibitory involvement of FSH could not be ruled out, as exogenous T also partially reversed the GnRH antagonist-induced reduction of FSH levels (10). This increase in FSH has been shown to occur in rats by direct up-regulation of FSHß gene transcription by T circumventing the hypothalamo-hypophysial axis (16). A similar mechanism has not been reported in mice, and our results also show no effect of T or flutamide on FSH levels. The present results showing changes in TDI without concomitant changes in FSH show that FSH is not involved in the inhibition of spermatogonial differentiation in jsd mice.

Recently, spermatogonial transplantation experiments have shown that the jsd phenotype is due to a defect in the germ cells themselves and not in their environment (17). As the spermatogonia do not have androgen receptors, the inhibitory effect of T must be mediated through factors produced by T-responsive nongerminal cells. T could act on these cells to either produce a factor that enhances apoptosis of jsd spermatogonia, but not normal spermatogonia, or represses a factor that is necessary for differentiation of jsd spermatogonia, but not normal spermatogonia.

It is not clear whether the mechanism by which T inhibits the differentiation of spermatogonia in jsd mice is by increasing the level of an apoptotic factor or by repressing the level of a differentiation factor. Both the present study and an earlier report (6) indicate that T is not likely to inhibit the replication of spermatogonia, as proliferation of at least smaller clones were observed. The higher incidence of apoptosis in the larger clones (6), the clones that mostly produce the differentiated A1 spermatogonia, suggests that the primary effect of T may be to inhibit the differentiation of undifferentiated spermatogonia to A1 spermatogonia. If this is the case apoptosis may be a secondary process that occurs when the cells do not get the crucial signal to differentiate during the quiescent stage before differentiation into A1 spermatogonia (18). The ability to stimulate spermatogonial differentiation by suppressing T both in this genetically defective mouse model and in the toxicant-treated rat model implies that similar mechanisms may be involved in the inhibition of spermatogonial differentiation. In the irradiated rat, the reduction in apoptosis occurred well before initiation of differentiation after starting GnRH antagonist treatment (14). In jsd mice, it is not known whether the initial response to GnRH antagonist treatment is reduction in apoptosis of the undifferentiated Aal spermatogonia or initiation of differentiation.

The present results indicate that suppression of T with GnRH analogs, which has been proposed for treatment of men rendered azoospermic by cytotoxic treatment for cancer, may also be applicable to human males with idiopathic infertility due to spermatogenic arrest or, more specifically, spermatogonial arrest (19). However, it will first be necessary to demonstrate that a similar mechanism, including inhibition of spermatogenic differentiation by T, also applies to humans.


    Acknowledgments
 
We thank Kuriakose Abraham for the histological preparations, and Walter Pagel for editorial advice. We are also thankful to Dr. Thomas Reissmann, ASTA Medica, for providing Cetrorelix for our study, and to Ms. Tarja Laiho and Dr. Pirjo Pakarinen for skillful assistance in performing gonadotropin assays.


    Footnotes
 
1 This work was supported by Research Grant R01 ES-08075 from the NIEHS, NIH (to M.L.M.), a grant from the Lalor Foundation (to G.S.), Core Grant CA-16672, and Grant R01-HD-36853 (to Dr. Colin Bishop). Back

2 Current address: Department of Biology, Wesleyan College, Macon, Georgia 31210. Back

Received August 21, 2000.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Boekelheide K, Hall SJ 1991 2,5-Hexanedione exposure in the rat results in long-term testicular atrophy despite the presence of residual spermatogonia. J Androl 12:18–26[Abstract/Free Full Text]
  2. Kangasniemi M, Huhtaniemi I, Meistrich ML 1996 Failure of spermatogenesis to recover despite the presence of A spermatogonia in the irradiated LBNF1 rat. Biol Reprod 54:1200–1208[Abstract]
  3. Meistrich ML, Wilson G, Huhtaniemi I 1999 Hormonal treatment after cytotoxic therapy stimulates recovery of spermatogenesis. Cancer Res 59:3557–3560[Abstract/Free Full Text]
  4. Beamer WG, Cunliffe-Beamer TL, Shultz KL, Langley SH, Roderick TH 1988 Juvenile spermatogonial depletion (jsd): a genetic defect of germ cell proliferations of male mice. Biol Reprod 38:899–908[Abstract]
  5. Kojima Y, Kominami K, Dohmae K, Nonomura N, Miki T, Okuyama A, Nishimune Y, Okabe M 1997 Cessation of spermatogenesis in juvenile spermatogonial depletion (jsd/jsd) mice. Int J Urol 4:500–507[Medline]
  6. de Rooij DG, Okabe M, Nishimune Y 1999 Arrest of spermatogonial differentiation in jsd/jsd, Sl17H/Sl17H, and cryptorchid mice. Biol Reprod 61:842–847[Abstract/Free Full Text]
  7. Blanchard KT, Lee J, Boekelheide K 1998 Leuprolide, a gonadotropin-releasing hormone agonist, reestablishes spermatogenesis after 2,5-hexanedione-induced irreversible testicular injury in the rat, resulting in normalized stem cell factor expression. Endocrinology 139:236–244[Abstract/Free Full Text]
  8. Meistrich ML, Kangasniemi M 1997 Hormone treatment after irradiation stimulates recovery of rat spermatogenesis from surviving spermatogonia. J Androl 18:80–87[Abstract/Free Full Text]
  9. Matsumiya K, Meistrich ML, Shetty G, Dohmae K, Tohda A, Okuyama A, Nishimune Y 1999 Stimulation of spermatogonial differentiation in juvenile spermatogonial depletion (jsd) mutant mice by gonadotropin-releasing hormone antagonist treatment. Endocrinology 140:4912–4915[Abstract/Free Full Text]
  10. Shetty G, Wilson G, Huhtaniemi I, Shuttlesworth GA, Reissmann T, Meistrich ML 2000 Gonadotropin-releasing hormone analogs stimulate and testosterone inhibits the recovery of spermatogenesis in irradiated rats. Endocrinology 141:1735–1745[Abstract/Free Full Text]
  11. Haavisto A, Pettersson K, Bergendahl M, Perheentupa A, Roser JF, Huhtaniemi I 1993 A supersensitive immunofluorometric assay for rat luteinizing hormone. Endocrinology 132:1687–1691[Abstract/Free Full Text]
  12. Hakola K, Van der Boogaart P, Mulders J, de Leeuw R, Schoonen W, Van Heyst J, Swolfs A, Van Casteren J, Huhtaniemi I, Kloosterboer H 1997 Recombinant rat follicle-stimulating hormone; production by Chinese hamster ovary cells, purification and functional characterization. Mol Cell Endocrinol 127:59–69[CrossRef][Medline]
  13. van Casteren JI, Schoonen WG, Kloosterboer HJ 2000 Development of time-resolved immunofluorometric assays for rat follicle-stimulating hormone and luteinizing hormone and application on sera of cycling rats. Biol Reprod 62:886–894[Abstract/Free Full Text]
  14. Shuttlesworth GA, de Rooij DG, Huhtaniemi I, Reissmann T, Russell LD, Shetty G, Wilson G, Meistrich ML 2000 Enhancement of A spermatogonial proliferation and differentiation in irradiated rats by GnRH antagonist administration. Endocrinology 141:37–49[Abstract/Free Full Text]
  15. Hasegawa M, Wilson G, Russell LD, Meistrich ML 1997 Radiation-induced cell death in the mouse testis: relationship to apoptosis. Radiat Res 147:457–467[Medline]
  16. Perheentupa A, de Jong F, Huhtaniemi I 1993 Biphasic effect of exogenous testosterone on follicle-stimulating hormone gene expression and synthesis in the male rat. Mol Cell Endocrinol 93:135–141[CrossRef][Medline]
  17. Boettger-Tong HL, Johnston DS, Russell LD, Griswold MD, Bishop CE 2000 Juvenile spermatogonial depletion (jsd) mutant seminiferous tubules are capable of supporting transplanted spermatogenesis. Biol Reprod 63:1185–1191[Abstract/Free Full Text]
  18. Tegelenbosch RA, de Rooij DG 1993 A quantitative study of spermatogonial multiplication and stem cell renewal in the C3H/101 F1 hybrid mouse. Mutat Res 290:193–200[CrossRef][Medline]
  19. Skakkebaek NE, Hammen R, Philip J, Rebbe H 1973 Quantification of human seminiferous epithelium. III. Histological studies in 44 infertile men with normal chromosome complements. APMIS 81:97–111



This article has been cited by other articles:


Home page
J AndrolHome page
G. Wang, C. C. Y. Weng, S. H. Shao, W. Zhou, K. de Gendt, R. E. Braun, G. Verhoeven, and M. L. Meistrich
Androgen Receptor in Sertoli Cells Is Not Required for Testosterone-Induced Suppression of Spermatogenesis, but Contributes to Sertoli Cell Organization in Utp14bjsd Mice
J Androl, May 1, 2009; 30(3): 338 - 348.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
G. Shetty, S. H. Shao, and C. C. Y. Weng
p53-Dependent Apoptosis in the Inhibition of Spermatogonial Differentiation in Juvenile Spermatogonial Depletion (Utp14bjsd) Mice
Endocrinology, June 1, 2008; 149(6): 2773 - 2781.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
O. U. Bolden-Tiller, H. Chiarini-Garcia, C. Poirier, D. Alves-Freitas, C. C. Weng, G. Shetty, and M. L. Meistrich
Genetic Factors Contributing to Defective Spermatogonial Differentiation in Juvenile Spermatogonial Depletion (Utp14bjsd) Mice
Biol Reprod, August 1, 2007; 77(2): 237 - 246.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
G. Shetty, C. C. Y. Weng, K. L. Porter, Z. Zhang, P. Pakarinen, T. R. Kumar, and M. L. Meistrich
Spermatogonial Differentiation in Juvenile Spermatogonial Depletion (jsd) Mice with Androgen Receptor or Follicle-Stimulating Hormone Mutations
Endocrinology, July 1, 2006; 147(7): 3563 - 3570.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
G. Shetty, C. C. Y. Weng, S. J. Meachem, O. U. Bolden-Tiller, Z. Zhang, P. Pakarinen, I. Huhtaniemi, and M. L. Meistrich
Both Testosterone and Follicle-Stimulating Hormone Independently Inhibit Spermatogonial Differentiation in Irradiated Rats
Endocrinology, January 1, 2006; 147(1): 472 - 482.
[Abstract] [Full Text] [PDF]


Home page
J ANIM SCIHome page
H. Jimenez-Severiano, M. L. Mussard, L. A. Fitzpatrick, M. J. D'Occhio, J. J. Ford, D. D. Lunstra, and J. E. Kinder
Testicular development of Zebu bulls after chronic treatment with a gonadotropin-releasing hormone agonist
J Anim Sci, September 1, 2005; 83(9): 2111 - 2122.
[Abstract] [Full Text] [PDF]


Home page
J Natl Cancer Inst MonogrHome page
G. Shetty and M. L. Meistrich
Hormonal Approaches to Preservation and Restoration of Male Fertility After Cancer Treatment
J Natl Cancer Inst Monographs, March 1, 2005; 2005(34): 36 - 39.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. Rohozinski and C. E. Bishop
The mouse juvenile spermatogonial depletion (jsd) phenotype is due to a mutation in the X-derived retrogene, mUtp14b
PNAS, August 10, 2004; 101(32): 11695 - 11700.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
S. E. Malstrom, O. Tornavaca, A. Meseguer, A. F. Purchio, and D. B. West
The Characterization and Hormonal Regulation of Kidney Androgen-Regulated Protein (Kap)-Luciferase Transgenic Mice
Toxicol. Sci., June 1, 2004; 79(2): 266 - 277.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
J. Eberhard, O. Stahl, Y. Giwercman, M. Cwikiel, E. Cavallin-Stahl, K.B. Lundin, P. Flodgren, and A. Giwercman
Impact of therapy and androgen receptor polymorphism on sperm concentration in men treated for testicular germ cell cancer: a longitudinal study
Hum. Reprod., June 1, 2004; 19(6): 1418 - 1425.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
G. Shetty and C. C. Y. Weng
Cryptorchidism Rescues Spermatogonial Differentiation in Juvenile Spermatogonial Depletion (Jsd) Mice
Endocrinology, January 1, 2004; 145(1): 126 - 133.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
G. Rothschild, C. M. Sottas, H. Kissel, V. Agosti, K. Manova, M. P. Hardy, and P. Besmer
A Role for Kit Receptor Signaling in Leydig Cell Steroidogenesis
Biol Reprod, September 1, 2003; 69(3): 925 - 932.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
M. Ohmura, T. Ogawa, M. Ono, M. Dezawa, M. Hosaka, Y. Kubota, and H. Sawada
Increment of Murine Spermatogonial Cell Number by Gonadotropin-Releasing Hormone Analogue Is Independent of Stem Cell Factor c-kit Signal
Biol Reprod, June 1, 2003; 68(6): 2304 - 2313.
[Abstract] [Full Text] [PDF]


Home page
J AndrolHome page
M. L. Meistrich and G. Shetty
Inhibition of Spermatogonial Differentiation by Testosterone
J Androl, March 1, 2003; 24(2): 135 - 148.
[Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
T. R. Pak, G. R. Lynch, D. M. Ziegler, J. B. Lunden, and P.-S. Tsai
Disruption of pubertal onset by exogenous testosterone and estrogen in two species of rodents
Am J Physiol Endocrinol Metab, January 1, 2003; 284(1): E206 - E212.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
G. Shetty, G. Wilson, M. P. Hardy, E. Niu, I. Huhtaniemi, and M. L. Meistrich
Inhibition of Recovery of Spermatogenesis in Irradiated Rats by Different Androgens
Endocrinology, September 1, 2002; 143(9): 3385 - 3396.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shetty, G.
Right arrow Articles by Meistrich, M. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shetty, G.
Right arrow Articles by Meistrich, M. L.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*UniGene
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*TESTOSTERONE


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals