| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Department of Experimental Radiation Oncology, University of Texas M. D. Anderson Cancer Center (G.S., G.W., M.L.M.), Houston, Texas 77030; Department of Physiology, University of Turku (I.H.), 20520 Turku, Finland; and Department of Obstetrics and Gynecology, Baylor College of Medicine (H.B.-T.), Houston, Texas 77030.
Address all correspondence and requests for reprints to: Dr. Gunapala Shetty, Department of Experimental Radiation Oncology, University of Texas M. D. Anderson Cancer Center, Houston, Texas 77030. E-mail: gshetty{at}audumla.mdacc.tmc.edu
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Both genetic and external factors can influence the regulation of spermatogenesis. In LBNF1 rats, such cytotoxic agents as radiation and chemosterilants eliminate the differentiating germ cells, and the remaining A spermatogonia proliferate, but do not differentiate, for a prolonged period of time (1, 2, 3). Likewise, male mice homozygous for the mutant juvenile spermatogonial depletion (jsd) gene are sterile and have very small testes due to the cessation of spermatogonial differentiation, which occurs after the first spermatogenic wave (4, 5). The jsd/jsd males are otherwise phenotypically normal, and jsd/jsd females are fully fertile.
Whole mounts of seminiferous tubules showed that the A spermatogonia in jsd testes were topographically arranged in clones of 1–16 cells; larger clones were rarely observed (6). The clonal sizes of these cells were comparable to those seen in stages VII–VIII in the normal epithelium, indicating that spermatogenesis can develop only to the point at which Aal cells should differentiate into A1 spermatogonia, but not further. The observation of mitotic and apoptotic figures indicated that these cells underwent proliferation, but did not accumulate, as apoptosis also occurred preferentially in the larger clones. It is not known, however, whether the inhibitory mechanism is one that causes apoptosis or fails to support differentiation.
In both the cytotoxicity-induced (7, 8) and genetically determined (9) A spermatogonia-only models, suppression of gonadotropins and testosterone (T) production with GnRH analogs and/or steroids stimulated differentiation of the spermatogonia. Further, it has been shown that inhibition of spermatogonial differentiation in the irradiated rat model was largely due to the androgen receptor-mediated action of T, although we could not rule out possible inhibitory effects of FSH (10).
The present study was undertaken to determine whether the inhibition of spermatogonial differentiation in jsd/jsd mice also occurs through the androgen receptor-mediated action of T. In addition, we examined whether spermatogonial differentiation was maintained after the cessation of GnRH antagonist treatment in jsd mice, as was the case in the rat. The studies in the jsd mouse may also elucidate the relative importance of genetic and hormonal elements in the regulation of spermatogenesis and the interaction between these elements.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The heterozygous jsd (+/-) males and either jsd (+/-) or, preferentially, homozygous jsd/jsd females were used for breeding to produce the homozygous mutant jsd/jsd male mice. These jsd mutant mice were used for all experiments.
Screening the mice for the jsd mutation
At 4–5 weeks of age, approximately 1 cm tissue was chipped from
the end of the tail and digested overnight in 465 µl lysis buffer
(containing 50 mM Tris-HCl, 0.5% SDS, 100 mM
EDTA, and 0.086% proteinase K, pH 8). The dissolved tail was vortexed
and centrifuged at 12,000 rpm for 5 min. An aliquot of supernatant was
diluted 1:100 and heated at 95 C for 15 min to inactivate proteinase
K.
The loci D1Mit 415 and D1Mit 181 encoding microsatellite DNA sequences close to the jsd locus were used for screening. The forward and reverse sequences of the primer for D1Mit 181 are AGCCCACAGCCATCTACAAC and AACCATGTTCTGGGATTCG, respectively, and the forward and reverse primer sequences for D1Mit 415 are TTGGCACATGCCTACAACTC and AGAACACCATATATTGTGCCCC, respectively. Each 25-µl reaction mixture contained 0.1 mM deoxy-NTPs (Promega Corp., Madison, WI), 1 x PCR buffer with 2 mM MgCl2 (Promega Corp.), 50 ng each of forward and reverse primers, 0.5 U Taq polymerase (Promega Corp.), and 1 µl DNA. The PCR was performed with a pre-dwell at 94 C for 3 min, followed by 35 cycles of 94 C for 30 sec, 57.5 C for 45 sec, and 72 C for 5 sec, and ending with a post-dwell at 72 C for 5 min. The amplified DNA was fractionated electrophoretically in 4% NuSieve (BioWhittaker Molecular Applications, Rockland, ME) agarose and then stained with ethidium bromide, visualized with UV light, and photographed.
Hormone treatment
Preliminary studies were undertaken to select a dose of the GnRH
antagonist Cetrorelix
([Ac-D-Nal(2)1,D-Phe(4Cl)2,D-pal(3)3,
D-Cit6,D-Ala10]-
LH-RH, SB-75; provided by ASTA Medica, Frankfurt, Germany) and a
time and duration of treatment that were effective. To produce an
immediate and prolonged effect, mice were injected simultaneously with
equal doses of Cetrorelix acetate (acetate salt of Cetrorelix,
dissolved in bacteriostatic water) and Cetrorelix pamoate (pamoate salt
of Cetrorelix, suspended in a medium containing 0.5% Tween 80 and 2%
sodium carboxymethylcellulose, provided by ASTA Medica), respectively.
Single sc injections each of the acetate and pamoate forms given to
8-week-old normal B6 mice at a dose of 6 or 20 mg/kg BW suppressed
intratesticular testosterone (ITT) to 50% or 13%, respectively, of
the control levels at 3 weeks after injection. The latter dose also
significantly reduced the sperm head count to 19% of the control value
and was chosen for all experiments. The dose of 20 mg/kg BW each of
Cetrorelix acetate and pamoate given to jsd mice on the
hybrid background at 7.6 weeks of age kept the ITT suppressed to 12
ng/g testis after 4 weeks compared with 280 ng/g testis in untreated
mice at that age. A similar dose of Cetrorelix at 5 weeks of age
followed by the pamoate form (again in 20 mg/kg BW) at week 8.3
suppressed the ITT to 39 ng/g testis at 11.6 weeks of age. When
similarly treated mice were killed at week 16.6, the ITT levels further
increased to 55 ng/g testis, although this level is lower than the
value of 493 ng/g testis in untreated age-matched jsd mice.
Thus, the treatment is sufficient to suppress ITT for 4 weeks in
jsd mice, and gradual recovery of T production is observed
after this period.
The schedules of treatment for the initial studies (protocols 1, 2, and
3) and the main study (protocol 4) are represented in Fig. 1
. Protocols 1 and 2 were designed to
compare the ability to stimulate spermatogonial differentiation at
different phases of the spontaneous degeneration process. Protocol 3
was designed to investigate the maintenance of spermatogonial
differentiation after stopping GnRH antagonist treatment.
|
Hormone measurements
At the time of death, the mice were anesthetized with sodium
pentobarbital, and blood was collected by cutting the axillary vein.
The serum was separated and stored at -20 C until analysis of
gonadotropin levels. The right testis was removed, weighed, and stored
in liquid nitrogen. It was then homogenized in 0.5 ml deionized water
using a Teflon homogenizer that fits into a microfuge tube. The sample
was centrifuged at 10,000 rpm at room temperature for 10 min. The
supernatant was frozen for later assay of ITT with a DSL-4000 coated
tube RIA kit (Diagostics Systems Laboratories, Webster,
TX) as described previously (9, 10). T standards were
dissolved in 0.1% gelatin PBS, and all dilutions were made in the same
solution. The lower limit of detection for T by this method was 0.041
ng/ml sample.
Serum levels of FSH and LH were measured using in-house
immunofluorometric assays (Delfia, Wallac, Inc., Turku,
Finland) as previously described (11, 12, 13). The antibodies
used in the FSH assay were a monoclonal antibody against recombinant
human FSHß (FSH 56A) and a polyclonal antibody against recombinant
human FSH
(R93–2705), both donated by Organon (Oss,
The Netherlands). The minimum levels of detection for LH and FSH by
these assays were 0.04 and 0.1 ng/ml, respectively.
Histological analysis
The left testis was weighed and fixed in Bouin’s fluid, and
paraffin sections were stained in hematoxylin. All seminiferous tubules
(
100–150) in the testis section were categorized as either
differentiating (containing germ cells at stage B spermatogonia or
beyond) or not, and the tubule differentiation index (TDI) was
calculated as the percentage of differentiating tubules. We propose
that the term TDI is a more convenient abbreviation than the percentage
of differentiated tubules and is more reflective of the situation than
the term repopulation index, which was used to define spermatogenesis
in toxicant-treated rats.
Spermatogonial cells, mitoses, and apoptotic spermatogonia were counted in untreated jsd mice in nondifferentiating seminiferous tubular cross-sections. Only those Sertoli cell nuclei with visible nucleoli were counted in every fifth cross-section. The mitotic index was calculated by dividing the number of mitotic cells by the sum of the A spermatogonia plus mitotic cells. The criterion for apoptosis was the appearance of densely stained chromatin, in some cases being fragmented bodies (14) but more often uniformly distributed in the cell nucleus (15). The apoptotic index was calculated by dividing the number of apoptotic A spermatogonia by the total number of A spermatogonia, including mitoses and apoptotic spermatogonia, scored in the same tubules.
Statistical analysis
The data were represented as the arithmetic mean ±
SEM, except for LH and ITT, for which the averages and
SEM were calculated on log-transformed data. In experiments
in which there were only two groups being compared, a t test
was performed to analyze the significance of the difference. In the
major experiment having multiple treatment groups, the differences
between the treatment groups were first analyzed by one-way ANOVA. If
the differences were significant (P < 0.05),
Dunnett’s post-hoc test for multiple comparisons was
performed to determine the significance of differences between the
treated groups and the untreated jsd/jsd control group. An
independent samples t test was also performed to
specifically test the effects of T and flutamide. A computer-assisted
statistics program (SPSS, Inc., Chicago, IL) was used.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
). This decline was slower
than that in jsd/jsd-B6 mice, which already had a TDI of
only 0.3 ± 0.3% (n = 9) by 11.6 weeks of age. The ITT
levels in the jsd (+/-) and jsd/jsd
males were 41 and 78 ng/g testis, respectively, at week 5. In
jsd/jsd mice these levels subsequently showed a
sharp increase concomitant with depletion of germ cells and drastic
reduction in testis weight (Fig. 2B). Thus, the jsd/jsd mice
had ITT values of 284, 493, and 532 ng/g testis, respectively, at weeks
11.6, 16.6, and 25. In contrast, the heterozygous males showed no
significant differences in ITT with age and maintained a normal value
of 24 ng/g testis at 11.6 weeks. Surprisingly, the ITT levels in these
adult C3HxB6 hybrid jsd (+/-) males (24 ng/g testis) were
low compared with those in age-matched C3H (48 ng/g testis) and B6 (100
ng/g testis) mice.
|
When GnRH antagonist treatment was given to jsd/jsd-C3HxB6
mice during weeks 5–11.6 of age (protocol 1) and during weeks 10–16.6
(protocol 2), the TDIs were 95% and 92%, respectively (Fig. 3A). In these treated mice the ITT levels
were suppressed to 17% and 4.5%, respectively, of the age-matched
jsd control levels (Fig. 3B). Treatment of
jsd/jsd-B6 males with Cetrorelix during 5–11.6
weeks (protocol 1) also stimulated spermatogenic differentiation when
the treatment was given as described above (TDI = 60 ±
10.9%; n = 9), but the ability of Cetrorelix to stimulate
differentiation was reduced drastically when treatment was given during
weeks 10–16.6 in these mice (TDI = 0.4%; n = 2). These
observations are consistent with earlier studies of these mice treated
with the GnRH antagonist Nal-Glu (9). Thus, compared with
age-matched B6 mice the stimulatory effect of GnRH antagonist was
significantly greater in C3HxB6 mice. However, even in the hybrid mice
when the initiation of treatment was delayed until 25 weeks of age, the
recovery appeared to be reduced (TDI = 45%; n = 2) despite
treatment for a period of 10 weeks.
|
). The TDI values were reduced to 76%
at 16.6 weeks (Fig. 4A). However, five of six mice in this group showed
stages beyond pachytene spermatocytes, of which four had variable
amounts of elongated spermatids in 25 ± 19% of tubules (Fig. 5) due to the facilitation of
spermiogenesis with the moderate increase in ITT levels. With the
further increase in ITT levels at week 25, the TDI decreased to levels
not significantly different from those in the untreated mice.
|
|
). In
mice given T alone during weeks 7.6–11.6, differentiation occurred in
18% of tubules; however, this was not significantly different from
values in either the untreated jsd mice or the GnRH
antagonist- plus T-treated jsd mice.
|
). However, the more total androgen blockade by treatment with
the GnRH antagonist and flutamide produced the highest TDI value of
95%. Most significant, addition of flutamide to the regimen employing
GnRH antagonist and 0.5 cm T reversed the exogenous T-induced
suppression of spermatogenic differentiation stimulated by GnRH
antagonist (TDI = 57%).
To further understand the endocrine basis of these changes, serum FSH
and LH levels were measured in addition to ITT. As was observed with
ITT, serum LH and FSH levels were also elevated in jsd mice
compared with the age-matched heterozygous males (Fig. 6, B–D).
Treatment with GnRH antagonist reduced the LH in jsd mice to
undetectable levels, and the ITT and serum FSH levels were reduced to
10 ng/g testis (4% of the age-matched jsd control) and 2.4
ng/ml (5% of the jsd control), respectively. Treatment with
0.5 cm T raised the serum T levels to 6 ng/ml, but reduced ITT to 19
ng/g testis, a value intermediate between the control value and the
GnRH-suppressed value of 10 ng/g testis. Combined treatment with T and
GnRH antagonist resulted in ITT concentrations identical to the levels
observed in mice treated with T alone, undetectable serum LH levels,
and unaltered serum FSH levels compared with those in GnRH
antagonist-suppressed mice.
Treatment with flutamide alone did not significantly alter the
LH, ITT, and FSH levels in jsd mice (Fig. 6, B–D), although
the effectiveness of flutamide was demonstrated by a reduction of
seminal vesicle weight to 65% of the value in age-matched
jsd/jsd mice. The addition of flutamide to either
the Cetrorelix or Cetrorelix plus T treatments slightly increased the
ITT concentrations to about 30 ng/g testis. Serum FSH levels were not
changed. Inhibition of the effects of exogenous T in the Cetrorelix-
plus T-treated mice by flutamide was manifested by a reduction in the
weight of the seminal vesicle to 50% of that observed in mice treated
only with Cetrorelix plus T.
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The jsd mice on the hybrid background show a slower decline in spermatogenesis compared with B6 mice. The low levels of ITT in adult normal hybrid mice (24 ng/g testis) compared with a high ITT (100 ng/g testis) in B6 mice may have been responsible for the delayed expression of the jsd phenotype. Furthermore, the jsd mice on the hybrid background were more responsive to hormone stimulation, especially after the depletion of germ cells. It is also possible that the lowered severity of inhibition of spermatogonial differentiation by T in hybrid mice is the reason why they recover better with suppression of ITT by the GnRH antagonist.
GnRH antagonist stimulation of spermatogonial differentiation in jsd mice is not sustained once treatment is stopped. A rise in T levels with the discontinuation of treatment inhibited the differentiation of spermatogonia once again. The results are unlike those in rats treated with moderate doses of toxicants (e.g. 3.5 Gy of radiation) in which stimulation of spermatogonial differentiation by 4- to 10-week treatments with GnRH analogs continued even after the cessation of treatment (3, 10). This may be due to the fact that damage induced by toxicants in rats on a normal genetic background is epigenetic and therefore could be reversible, unlike the case in jsd mice, in which there is a permanent genetic defect.
In the present study flutamide, an androgen receptor antagonist, enhanced the GnRH antagonist-stimulated repopulation of the tubules and reversed the T inhibition of repopulation, supporting our hypothesis that T directly inhibits spermatogonial differentiation through androgen receptor-mediated action. Recently, we obtained additional evidence to confirm this observation using jsd mice with Tfm mutation (Shetty, G., et al., unpublished data). Although flutamide alone stimulated recovery in jsd mice, in the irradiated rats no such stimulation was observed. This was due to the fact that the ITT levels were unchanged by flutamide treatment in jsd mice, but were increased in the irradiated rats, which counterbalanced the protective effect of flutamide. The difference between the rat and mouse appears to be at the level of the hypothalamus or the pituitary, in that the blockade of T action achieved in the present study in mice did not cause an increase in gonadotropin (LH) secretion as was the case in the rat.
The degree of spermatogonial differentiation negatively correlated with
the ITT levels in jsd mice that were untreated or treated
with GnRH antagonist, GnRH antagonist plus T, and GnRH antagonist, T,
and flutamide (Fig. 7A). Among these, in
the mice that did not receive flutamide this correlation was very good
(r2 = 0.98). In those mice that received
flutamide the curve shifted up and to the right as expected, because
flutamide was antagonizing T action. The correlation in the presence of
flutamide was not as high (r2 = 0.71), indicating
that other factors in addition to ITT contributed to inhibition of
spermatogonial differentiation. Radiation- induced spermatogenic
arrest in rats also showed a similar correlation with ITT levels,
indicating T to be the major element inhibiting spermatogonial
differentiation.
|
). In the
case of irradiated rats, an inhibitory involvement of FSH could not be
ruled out, as exogenous T also partially reversed the GnRH
antagonist-induced reduction of FSH levels (10). This
increase in FSH has been shown to occur in rats by direct up-regulation
of FSHß gene transcription by T circumventing the
hypothalamo-hypophysial axis (16). A similar mechanism has
not been reported in mice, and our results also show no effect of T or
flutamide on FSH levels. The present results showing changes in TDI
without concomitant changes in FSH show that FSH is not involved in the
inhibition of spermatogonial differentiation in jsd
mice. Recently, spermatogonial transplantation experiments have shown that the jsd phenotype is due to a defect in the germ cells themselves and not in their environment (17). As the spermatogonia do not have androgen receptors, the inhibitory effect of T must be mediated through factors produced by T-responsive nongerminal cells. T could act on these cells to either produce a factor that enhances apoptosis of jsd spermatogonia, but not normal spermatogonia, or represses a factor that is necessary for differentiation of jsd spermatogonia, but not normal spermatogonia.
It is not clear whether the mechanism by which T inhibits the differentiation of spermatogonia in jsd mice is by increasing the level of an apoptotic factor or by repressing the level of a differentiation factor. Both the present study and an earlier report (6) indicate that T is not likely to inhibit the replication of spermatogonia, as proliferation of at least smaller clones were observed. The higher incidence of apoptosis in the larger clones (6), the clones that mostly produce the differentiated A1 spermatogonia, suggests that the primary effect of T may be to inhibit the differentiation of undifferentiated spermatogonia to A1 spermatogonia. If this is the case apoptosis may be a secondary process that occurs when the cells do not get the crucial signal to differentiate during the quiescent stage before differentiation into A1 spermatogonia (18). The ability to stimulate spermatogonial differentiation by suppressing T both in this genetically defective mouse model and in the toxicant-treated rat model implies that similar mechanisms may be involved in the inhibition of spermatogonial differentiation. In the irradiated rat, the reduction in apoptosis occurred well before initiation of differentiation after starting GnRH antagonist treatment (14). In jsd mice, it is not known whether the initial response to GnRH antagonist treatment is reduction in apoptosis of the undifferentiated Aal spermatogonia or initiation of differentiation.
The present results indicate that suppression of T with GnRH analogs, which has been proposed for treatment of men rendered azoospermic by cytotoxic treatment for cancer, may also be applicable to human males with idiopathic infertility due to spermatogenic arrest or, more specifically, spermatogonial arrest (19). However, it will first be necessary to demonstrate that a similar mechanism, including inhibition of spermatogenic differentiation by T, also applies to humans.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Current address: Department of Biology, Wesleyan College, Macon,
Georgia 31210.
Received August 21, 2000.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  G. Wang, C. C. Y. Weng, S. H. Shao, W. Zhou, K. de Gendt, R. E. Braun, G. Verhoeven, and M. L. Meistrich Androgen Receptor in Sertoli Cells Is Not Required for Testosterone-Induced Suppression of Spermatogenesis, but Contributes to Sertoli Cell Organization in Utp14bjsd Mice J Androl, May 1, 2009; 30(3): 338 - 348. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Shetty, S. H. Shao, and C. C. Y. Weng p53-Dependent Apoptosis in the Inhibition of Spermatogonial Differentiation in Juvenile Spermatogonial Depletion (Utp14bjsd) Mice Endocrinology, June 1, 2008; 149(6): 2773 - 2781. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 O. U. Bolden-Tiller, H. Chiarini-Garcia, C. Poirier, D. Alves-Freitas, C. C. Weng, G. Shetty, and M. L. Meistrich Genetic Factors Contributing to Defective Spermatogonial Differentiation in Juvenile Spermatogonial Depletion (Utp14bjsd) Mice Biol Reprod, August 1, 2007; 77(2): 237 - 246. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Shetty, C. C. Y. Weng, K. L. Porter, Z. Zhang, P. Pakarinen, T. R. Kumar, and M. L. Meistrich Spermatogonial Differentiation in Juvenile Spermatogonial Depletion (jsd) Mice with Androgen Receptor or Follicle-Stimulating Hormone Mutations Endocrinology, July 1, 2006; 147(7): 3563 - 3570. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Shetty, C. C. Y. Weng, S. J. Meachem, O. U. Bolden-Tiller, Z. Zhang, P. Pakarinen, I. Huhtaniemi, and M. L. Meistrich Both Testosterone and Follicle-Stimulating Hormone Independently Inhibit Spermatogonial Differentiation in Irradiated Rats Endocrinology, January 1, 2006; 147(1): 472 - 482. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Jimenez-Severiano, M. L. Mussard, L. A. Fitzpatrick, M. J. D'Occhio, J. J. Ford, D. D. Lunstra, and J. E. Kinder Testicular development of Zebu bulls after chronic treatment with a gonadotropin-releasing hormone agonist J Anim Sci, September 1, 2005; 83(9): 2111 - 2122. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Shetty and M. L. Meistrich Hormonal Approaches to Preservation and Restoration of Male Fertility After Cancer Treatment J Natl Cancer Inst Monographs, March 1, 2005; 2005(34): 36 - 39. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Rohozinski and C. E. Bishop The mouse juvenile spermatogonial depletion (jsd) phenotype is due to a mutation in the X-derived retrogene, mUtp14b PNAS, August 10, 2004; 101(32): 11695 - 11700. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. E. Malstrom, O. Tornavaca, A. Meseguer, A. F. Purchio, and D. B. West The Characterization and Hormonal Regulation of Kidney Androgen-Regulated Protein (Kap)-Luciferase Transgenic Mice Toxicol. Sci., June 1, 2004; 79(2): 266 - 277. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Eberhard, O. Stahl, Y. Giwercman, M. Cwikiel, E. Cavallin-Stahl, K.B. Lundin, P. Flodgren, and A. Giwercman Impact of therapy and androgen receptor polymorphism on sperm concentration in men treated for testicular germ cell cancer: a longitudinal study Hum. Reprod., June 1, 2004; 19(6): 1418 - 1425. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Shetty and C. C. Y. Weng Cryptorchidism Rescues Spermatogonial Differentiation in Juvenile Spermatogonial Depletion (Jsd) Mice Endocrinology, January 1, 2004; 145(1): 126 - 133. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Rothschild, C. M. Sottas, H. Kissel, V. Agosti, K. Manova, M. P. Hardy, and P. Besmer A Role for Kit Receptor Signaling in Leydig Cell Steroidogenesis Biol Reprod, September 1, 2003; 69(3): 925 - 932. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Ohmura, T. Ogawa, M. Ono, M. Dezawa, M. Hosaka, Y. Kubota, and H. Sawada Increment of Murine Spermatogonial Cell Number by Gonadotropin-Releasing Hormone Analogue Is Independent of Stem Cell Factor c-kit Signal Biol Reprod, June 1, 2003; 68(6): 2304 - 2313. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. L. Meistrich and G. Shetty Inhibition of Spermatogonial Differentiation by Testosterone J Androl, March 1, 2003; 24(2): 135 - 148. [Full Text] [PDF]
|
|
|
|
 |
|
 T. R. Pak, G. R. Lynch, D. M. Ziegler, J. B. Lunden, and P.-S. Tsai Disruption of pubertal onset by exogenous testosterone and estrogen in two species of rodents Am J Physiol Endocrinol Metab, January 1, 2003; 284(1): E206 - E212. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Shetty, G. Wilson, M. P. Hardy, E. Niu, I. Huhtaniemi, and M. L. Meistrich Inhibition of Recovery of Spermatogenesis in Irradiated Rats by Different Androgens Endocrinology, September 1, 2002; 143(9): 3385 - 3396. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
) and the respective tubule
differentiation indexes (•) for jsd/jsd
male mice at different ages. The ITT levels for jsd
(+/-) males during weeks 5–11.6 are indicated (
). B, Testis
weights in jsd/jsd (
, P < 0.05; 
) and jsd mice treated with flutamide (
); GnRH antagonist plus flutamide (
); GnRH
antagonist plus T
(
); GnRH
antagonist, T, and flutamide (
); and T alone (
).
Bars represent the SEM. All curves were
drawn using three-parameter fits. Two separate curves were fitted to
analyze the correlation between tubule differentiation index and ITT,
because flutamide competes against the androgenic activity of T. The
solid curve is through the values for the
jsd mice that did not receive flutamide (all open
symbols), and the dashed curve is through the
values for the mice that received flutamide (all filled
symbols).