Endocrinology Vol. 142, No. 7 3125-3134
Copyright © 2001 by The Endocrine Society
Transcriptional Suppression of Type 1 Angiotensin II Receptor Gene Expression by Peroxisome Proliferator-Activated Receptor-
in Vascular Smooth Muscle Cells1
Akira Sugawara,
Kazuhisa Takeuchi,
Akira Uruno,
Yukio Ikeda,
Shuji Arima,
Masataka Kudo,
Kazunori Sato,
Yoshihiro Taniyama and
Sadayoshi Ito
Division of Nephrology, Endocrinology, and Vascular Medicine,
Department of Medicine, Tohoku University Graduate School of Medicine,
Sendai 980-8574, Japan
Address all correspondence and requests for reprints to: Dr. Akira Sugawara, Molecular Biology Unit, Division of Nephrology, Endocrinology, and Vascular Medicine, Department of Medicine, Tohoku University Graduate School of Medicine, 1-1 Seiryo-cho, Aoba-ku, Sendai 980-8574 Japan. E-mail: akiras2i{at}mail.cc.tohoku.ac.jp
 |
Abstract
|
|---|
Angiotensin (A) II plays a critical role in vascular remodeling, and
its action is mediated by type 1 AII receptor (AT1R). Recently,
15-deoxy-
12,14-prostaglandin J2
and thiazolidinediones have been shown to be ligands for peroxisome
proliferator-activated receptor (PPAR)-
and activate PPAR-
. In
the present work, we have studied the effect of PPAR-
on AT1R
expression in rat vascular smooth muscle cells (VSMCs). We observed
that: 1) endogenous AT1R expression was significantly decreased by
PPAR-
ligands both at messenger RNA and protein levels, whereas AT1R
messenger RNA stability was not affected; 2) AII-induced increase of
3H-thymidine incorporation into VSMCs was inhibited by
PPAR-
ligands; 3) rat AT1R gene promoter activity was significantly
suppressed by PPAR-
ligands, and PPAR-
overexpression further
suppressed the promoter activity; 4) transcriptional analyses using
AT1R gene promoter mutants revealed that a GC-box-related sequence
within the -58/-34 region of the AT1R gene promoter was responsible
for the suppression; 5) Sp1 overexpression stimulated AT1R gene
transcription via the GC-box-related sequence, which was inhibited by
additional PPAR-
overexpression; 6) electrophoretic mobility shift
assay suggested that Sp1 could bind to the GC-box-related sequence
whereas PPAR-
could not; 7) antibody supershift experiments using
VSMC nuclear extracts revealed that protein-DNA complexes formed on the
GC-box-related sequence, which were decreased by PPAR-
coincubation,
were mostly composed of Sp1; and 8) glutathione S-transferase pull-down
assay revealed a direct interaction between PPAR-
and Sp1. Taken
together, it is suggested that activated PPAR-
suppresses AT1R gene
at a transcriptional level by inhibiting Sp1 via a protein-protein
interaction. PPAR-
ligands, thus, may inhibit AII-induced cell
growth and hypertrophy in VSMCs by AT1R expression suppression and
possibly be beneficial for treatment of diabetic patients with
hypertension and atherosclerosis.
 |
Introduction
|
|---|
ANGIOTENSIN (A) II plays a critical role in
the progression of atherosclerosis and hypertension via type
1(a) AII receptor (AT1R) (1, 2, 3, 4, 5). In vascular smooth
muscle cells (VSMCs), activation of AT1R induces cell contraction,
proliferation, and migration through several signal transduction
pathways, including tyrosine kinases and mitogen-activated
protein kinase (1, 2). Overexpression of AT1R in
cardiomyocytes using transgenic models induced cardiac hypertrophy and
remodeling (3). AT1R antagonists that inhibit AT1R
activation have been widely used for therapeutic purposes for
cardiovascular diseases (6). Moreover, AT1R activation by
AII triggers the proliferation and activation of splenic lymphocytes,
which may cause promotion of inflammation (4). The
5'-flanking region (FL) of rat AT1R gene was cloned, and its
transcriptional regulation in rat VSMCs has been studied (7, 8).
Recently, 15-deoxy-
12,
14-prostaglandin (PG) J2
(15dPGJ2) as well as insulin-sensitizing
thiazolidinediones, including troglitazone and
rosiglitazone, have been known to activate peroxisome
proliferator-activated receptor (PPAR)-
as its ligands (9, 10). PPAR-
is a nuclear hormone receptor that binds to
PPAR-response element (PPRE) composed of direct repeat of AGGTCA gapped
by one nucleotide (DR1) as a heterodimer with retinoid X receptor
(RXR)-
, and induces ligand-dependent transactivation
(11). In adipocytes, ligand-activated PPAR-
is well
known to transactivate adipocyte-specific genes and induce adipocyte
differentiation (12). Recently, however, expression and
function of PPAR-
in other cells, especially in the vasculature,
have been more focused with reference to atherosclerosis. For example,
it has recently been reported that PPAR-
inhibits macrophage
activation and may lead to inhibition of the progression of
atherosclerosis (13, 14).
VSMC is one of the major organs involved in the etiology of
atherosclerosis (15). Although the expression of PPAR-
in VSMCs has recently been reported (16, 17), the role of
PPAR-
in gene transcription in VSMCs has not yet been fully studied.
In the present study, we examined the effect of PPAR-
activation on
AT1R expression in VSMCs and observed that activated PPAR-
could
suppress AT1R expression at a transcriptional level. We also observed
that the transcriptional suppression was mediated at a GC-box-
related sequence within the -58/-34 region of the AT1R gene
promoter possibly via a protein-protein interaction between PPAR-
and Sp1.
 |
Materials and Methods
|
|---|
Plasmids
The following reporter plasmids containing rat AT1R gene
promoter fragments and luciferase complementary DNA (cDNA)
(7) were used for transient transfection studies:
-1969/+104-luc [1969-bp 5'-FL and 104-bp 5'-untranslated region (UTR)
of rat AT1R gene]; -987/+104-luc (987-bp 5'-FL and 104-bp 5'-UTR);
-331/+104-luc (331-bp 5'-FL and 104-bp 5'-UTR); -58/+104-luc (58-bp
5'-FL and 104-bp 5'-UTR); -58/-1-luc (58-bp 5'-FL); -34/-1-luc
(34-bp 5'-FL); and -1/-34-luc (34-bp 5'-FL in the reverse
orientation). Mutated -58/-1-luc, whose GC-box-related sequence
within the -58/-34 region was abrogated (changed from
TGCAGAGCAGCGACGCCCCCTAGGC to TGCAGAGCAGCGACGTTTTTTAGGC;
mutated sites are underlined), was also generated. Mutated
-1969/+104-luc, whose GC-box-related sequence within the
-58/-34 region was abrogated (changed from TGCAGAGCA-
GCGACGCCCCCTAGGC to TGCAGAGCAGCGACGTTTCCTAGGC; mutated
sites are underlined), was generated using QuikChange
Site-Directed Mutagenesis Kit (Stratagene, La Jolla,
CA). Mouse PPAR-
1 and PPAR-
expression plasmids in pCMX
(18) were kindly provided by Dr. K. Umesono (Kyoto
University, Kyoto, Japan). Mouse RXR-
in pBSK (19)
(kindly provided by Dr. R. M. Evans, The Salk Institute, San
Diego, CA) was subcloned into pcDNA1/AMP in the right orientation.
Full-length mouse PPAR-
1 cDNA was subcloned into the pGEX-4T-2
vector (Amersham Pharmacia Biotech,
Buckinghamshire, UK) in the right orientation (designated as
pGEX-PPAR-
). Sp1 in pCMSV (20) was kindly provided by
Dr. Y. Fujii (Tohoku University, Sendai, Japan).
Cell culture
Rat VSMCs, which were isolated from male Sprague Dawley rat
thoracic aortas, were gifted from Dr. K. K. Griendling (Emory
University, Atlanta, GA) and maintained as described previously
(7). Passages between 7 and 15 were used for the following
experiments.
RNA preparation/Northern blot analysis/RT-PCR
When rat VSMCs became 70% confluent, media were changed
to DMEM with 1% resin and charcoal-treated calf serum (stripped
medium) (21) and were incubated for 56 h. The cells then
were incubated either with or without 15dPGJ2 (1
or 2.5 µM; Cayman Chemical, Ann Arbor, MI),
troglitazone (10 or 50 µM; kindly provided
by Sankyo Co., Ltd., Tokyo, Japan), rosiglitazone (10 or
50 µM; kindly provided by Sankyo Co., Ltd.),
or pioglitazone (10 or 50 µM; kindly
provided by Takeda Chemical Industries Co., Ltd., Osaka,
Japan) for additional 12 h. Their total RNAs were then extracted
using RNeasy mini kit (QIAGEN, Hilden, Germany).
Ten micrograms of isolated total RNA were subjected to electrophoresis
in 1% agarose-formaldehyde gels, transferred to nylon membrane
(Hybond-N; Amersham Pharmacia Biotech), and the blot
was hybridized with 32P-labeled AT1R cDNA probe
as described previously (22). Intensity of the blot was
calculated using Luminous Imager (AI-C) (Aichi, Japan) and all
values were normalized to the densities of ethidium bromide staining of
28S ribosomal RNA (rRNA). For determination of AT1R messenger RNA
(mRNA) stability, rat VSMCs preincubated either in the presence or
absence of 15dPGJ2 (1 µM) or
troglitazone (10 µM) for 12 h were
coincubated with 5 µg/ml actinomycin D (Nacalai Tesque, Osaka, Japan)
for an additional 4 or 8 h before harvesting. For confirmation of
PPAR-
expression in rat VSMCs, 1 µg isolated total RNA was
subjected to RT-PCR using specific primers either for rat PPAR-
(a
forward primer: 5'-GTTCATGCTTGTGAAGGATGC-3'; a reverse
primer 5'-ACTCTGGATTCAGCTGGTCG-3') (23) or rat
glyceraldehyde-3-phosphate-dehydrogenase (GAPDH) (a forward primer:
5'-TCCCTCAAGATTGTCAGCAA-3'; a reverse primer
5'-AGATCCACAACGGATACATT-3') (24) at the following
conditions: 50 C, 30 min and 94 C, 2 min for RT; 94 C, 30 sec; 60 C, 30
sec; 72 C, 1 min, for 40 cycles. RT-PCR of both GAPDH and PPAR-
mRNAs was performed simultaneously.
Western immunoblot analysis
Membrane proteins of rat VSMCs grown and treated with PPAR-
ligands (2.5 µM 15dPGJ2, 50
µM troglitazone, or 50 µM
rosiglitazone) in the above conditions were extracted as described
previously (25). Twenty micrograms of the proteins were
subjected to SDS-PAGE (9% acrylamide gel). After SDS-PAGE, proteins
were transferred to polyvinylidene difluoride (Immobilon P;
Millipore Corp., Bedford, MA) and were subjected to
immunoblot analysis using rabbit polyclonal anti-AT1R (N-10) antibody
(Santa Cruz Biotechnology, Inc., Santa Cruz, CA) as
described previously (21). The intensity of the blot was
calculated using Luminous Imager (AI-C).
Luciferase reporter gene assay
When rat VSMCs became 70% confluent, media were changed to
stripped medium and were incubated for 56 h. Then, the transfection
using lipofectin was performed according to the manufacturers
instructions (GIBCO BRL, Rockville, MD). Briefly,
1.2 µg reporter plasmid and 0.8 µg ß-galactosidase control
plasmid in pCMV (CLONTECH Laboratories, Inc., Palo Alto,
CA) were mixed with 6 µl lipofectin per 3.5-cm plate. In some
experiments, 1 µg PPAR-
1, PPAR-
, RXR-
, and/or Sp1 expression
plasmids were cotransfected. Twelve hours after transfection, media
were changed to stripped medium and the cells were incubated for an
additional 12 h. The cells were then incubated either with or
without several concentrations of 15dPGJ2,
troglitazone, or rosiglitazone for 12 h. In some
experiments, the cells were incubated either with 1 µM
9-cis retinoic acid (9cRA) or 1 µM
leukotriene (LT) B4 (Cayman Chemical) for 12
h. After harvesting, the cell extracts were analyzed for both
luciferase and ß-galactosidase activities (21).
Transfection efficiency was normalized by the ß-galactosidase
expression.
3H-thymidine incorporation
When rat VSMCs became 70% confluent, media were changed to
serum-free MEM and incubated for 2 days. Then, the cells were incubated
in the presence or absence of 1 µM AII
(Sigma, St. Louis, MO), AII plus 1 µM
AT1R antagonist candesartan (kindly provided by Takeda Chemical Industries Co., Ltd.), 1 µM
15dPGJ2, or 10 µM
troglitazone for 12 h with 1 µCi/ml
3H-thymidine (Amersham Pharmacia Biotech) in serum-free MEM. The cells were washed twice with
ice-cold PBS, incubated with 500 µl 5% trichloroacetic acid for 30
min at 4 C, washed twice with 1 ml 5% trichloroacetic acid, and
incubated with 400 µl 1 N NaOH for 20 min at room temperature. After
neutralization with 400 µl 1 N HCl, the cell extracts were put into
vials with 5 ml scintillation solution and counted in a
ß-counter.
Electrophoretic mobility shift assay (EMSA)
In vitro transcription/translation of mouse
PPAR-
1, RXR-
, and Sp1 cDNA clones was performed using TNT
kits (Promega Corp., Madison, WI). Unprogrammed
reticulocyte lysate (RL) was also generated simultaneously. EMSA was
performed as described previously (21). Briefly,
32P-labeled double-stranded oligonucleotides
containing either HMG-CoA synthase gene PPRE (-111/-85;
TGTTCTGAGACCTTTGGCCCAGTTTTT) (11), the -58/-34 region
(TGCAGAGCAGCGACGCCCCCTAGGC) of the AT1R gene promoter (7),
or the GC-box-related sequence mutated -58/-34 region probe
(TGCAGAGCAGCGACG- TTTTTTAGGC; mutated sites are
underlined) were incubated with either 2 µl in
vitro translated Sp1, PPAR-
1, and/or RXR-
for 30 min at room
temperature and were subjected to electrophoresis on 4% polyacrylamide
gels. In some experiments, rat VSMCs nuclear extracts (2 µg) prepared
as previously described (26) were incubated either in the
presence or absence of 2 µl in vitro translated PPAR-
1
and/or RXR-
.
Antibody supershift experiments
After a 30-min incubation of rat VSMC nuclear extracts (2 µg)
with either the -58/-34 region probe or the GC-box-related sequence
mutated -58/-34 region probe, further incubation with 1 µl of
either polyclonal anti-Sp1 antibody (1C6; Santa Cruz Biotechnology, Inc.), anti-Sp2 antibody (K-20; Santa Cruz Biotechnology, Inc.), anti-Sp3 antibody (D-20;
Santa Cruz Biotechnology, Inc.), or anti-Sp4 antibody
(V-20; Santa Cruz Biotechnology, Inc.) at 4 C for 2 h
was performed before electrophoresis as described previously
(26). For competition experiment, 100-fold excess of
unlabeled oligonucleotides for the -58/-34 region or SV40 early
promoter Sp1 site (AGTTAGGGGCGGGATGGGCGGAGTTAG) (27) was
coincubated.
Glutathione S-transferase (GST) pull-down assay
Full-length GST-PPAR-
fusion protein was synthesized from
pGEX-PPAR-
(described above) by the GST Gene Fusion system
(Amersham Pharmacia Biotech). The protein was loaded onto
glutathione-Sepharose beads, which were washed and resuspended in
binding buffer [20 mM HEPES (pH 7.7), 75 mM
KCl, 0.1 mM EDTA, 2.5 mM
MgCl2, 0.05% Nonidet P-40, 2 mM
dithiothreitol, and 10% glycerol]. The beads were incubated with 5
µl in vitro translated 35S-labeled
Sp1 for 1 h at 4 C, followed by washing five times with binding
buffer in the presence or absence of troglitazone (50
µM). They were then resuspended in 30 µl SDS
sample buffer and were analyzed by SDS-PAGE.
Statistical analysis
Statistical significance was calculated by one-factor ANOVA
using StatView 4.0 (ABACUS Concepts, Cary, NC).
 |
Results
|
|---|
Suppression of AT1R mRNA/protein expressions by PPAR-
ligands
We first performed Northern blot analysis to study AT1R mRNA
expression regulation in VSMCs by PPAR-
ligands. Abundant AT1R mRNA
expression (3.5-kb, indicated by an arrow in the top
panel of Fig. 1A
) was observed in
VSMCs in the absence of PPAR-
ligands. Incubation of VSMCs with
PPAR-
ligands such as 15dPGJ2,
troglitazone, rosiglitazone, or pioglitazone
significantly decreased AT1R mRNA levels in a dose-dependent manner
(Fig. 1A
). Interestingly, troglitazone was observed to be
more potent than other thiazolidinediones, such as rosiglitazone and
pioglitazone. Western immunoblot analysis using VSMCs
membrane proteins by anti-AT1R antibody (Fig. 1B
) also demonstrated a
significant decrease in AT1R protein expression (41-kDa, indicated by
an arrow) by these PPAR-
ligands treatment (lines 14).
These results indicate that endogenous AT1R mRNA/protein expressions in
VSMCs are both suppressed by PPAR-
ligands.
Effect of PPAR-
ligands on AT1R mRNA stability
To examine whether the effect of PPAR-
ligands on AT1R mRNA
decrease was due to decrease of AT1R mRNA stability, we next treated
VSMCs with 5 µg/ml actinomycin D. As shown in Fig. 2
, AT1R mRNA in VSMCs untreated with
PPAR-
ligands (control) degraded approximately by 50% after 8
h treatment with actinomycin D. Even when VSMCs were pretreated with
15dPGJ2 or troglitazone, AT1R mRNA
degradation rate was not affected (Fig. 2
). These results suggest that
PPAR-
ligands do not affect AT1R mRNA stability.
Effect of PPAR-
ligands on AII-induced
3H-thymidine incorporation
We next examined the effect of PPAR-
ligands on DNA synthesis
in VSMCs. As shown in Fig. 3
, an increase
(approximately 135% of basal) of 3H-thymidine
incorporation into VSMCs was observed by 1 µM AII
incubation (line 2). The increase was completely inhibited by 1
µM AT1R antagonist candesartan treatment (line 3),
suggesting that the increase was AII-specific effect. When VSMCs were
coincubated either with 1 µM
15dPGJ2 or 10 µM
troglitazone, AII-induced increase of
3H-thymidine incorporation was completely
abrogated (lines 4 and 5), most likely due to the decrease of AT1R
protein expression by these PPAR-
ligands as observed in Fig. 1B
.

View larger version (17K):
[in this window]
[in a new window]
|
Figure 3. Effect of PPAR- ligands on AII
induced-3H-thymidine incorporation. Rat VSMCs incubated
either without (line 1) or with 1 µM AII (line 2), AII
plus 1 µM candesartan (line 3), AII plus 1
µM 15dPGJ2 (line 4), or AII plus 10
µM troglitazone (line 5) for 12 h with
1 µCi/ml 3H-thymidine were harvested, and their
3H-thymidine incorporation was measured. The bar
graph represents the mean ± SD of the
percentage of 3H-thymidine incorporation compared with
control value (line 1 as 100%) (n = 6). *, P
< 0.01, as compared with line 2.
|
|
Transcriptional suppression of AT1R expression by PPAR-
ligands
We next studied the effect of PPAR-
ligands on AT1R gene
transcription. As seen in Fig. 4
, PPAR-
ligands such as 15dPGJ2 (lines 27),
troglitazone (lines 811), and rosiglitazone (lines 12
and 13) significantly decreased -1969/+104-luc activity in a
dose-dependent manner. In contrast, PPAR-
ligand
LTB4 did not affect the transcription (line 14).
Interestingly, RXR-
ligand 9cRA slightly suppressed AT1R gene
transcription (line 15). Because endogenous expression of PPAR-
in
rat VSMCs was confirmed by RT-PCR as shown in Fig. 5
, it is suggested that PPAR-
ligands
suppress AT1R gene expression at a transcriptional level by activating
endogenous PPAR-
in VSMCs.

View larger version (30K):
[in this window]
[in a new window]
|
Figure 4. Effect of PPAR- ligands on AT1R gene promoter
activity. Rat VSMCs transfected with -1969/+104-luc were treated with
indicated concentrations of 15dPGJ2,
troglitazone, rosiglitazone, LTB4, or 9cRA for
12 h and harvested for measuring luciferase activities. Line 1, no
ligands. Bar graphs represent mean ±
SE (%) of luciferase activity (line 1 as 100%) (n =
6). *, P < 0.01 as compared with line 1. **,
P < 0.05 as compared with line 1.
|
|
Involvement of PPAR-
in AT1R gene suppression
PPAR-
overexpression in VSMCs was performed next. As seen in
Fig. 6
, PPAR-
overexpression
significantly decreased -1969/+104-luc activity in the absence (lines
1 and 2) or the presence of PPAR-
ligands (lines 6 and 7 for
15dPGJ2 and lines 10, 11, 14, and 15 for
troglitazone), whereas RXR-
overexpression did not
affect it (lines 3, 8, 12, and 16). Moreover, overexpression of both
factors did not affect the transcriptional suppression brought about by
PPAR-
alone (lines 4, 9, 13, and 17). PPAR-
overexpression showed
no effect (line 5). It is, therefore, indicated that PPAR-
, but not
RXR-
, is involved in AT1R gene suppression.

View larger version (31K):
[in this window]
[in a new window]
|
Figure 6. Effect of PPAR- overexpression on the AT1R gene
promoter. Rat VSMCs were transfected with expression plasmid of
PPAR- 1 (lines 2, 7, 11, and 15), PPAR- (line 5), RXR- (lines
3, 8, 12, and 16), or both (lines 4, 9, 13, and 17) as well as
-1969/+104-luc. The transfected cells were treated with 2.5
µM 15dPGJ2 (lines 69), 10 µM
troglitazone (lines 1013), or 50 µM
troglitazone (lines 1417) for 12 h. Bar
graphs represent mean ± SE (%) of luciferase
activity (line 1 as 100%) (n = 6). *, P <
0.01, as compared with line 1; **, P < 0.01, as
compared with line 6; ***, P < 0.01, as
compared with line 10; ****, P < 0.05, as compared
with line 14.
|
|
A GC-box-related sequence within the -58/-34 region of the AT1R
gene promoter responsible for the suppression
The element(s) responsible for the AT1R gene suppression by
PPAR-
ligands were localized next. As shown in Fig. 7A
, the suppression was observed in all
constructs from -1969/+104-luc to -58/+104-luc (lines 14 for
-1969/+104-luc, lines 58 for -987/+104-luc, lines 912 for
-331/+104-luc, and lines 1316 for -58/+104-luc). To further
localize the element, we next transfected -58/+104-luc, -58/-1-luc,
-34/-1-luc, or -1/-34-luc (inverted orientation of -34/-1-luc)
into VSMCs and treated them with 15dPGJ2 or
troglitazone. As shown in Fig. 7B
, both PPAR-
ligands
suppressed transcriptional activities of -58/+104-luc (lines 14) and
-58/-1-luc (lines 58), suggesting that the suppression was mediated
within the -58/-1 region. In contrast, the transcriptional activity
of -34/-1-luc (element between 1-bp upstream of TATA box and the
transcription start site) was not suppressed by PPAR-
ligands (lines
912). When -1/-34-luc was transfected, the basal transcriptional
level decreased approximately to one fourth of -34/-1-luc (lines
1315), suggesting that the -34/-1 region functions as the major
promoter of the AT1R gene in the right orientation. These data suggest
that the region between -58 and -34 (the -58/-34 region) is
responsible for the suppression. The -58/-34 region
(TGCAGAGCAGCGACGCCCCCTAGGC) is composed of several G and C nucleotides
and contains a GC-box-related sequence in the latter half that is
supposed to be bound by a Sp-family protein(s). We, therefore,
generated mutated -58/-1-luc, whose GC-box-related sequence within
the -58/-34 region was abrogated as described in Materials and
Methods, and transfected it into VSMCs. The transcriptional
activity of mutated -58/-1-luc also was not suppressed by PPAR-
ligands (lines 1619). To confirm that the GC-box-related sequence
within the -58/-34 region was responsible for the suppression by
PPAR-
ligands, we also generated mutated -1969/+104-luc, whose
GC-box-related sequence within the -58/-34 region was abrogated as
described in Materials and Methods. As shown in Fig. 7C
, the
transcriptional activity of mutated -1969/+104-luc also was not
suppressed by PPAR-
ligands (lines 58). Taken together, it is
suggested that the GC-box-related sequence within the -58/-34 region
is responsible for the suppression.

View larger version (35K):
[in this window]
[in a new window]
|
Figure 7. Localization of the element(s) responsible for the
transcriptional suppression by PPAR- . A, Rat VSMCs were transfected
with either -1969/+104-luc, -987/+104-luc, -331/+104-luc, or
-58/+104-luc. Bar graphs represent mean ±
SE (%) of luciferase activity (line 1 as 100%) (n =
6). *, P < 0.01, as compared with line
1; **, P < 0.01, as compared with line 5;
***, P < 0.01, as compared with line 9;
****, P < 0.01, as compared with line 13. B, Rat
VSMCs were transfected either with -58/+104-luc, -58/-1-luc,
-34/-1-luc, -1/-34-luc, or mutated -58/-1-luc. Bar
graphs represent mean ± SE (%) of luciferase
activity (line 1 as 100%) (n = 6). Arrows indicate
the orientation of the promoter. TATA, TATA box; GC, GC-box-related
sequence. *, P < 0.01, as compared with line 1;
**, P < 0.01, as compared with line 5. C, Rat
VSMCs were transfected with either -1969/+104-luc or mutated
-1969/+104-luc. Bar graphs represent mean ±
SE (%) of luciferase activity (line 1 as 100%) (n =
6). *, P < 0.01, as compared with line 1. The
shaded area in A, B, and C is 5'-UTR. The cells were
treated with indicated concentrations of 15dPGJ2 or
troglitazone for 12 h.
|
|
Sp1, but not PPAR-
, binding to the GC-box-related sequence
within the -58/-34 region
By EMSA, we next examined a binding of PPAR-
to the -58/-34
region of the AT1R gene promoter (Fig. 8A
). When
32P-labeled HMG-CoA synthase gene PPRE
(11) oligonucleotides (positive control) were incubated
with in vitro translated PPAR-
1 and/or RXR-
,
PPAR-
/RXR-
heterodimer formation (PPAR-
/RXR-
in lane 3,
indicated by an arrow) was observed only in the presence of
both factors (lanes 14). In contrast, the complex was not observed
when using 32P-labeled -58/-34 region
oligonucleotides (lanes 58). It is, therefore, suggested that
PPAR-
cannot bind to the -58/-34 region either as
monomer/homodimer or as heterodimer with RXR-
. We next studied a
binding of Sp1 to the -58/-34 region (Fig. 8B
). When in
vitro translated Sp1 was incubated with
32P-labeled -58/-34 region oligonucleotides,
formation of a Sp1-DNA complex (Sp1 in lane 3, indicated by an
arrow) was observed. When unprogrammed RL that did not
contain Sp1 was used, the complex could not be observed (lane 2). In
addition, formation of the Sp1-DNA complex was abrogated when the
GC-box-related sequence mutated -58/-34 region (described in
Materials and Methods) was used as a probe (lane 4). It is,
therefore, suggested that the GC-box-related sequence within the
-58/-34 region is a Sp1 (Sp-family) binding site.
Binding of Sp1 in VSMCs to the GC-box-related sequence within the
-58/-34 region
To identify a possible factor(s) that can bind to the
GC-box-related sequence within the -58/-34 region in VSMCs, antibody
supershift experiments in EMSA were performed next (Fig. 9
). When VSMC nuclear extracts were
incubated with 32P-labeled oligonucleotides of
the -58/-34 region, two protein-DNA complexes were observed
(Protein/DNA Complexes with arrows, lane 1). Coincubation
with 100-fold excess of the unlabeled -58/-34 region oligonucleotides
completely abolished the formation of both complexes (lane 6),
suggesting that both complexes were specific for the -58/-34 region.
When the GC-box-related sequence mutated -58/-34 region was used as a
probe, formation of both complexes was completely abolished (lane 8),
suggesting that the GC-box-related sequence was necessary for the
protein binding. Moreover, when we coincubated with 100-fold excess of
unlabeled oligonucleotides containing the SV40 early promoter Sp1 site
(27), which contains consensus GC-boxes, formation of both
complexes was also completely abolished (lane 7). These data suggest
that the protein-DNA complexes would be composed of a Sp-family
protein(s) in VSMCs that could bind to the GC-box-related sequence. We
next performed antibody supershift experiments further, to identify a
Sp-family protein(s) binding to the GC-box-related sequence. As
observed in lane 2, incubation with anti-Sp1 antibody abolished
formation of most of both complexes, and induction of a supershifted
complex (Supershifted Sp1 with an arrow, Fig. 7
) was
observed. These data suggest that most of both complexes may be
composed of the Sp1 protein. Incubation with anti-Sp2 (lane 3) and
anti-Sp3 (lane 4) antibodies also decreased the upper complex, to some
extent, and induced supershifted complexes (Supershifted Sp2/Sp3 with
an arrow, Fig. 7
). In contrast, incubation with anti-Sp4
antibody did not affect both complexes, and no supershifted complex was
observed (lane 5). These data suggest that Sp1 protein is mostly
involved in the protein-DNA complexes, and some Sp2 and Sp3 proteins
are also possibly involved.

View larger version (54K):
[in this window]
[in a new window]
|
Figure 9. Interaction between VSMC nuclear extracts and the
AT1R gene promoter. 32P-labeled oligonucleotides containing
the -58/-34 region of the AT1R gene promoter (-58/-34; lanes 17)
were incubated with 2 µg VSMC nuclear extracts (VSMC NE) and were
sequentially incubated with 1 µl anti-Sp1 antibody (lane 2), anti-Sp2
antibody (lane 3), anti-Sp3 antibody (lane 4), or anti-Sp4 antibody
(lane 5). Protein-DNA complexes are indicated by arrows
(Protein/DNA Complexes). Supershifted bands by anti-Sp1 antibody (lane
2) (Supershifted Sp1), anti-Sp2 antibody (lane 3), or by anti-Sp3
antibody (lane 4) (Supershifted Sp2/Sp3) are also indicated by
arrows. 32P-labeled oligonucleotides
containing the mutated GC-box-related sequence in the -58/-34 region
(GC Mut) were also used (lane 8). Unlabeled oligonucleotides (100-fold
excess) containing the -58/-34 region (-58/-34; lane 6) or SV40
early promoter Sp1 site (Sp1; lane 7) were used for competition.
|
|
Functional antagonism of PPAR-
against Sp1
The functional interaction between Sp1 and PPAR-
on the
-58/-34 region was examined next. As shown in Fig. 10
, overexpression of Sp1 significantly
increased -58/-1-luc activity (lines 1 and 2) whereas -34/-1-luc
(lines 6 and 7) and mutated -58/-1-luc (lines 9 and 10) activities
were not affected. These data suggest that Sp1 can transactivate the
-58/-34 region most likely via the GC-box-related sequence. When we
overexpressed PPAR-
in the presence of Sp1, -58/-1-luc activity
was significantly decreased (line 3), whereas -34/-1-luc (line 8) and
mutated -58/-1-luc (line 11) activities were not affected. In
addition, the decrease of -58/-1-luc activity by PPAR-
overexpression was further augmented by the addition of PPAR-
ligands 15dPGJ2 (line 4) or
troglitazone (line 5). These data suggest that activated
PPAR-
can functionally antagonize against Sp1 via the GC-box-related
sequence within the -58/-34 region.

View larger version (22K):
[in this window]
[in a new window]
|
Figure 10. Effect of Sp1 and PPAR- overexpression on the
AT1R gene promoter. Rat VSMCs were transfected with expression plasmid
of Sp1 alone (lines 2, 7, and 10) or Sp1 plus PPAR- 1 (lines 35, 8,
and 11) with either -58/-1-luc (lines 15), -34/-1-luc (lines
68), or mutated -58/-1-luc (lines 911). In some experiments, the
cells were treated with 2.5 µM 15dPGJ2 (line
4) or 10 µM troglitazone (line 5).
Bar graphs represent mean ± SE (%) of
luciferase activity (line 1 as 100%) (n = 6). TATA, TATA box; GC,
GC-box-related sequence. *, P < 0.01, as compared
with line 1; **, P < 0.05, as compared with
line 2; ***, P < 0.01, as compared with line 2.
|
|
Inhibition of Sp1 binding to the GC-box-related sequence within the
-58/-34 region by PPAR-
We next examined the effect of PPAR-
on Sp1 binding to the
GC-box-related sequence within the -58/-34 region. As shown in Fig. 11
, incubation of VSMC nuclear extracts
with the -58/-34 region probe could form protein-DNA complexes mostly
composed of Sp1 as shown in Fig. 9
(Protein/DNA Complexes with
arrows, lane 1). When 2 µl in vitro translated
PPAR-
was coincubated in the reaction, formation of the protein-DNA
complexes was significantly inhibited (lane 2). When the same amounts
of in vitro translated RXR-
was used instead of PPAR-
,
the inhibition was not observed (lane 3), suggesting that the effect
was PPAR-
specific. The addition of both factors did not affect the
Sp1 binding inhibition brought about by PPAR-
alone (lane 4).
Similar observations were obtained when we used in vitro
translated Sp1 (data not shown). These data suggest that PPAR-
can
specifically inhibit Sp1 binding to the GC-box-related sequence within
the -58/-34 region, and the binding inhibition may contribute to the
functional antagonism of PPAR-
against Sp1 (Fig. 10
).
Direct protein-protein interaction between PPAR-
and Sp1
We next performed GST pull-down assay to study direct
protein-protein interaction between PPAR-
and Sp1. As observed in
Fig. 12
, when GST alone was incubated
with in vitro translated 35S-labeled
Sp1, no interaction between GST and Sp1 was observed (lane 2). However,
when GST-PPAR-
fusion protein was incubated with
35S-labeled Sp1, a direct protein-protein
interaction between PPAR-
and Sp1 was observed (lane 3), and the
interaction was enhanced approximately to 1.5-fold by incubation with
50 µM troglitazone (lane 4). These
results suggest that PPAR-
can physically interact with Sp1 and may
directly inhibit its function.
 |
Discussion
|
|---|
PPAR-
ligands such as 15dPGJ2 and
thiazolidinediones including troglitazone, rosiglitazone,
and pioglitazone significantly decreased AT1R mRNA
expression level in VSMCs. In addition, PPAR-
ligands also decreased
AT1R protein expression level and led to inhibition of AII-induced
increase of 3H-thymidine incorporation into
VSMCs. Because PPAR-
ligands did not affect AT1R mRNA stability and
AT1R gene promoter activity was suppressed by PPAR-
ligands, it was
suggested that AT1R expression suppression was mediated at the gene
transcription level. We have also observed that overexpression of
PPAR-
further augmented the transcriptional suppression of the AT1R
gene promoter by PPAR-
ligands, whereas other nuclear receptors
including PPAR-
and RXR-
showed no effect. Moreover, consistent
with the previous report (16, 17), endogenous expression
of PPAR-
in VSMCs was also confirmed. It is, therefore, suggested
that the transcriptional suppression of AT1R gene by PPAR-
ligands
was mediated by activated PPAR-
. These present observations suggest
that PPAR-
activation can cause suppression of AT1R gene expression
in VSMCs, resulting in inhibition of AT1R-mediated VSMC proliferation.
Different from this genomic effect via PPAR-
,
troglitazone has been shown to inhibit translocation of
mitogen-activated protein kinase in VSMCs and inhibit
AII-induced cell proliferation and migration (28, 29).
Here, AT1R gene expression suppression is suggested to be another
effect of PPAR-
ligands leading to inhibition of vascular AII
action.
We identified the element(s) responsible for AT1R gene suppression by
activated PPAR-
within the -58/-1 region, most likely at the
-58/-34 region, in the AT1R gene promoter. We, however, did not
detect a PPAR-
/RXR-
heterodimer complex using the radiolabeled
-58/-34 region by EMSA. In addition, PPRE sequence (11)
was not observed within the -58/-34 region (7). Thus,
AT1R gene suppression by activated PPAR-
may not be due to a direct
interaction between the AT1R gene promoter and PPAR-
/RXR-
heterodimer. Consistent with this observation, transcription of
inducible nitric oxide synthase, gelatinase B, and scavenger receptor A
genes that lack PPREs was shown to be suppressed by activated PPAR-
(13). A protein-protein interaction has been suggested to
be involved in the inhibition of transcriptional activity of activator
protein 1, nuclear factor (NF)-
B, or signal transducers and
activation of transcription (13).
A GC-box-related sequence was suggested to be located within the
-58/-34 region. By mutation analyses, we have observed that the
GC-box-related sequence was responsible for the transcriptional
suppression. EMSA had shown that in vitro translated Sp1
could bind to the GC-box-related sequence. Binding of Sp-family
proteins, especially Sp1, to the GC-box-related sequence was also shown
by antibody supershift experiments using VSMC nuclear extracts.
Moreover, overexpression of Sp1 was shown to transactivate the
GC-box-related sequence. Taken together, it is suggested that Sp1 binds
to and transactivates the GC-box-related sequence within the -58/-34
region in VSMCs. Inhibitory action of PPAR-
on Sp1-stimulated
transactivation at the GC-box-related sequence was also observed.
Moreover, Sp1 binding to the GC-box-related sequence was shown to be
inhibited by PPAR-
. It is, therefore, suggested that activated
PPAR-
suppresses Sp1 function most likely by inhibiting Sp1 binding
to the GC-box-related sequence. Furthermore, GST pull-down assay showed
a direct protein-protein interaction between PPAR-
and Sp1. It is
suggested that a direct binding of PPAR-
to Sp1 would be involved in
the inhibition of transcription of the GC-box-related sequence within
the -58/-34 region by Sp1. A similar mechanism of gene transcription
inhibition by a direct protein-protein interaction has been suggested
in glucocorticoid receptor and NF-
B interaction
(30).
Recently, PPAR-
has been shown to suppress several genes related to
atherogenesis. For instance, in macrophages, activated PPAR-
inhibited transcription of inducible nitric oxide synthase, gelatinase
B, and scavenger receptor A genes (13). Production of
inflammatory cytokines was inhibited by PPAR-
ligands in monocytes
(14). We have also observed that activated PPAR-
suppresses gene transcription of thromboxane synthase in macrophages
via an interaction with NF-E2-related factor 2 (31). In
VSMCs, matrix metalloproteinase-9 gene suppression by PPAR-
has been
reported (16). In addition, we have shown transcriptional
suppression of thromboxane receptor gene by activated PPAR-
(32). In vascular endothelial cells,
troglitazone has been shown to suppress expression of
endothelin-1 (33) and plasminogen activator inhibitor type
1 (34). Because activation of these genes, including the
AT1R gene, are prone to stimulate atherosclerotic changes,
transcriptional suppression of these genes by activated PPAR-
may
exert some antiatherosclerotic effects. In addition to these effects on
the transcriptional suppression, troglitazone has been
reported to suppress cell proliferation induced by AII
(28), platelet-derived growth factor, or basic fibroblast
growth factor (35) and cell migration
(16) in VSMCs. On the other hand, activated PPAR-
has
also been suggested to promote some atherogenic effects such as
oxidized low-density lipoprotein uptake, transactivation of CD36 in
macrophages/monocytes, and lipid accumulation in these cells to
generate foaming cells (36, 37). Nonetheless, in in
vivo studies, neointimal formation following balloon injury was
shown to be inhibited by troglitazone (35, 38). In clinical studies, some beneficial effects of
troglitazone on hypertension (39),
proteinuria (40), and cardiac function (41)
have also been reported. It seems that PPAR-
ligand may have some
favorable clinical efficacy in the treatment of cardiovascular
diseases, although more studies are required to clarify the underlying
molecular mechanisms.
In summary, it is suggested that PPAR-
activation can inhibit AT1R
gene expression at the transcriptional level. PPAR-
ligands, thus,
may inhibit AII-induced cell growth and hypertrophy in VSMCs by AT1R
expression suppression and may possibly be beneficial for treatment of
diabetic patients to avoid cardiovascular complications.
 |
Footnotes
|
|---|
1 Supported in part by Grants-in-Aid from the Ministry of Education,
Science and Culture, Japan (09671018 to A.S.; 09470236 to K.T.), Kanae
Foundation for Life and Socio-Medical Science (to A.S.), Takeda
Metabolic Disorder Research Foundation (to K.T.), and Sankyo Co., Ltd., Japan (to K.T.). 
Received September 29, 2000.
 |
References
|
|---|
-
Griendling KK, Ushio-Fukai M, Lassegue B, Alexander
RW 1997 Angiotensin II signaling in vascular smooth muscle. New
concepts. Hypertension 29:366373[Abstract/Free Full Text]
-
Berk BC 1999 Angiotensin II signal transduction in
vascular smooth muscle: pathways activated by specific tyrosine
kinases. J Am Soc Nephrol 10(Suppl 11):S62S68
-
Paradis P, Dali-Youcef N, Paradis FW, Thibault G, Nemer
M 2000 Overexpression of angiotensin II type I receptor in
cardiomyocytes induces cardiac hypertrophy and remodeling. Proc Natl
Acad Sci USA 97:931936[Abstract/Free Full Text]
-
Nataraj C, Oliverio MI, Mannon RB, Mannon PJ, Audoly
LP, Amuchastegui CS, Ruiz P, Smithies O, Coffman TM 1999 Angiotensin II regulates cellular immune responses through a
calcineurin-dependent pathway. J Clin Invest 104:16931701[Medline]
-
Murphy TJ, Takeuchi K, Alexander RW 1992 Molecular
biology of vascular type-1 angiotensin II receptor. Am J Hypertens 5:236S242S
-
Timmermans PB 1999 Angiotensin II receptor
antagonists: an emerging new class of cardiovascular therapeutics
Hypertens Res 22: 147153
-
Takeuchi K, Alexander RW, Nakamura Y, Tsujino T, Murphy
TJ 1993 Molecular structure and transcriptional function of the
rat vascular AT1a angiotensin receptor gene. Circ Res 73:612621[Abstract/Free Full Text]
-
Ikeda Y, Takeuchi K, Kato T, Taniyama Y, Sato K,
Takahashi N, Sugawara A, Ito S 1999 Transcriptional suppression of
rat angiotensin AT1a receptor gene expression by interferon-gamma in
vascular smooth muscle cells. Biochem Biophys Res Commun 262:494498[CrossRef][Medline]
-
Forman BM, Tontonoz P, Chen J, Brun RP, Spiegelman BM,
Evans RM 1995 15-Deoxy-
12, 14-prostaglandin J2 is a ligand for
the adipocyte determination factor PPAR
. Cell 83:803812[CrossRef][Medline]
-
Lehmann JM, Moore LB, Smith-Oliver TA, Wilkison WO,
Willson TM, Kliewer SA 1995 An antidiabetic thiazolidinedione is a
high affinity ligand for peroxisome proliferator-activated receptor
(PPAR
). J Biol Chem 270:1295312956[Abstract/Free Full Text]
-
Juge-Aubry C, Pernin A, Favez T, Burger AG, Wahli W,
Meier CA, Desvergne B 1997 DNA binding properties of peroxisome
proliferator-activated receptor subtypes on various natural peroxisome
proliferator response elements. Importance of the 5'-flanking region.
J Biol Chem 272:2525225259[Abstract/Free Full Text]
-
Spiegelman BM 1998 PPAR-
: adipogenic regulator
and thiazolidinedione receptor. Diabetes 47:507514[Abstract]
-
Ricote M, Li AC, Willson TM, Kelly CJ, Glass CK 1998 The peroxisome proliferator-activated receptor-
is a negative
regulator of macrophage activation. Nature 391:7982[CrossRef][Medline]
-
Jiang C, Ting AT, Seed B 1998 PPAR-
agonists
inhibit production of monocyte inflammatory cytokines. Nature 391:8286[CrossRef][Medline]
-
Ross R 1999 Atherosclerosisan inflammatory
disease. N Engl J Med 340:115126[Free Full Text]
-
Marx N, Schonbeck U, Lazar MA, Libby P, Plutzky J 1998 Peroxisome proliferator-activated receptor
activators inhibit
gene expression and migration in human vascular smooth muscle cells.
Circ Res 83:10971103[Abstract/Free Full Text]
-
Iijima K, Yoshizumi M, Ako J, Eto M, Kim S, Hashimoto M,
Sugimoto N, Liang YQ, Sudoh N, Toba K, Ouchi Y 1998 Expression of
peroxisome proliferator-activated receptor
(PPAR
) in rat
aortic smooth muscle cells. Biochem Biophys Res Commun 247:353356[CrossRef][Medline]
-
Kliewer SA, Forman BM, Blumberg B, Ong ES, Borgmeyer U,
Mangelsdorf DJ, Umesono K, Evans RM 1994 Differential expression
and activation of a family of murine peroxisome proliferator-activated
receptors. Proc Natl Acad Sci USA 91:73557359[Abstract/Free Full Text]
-
Mangelsdorf DJ, Borgmeyer U, Heyman RA, Zhou JY, Ong ES,
Oro AE, Kakizuka A, Evans RM 1992 Characterization of three RXR
genes that mediate the action of 9-cis retinoic acid. Genes Dev 6:329344[Abstract/Free Full Text]
-
Kobayashi A, Sogawa K, Fujii-Kuriyama Y 1996 Cooperative interaction between AhR.Arnt and Sp1 for the drug-inducible
expression of CYP1A1 gene. J Biol Chem 271:1231012316[Abstract/Free Full Text]
-
Sugawara A, Sanno N, Takahashi N, Osamura RY, Abe K 1997 Retinoid X receptors in the kidney: their protein expression and
functional significance. Endocrinology 138:31753180[Abstract/Free Full Text]
-
Murphy TJ, Alexander RW, Griendling KK, Runge MS,
Bernstein KE 1991 Isolation of a cDNA encoding the vascular type-1
angiotensin II receptor. Nature 351:233236[CrossRef][Medline]
-
Park KS, Ciaraldi TP, Abrams-Carter L, Mudaliar S,
Nikoulina SE, Henry RR 1997 PPAR-
gene expression is elevated
in skeletal muscle of obese and type II diabetic subjects. Diabetes 46:12301234[Abstract]
-
Takahashi N, Takeuchi K, Sugawara A, Taniyama Y, Kato T,
Wilcox CS, Abe K, Ito S 1998 Structure and transcriptional
function of the 5'-flanking region of rat thromboxane receptor gene.
Biochem Biophys Res Commun 244:489493[CrossRef][Medline]
-
Wang ZQ, Moore AF, Ozono R, Siragy HM, Carey RM 1998 Immunolocalization of subtype 2 angiotensin II (AT2) receptor
protein in rat heart. Hypertension 32:7883[Abstract/Free Full Text]
-
Sugawara A, Yen PM, Qi Y, Lechan RM, Chin WW 1995 Isoform-specific retinoid-X receptor (RXR) antibodies detect
differential expression of RXR proteins in the pituitary gland.
Endocrinology 136:17661774[Abstract]
-
Dynan WS, Tjian R 1983 The promoter-specific
transcription factor Sp1 binds to upstream sequences in the SV40 early
promoter. Cell 35:7987[CrossRef][Medline]
-
Graf K, Xi XP, Hsueh WA, Law RE 1997 Troglitazone
inhibits angiotensin II-induced DNA synthesis and migration in vascular
smooth muscle cells. FEBS Lett 400:119121[CrossRef][Medline]
-
Goetze S, Xi XP, Graf K, Fleck E, Hsueh WA, Law RE 1999 Troglitazone inhibits angiotensin II-induced extracellular
signal-regulated kinase 1/2 nuclear translocation and activation in
vascular smooth muscle cells. FEBS Lett 452:277282[CrossRef][Medline]
-
Scheinman RI, Gualberto A, Jewell CM, Cidlowski JA,
Baldwin AS Jr 1995 Characterization of mechanisms involved in
transrepression of NF-
B by activated glucocorticoid receptors. Mol
Cell Biol 15:943953[Abstract]
-
Ikeda Y, Sugawara A, Taniyama Y, Uruno A, Igarashi K,
Arima S, Ito S, Takeuchi K 2000 Suppression of rat thromboxane
synthase gene transcription by peroxiosme proliferator-activated
receptor in macrophages via an interaction with NF-E2 related factor 2.
J Biol Chem 275:3314233150[Abstract/Free Full Text]
-
Sugawara A, Takeuchi K, Uruno A, Kudo M, Taniyama Y,
Ikeda Y, Kato T, Takahashi N, Ito S 1998 Negative regulation of
rat thromboxane receptor gene by 15-deoxy-
12,
14-PGJ2 and troglitazone by
activating PPAR-
in vascular smooth muscle cells. J Am Soc
Nephrol 9:358A (Abstract)
-
Satoh H, Tsukamoto K, Hashimoto Y, Hashimoto N, Togo M,
Hara M, Maekawa H, Isoo N, Kimura S, Watanabe T 1999 Thiazolidinediones suppress endothelin-1 secretion from bovine vascular
endothelial cells: a new possible role of PPAR
on vascular
endothelial function. Biochem Biophys Res Commun 254:757763[CrossRef][Medline]
-
Kato K, Satoh H, Endo Y, Yamada D, Midorikawa S, Sato W,
Mizuno K, Fujita T, Tsukamoto K, Watanabe T 1999 Thiazolidinediones down-regulate plasminogen activator inhibitor type 1
expression in human endothelial cells: a possible role of PPAR
in
endothelial function. Biochem Biophys Res Commun 258:431435[CrossRef][Medline]
-
Law RE, Meehan WP, Xi XP, Graf K, Wuthrich DA, Coats W,
Faxon D, Hsueh WA 1996 Troglitazone inhibits vascular smooth
muscle cell growth and intimal hyperplasia. J Clin Invest 98:18971905[Medline]
-
Tontonoz P, Nagy L, Alvarez JG, Thomazy VA, Evans
RM 1998 PPAR
promotes monocyte/macrophage differentiation and
uptake of oxidized LDL. Cell 93:241252[CrossRef][Medline]
-
Nagy L, Tontonoz P, Alvarez JG, Chen H, Evans RM 1998 Oxidized LDL regulates macrophage gene expression through ligand
activation of PPAR
. Cell 93:229240[CrossRef][Medline]
-
Shinohara E, Kihara S, Ouchi N, Funahashi T, Nakamura T,
Yamashita S, Kameda-Takemura K, Matsuzawa Y 1998 Troglitazone
suppresses intimal formation following balloon injury in
insulin-resistant Zucker fatty rats. Atherosclerosis 136:275279[CrossRef][Medline]
-
Ogihara T, Rakugi H, Ikegami H, Mikami H, Masuo K 1995 Enhancement of insulin sensitivity by troglitazone lowers blood
pressure in diabetic hypertensives. Am J Hypertens 8:316320[CrossRef][Medline]
-
Imano E, Kanda T, Nakatani Y, Nishida T, Arai K,
Motomura M, Kajimoto Y, Yamasaki Y, Hori M 1988 Effect of
troglitazone on microalbuminuria in patients with incipient diabetic
nephropathy. Diabetes Care 21:21352139[Abstract]
-
Ghazzi MN, Perez JE, Antonucci TK, Driscoll JH, Huang
SM, Faja BW, Whitcomb RW 1997 Cardiac and glycemic benefits of
troglitazone treatment in NIDDM. The Troglitazone Study Group. Diabetes 46:433439[Abstract]
This article has been cited by other articles:

|
 |

|
 |
 
K. K. Koh and M. J. Quon
Combination Therapy for Treatment or Prevention of Atherosclerosis
Hypertension,
August 1, 2008;
52(2):
e18 - e18.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Kuipers, P. van der Harst, G. Navis, L. van Genne, F. Morello, W. H. van Gilst, D. J. van Veldhuisen, and R. A. de Boer
Nuclear Hormone Receptors as Regulators of the Renin-Angiotensin-Aldosterone System
Hypertension,
June 1, 2008;
51(6):
1442 - 1448.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Imayama, T. Ichiki, D. Patton, K. Inanaga, R. Miyazaki, H. Ohtsubo, Q. Tian, K. Yano, and K. Sunagawa
Liver X Receptor Activator Downregulates Angiotensin II Type 1 Receptor Expression Through Dephosphorylation of Sp1
Hypertension,
June 1, 2008;
51(6):
1631 - 1636.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. M. Beyer, G. L. Baumbach, C. M. Halabi, M. L. Modrick, C. M. Lynch, T. D. Gerhold, S. M. Ghoneim, W. J. de Lange, H. L. Keen, Y.-S. Tsai, et al.
Interference With PPAR{gamma} Signaling Causes Cerebral Vascular Dysfunction, Hypertrophy, and Remodeling
Hypertension,
April 1, 2008;
51(4):
867 - 871.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z.-G. Xu, H. Yuan, L. Lanting, S.-L. Li, M. Wang, N. Shanmugam, M. Kato, S. G. Adler, M. A. Reddy, and R. Natarajan
Products of 12/15-Lipoxygenase Upregulate the Angiotensin II Receptor
J. Am. Soc. Nephrol.,
March 1, 2008;
19(3):
559 - 569.
[Abstract]
[Full Text]
[PDF]
|