help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sugawara, A.
Right arrow Articles by Ito, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sugawara, A.
Right arrow Articles by Ito, S.
Endocrinology Vol. 142, No. 7 3125-3134
Copyright © 2001 by The Endocrine Society


ARTICLES

Transcriptional Suppression of Type 1 Angiotensin II Receptor Gene Expression by Peroxisome Proliferator-Activated Receptor-{gamma} in Vascular Smooth Muscle Cells1

Akira Sugawara, Kazuhisa Takeuchi, Akira Uruno, Yukio Ikeda, Shuji Arima, Masataka Kudo, Kazunori Sato, Yoshihiro Taniyama and Sadayoshi Ito

Division of Nephrology, Endocrinology, and Vascular Medicine, Department of Medicine, Tohoku University Graduate School of Medicine, Sendai 980-8574, Japan

Address all correspondence and requests for reprints to: Dr. Akira Sugawara, Molecular Biology Unit, Division of Nephrology, Endocrinology, and Vascular Medicine, Department of Medicine, Tohoku University Graduate School of Medicine, 1-1 Seiryo-cho, Aoba-ku, Sendai 980-8574 Japan. E-mail: akiras2i{at}mail.cc.tohoku.ac.jp


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Angiotensin (A) II plays a critical role in vascular remodeling, and its action is mediated by type 1 AII receptor (AT1R). Recently, 15-deoxy-{Delta}12,14-prostaglandin J2 and thiazolidinediones have been shown to be ligands for peroxisome proliferator-activated receptor (PPAR)-{gamma} and activate PPAR-{gamma}. In the present work, we have studied the effect of PPAR-{gamma} on AT1R expression in rat vascular smooth muscle cells (VSMCs). We observed that: 1) endogenous AT1R expression was significantly decreased by PPAR-{gamma} ligands both at messenger RNA and protein levels, whereas AT1R messenger RNA stability was not affected; 2) AII-induced increase of 3H-thymidine incorporation into VSMCs was inhibited by PPAR-{gamma} ligands; 3) rat AT1R gene promoter activity was significantly suppressed by PPAR-{gamma} ligands, and PPAR-{gamma} overexpression further suppressed the promoter activity; 4) transcriptional analyses using AT1R gene promoter mutants revealed that a GC-box-related sequence within the -58/-34 region of the AT1R gene promoter was responsible for the suppression; 5) Sp1 overexpression stimulated AT1R gene transcription via the GC-box-related sequence, which was inhibited by additional PPAR-{gamma} overexpression; 6) electrophoretic mobility shift assay suggested that Sp1 could bind to the GC-box-related sequence whereas PPAR-{gamma} could not; 7) antibody supershift experiments using VSMC nuclear extracts revealed that protein-DNA complexes formed on the GC-box-related sequence, which were decreased by PPAR-{gamma} coincubation, were mostly composed of Sp1; and 8) glutathione S-transferase pull-down assay revealed a direct interaction between PPAR-{gamma} and Sp1. Taken together, it is suggested that activated PPAR-{gamma} suppresses AT1R gene at a transcriptional level by inhibiting Sp1 via a protein-protein interaction. PPAR-{gamma} ligands, thus, may inhibit AII-induced cell growth and hypertrophy in VSMCs by AT1R expression suppression and possibly be beneficial for treatment of diabetic patients with hypertension and atherosclerosis.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
ANGIOTENSIN (A) II plays a critical role in the progression of atherosclerosis and hypertension via type 1(a) AII receptor (AT1R) (1, 2, 3, 4, 5). In vascular smooth muscle cells (VSMCs), activation of AT1R induces cell contraction, proliferation, and migration through several signal transduction pathways, including tyrosine kinases and mitogen-activated protein kinase (1, 2). Overexpression of AT1R in cardiomyocytes using transgenic models induced cardiac hypertrophy and remodeling (3). AT1R antagonists that inhibit AT1R activation have been widely used for therapeutic purposes for cardiovascular diseases (6). Moreover, AT1R activation by AII triggers the proliferation and activation of splenic lymphocytes, which may cause promotion of inflammation (4). The 5'-flanking region (FL) of rat AT1R gene was cloned, and its transcriptional regulation in rat VSMCs has been studied (7, 8).

Recently, 15-deoxy-{Delta} 12, 14-prostaglandin (PG) J2 (15dPGJ2) as well as insulin-sensitizing thiazolidinediones, including troglitazone and rosiglitazone, have been known to activate peroxisome proliferator-activated receptor (PPAR)-{gamma} as its ligands (9, 10). PPAR-{gamma} is a nuclear hormone receptor that binds to PPAR-response element (PPRE) composed of direct repeat of AGGTCA gapped by one nucleotide (DR1) as a heterodimer with retinoid X receptor (RXR)-{alpha}, and induces ligand-dependent transactivation (11). In adipocytes, ligand-activated PPAR-{gamma} is well known to transactivate adipocyte-specific genes and induce adipocyte differentiation (12). Recently, however, expression and function of PPAR-{gamma} in other cells, especially in the vasculature, have been more focused with reference to atherosclerosis. For example, it has recently been reported that PPAR-{gamma} inhibits macrophage activation and may lead to inhibition of the progression of atherosclerosis (13, 14).

VSMC is one of the major organs involved in the etiology of atherosclerosis (15). Although the expression of PPAR-{gamma} in VSMCs has recently been reported (16, 17), the role of PPAR-{gamma} in gene transcription in VSMCs has not yet been fully studied. In the present study, we examined the effect of PPAR-{gamma} activation on AT1R expression in VSMCs and observed that activated PPAR-{gamma} could suppress AT1R expression at a transcriptional level. We also observed that the transcriptional suppression was mediated at a GC-box- related sequence within the -58/-34 region of the AT1R gene promoter possibly via a protein-protein interaction between PPAR-{gamma} and Sp1.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Plasmids
The following reporter plasmids containing rat AT1R gene promoter fragments and luciferase complementary DNA (cDNA) (7) were used for transient transfection studies: -1969/+104-luc [1969-bp 5'-FL and 104-bp 5'-untranslated region (UTR) of rat AT1R gene]; -987/+104-luc (987-bp 5'-FL and 104-bp 5'-UTR); -331/+104-luc (331-bp 5'-FL and 104-bp 5'-UTR); -58/+104-luc (58-bp 5'-FL and 104-bp 5'-UTR); -58/-1-luc (58-bp 5'-FL); -34/-1-luc (34-bp 5'-FL); and -1/-34-luc (34-bp 5'-FL in the reverse orientation). Mutated -58/-1-luc, whose GC-box-related sequence within the -58/-34 region was abrogated (changed from TGCAGAGCAGCGACGCCCCCTAGGC to TGCAGAGCAGCGACGTTTTTTAGGC; mutated sites are underlined), was also generated. Mutated -1969/+104-luc, whose GC-box-related sequence within the -58/-34 region was abrogated (changed from TGCAGAGCA- GCGACGCCCCCTAGGC to TGCAGAGCAGCGACGTTTCCTAGGC; mutated sites are underlined), was generated using QuikChange Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA). Mouse PPAR-{gamma}1 and PPAR-{alpha} expression plasmids in pCMX (18) were kindly provided by Dr. K. Umesono (Kyoto University, Kyoto, Japan). Mouse RXR-{alpha} in pBSK (19) (kindly provided by Dr. R. M. Evans, The Salk Institute, San Diego, CA) was subcloned into pcDNA1/AMP in the right orientation. Full-length mouse PPAR-{gamma}1 cDNA was subcloned into the pGEX-4T-2 vector (Amersham Pharmacia Biotech, Buckinghamshire, UK) in the right orientation (designated as pGEX-PPAR-{gamma}). Sp1 in pCMSV (20) was kindly provided by Dr. Y. Fujii (Tohoku University, Sendai, Japan).

Cell culture
Rat VSMCs, which were isolated from male Sprague Dawley rat thoracic aortas, were gifted from Dr. K. K. Griendling (Emory University, Atlanta, GA) and maintained as described previously (7). Passages between 7 and 15 were used for the following experiments.

RNA preparation/Northern blot analysis/RT-PCR
When rat VSMCs became 70% confluent, media were changed to DMEM with 1% resin and charcoal-treated calf serum (stripped medium) (21) and were incubated for 5–6 h. The cells then were incubated either with or without 15dPGJ2 (1 or 2.5 µM; Cayman Chemical, Ann Arbor, MI), troglitazone (10 or 50 µM; kindly provided by Sankyo Co., Ltd., Tokyo, Japan), rosiglitazone (10 or 50 µM; kindly provided by Sankyo Co., Ltd.), or pioglitazone (10 or 50 µM; kindly provided by Takeda Chemical Industries Co., Ltd., Osaka, Japan) for additional 12 h. Their total RNAs were then extracted using RNeasy mini kit (QIAGEN, Hilden, Germany). Ten micrograms of isolated total RNA were subjected to electrophoresis in 1% agarose-formaldehyde gels, transferred to nylon membrane (Hybond-N; Amersham Pharmacia Biotech), and the blot was hybridized with 32P-labeled AT1R cDNA probe as described previously (22). Intensity of the blot was calculated using Luminous Imager (AI-C) (Aichi, Japan) and all values were normalized to the densities of ethidium bromide staining of 28S ribosomal RNA (rRNA). For determination of AT1R messenger RNA (mRNA) stability, rat VSMCs preincubated either in the presence or absence of 15dPGJ2 (1 µM) or troglitazone (10 µM) for 12 h were coincubated with 5 µg/ml actinomycin D (Nacalai Tesque, Osaka, Japan) for an additional 4 or 8 h before harvesting. For confirmation of PPAR-{gamma} expression in rat VSMCs, 1 µg isolated total RNA was subjected to RT-PCR using specific primers either for rat PPAR-{gamma} (a forward primer: 5'-GTTCATGCTTGTGAAGGATGC-3'; a reverse primer 5'-ACTCTGGATTCAGCTGGTCG-3') (23) or rat glyceraldehyde-3-phosphate-dehydrogenase (GAPDH) (a forward primer: 5'-TCCCTCAAGATTGTCAGCAA-3'; a reverse primer 5'-AGATCCACAACGGATACATT-3') (24) at the following conditions: 50 C, 30 min and 94 C, 2 min for RT; 94 C, 30 sec; 60 C, 30 sec; 72 C, 1 min, for 40 cycles. RT-PCR of both GAPDH and PPAR-{gamma} mRNAs was performed simultaneously.

Western immunoblot analysis
Membrane proteins of rat VSMCs grown and treated with PPAR-{gamma} ligands (2.5 µM 15dPGJ2, 50 µM troglitazone, or 50 µM rosiglitazone) in the above conditions were extracted as described previously (25). Twenty micrograms of the proteins were subjected to SDS-PAGE (9% acrylamide gel). After SDS-PAGE, proteins were transferred to polyvinylidene difluoride (Immobilon P; Millipore Corp., Bedford, MA) and were subjected to immunoblot analysis using rabbit polyclonal anti-AT1R (N-10) antibody (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) as described previously (21). The intensity of the blot was calculated using Luminous Imager (AI-C).

Luciferase reporter gene assay
When rat VSMCs became 70% confluent, media were changed to stripped medium and were incubated for 5–6 h. Then, the transfection using lipofectin was performed according to the manufacturer’s instructions (GIBCO BRL, Rockville, MD). Briefly, 1.2 µg reporter plasmid and 0.8 µg ß-galactosidase control plasmid in pCMV (CLONTECH Laboratories, Inc., Palo Alto, CA) were mixed with 6 µl lipofectin per 3.5-cm plate. In some experiments, 1 µg PPAR-{gamma}1, PPAR-{alpha}, RXR-{alpha}, and/or Sp1 expression plasmids were cotransfected. Twelve hours after transfection, media were changed to stripped medium and the cells were incubated for an additional 12 h. The cells were then incubated either with or without several concentrations of 15dPGJ2, troglitazone, or rosiglitazone for 12 h. In some experiments, the cells were incubated either with 1 µM 9-cis retinoic acid (9cRA) or 1 µM leukotriene (LT) B4 (Cayman Chemical) for 12 h. After harvesting, the cell extracts were analyzed for both luciferase and ß-galactosidase activities (21). Transfection efficiency was normalized by the ß-galactosidase expression.

3H-thymidine incorporation
When rat VSMCs became 70% confluent, media were changed to serum-free MEM and incubated for 2 days. Then, the cells were incubated in the presence or absence of 1 µM AII (Sigma, St. Louis, MO), AII plus 1 µM AT1R antagonist candesartan (kindly provided by Takeda Chemical Industries Co., Ltd.), 1 µM 15dPGJ2, or 10 µM troglitazone for 12 h with 1 µCi/ml 3H-thymidine (Amersham Pharmacia Biotech) in serum-free MEM. The cells were washed twice with ice-cold PBS, incubated with 500 µl 5% trichloroacetic acid for 30 min at 4 C, washed twice with 1 ml 5% trichloroacetic acid, and incubated with 400 µl 1 N NaOH for 20 min at room temperature. After neutralization with 400 µl 1 N HCl, the cell extracts were put into vials with 5 ml scintillation solution and counted in a ß-counter.

Electrophoretic mobility shift assay (EMSA)
In vitro transcription/translation of mouse PPAR-{gamma}1, RXR-{alpha}, and Sp1 cDNA clones was performed using TNT kits (Promega Corp., Madison, WI). Unprogrammed reticulocyte lysate (RL) was also generated simultaneously. EMSA was performed as described previously (21). Briefly, 32P-labeled double-stranded oligonucleotides containing either HMG-CoA synthase gene PPRE (-111/-85; TGTTCTGAGACCTTTGGCCCAGTTTTT) (11), the -58/-34 region (TGCAGAGCAGCGACGCCCCCTAGGC) of the AT1R gene promoter (7), or the GC-box-related sequence mutated -58/-34 region probe (TGCAGAGCAGCGACG- TTTTTTAGGC; mutated sites are underlined) were incubated with either 2 µl in vitro translated Sp1, PPAR-{gamma}1, and/or RXR-{alpha} for 30 min at room temperature and were subjected to electrophoresis on 4% polyacrylamide gels. In some experiments, rat VSMCs nuclear extracts (2 µg) prepared as previously described (26) were incubated either in the presence or absence of 2 µl in vitro translated PPAR-{gamma}1 and/or RXR-{alpha}.

Antibody supershift experiments
After a 30-min incubation of rat VSMC nuclear extracts (2 µg) with either the -58/-34 region probe or the GC-box-related sequence mutated -58/-34 region probe, further incubation with 1 µl of either polyclonal anti-Sp1 antibody (1C6; Santa Cruz Biotechnology, Inc.), anti-Sp2 antibody (K-20; Santa Cruz Biotechnology, Inc.), anti-Sp3 antibody (D-20; Santa Cruz Biotechnology, Inc.), or anti-Sp4 antibody (V-20; Santa Cruz Biotechnology, Inc.) at 4 C for 2 h was performed before electrophoresis as described previously (26). For competition experiment, 100-fold excess of unlabeled oligonucleotides for the -58/-34 region or SV40 early promoter Sp1 site (AGTTAGGGGCGGGATGGGCGGAGTTAG) (27) was coincubated.

Glutathione S-transferase (GST) pull-down assay
Full-length GST-PPAR-{gamma} fusion protein was synthesized from pGEX-PPAR-{gamma} (described above) by the GST Gene Fusion system (Amersham Pharmacia Biotech). The protein was loaded onto glutathione-Sepharose beads, which were washed and resuspended in binding buffer [20 mM HEPES (pH 7.7), 75 mM KCl, 0.1 mM EDTA, 2.5 mM MgCl2, 0.05% Nonidet P-40, 2 mM dithiothreitol, and 10% glycerol]. The beads were incubated with 5 µl in vitro translated 35S-labeled Sp1 for 1 h at 4 C, followed by washing five times with binding buffer in the presence or absence of troglitazone (50 µM). They were then resuspended in 30 µl SDS sample buffer and were analyzed by SDS-PAGE.

Statistical analysis
Statistical significance was calculated by one-factor ANOVA using StatView 4.0 (ABACUS Concepts, Cary, NC).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Suppression of AT1R mRNA/protein expressions by PPAR-{gamma} ligands
We first performed Northern blot analysis to study AT1R mRNA expression regulation in VSMCs by PPAR-{gamma} ligands. Abundant AT1R mRNA expression (3.5-kb, indicated by an arrow in the top panel of Fig. 1AGo) was observed in VSMCs in the absence of PPAR-{gamma} ligands. Incubation of VSMCs with PPAR-{gamma} ligands such as 15dPGJ2, troglitazone, rosiglitazone, or pioglitazone significantly decreased AT1R mRNA levels in a dose-dependent manner (Fig. 1AGo). Interestingly, troglitazone was observed to be more potent than other thiazolidinediones, such as rosiglitazone and pioglitazone. Western immunoblot analysis using VSMCs membrane proteins by anti-AT1R antibody (Fig. 1BGo) also demonstrated a significant decrease in AT1R protein expression (41-kDa, indicated by an arrow) by these PPAR-{gamma} ligands treatment (lines 1–4). These results indicate that endogenous AT1R mRNA/protein expressions in VSMCs are both suppressed by PPAR-{gamma} ligands.



View larger version (40K):
[in this window]
[in a new window]
 
Figure 1. Effect of PPAR-{gamma} ligands on AT1R expression. A, Effect of PPAR-{gamma} ligands on AT1R mRNA expression. The top panel shows a representative result. The upper bands represent AT1R mRNA expression (3.5-kb, indicated by an arrow) in rat VSMC total RNA demonstrated by Northern blot analysis. The lower bands represent ethidium bromide staining of 28S rRNA (indicated by an arrow) of the corresponding samples. Bar graphs in the bottom panel represent mean ± SE (%) of AT1R mRNA expression levels normalized by densities of 28S rRNA (incubated in the absence of ligands as 100%) (n = 4). *, P < 0.01, as compared with the control value. B, Effect of PPAR-{gamma} ligands on AT1R protein expression. The bottom panel shows a representative blot. Anti-AT1R antibody detected AT1R protein at the expected molecular mass (41-kDa, indicated by an arrow) in rat VSMC membrane proteins (lanes 1–4). Bar graphs represent mean ± SE (%) of AT1R protein expression levels (lane 1 as 100%) (n = 4). *, P < 0.01, as compared with lane 1 (control).

 
Effect of PPAR-{gamma} ligands on AT1R mRNA stability
To examine whether the effect of PPAR-{gamma} ligands on AT1R mRNA decrease was due to decrease of AT1R mRNA stability, we next treated VSMCs with 5 µg/ml actinomycin D. As shown in Fig. 2Go, AT1R mRNA in VSMCs untreated with PPAR-{gamma} ligands (control) degraded approximately by 50% after 8 h treatment with actinomycin D. Even when VSMCs were pretreated with 15dPGJ2 or troglitazone, AT1R mRNA degradation rate was not affected (Fig. 2Go). These results suggest that PPAR-{gamma} ligands do not affect AT1R mRNA stability.



View larger version (24K):
[in this window]
[in a new window]
 
Figure 2. Effect of PPAR-{gamma} ligands on AT1R mRNA stability. Rat VSMCs were treated in the absence ({square}) or presence of 1 µM 15dPGJ2 () or 10 µM troglitazone ({blacksquare}) for 12 h. Actinomycin D (5 µg/ml) was then added and incubated for an additional 4 or 8 h. Extracted RNAs were then processed to Northern blot analysis. The horizontal line represents mean ± SE (%) of AT1R mRNA expression levels normalized by densities of 28S rRNA (time 0 as 100%) (n = 4).

 
Effect of PPAR-{gamma} ligands on AII-induced 3H-thymidine incorporation
We next examined the effect of PPAR-{gamma} ligands on DNA synthesis in VSMCs. As shown in Fig. 3Go, an increase (approximately 135% of basal) of 3H-thymidine incorporation into VSMCs was observed by 1 µM AII incubation (line 2). The increase was completely inhibited by 1 µM AT1R antagonist candesartan treatment (line 3), suggesting that the increase was AII-specific effect. When VSMCs were coincubated either with 1 µM 15dPGJ2 or 10 µM troglitazone, AII-induced increase of 3H-thymidine incorporation was completely abrogated (lines 4 and 5), most likely due to the decrease of AT1R protein expression by these PPAR-{gamma} ligands as observed in Fig. 1BGo.



View larger version (17K):
[in this window]
[in a new window]
 
Figure 3. Effect of PPAR-{gamma} ligands on AII induced-3H-thymidine incorporation. Rat VSMCs incubated either without (line 1) or with 1 µM AII (line 2), AII plus 1 µM candesartan (line 3), AII plus 1 µM 15dPGJ2 (line 4), or AII plus 10 µM troglitazone (line 5) for 12 h with 1 µCi/ml 3H-thymidine were harvested, and their 3H-thymidine incorporation was measured. The bar graph represents the mean ± SD of the percentage of 3H-thymidine incorporation compared with control value (line 1 as 100%) (n = 6). *, P < 0.01, as compared with line 2.

 
Transcriptional suppression of AT1R expression by PPAR-{gamma} ligands
We next studied the effect of PPAR-{gamma} ligands on AT1R gene transcription. As seen in Fig. 4Go, PPAR-{gamma} ligands such as 15dPGJ2 (lines 2–7), troglitazone (lines 8–11), and rosiglitazone (lines 12 and 13) significantly decreased -1969/+104-luc activity in a dose-dependent manner. In contrast, PPAR-{alpha} ligand LTB4 did not affect the transcription (line 14). Interestingly, RXR-{alpha} ligand 9cRA slightly suppressed AT1R gene transcription (line 15). Because endogenous expression of PPAR-{gamma} in rat VSMCs was confirmed by RT-PCR as shown in Fig. 5Go, it is suggested that PPAR-{gamma} ligands suppress AT1R gene expression at a transcriptional level by activating endogenous PPAR-{gamma} in VSMCs.



View larger version (30K):
[in this window]
[in a new window]
 
Figure 4. Effect of PPAR-{gamma} ligands on AT1R gene promoter activity. Rat VSMCs transfected with -1969/+104-luc were treated with indicated concentrations of 15dPGJ2, troglitazone, rosiglitazone, LTB4, or 9cRA for 12 h and harvested for measuring luciferase activities. Line 1, no ligands. Bar graphs represent mean ± SE (%) of luciferase activity (line 1 as 100%) (n = 6). *, P < 0.01 as compared with line 1. **, P < 0.05 as compared with line 1.

 


View larger version (42K):
[in this window]
[in a new window]
 
Figure 5. Expression of PPAR-{gamma} mRNA in VSMCs. Total RNAs extracted from rat VSMCs were subjected to semiquantitative RT-PCR using specific primers for rat PPAR-{gamma} and rat GAPDH. The lower band, indicated by an arrow, is PCR products from rat PPAR-{gamma} mRNA (250 bp), and the upper band indicated by an arrow is PCR products from rat GAPDH mRNA (308 bp). Lane 1, size marker; lane 2, PCR products of rat VSMCs total RNA in the absence of RT (note that no PCR products are observed); lane 3, RT-PCR products of rat VSMCs total RNA.

 
Involvement of PPAR-{gamma} in AT1R gene suppression
PPAR-{gamma} overexpression in VSMCs was performed next. As seen in Fig. 6Go, PPAR-{gamma} overexpression significantly decreased -1969/+104-luc activity in the absence (lines 1 and 2) or the presence of PPAR-{gamma} ligands (lines 6 and 7 for 15dPGJ2 and lines 10, 11, 14, and 15 for troglitazone), whereas RXR-{alpha} overexpression did not affect it (lines 3, 8, 12, and 16). Moreover, overexpression of both factors did not affect the transcriptional suppression brought about by PPAR-{gamma} alone (lines 4, 9, 13, and 17). PPAR-{alpha} overexpression showed no effect (line 5). It is, therefore, indicated that PPAR-{gamma}, but not RXR-{alpha}, is involved in AT1R gene suppression.



View larger version (31K):
[in this window]
[in a new window]
 
Figure 6. Effect of PPAR-{gamma} overexpression on the AT1R gene promoter. Rat VSMCs were transfected with expression plasmid of PPAR-{gamma}1 (lines 2, 7, 11, and 15), PPAR-{alpha} (line 5), RXR-{alpha} (lines 3, 8, 12, and 16), or both (lines 4, 9, 13, and 17) as well as -1969/+104-luc. The transfected cells were treated with 2.5 µM 15dPGJ2 (lines 6–9), 10 µM troglitazone (lines 10–13), or 50 µM troglitazone (lines 14–17) for 12 h. Bar graphs represent mean ± SE (%) of luciferase activity (line 1 as 100%) (n = 6). *, P < 0.01, as compared with line 1; **, P < 0.01, as compared with line 6; ***, P < 0.01, as compared with line 10; ****, P < 0.05, as compared with line 14.

 
A GC-box-related sequence within the -58/-34 region of the AT1R gene promoter responsible for the suppression
The element(s) responsible for the AT1R gene suppression by PPAR-{gamma} ligands were localized next. As shown in Fig. 7AGo, the suppression was observed in all constructs from -1969/+104-luc to -58/+104-luc (lines 1–4 for -1969/+104-luc, lines 5–8 for -987/+104-luc, lines 9–12 for -331/+104-luc, and lines 13–16 for -58/+104-luc). To further localize the element, we next transfected -58/+104-luc, -58/-1-luc, -34/-1-luc, or -1/-34-luc (inverted orientation of -34/-1-luc) into VSMCs and treated them with 15dPGJ2 or troglitazone. As shown in Fig. 7BGo, both PPAR-{gamma} ligands suppressed transcriptional activities of -58/+104-luc (lines 1–4) and -58/-1-luc (lines 5–8), suggesting that the suppression was mediated within the -58/-1 region. In contrast, the transcriptional activity of -34/-1-luc (element between 1-bp upstream of TATA box and the transcription start site) was not suppressed by PPAR-{gamma} ligands (lines 9–12). When -1/-34-luc was transfected, the basal transcriptional level decreased approximately to one fourth of -34/-1-luc (lines 13–15), suggesting that the -34/-1 region functions as the major promoter of the AT1R gene in the right orientation. These data suggest that the region between -58 and -34 (the -58/-34 region) is responsible for the suppression. The -58/-34 region (TGCAGAGCAGCGACGCCCCCTAGGC) is composed of several G and C nucleotides and contains a GC-box-related sequence in the latter half that is supposed to be bound by a Sp-family protein(s). We, therefore, generated mutated -58/-1-luc, whose GC-box-related sequence within the -58/-34 region was abrogated as described in Materials and Methods, and transfected it into VSMCs. The transcriptional activity of mutated -58/-1-luc also was not suppressed by PPAR-{gamma} ligands (lines 16–19). To confirm that the GC-box-related sequence within the -58/-34 region was responsible for the suppression by PPAR-{gamma} ligands, we also generated mutated -1969/+104-luc, whose GC-box-related sequence within the -58/-34 region was abrogated as described in Materials and Methods. As shown in Fig. 7CGo, the transcriptional activity of mutated -1969/+104-luc also was not suppressed by PPAR-{gamma} ligands (lines 5–8). Taken together, it is suggested that the GC-box-related sequence within the -58/-34 region is responsible for the suppression.



View larger version (35K):
[in this window]
[in a new window]
 
Figure 7. Localization of the element(s) responsible for the transcriptional suppression by PPAR-{gamma}. A, Rat VSMCs were transfected with either -1969/+104-luc, -987/+104-luc, -331/+104-luc, or -58/+104-luc. Bar graphs represent mean ± SE (%) of luciferase activity (line 1 as 100%) (n = 6). *, P < 0.01, as compared with line 1; **, P < 0.01, as compared with line 5; ***, P < 0.01, as compared with line 9; ****, P < 0.01, as compared with line 13. B, Rat VSMCs were transfected either with -58/+104-luc, -58/-1-luc, -34/-1-luc, -1/-34-luc, or mutated -58/-1-luc. Bar graphs represent mean ± SE (%) of luciferase activity (line 1 as 100%) (n = 6). Arrows indicate the orientation of the promoter. TATA, TATA box; GC, GC-box-related sequence. *, P < 0.01, as compared with line 1; **, P < 0.01, as compared with line 5. C, Rat VSMCs were transfected with either -1969/+104-luc or mutated -1969/+104-luc. Bar graphs represent mean ± SE (%) of luciferase activity (line 1 as 100%) (n = 6). *, P < 0.01, as compared with line 1. The shaded area in A, B, and C is 5'-UTR. The cells were treated with indicated concentrations of 15dPGJ2 or troglitazone for 12 h.

 
Sp1, but not PPAR-{gamma}, binding to the GC-box-related sequence within the -58/-34 region
By EMSA, we next examined a binding of PPAR-{gamma} to the -58/-34 region of the AT1R gene promoter (Fig. 8AGo). When 32P-labeled HMG-CoA synthase gene PPRE (11) oligonucleotides (positive control) were incubated with in vitro translated PPAR-{gamma}1 and/or RXR-{alpha}, PPAR-{gamma}/RXR-{alpha} heterodimer formation (PPAR-{gamma}/RXR-{alpha} in lane 3, indicated by an arrow) was observed only in the presence of both factors (lanes 1–4). In contrast, the complex was not observed when using 32P-labeled -58/-34 region oligonucleotides (lanes 5–8). It is, therefore, suggested that PPAR-{gamma} cannot bind to the -58/-34 region either as monomer/homodimer or as heterodimer with RXR-{alpha}. We next studied a binding of Sp1 to the -58/-34 region (Fig. 8BGo). When in vitro translated Sp1 was incubated with 32P-labeled -58/-34 region oligonucleotides, formation of a Sp1-DNA complex (Sp1 in lane 3, indicated by an arrow) was observed. When unprogrammed RL that did not contain Sp1 was used, the complex could not be observed (lane 2). In addition, formation of the Sp1-DNA complex was abrogated when the GC-box-related sequence mutated -58/-34 region (described in Materials and Methods) was used as a probe (lane 4). It is, therefore, suggested that the GC-box-related sequence within the -58/-34 region is a Sp1 (Sp-family) binding site.



View larger version (44K):
[in this window]
[in a new window]
 
Figure 8. Interaction between PPAR-{gamma}/Sp1 and the AT1R gene promoter. A, Interaction between PPAR-{gamma} and the AT1R gene promoter. 32P-labeled oligonucleotides containing HMG-CoA synthase gene PPRE (HMGS-PPRE; lanes 1–4) or the -58/-34 region of the AT1R gene promoter (-58/-34; lanes 5–8) were incubated with 2 µl in vitro translated PPAR-{gamma}1 (PPAR-{gamma}; lanes 4 and 8), RXR-{alpha} (RXR-{alpha}; lanes 2 and 6), or both factors (lanes 3 and 7). Total amounts of RL were adjusted to 4 µl by adding 4 µl (lanes 1 and 5) or 2 µl (lanes 2, 4, 6, and 8) unprogrammed RL to each lane. PPAR-{gamma}/RXR-{alpha} heterodimer is indicated by an arrow. B, Interaction between Sp1 and the AT1R gene promoter. 32P-labeled oligonucleotides containing the -58/-34 region of the AT1R gene promoter (-58/-34; lanes 1–3) were incubated with 2 µl unprogrammed RL (RL; lane 2) or 2 µl in vitro translated Sp1 (lane 3). 32P-labeled oligonucleotides containing the mutated GC-box-related sequence in the -58/-34 region (GC Mut) were also incubated with 2 µl in vitro translated Sp1 (lane 4). Sp1-DNA complex is indicated by an arrow (Sp1). The asterisk represents nonspecific binding formed with unprogrammed RL.

 
Binding of Sp1 in VSMCs to the GC-box-related sequence within the -58/-34 region
To identify a possible factor(s) that can bind to the GC-box-related sequence within the -58/-34 region in VSMCs, antibody supershift experiments in EMSA were performed next (Fig. 9Go). When VSMC nuclear extracts were incubated with 32P-labeled oligonucleotides of the -58/-34 region, two protein-DNA complexes were observed (Protein/DNA Complexes with arrows, lane 1). Coincubation with 100-fold excess of the unlabeled -58/-34 region oligonucleotides completely abolished the formation of both complexes (lane 6), suggesting that both complexes were specific for the -58/-34 region. When the GC-box-related sequence mutated -58/-34 region was used as a probe, formation of both complexes was completely abolished (lane 8), suggesting that the GC-box-related sequence was necessary for the protein binding. Moreover, when we coincubated with 100-fold excess of unlabeled oligonucleotides containing the SV40 early promoter Sp1 site (27), which contains consensus GC-boxes, formation of both complexes was also completely abolished (lane 7). These data suggest that the protein-DNA complexes would be composed of a Sp-family protein(s) in VSMCs that could bind to the GC-box-related sequence. We next performed antibody supershift experiments further, to identify a Sp-family protein(s) binding to the GC-box-related sequence. As observed in lane 2, incubation with anti-Sp1 antibody abolished formation of most of both complexes, and induction of a supershifted complex (Supershifted Sp1 with an arrow, Fig. 7Go) was observed. These data suggest that most of both complexes may be composed of the Sp1 protein. Incubation with anti-Sp2 (lane 3) and anti-Sp3 (lane 4) antibodies also decreased the upper complex, to some extent, and induced supershifted complexes (Supershifted Sp2/Sp3 with an arrow, Fig. 7Go). In contrast, incubation with anti-Sp4 antibody did not affect both complexes, and no supershifted complex was observed (lane 5). These data suggest that Sp1 protein is mostly involved in the protein-DNA complexes, and some Sp2 and Sp3 proteins are also possibly involved.



View larger version (54K):
[in this window]
[in a new window]
 
Figure 9. Interaction between VSMC nuclear extracts and the AT1R gene promoter. 32P-labeled oligonucleotides containing the -58/-34 region of the AT1R gene promoter (-58/-34; lanes 1–7) were incubated with 2 µg VSMC nuclear extracts (VSMC NE) and were sequentially incubated with 1 µl anti-Sp1 antibody (lane 2), anti-Sp2 antibody (lane 3), anti-Sp3 antibody (lane 4), or anti-Sp4 antibody (lane 5). Protein-DNA complexes are indicated by arrows (Protein/DNA Complexes). Supershifted bands by anti-Sp1 antibody (lane 2) (Supershifted Sp1), anti-Sp2 antibody (lane 3), or by anti-Sp3 antibody (lane 4) (Supershifted Sp2/Sp3) are also indicated by arrows. 32P-labeled oligonucleotides containing the mutated GC-box-related sequence in the -58/-34 region (GC Mut) were also used (lane 8). Unlabeled oligonucleotides (100-fold excess) containing the -58/-34 region (-58/-34; lane 6) or SV40 early promoter Sp1 site (Sp1; lane 7) were used for competition.

 
Functional antagonism of PPAR-{gamma} against Sp1
The functional interaction between Sp1 and PPAR-{gamma} on the -58/-34 region was examined next. As shown in Fig. 10Go, overexpression of Sp1 significantly increased -58/-1-luc activity (lines 1 and 2) whereas -34/-1-luc (lines 6 and 7) and mutated -58/-1-luc (lines 9 and 10) activities were not affected. These data suggest that Sp1 can transactivate the -58/-34 region most likely via the GC-box-related sequence. When we overexpressed PPAR-{gamma} in the presence of Sp1, -58/-1-luc activity was significantly decreased (line 3), whereas -34/-1-luc (line 8) and mutated -58/-1-luc (line 11) activities were not affected. In addition, the decrease of -58/-1-luc activity by PPAR-{gamma} overexpression was further augmented by the addition of PPAR-{gamma} ligands 15dPGJ2 (line 4) or troglitazone (line 5). These data suggest that activated PPAR-{gamma} can functionally antagonize against Sp1 via the GC-box-related sequence within the -58/-34 region.



View larger version (22K):
[in this window]
[in a new window]
 
Figure 10. Effect of Sp1 and PPAR-{gamma} overexpression on the AT1R gene promoter. Rat VSMCs were transfected with expression plasmid of Sp1 alone (lines 2, 7, and 10) or Sp1 plus PPAR-{gamma}1 (lines 3–5, 8, and 11) with either -58/-1-luc (lines 1–5), -34/-1-luc (lines 6–8), or mutated -58/-1-luc (lines 9–11). In some experiments, the cells were treated with 2.5 µM 15dPGJ2 (line 4) or 10 µM troglitazone (line 5). Bar graphs represent mean ± SE (%) of luciferase activity (line 1 as 100%) (n = 6). TATA, TATA box; GC, GC-box-related sequence. *, P < 0.01, as compared with line 1; **, P < 0.05, as compared with line 2; ***, P < 0.01, as compared with line 2.

 
Inhibition of Sp1 binding to the GC-box-related sequence within the -58/-34 region by PPAR-{gamma}
We next examined the effect of PPAR-{gamma} on Sp1 binding to the GC-box-related sequence within the -58/-34 region. As shown in Fig. 11Go, incubation of VSMC nuclear extracts with the -58/-34 region probe could form protein-DNA complexes mostly composed of Sp1 as shown in Fig. 9Go (Protein/DNA Complexes with arrows, lane 1). When 2 µl in vitro translated PPAR-{gamma} was coincubated in the reaction, formation of the protein-DNA complexes was significantly inhibited (lane 2). When the same amounts of in vitro translated RXR-{alpha} was used instead of PPAR-{gamma}, the inhibition was not observed (lane 3), suggesting that the effect was PPAR-{gamma} specific. The addition of both factors did not affect the Sp1 binding inhibition brought about by PPAR-{gamma} alone (lane 4). Similar observations were obtained when we used in vitro translated Sp1 (data not shown). These data suggest that PPAR-{gamma} can specifically inhibit Sp1 binding to the GC-box-related sequence within the -58/-34 region, and the binding inhibition may contribute to the functional antagonism of PPAR-{gamma} against Sp1 (Fig. 10Go).



View larger version (34K):
[in this window]
[in a new window]
 
Figure 11. Effect of PPAR-{gamma} on Sp1 binding to the AT1R gene promoter. 32P-labeled oligonucleotides containing the -58/-34 region of the AT1R gene promoter (-58/-34; lanes 1–4) were incubated with 2 µg VSMC nuclear extracts (VSMC NE) in the absence (lane 1) or presence of 2 µl in vitro translated PPAR-{gamma}1 (PPAR-{gamma}; lane 2), RXR-{alpha} (RXR-{alpha}; lane 3), or both factors (lane 4). Total amounts of RL were adjusted to 4 µl by adding 4 µl (lane 1) or 2 µl (lanes 2 and 3) unprogrammed RL to each lane. Protein-DNA complexes are indicated by arrows (Protein/DNA Complexes).

 
Direct protein-protein interaction between PPAR-{gamma} and Sp1
We next performed GST pull-down assay to study direct protein-protein interaction between PPAR-{gamma} and Sp1. As observed in Fig. 12Go, when GST alone was incubated with in vitro translated 35S-labeled Sp1, no interaction between GST and Sp1 was observed (lane 2). However, when GST-PPAR-{gamma} fusion protein was incubated with 35S-labeled Sp1, a direct protein-protein interaction between PPAR-{gamma} and Sp1 was observed (lane 3), and the interaction was enhanced approximately to 1.5-fold by incubation with 50 µM troglitazone (lane 4). These results suggest that PPAR-{gamma} can physically interact with Sp1 and may directly inhibit its function.



View larger version (31K):
[in this window]
[in a new window]
 
Figure 12. Protein-protein interaction between PPAR-{gamma} and Sp1. GST pull-down assays using GST alone (lane 2) or GST-PPAR-{gamma} fusion protein (lanes 3 and 4) and in vitro translated 35S-labeled Sp1 (5 µl) were performed. An arrow indicates Sp1. In lane 4, the sample was incubated in the presence of 50 µM troglitazone. Lane 1 represents the 50% volume of in vitro translated 35S-labeled Sp1 used in the assays.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
PPAR-{gamma} ligands such as 15dPGJ2 and thiazolidinediones including troglitazone, rosiglitazone, and pioglitazone significantly decreased AT1R mRNA expression level in VSMCs. In addition, PPAR-{gamma} ligands also decreased AT1R protein expression level and led to inhibition of AII-induced increase of 3H-thymidine incorporation into VSMCs. Because PPAR-{gamma} ligands did not affect AT1R mRNA stability and AT1R gene promoter activity was suppressed by PPAR-{gamma} ligands, it was suggested that AT1R expression suppression was mediated at the gene transcription level. We have also observed that overexpression of PPAR-{gamma} further augmented the transcriptional suppression of the AT1R gene promoter by PPAR-{gamma} ligands, whereas other nuclear receptors including PPAR-{alpha} and RXR-{alpha} showed no effect. Moreover, consistent with the previous report (16, 17), endogenous expression of PPAR-{gamma} in VSMCs was also confirmed. It is, therefore, suggested that the transcriptional suppression of AT1R gene by PPAR-{gamma} ligands was mediated by activated PPAR-{gamma}. These present observations suggest that PPAR-{gamma} activation can cause suppression of AT1R gene expression in VSMCs, resulting in inhibition of AT1R-mediated VSMC proliferation. Different from this genomic effect via PPAR-{gamma}, troglitazone has been shown to inhibit translocation of mitogen-activated protein kinase in VSMCs and inhibit AII-induced cell proliferation and migration (28, 29). Here, AT1R gene expression suppression is suggested to be another effect of PPAR-{gamma} ligands leading to inhibition of vascular AII action.

We identified the element(s) responsible for AT1R gene suppression by activated PPAR-{gamma} within the -58/-1 region, most likely at the -58/-34 region, in the AT1R gene promoter. We, however, did not detect a PPAR-{gamma}/RXR-{alpha} heterodimer complex using the radiolabeled -58/-34 region by EMSA. In addition, PPRE sequence (11) was not observed within the -58/-34 region (7). Thus, AT1R gene suppression by activated PPAR-{gamma} may not be due to a direct interaction between the AT1R gene promoter and PPAR-{gamma}/RXR-{alpha} heterodimer. Consistent with this observation, transcription of inducible nitric oxide synthase, gelatinase B, and scavenger receptor A genes that lack PPREs was shown to be suppressed by activated PPAR-{gamma} (13). A protein-protein interaction has been suggested to be involved in the inhibition of transcriptional activity of activator protein 1, nuclear factor (NF)-{kappa}B, or signal transducers and activation of transcription (13).

A GC-box-related sequence was suggested to be located within the -58/-34 region. By mutation analyses, we have observed that the GC-box-related sequence was responsible for the transcriptional suppression. EMSA had shown that in vitro translated Sp1 could bind to the GC-box-related sequence. Binding of Sp-family proteins, especially Sp1, to the GC-box-related sequence was also shown by antibody supershift experiments using VSMC nuclear extracts. Moreover, overexpression of Sp1 was shown to transactivate the GC-box-related sequence. Taken together, it is suggested that Sp1 binds to and transactivates the GC-box-related sequence within the -58/-34 region in VSMCs. Inhibitory action of PPAR-{gamma} on Sp1-stimulated transactivation at the GC-box-related sequence was also observed. Moreover, Sp1 binding to the GC-box-related sequence was shown to be inhibited by PPAR-{gamma}. It is, therefore, suggested that activated PPAR-{gamma} suppresses Sp1 function most likely by inhibiting Sp1 binding to the GC-box-related sequence. Furthermore, GST pull-down assay showed a direct protein-protein interaction between PPAR-{gamma} and Sp1. It is suggested that a direct binding of PPAR-{gamma} to Sp1 would be involved in the inhibition of transcription of the GC-box-related sequence within the -58/-34 region by Sp1. A similar mechanism of gene transcription inhibition by a direct protein-protein interaction has been suggested in glucocorticoid receptor and NF-{kappa}B interaction (30).

Recently, PPAR-{gamma} has been shown to suppress several genes related to atherogenesis. For instance, in macrophages, activated PPAR-{gamma} inhibited transcription of inducible nitric oxide synthase, gelatinase B, and scavenger receptor A genes (13). Production of inflammatory cytokines was inhibited by PPAR-{gamma} ligands in monocytes (14). We have also observed that activated PPAR-{gamma} suppresses gene transcription of thromboxane synthase in macrophages via an interaction with NF-E2-related factor 2 (31). In VSMCs, matrix metalloproteinase-9 gene suppression by PPAR-{gamma} has been reported (16). In addition, we have shown transcriptional suppression of thromboxane receptor gene by activated PPAR-{gamma} (32). In vascular endothelial cells, troglitazone has been shown to suppress expression of endothelin-1 (33) and plasminogen activator inhibitor type 1 (34). Because activation of these genes, including the AT1R gene, are prone to stimulate atherosclerotic changes, transcriptional suppression of these genes by activated PPAR-{gamma} may exert some antiatherosclerotic effects. In addition to these effects on the transcriptional suppression, troglitazone has been reported to suppress cell proliferation induced by AII (28), platelet-derived growth factor, or basic fibroblast growth factor (35) and cell migration (16) in VSMCs. On the other hand, activated PPAR-{gamma} has also been suggested to promote some atherogenic effects such as oxidized low-density lipoprotein uptake, transactivation of CD36 in macrophages/monocytes, and lipid accumulation in these cells to generate foaming cells (36, 37). Nonetheless, in in vivo studies, neointimal formation following balloon injury was shown to be inhibited by troglitazone (35, 38). In clinical studies, some beneficial effects of troglitazone on hypertension (39), proteinuria (40), and cardiac function (41) have also been reported. It seems that PPAR-{gamma} ligand may have some favorable clinical efficacy in the treatment of cardiovascular diseases, although more studies are required to clarify the underlying molecular mechanisms.

In summary, it is suggested that PPAR-{gamma} activation can inhibit AT1R gene expression at the transcriptional level. PPAR-{gamma} ligands, thus, may inhibit AII-induced cell growth and hypertrophy in VSMCs by AT1R expression suppression and may possibly be beneficial for treatment of diabetic patients to avoid cardiovascular complications.


    Footnotes
 
1 Supported in part by Grants-in-Aid from the Ministry of Education, Science and Culture, Japan (09671018 to A.S.; 09470236 to K.T.), Kanae Foundation for Life and Socio-Medical Science (to A.S.), Takeda Metabolic Disorder Research Foundation (to K.T.), and Sankyo Co., Ltd., Japan (to K.T.). Back

Received September 29, 2000.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Griendling KK, Ushio-Fukai M, Lassegue B, Alexander RW 1997 Angiotensin II signaling in vascular smooth muscle. New concepts. Hypertension 29:366–373[Abstract/Free Full Text]
  2. Berk BC 1999 Angiotensin II signal transduction in vascular smooth muscle: pathways activated by specific tyrosine kinases. J Am Soc Nephrol 10(Suppl 11):S62–S68
  3. Paradis P, Dali-Youcef N, Paradis FW, Thibault G, Nemer M 2000 Overexpression of angiotensin II type I receptor in cardiomyocytes induces cardiac hypertrophy and remodeling. Proc Natl Acad Sci USA 97:931–936[Abstract/Free Full Text]
  4. Nataraj C, Oliverio MI, Mannon RB, Mannon PJ, Audoly LP, Amuchastegui CS, Ruiz P, Smithies O, Coffman TM 1999 Angiotensin II regulates cellular immune responses through a calcineurin-dependent pathway. J Clin Invest 104:1693–1701[Medline]
  5. Murphy TJ, Takeuchi K, Alexander RW 1992 Molecular biology of vascular type-1 angiotensin II receptor. Am J Hypertens 5:236S–242S
  6. Timmermans PB 1999 Angiotensin II receptor antagonists: an emerging new class of cardiovascular therapeutics Hypertens Res 22: 147–153
  7. Takeuchi K, Alexander RW, Nakamura Y, Tsujino T, Murphy TJ 1993 Molecular structure and transcriptional function of the rat vascular AT1a angiotensin receptor gene. Circ Res 73:612–621[Abstract/Free Full Text]
  8. Ikeda Y, Takeuchi K, Kato T, Taniyama Y, Sato K, Takahashi N, Sugawara A, Ito S 1999 Transcriptional suppression of rat angiotensin AT1a receptor gene expression by interferon-gamma in vascular smooth muscle cells. Biochem Biophys Res Commun 262:494–498[CrossRef][Medline]
  9. Forman BM, Tontonoz P, Chen J, Brun RP, Spiegelman BM, Evans RM 1995 15-Deoxy-{Delta} 12, 14-prostaglandin J2 is a ligand for the adipocyte determination factor PPAR {gamma}. Cell 83:803–812[CrossRef][Medline]
  10. Lehmann JM, Moore LB, Smith-Oliver TA, Wilkison WO, Willson TM, Kliewer SA 1995 An antidiabetic thiazolidinedione is a high affinity ligand for peroxisome proliferator-activated receptor {gamma} (PPAR {gamma}). J Biol Chem 270:12953–12956[Abstract/Free Full Text]
  11. Juge-Aubry C, Pernin A, Favez T, Burger AG, Wahli W, Meier CA, Desvergne B 1997 DNA binding properties of peroxisome proliferator-activated receptor subtypes on various natural peroxisome proliferator response elements. Importance of the 5'-flanking region. J Biol Chem 272:25252–25259[Abstract/Free Full Text]
  12. Spiegelman BM 1998 PPAR-{gamma}: adipogenic regulator and thiazolidinedione receptor. Diabetes 47:507–514[Abstract]
  13. Ricote M, Li AC, Willson TM, Kelly CJ, Glass CK 1998 The peroxisome proliferator-activated receptor-{gamma} is a negative regulator of macrophage activation. Nature 391:79–82[CrossRef][Medline]
  14. Jiang C, Ting AT, Seed B 1998 PPAR-{gamma} agonists inhibit production of monocyte inflammatory cytokines. Nature 391:82–86[CrossRef][Medline]
  15. Ross R 1999 Atherosclerosis—an inflammatory disease. N Engl J Med 340:115–126[Free Full Text]
  16. Marx N, Schonbeck U, Lazar MA, Libby P, Plutzky J 1998 Peroxisome proliferator-activated receptor {gamma} activators inhibit gene expression and migration in human vascular smooth muscle cells. Circ Res 83:1097–1103[Abstract/Free Full Text]
  17. Iijima K, Yoshizumi M, Ako J, Eto M, Kim S, Hashimoto M, Sugimoto N, Liang YQ, Sudoh N, Toba K, Ouchi Y 1998 Expression of peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}) in rat aortic smooth muscle cells. Biochem Biophys Res Commun 247:353–356[CrossRef][Medline]
  18. Kliewer SA, Forman BM, Blumberg B, Ong ES, Borgmeyer U, Mangelsdorf DJ, Umesono K, Evans RM 1994 Differential expression and activation of a family of murine peroxisome proliferator-activated receptors. Proc Natl Acad Sci USA 91:7355–7359[Abstract/Free Full Text]
  19. Mangelsdorf DJ, Borgmeyer U, Heyman RA, Zhou JY, Ong ES, Oro AE, Kakizuka A, Evans RM 1992 Characterization of three RXR genes that mediate the action of 9-cis retinoic acid. Genes Dev 6:329–344[Abstract/Free Full Text]
  20. Kobayashi A, Sogawa K, Fujii-Kuriyama Y 1996 Cooperative interaction between AhR.Arnt and Sp1 for the drug-inducible expression of CYP1A1 gene. J Biol Chem 271:12310–12316[Abstract/Free Full Text]
  21. Sugawara A, Sanno N, Takahashi N, Osamura RY, Abe K 1997 Retinoid X receptors in the kidney: their protein expression and functional significance. Endocrinology 138:3175–3180[Abstract/Free Full Text]
  22. Murphy TJ, Alexander RW, Griendling KK, Runge MS, Bernstein KE 1991 Isolation of a cDNA encoding the vascular type-1 angiotensin II receptor. Nature 351:233–236[CrossRef][Medline]
  23. Park KS, Ciaraldi TP, Abrams-Carter L, Mudaliar S, Nikoulina SE, Henry RR 1997 PPAR-{gamma} gene expression is elevated in skeletal muscle of obese and type II diabetic subjects. Diabetes 46:1230–1234[Abstract]
  24. Takahashi N, Takeuchi K, Sugawara A, Taniyama Y, Kato T, Wilcox CS, Abe K, Ito S 1998 Structure and transcriptional function of the 5'-flanking region of rat thromboxane receptor gene. Biochem Biophys Res Commun 244:489–493[CrossRef][Medline]
  25. Wang ZQ, Moore AF, Ozono R, Siragy HM, Carey RM 1998 Immunolocalization of subtype 2 angiotensin II (AT2) receptor protein in rat heart. Hypertension 32:78–83[Abstract/Free Full Text]
  26. Sugawara A, Yen PM, Qi Y, Lechan RM, Chin WW 1995 Isoform-specific retinoid-X receptor (RXR) antibodies detect differential expression of RXR proteins in the pituitary gland. Endocrinology 136:1766–1774[Abstract]
  27. Dynan WS, Tjian R 1983 The promoter-specific transcription factor Sp1 binds to upstream sequences in the SV40 early promoter. Cell 35:79–87[CrossRef][Medline]
  28. Graf K, Xi XP, Hsueh WA, Law RE 1997 Troglitazone inhibits angiotensin II-induced DNA synthesis and migration in vascular smooth muscle cells. FEBS Lett 400:119–121[CrossRef][Medline]
  29. Goetze S, Xi XP, Graf K, Fleck E, Hsueh WA, Law RE 1999 Troglitazone inhibits angiotensin II-induced extracellular signal-regulated kinase 1/2 nuclear translocation and activation in vascular smooth muscle cells. FEBS Lett 452:277–282[CrossRef][Medline]
  30. Scheinman RI, Gualberto A, Jewell CM, Cidlowski JA, Baldwin AS Jr 1995 Characterization of mechanisms involved in transrepression of NF-{kappa}B by activated glucocorticoid receptors. Mol Cell Biol 15:943–953[Abstract]
  31. Ikeda Y, Sugawara A, Taniyama Y, Uruno A, Igarashi K, Arima S, Ito S, Takeuchi K 2000 Suppression of rat thromboxane synthase gene transcription by peroxiosme proliferator-activated receptor in macrophages via an interaction with NF-E2 related factor 2. J Biol Chem 275:33142–33150[Abstract/Free Full Text]
  32. Sugawara A, Takeuchi K, Uruno A, Kudo M, Taniyama Y, Ikeda Y, Kato T, Takahashi N, Ito S 1998 Negative regulation of rat thromboxane receptor gene by 15-deoxy-{Delta}12, 14-PGJ2 and troglitazone by activating PPAR-{gamma} in vascular smooth muscle cells. J Am Soc Nephrol 9:358A (Abstract)
  33. Satoh H, Tsukamoto K, Hashimoto Y, Hashimoto N, Togo M, Hara M, Maekawa H, Isoo N, Kimura S, Watanabe T 1999 Thiazolidinediones suppress endothelin-1 secretion from bovine vascular endothelial cells: a new possible role of PPAR{gamma} on vascular endothelial function. Biochem Biophys Res Commun 254:757–763[CrossRef][Medline]
  34. Kato K, Satoh H, Endo Y, Yamada D, Midorikawa S, Sato W, Mizuno K, Fujita T, Tsukamoto K, Watanabe T 1999 Thiazolidinediones down-regulate plasminogen activator inhibitor type 1 expression in human endothelial cells: a possible role of PPAR{gamma} in endothelial function. Biochem Biophys Res Commun 258:431–435[CrossRef][Medline]
  35. Law RE, Meehan WP, Xi XP, Graf K, Wuthrich DA, Coats W, Faxon D, Hsueh WA 1996 Troglitazone inhibits vascular smooth muscle cell growth and intimal hyperplasia. J Clin Invest 98:1897–1905[Medline]
  36. Tontonoz P, Nagy L, Alvarez JG, Thomazy VA, Evans RM 1998 PPAR{gamma} promotes monocyte/macrophage differentiation and uptake of oxidized LDL. Cell 93:241–252[CrossRef][Medline]
  37. Nagy L, Tontonoz P, Alvarez JG, Chen H, Evans RM 1998 Oxidized LDL regulates macrophage gene expression through ligand activation of PPAR{gamma}. Cell 93:229–240[CrossRef][Medline]
  38. Shinohara E, Kihara S, Ouchi N, Funahashi T, Nakamura T, Yamashita S, Kameda-Takemura K, Matsuzawa Y 1998 Troglitazone suppresses intimal formation following balloon injury in insulin-resistant Zucker fatty rats. Atherosclerosis 136:275–279[CrossRef][Medline]
  39. Ogihara T, Rakugi H, Ikegami H, Mikami H, Masuo K 1995 Enhancement of insulin sensitivity by troglitazone lowers blood pressure in diabetic hypertensives. Am J Hypertens 8:316–320[CrossRef][Medline]
  40. Imano E, Kanda T, Nakatani Y, Nishida T, Arai K, Motomura M, Kajimoto Y, Yamasaki Y, Hori M 1988 Effect of troglitazone on microalbuminuria in patients with incipient diabetic nephropathy. Diabetes Care 21:2135–2139[Abstract]
  41. Ghazzi MN, Perez JE, Antonucci TK, Driscoll JH, Huang SM, Faja BW, Whitcomb RW 1997 Cardiac and glycemic benefits of troglitazone treatment in NIDDM. The Troglitazone Study Group. Diabetes 46:433–439[Abstract]



This article has been cited by other articles:


Home page
Nephrol Dial TransplantHome page
J. Xiao, J. C. K. Leung, L. Y. Y. Chan, H. Guo, and K. N. Lai
Protective effect of peroxisome proliferator-activated receptor-gamma agonists on activated renal proximal tubular epithelial cells in IgA nephropathy
Nephrol. Dial. Transplant., July 1, 2009; 24(7): 2067 - 2077.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
K. K. Koh, P. C. Oh, and M. J. Quon
Does reversal of oxidative stress and inflammation provide vascular protection?
Cardiovasc Res, March 1, 2009; 81(4): 649 - 659.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. M. Necela, W. Su, and E. A. Thompson
Peroxisome Proliferator-activated Receptor {gamma} Down-regulates Follistatin in Intestinal Epithelial Cells through SP1
J. Biol. Chem., October 31, 2008; 283(44): 29784 - 29794.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
K. K. Koh and M. J. Quon
Combination Therapy for Treatment or Prevention of Atherosclerosis
Hypertension, August 1, 2008; 52(2): e18 - e18.
[Full Text] [PDF]


Home page
HypertensionHome page
I. Kuipers, P. van der Harst, G. Navis, L. van Genne, F. Morello, W. H. van Gilst, D. J. van Veldhuisen, and R. A. de Boer
Nuclear Hormone Receptors as Regulators of the Renin-Angiotensin-Aldosterone System
Hypertension, June 1, 2008; 51(6): 1442 - 1448.
[Full Text] [PDF]


Home page
HypertensionHome page
I. Imayama, T. Ichiki, D. Patton, K. Inanaga, R. Miyazaki, H. Ohtsubo, Q. Tian, K. Yano, and K. Sunagawa
Liver X Receptor Activator Downregulates Angiotensin II Type 1 Receptor Expression Through Dephosphorylation of Sp1
Hypertension, June 1, 2008; 51(6): 1631 - 1636.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
A. M. Beyer, G. L. Baumbach, C. M. Halabi, M. L. Modrick, C. M. Lynch, T. D. Gerhold, S. M. Ghoneim, W. J. de Lange, H. L. Keen, Y.-S. Tsai, et al.
Interference With PPAR{gamma} Signaling Causes Cerebral Vascular Dysfunction, Hypertrophy, and Remodeling
Hypertension, April 1, 2008; 51(4): 867 - 871.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
Z.-G. Xu, H. Yuan, L. Lanting, S.-L. Li, M. Wang, N. Shanmugam, M. Kato, S. G. Adler, M. A. Reddy, and R. Natarajan
Products of 12/15-Lipoxygenase Upregulate the Angiotensin II Receptor
J. Am. Soc. Nephrol., March 1, 2008; 19(3): 559 - 569.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
E. T. Weatherford, H. Itani, H. L. Keen, and C. D. Sigmund
Is Peroxisome Proliferator-Activated Receptor-{gamma} a New "Pal" of Renin?
Hypertension, November 1, 2007; 50(5): 844 - 846.
[Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
Z. Yousefipour, H. Hercule, L. Truong, A. Oyekan, and M. Newaz
Ciglitazone, a Peroxisome Proliferator-Activated Receptor {gamma} Inducer, Ameliorates Renal Preglomerular Production and Activity of Angiotensin II and Thromboxane A2 in Glycerol-Induced Acute Renal Failure
J. Pharmacol. Exp. Ther., August 1, 2007; 322(2): 461 - 468.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
T. S. Elton and M. M. Martin
Angiotensin II Type 1 Receptor Gene Regulation: Transcriptional and Posttranscriptional Mechanisms
Hypertension, May 1, 2007; 49(5): 953 - 961.
[Full Text] [PDF]


Home page
Cardiovasc ResHome page
I. Imayama, T. Ichiki, K. Inanaga, H. Ohtsubo, K. Fukuyama, H. Ono, Y. Hashiguchi, and K. Sunagawa
Telmisartan downregulates angiotensin II type 1 receptor through activation of peroxisome proliferator-activated receptor {gamma}
Cardiovasc Res, October 1, 2006; 72(1): 184 - 190.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
O. A. Gudbrandsen, M. Hultstrom, S. Leh, L. Monica Bivol, O. Vagnes, R. K. Berge, and B. M. Iversen
Prevention of Hypertension and Organ Damage in 2-Kidney, 1-Clip Rats by Tetradecylthioacetic Acid
Hypertension, September 1, 2006; 48(3): 460 - 466.
[Abstract] [Full Text] [PDF]


Home page
Diabetes CareHome page
K. K. Koh, M. J. Quon, S. H. Han, W.-J. Chung, J. Y. Ahn, J.-a Kim, Y. Lee, and E. K. Shin
Additive Beneficial Effects of Fenofibrate Combined With Candesartan in the Treatment of Hypertriglyceridemic Hypertensive Patients
Diabetes Care, February 1, 2006; 29(2): 195 - 201.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
T. Deng, S. Shan, P.-P. Li, Z.-F. Shen, X.-P. Lu, J. Cheng, and Z.-Q. Ning
Peroxisome Proliferator-Activated Receptor-{gamma} Transcriptionally Up-Regulates Hormone-Sensitive Lipase via the Involvement of Specificity Protein-1
Endocrinology, February 1, 2006; 147(2): 875 - 884.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
K. Benkirane, E. C. Viel, F. Amiri, and E. L. Schiffrin
Peroxisome Proliferator-Activated Receptor {gamma} Regulates Angiotensin II-Stimulated Phosphatidylinositol 3-Kinase and Mitogen-Activated Protein Kinase in Blood Vessels In Vivo
Hypertension, January 1, 2006; 47(1): 102 - 108.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
M. Houston, M. A. Julien, S. Parthasarathy, and E. L. Chaikof
Oxidized linoleic acid regulates expression and shedding of syndecan-4
Am J Physiol Cell Physiol, February 1, 2005; 288(2): C458 - C466.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
M. Kudo, A. Sugawara, A. Uruno, K. Takeuchi, and S. Ito
Transcription Suppression of Peroxisome Proliferator-Activated Receptor {gamma}2 Gene Expression by Tumor Necrosis Factor {alpha} via an Inhibition of CCAAT/ Enhancer-binding Protein {delta} during the Early Stage of Adipocyte Differentiation
Endocrinology, November 1, 2004; 145(11): 4948 - 4956.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
S. Wakino, K. Hayashi, T. Kanda, S. Tatematsu, K. Homma, K. Yoshioka, I. Takamatsu, and T. Saruta
Peroxisome Proliferator-Activated Receptor {gamma} Ligands Inhibit Rho/Rho Kinase Pathway by Inducing Protein Tyrosine Phosphatase SHP-2
Circ. Res., September 3, 2004; 95(5): e45 - e55.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
Y. Sassa, Y. Hata, L. P. Aiello, Y. Taniguchi, K. Kohno, and T. Ishibashi
Bifunctional Properties of Peroxisome Proliferator-Activated Receptor {gamma}1 in KDR Gene Regulation Mediated via Interaction With Both Sp1 and Sp3
Diabetes, May 1, 2004; 53(5): 1222 - 1229.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
W. A. Hsueh and D. Bruemmer
Peroxisome Proliferator-Activated Receptor {gamma}: Implications for Cardiovascular Disease
Hypertension, February 1, 2004; 43(2): 297 - 305.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
C.-H. Wang, R. D. Weisel, P. P. Liu, P. W.M. Fedak, and S. Verma
Glitazones and Heart Failure: Critical Appraisal for the Clinician
Circulation, March 18, 2003; 107(10): 1350 - 1354.
[Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Fu, J. Zhang, Y. Lin, X. Zhu, M. U. Ehrengruber, and Y. E. Chen
Early Growth Response Factor-1 Is a Critical Transcriptional Mediator of Peroxisome Proliferator-activated Receptor-gamma 1 Gene Expression in Human Aortic Smooth Muscle Cells
J. Biol. Chem., July 19, 2002; 277(30): 26808 - 26814.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
Q. N. Diep, M. El Mabrouk, J. S. Cohn, D. Endemann, F. Amiri, A. Virdis, M. F. Neves, and E. L. Schiffrin
Structure, Endothelial Function, Cell Growth, and Inflammation in Blood Vessels of Angiotensin II-Infused Rats: Role of Peroxisome Proliferator-Activated Receptor-{gamma}
Circulation, May 14, 2002; 105(19): 2296 - 2302.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. M. Hayes, B. R. Lane, S. R. King, D. M. Markovitz, and M. J. Coffey
Peroxisome Proliferator-activated Receptor gamma Agonists Inhibit HIV-1 Replication in Macrophages by Transcriptional and Post-transcriptional Effects
J. Biol. Chem., May 3, 2002; 277(19): 16913 - 16919.
[Abstract] [Full Text] [PDF]


Home page
J CARDIOVASC PHARMACOL THERHome page
B. Molavi, N. Rasouli, and J. L. Mehta
Peroxisome Proliferator-Activated Receptor Ligands as Antiatherogenic Agents: Panacea or Another Pandora's Box?
Journal of Cardiovascular Pharmacology and Therapeutics, March 1, 2002; 7(1): 1 - 8.
[Abstract] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sugawara, A.
Right arrow Articles by Ito, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sugawara, A.
Right arrow Articles by Ito, S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals