| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
in Vascular Smooth Muscle Cells1
Division of Nephrology, Endocrinology, and Vascular Medicine, Department of Medicine, Tohoku University Graduate School of Medicine, Sendai 980-8574, Japan
Address all correspondence and requests for reprints to: Dr. Akira Sugawara, Molecular Biology Unit, Division of Nephrology, Endocrinology, and Vascular Medicine, Department of Medicine, Tohoku University Graduate School of Medicine, 1-1 Seiryo-cho, Aoba-ku, Sendai 980-8574 Japan. E-mail: akiras2i{at}mail.cc.tohoku.ac.jp
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
12,14-prostaglandin J2
and thiazolidinediones have been shown to be ligands for peroxisome
proliferator-activated receptor (PPAR)-
and activate PPAR-. In
the present work, we have studied the effect of PPAR- on AT1R
expression in rat vascular smooth muscle cells (VSMCs). We observed
that: 1) endogenous AT1R expression was significantly decreased by
PPAR- ligands both at messenger RNA and protein levels, whereas AT1R
messenger RNA stability was not affected; 2) AII-induced increase of
3H-thymidine incorporation into VSMCs was inhibited by
PPAR- ligands; 3) rat AT1R gene promoter activity was significantly
suppressed by PPAR- ligands, and PPAR- overexpression further
suppressed the promoter activity; 4) transcriptional analyses using
AT1R gene promoter mutants revealed that a GC-box-related sequence
within the -58/-34 region of the AT1R gene promoter was responsible
for the suppression; 5) Sp1 overexpression stimulated AT1R gene
transcription via the GC-box-related sequence, which was inhibited by
additional PPAR- overexpression; 6) electrophoretic mobility shift
assay suggested that Sp1 could bind to the GC-box-related sequence
whereas PPAR- could not; 7) antibody supershift experiments using
VSMC nuclear extracts revealed that protein-DNA complexes formed on the
GC-box-related sequence, which were decreased by PPAR- coincubation,
were mostly composed of Sp1; and 8) glutathione S-transferase pull-down
assay revealed a direct interaction between PPAR- and Sp1. Taken
together, it is suggested that activated PPAR- suppresses AT1R gene
at a transcriptional level by inhibiting Sp1 via a protein-protein
interaction. PPAR- ligands, thus, may inhibit AII-induced cell
growth and hypertrophy in VSMCs by AT1R expression suppression and
possibly be beneficial for treatment of diabetic patients with
hypertension and atherosclerosis. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Recently, 15-deoxy- 12,
14-prostaglandin (PG) J2
(15dPGJ2) as well as insulin-sensitizing
thiazolidinediones, including troglitazone and
rosiglitazone, have been known to activate peroxisome
proliferator-activated receptor (PPAR)- as its ligands (9, 10). PPAR- is a nuclear hormone receptor that binds to
PPAR-response element (PPRE) composed of direct repeat of AGGTCA gapped
by one nucleotide (DR1) as a heterodimer with retinoid X receptor
(RXR)-
, and induces ligand-dependent transactivation
(11). In adipocytes, ligand-activated PPAR- is well
known to transactivate adipocyte-specific genes and induce adipocyte
differentiation (12). Recently, however, expression and
function of PPAR- in other cells, especially in the vasculature,
have been more focused with reference to atherosclerosis. For example,
it has recently been reported that PPAR- inhibits macrophage
activation and may lead to inhibition of the progression of
atherosclerosis (13, 14).
VSMC is one of the major organs involved in the etiology of
atherosclerosis (15). Although the expression of PPAR-
in VSMCs has recently been reported (16, 17), the role of
PPAR- in gene transcription in VSMCs has not yet been fully studied.
In the present study, we examined the effect of PPAR- activation on
AT1R expression in VSMCs and observed that activated PPAR- could
suppress AT1R expression at a transcriptional level. We also observed
that the transcriptional suppression was mediated at a GC-box-
related sequence within the -58/-34 region of the AT1R gene
promoter possibly via a protein-protein interaction between PPAR-
and Sp1.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
1 and PPAR- expression plasmids in pCMX
(18) were kindly provided by Dr. K. Umesono (Kyoto
University, Kyoto, Japan). Mouse RXR- in pBSK (19)
(kindly provided by Dr. R. M. Evans, The Salk Institute, San
Diego, CA) was subcloned into pcDNA1/AMP in the right orientation.
Full-length mouse PPAR-1 cDNA was subcloned into the pGEX-4T-2
vector (Amersham Pharmacia Biotech,
Buckinghamshire, UK) in the right orientation (designated as
pGEX-PPAR-). Sp1 in pCMSV (20) was kindly provided by
Dr. Y. Fujii (Tohoku University, Sendai, Japan).
Cell culture
Rat VSMCs, which were isolated from male Sprague Dawley rat
thoracic aortas, were gifted from Dr. K. K. Griendling (Emory
University, Atlanta, GA) and maintained as described previously
(7). Passages between 7 and 15 were used for the following
experiments.
RNA preparation/Northern blot analysis/RT-PCR
When rat VSMCs became 70% confluent, media were changed
to DMEM with 1% resin and charcoal-treated calf serum (stripped
medium) (21) and were incubated for 5–6 h. The cells then
were incubated either with or without 15dPGJ2 (1
or 2.5 µM; Cayman Chemical, Ann Arbor, MI),
troglitazone (10 or 50 µM; kindly provided
by Sankyo Co., Ltd., Tokyo, Japan), rosiglitazone (10 or
50 µM; kindly provided by Sankyo Co., Ltd.),
or pioglitazone (10 or 50 µM; kindly
provided by Takeda Chemical Industries Co., Ltd., Osaka,
Japan) for additional 12 h. Their total RNAs were then extracted
using RNeasy mini kit (QIAGEN, Hilden, Germany).
Ten micrograms of isolated total RNA were subjected to electrophoresis
in 1% agarose-formaldehyde gels, transferred to nylon membrane
(Hybond-N; Amersham Pharmacia Biotech), and the blot
was hybridized with 32P-labeled AT1R cDNA probe
as described previously (22). Intensity of the blot was
calculated using Luminous Imager (AI-C) (Aichi, Japan) and all
values were normalized to the densities of ethidium bromide staining of
28S ribosomal RNA (rRNA). For determination of AT1R messenger RNA
(mRNA) stability, rat VSMCs preincubated either in the presence or
absence of 15dPGJ2 (1 µM) or
troglitazone (10 µM) for 12 h were
coincubated with 5 µg/ml actinomycin D (Nacalai Tesque, Osaka, Japan)
for an additional 4 or 8 h before harvesting. For confirmation of
PPAR- expression in rat VSMCs, 1 µg isolated total RNA was
subjected to RT-PCR using specific primers either for rat PPAR- (a
forward primer: 5'-GTTCATGCTTGTGAAGGATGC-3'; a reverse
primer 5'-ACTCTGGATTCAGCTGGTCG-3') (23) or rat
glyceraldehyde-3-phosphate-dehydrogenase (GAPDH) (a forward primer:
5'-TCCCTCAAGATTGTCAGCAA-3'; a reverse primer
5'-AGATCCACAACGGATACATT-3') (24) at the following
conditions: 50 C, 30 min and 94 C, 2 min for RT; 94 C, 30 sec; 60 C, 30
sec; 72 C, 1 min, for 40 cycles. RT-PCR of both GAPDH and PPAR-
mRNAs was performed simultaneously.
Western immunoblot analysis
Membrane proteins of rat VSMCs grown and treated with PPAR-
ligands (2.5 µM 15dPGJ2, 50
µM troglitazone, or 50 µM
rosiglitazone) in the above conditions were extracted as described
previously (25). Twenty micrograms of the proteins were
subjected to SDS-PAGE (9% acrylamide gel). After SDS-PAGE, proteins
were transferred to polyvinylidene difluoride (Immobilon P;
Millipore Corp., Bedford, MA) and were subjected to
immunoblot analysis using rabbit polyclonal anti-AT1R (N-10) antibody
(Santa Cruz Biotechnology, Inc., Santa Cruz, CA) as
described previously (21). The intensity of the blot was
calculated using Luminous Imager (AI-C).
Luciferase reporter gene assay
When rat VSMCs became 70% confluent, media were changed to
stripped medium and were incubated for 5–6 h. Then, the transfection
using lipofectin was performed according to the manufacturer’s
instructions (GIBCO BRL, Rockville, MD). Briefly,
1.2 µg reporter plasmid and 0.8 µg ß-galactosidase control
plasmid in pCMV (CLONTECH Laboratories, Inc., Palo Alto,
CA) were mixed with 6 µl lipofectin per 3.5-cm plate. In some
experiments, 1 µg PPAR-1, PPAR-, RXR-, and/or Sp1 expression
plasmids were cotransfected. Twelve hours after transfection, media
were changed to stripped medium and the cells were incubated for an
additional 12 h. The cells were then incubated either with or
without several concentrations of 15dPGJ2,
troglitazone, or rosiglitazone for 12 h. In some
experiments, the cells were incubated either with 1 µM
9-cis retinoic acid (9cRA) or 1 µM
leukotriene (LT) B4 (Cayman Chemical) for 12
h. After harvesting, the cell extracts were analyzed for both
luciferase and ß-galactosidase activities (21).
Transfection efficiency was normalized by the ß-galactosidase
expression.
3H-thymidine incorporation
When rat VSMCs became 70% confluent, media were changed to
serum-free MEM and incubated for 2 days. Then, the cells were incubated
in the presence or absence of 1 µM AII
(Sigma, St. Louis, MO), AII plus 1 µM
AT1R antagonist candesartan (kindly provided by Takeda Chemical Industries Co., Ltd.), 1 µM
15dPGJ2, or 10 µM
troglitazone for 12 h with 1 µCi/ml
3H-thymidine (Amersham Pharmacia Biotech) in serum-free MEM. The cells were washed twice with
ice-cold PBS, incubated with 500 µl 5% trichloroacetic acid for 30
min at 4 C, washed twice with 1 ml 5% trichloroacetic acid, and
incubated with 400 µl 1 N NaOH for 20 min at room temperature. After
neutralization with 400 µl 1 N HCl, the cell extracts were put into
vials with 5 ml scintillation solution and counted in a
ß-counter.
Electrophoretic mobility shift assay (EMSA)
In vitro transcription/translation of mouse
PPAR-1, RXR-, and Sp1 cDNA clones was performed using TNT
kits (Promega Corp., Madison, WI). Unprogrammed
reticulocyte lysate (RL) was also generated simultaneously. EMSA was
performed as described previously (21). Briefly,
32P-labeled double-stranded oligonucleotides
containing either HMG-CoA synthase gene PPRE (-111/-85;
TGTTCTGAGACCTTTGGCCCAGTTTTT) (11), the -58/-34 region
(TGCAGAGCAGCGACGCCCCCTAGGC) of the AT1R gene promoter (7),
or the GC-box-related sequence mutated -58/-34 region probe
(TGCAGAGCAGCGACG- TTTTTTAGGC; mutated sites are
underlined) were incubated with either 2 µl in
vitro translated Sp1, PPAR-1, and/or RXR- for 30 min at room
temperature and were subjected to electrophoresis on 4% polyacrylamide
gels. In some experiments, rat VSMCs nuclear extracts (2 µg) prepared
as previously described (26) were incubated either in the
presence or absence of 2 µl in vitro translated PPAR-1
and/or RXR-.
Antibody supershift experiments
After a 30-min incubation of rat VSMC nuclear extracts (2 µg)
with either the -58/-34 region probe or the GC-box-related sequence
mutated -58/-34 region probe, further incubation with 1 µl of
either polyclonal anti-Sp1 antibody (1C6; Santa Cruz Biotechnology, Inc.), anti-Sp2 antibody (K-20; Santa Cruz Biotechnology, Inc.), anti-Sp3 antibody (D-20;
Santa Cruz Biotechnology, Inc.), or anti-Sp4 antibody
(V-20; Santa Cruz Biotechnology, Inc.) at 4 C for 2 h
was performed before electrophoresis as described previously
(26). For competition experiment, 100-fold excess of
unlabeled oligonucleotides for the -58/-34 region or SV40 early
promoter Sp1 site (AGTTAGGGGCGGGATGGGCGGAGTTAG) (27) was
coincubated.
Glutathione S-transferase (GST) pull-down assay
Full-length GST-PPAR- fusion protein was synthesized from
pGEX-PPAR- (described above) by the GST Gene Fusion system
(Amersham Pharmacia Biotech). The protein was loaded onto
glutathione-Sepharose beads, which were washed and resuspended in
binding buffer [20 mM HEPES (pH 7.7), 75 mM
KCl, 0.1 mM EDTA, 2.5 mM
MgCl2, 0.05% Nonidet P-40, 2 mM
dithiothreitol, and 10% glycerol]. The beads were incubated with 5
µl in vitro translated 35S-labeled
Sp1 for 1 h at 4 C, followed by washing five times with binding
buffer in the presence or absence of troglitazone (50
µM). They were then resuspended in 30 µl SDS
sample buffer and were analyzed by SDS-PAGE.
Statistical analysis
Statistical significance was calculated by one-factor ANOVA
using StatView 4.0 (ABACUS Concepts, Cary, NC).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
ligands ligands. Abundant AT1R mRNA
expression (3.5-kb, indicated by an arrow in the top
panel of Fig. 1A
) was observed in
VSMCs in the absence of PPAR- ligands. Incubation of VSMCs with
PPAR- ligands such as 15dPGJ2,
troglitazone, rosiglitazone, or pioglitazone
significantly decreased AT1R mRNA levels in a dose-dependent manner
(Fig. 1A). Interestingly, troglitazone was observed to be
more potent than other thiazolidinediones, such as rosiglitazone and
pioglitazone. Western immunoblot analysis using VSMCs
membrane proteins by anti-AT1R antibody (Fig. 1B) also demonstrated a
significant decrease in AT1R protein expression (41-kDa, indicated by
an arrow) by these PPAR- ligands treatment (lines 1–4).
These results indicate that endogenous AT1R mRNA/protein expressions in
VSMCs are both suppressed by PPAR- ligands.
|
ligands on AT1R mRNA stability ligands on AT1R mRNA
decrease was due to decrease of AT1R mRNA stability, we next treated
VSMCs with 5 µg/ml actinomycin D. As shown in Fig. 2, AT1R mRNA in VSMCs untreated with
PPAR- ligands (control) degraded approximately by 50% after 8
h treatment with actinomycin D. Even when VSMCs were pretreated with
15dPGJ2 or troglitazone, AT1R mRNA
degradation rate was not affected (Fig. 2). These results suggest that
PPAR- ligands do not affect AT1R mRNA stability.
|
ligands on AII-induced
3H-thymidine incorporation ligands on DNA synthesis
in VSMCs. As shown in Fig. 3, an increase
(approximately 135% of basal) of 3H-thymidine
incorporation into VSMCs was observed by 1 µM AII
incubation (line 2). The increase was completely inhibited by 1
µM AT1R antagonist candesartan treatment (line 3),
suggesting that the increase was AII-specific effect. When VSMCs were
coincubated either with 1 µM
15dPGJ2 or 10 µM
troglitazone, AII-induced increase of
3H-thymidine incorporation was completely
abrogated (lines 4 and 5), most likely due to the decrease of AT1R
protein expression by these PPAR- ligands as observed in Fig. 1B
.
|
ligands ligands on AT1R gene
transcription. As seen in Fig. 4, PPAR- ligands such as 15dPGJ2 (lines 2–7),
troglitazone (lines 8–11), and rosiglitazone (lines 12
and 13) significantly decreased -1969/+104-luc activity in a
dose-dependent manner. In contrast, PPAR- ligand
LTB4 did not affect the transcription (line 14).
Interestingly, RXR- ligand 9cRA slightly suppressed AT1R gene
transcription (line 15). Because endogenous expression of PPAR- in
rat VSMCs was confirmed by RT-PCR as shown in Fig. 5, it is suggested that PPAR- ligands
suppress AT1R gene expression at a transcriptional level by activating
endogenous PPAR- in VSMCs.
|
|
in AT1R gene suppression overexpression in VSMCs was performed next. As seen in
Fig. 6, PPAR- overexpression
significantly decreased -1969/+104-luc activity in the absence (lines
1 and 2) or the presence of PPAR- ligands (lines 6 and 7 for
15dPGJ2 and lines 10, 11, 14, and 15 for
troglitazone), whereas RXR- overexpression did not
affect it (lines 3, 8, 12, and 16). Moreover, overexpression of both
factors did not affect the transcriptional suppression brought about by
PPAR- alone (lines 4, 9, 13, and 17). PPAR- overexpression showed
no effect (line 5). It is, therefore, indicated that PPAR-, but not
RXR-, is involved in AT1R gene suppression.
|
ligands were localized next. As shown in Fig. 7A, the suppression was observed in all
constructs from -1969/+104-luc to -58/+104-luc (lines 1–4 for
-1969/+104-luc, lines 5–8 for -987/+104-luc, lines 9–12 for
-331/+104-luc, and lines 13–16 for -58/+104-luc). To further
localize the element, we next transfected -58/+104-luc, -58/-1-luc,
-34/-1-luc, or -1/-34-luc (inverted orientation of -34/-1-luc)
into VSMCs and treated them with 15dPGJ2 or
troglitazone. As shown in Fig. 7B, both PPAR- ligands
suppressed transcriptional activities of -58/+104-luc (lines 1–4) and
-58/-1-luc (lines 5–8), suggesting that the suppression was mediated
within the -58/-1 region. In contrast, the transcriptional activity
of -34/-1-luc (element between 1-bp upstream of TATA box and the
transcription start site) was not suppressed by PPAR- ligands (lines
9–12). When -1/-34-luc was transfected, the basal transcriptional
level decreased approximately to one fourth of -34/-1-luc (lines
13–15), suggesting that the -34/-1 region functions as the major
promoter of the AT1R gene in the right orientation. These data suggest
that the region between -58 and -34 (the -58/-34 region) is
responsible for the suppression. The -58/-34 region
(TGCAGAGCAGCGACGCCCCCTAGGC) is composed of several G and C nucleotides
and contains a GC-box-related sequence in the latter half that is
supposed to be bound by a Sp-family protein(s). We, therefore,
generated mutated -58/-1-luc, whose GC-box-related sequence within
the -58/-34 region was abrogated as described in Materials and
Methods, and transfected it into VSMCs. The transcriptional
activity of mutated -58/-1-luc also was not suppressed by PPAR-
ligands (lines 16–19). To confirm that the GC-box-related sequence
within the -58/-34 region was responsible for the suppression by
PPAR- ligands, we also generated mutated -1969/+104-luc, whose
GC-box-related sequence within the -58/-34 region was abrogated as
described in Materials and Methods. As shown in Fig. 7C, the
transcriptional activity of mutated -1969/+104-luc also was not
suppressed by PPAR- ligands (lines 5–8). Taken together, it is
suggested that the GC-box-related sequence within the -58/-34 region
is responsible for the suppression.
|
, binding to the GC-box-related sequence
within the -58/-34 region to the -58/-34
region of the AT1R gene promoter (Fig. 8A). When
32P-labeled HMG-CoA synthase gene PPRE
(11) oligonucleotides (positive control) were incubated
with in vitro translated PPAR-1 and/or RXR-,
PPAR-/RXR- heterodimer formation (PPAR-/RXR- in lane 3,
indicated by an arrow) was observed only in the presence of
both factors (lanes 1–4). In contrast, the complex was not observed
when using 32P-labeled -58/-34 region
oligonucleotides (lanes 5–8). It is, therefore, suggested that
PPAR- cannot bind to the -58/-34 region either as
monomer/homodimer or as heterodimer with RXR-. We next studied a
binding of Sp1 to the -58/-34 region (Fig. 8B). When in
vitro translated Sp1 was incubated with
32P-labeled -58/-34 region oligonucleotides,
formation of a Sp1-DNA complex (Sp1 in lane 3, indicated by an
arrow) was observed. When unprogrammed RL that did not
contain Sp1 was used, the complex could not be observed (lane 2). In
addition, formation of the Sp1-DNA complex was abrogated when the
GC-box-related sequence mutated -58/-34 region (described in
Materials and Methods) was used as a probe (lane 4). It is,
therefore, suggested that the GC-box-related sequence within the
-58/-34 region is a Sp1 (Sp-family) binding site.
|
). When VSMC nuclear extracts were
incubated with 32P-labeled oligonucleotides of
the -58/-34 region, two protein-DNA complexes were observed
(Protein/DNA Complexes with arrows, lane 1). Coincubation
with 100-fold excess of the unlabeled -58/-34 region oligonucleotides
completely abolished the formation of both complexes (lane 6),
suggesting that both complexes were specific for the -58/-34 region.
When the GC-box-related sequence mutated -58/-34 region was used as a
probe, formation of both complexes was completely abolished (lane 8),
suggesting that the GC-box-related sequence was necessary for the
protein binding. Moreover, when we coincubated with 100-fold excess of
unlabeled oligonucleotides containing the SV40 early promoter Sp1 site
(27), which contains consensus GC-boxes, formation of both
complexes was also completely abolished (lane 7). These data suggest
that the protein-DNA complexes would be composed of a Sp-family
protein(s) in VSMCs that could bind to the GC-box-related sequence. We
next performed antibody supershift experiments further, to identify a
Sp-family protein(s) binding to the GC-box-related sequence. As
observed in lane 2, incubation with anti-Sp1 antibody abolished
formation of most of both complexes, and induction of a supershifted
complex (Supershifted Sp1 with an arrow, Fig. 7) was
observed. These data suggest that most of both complexes may be
composed of the Sp1 protein. Incubation with anti-Sp2 (lane 3) and
anti-Sp3 (lane 4) antibodies also decreased the upper complex, to some
extent, and induced supershifted complexes (Supershifted Sp2/Sp3 with
an arrow, Fig. 7). In contrast, incubation with anti-Sp4
antibody did not affect both complexes, and no supershifted complex was
observed (lane 5). These data suggest that Sp1 protein is mostly
involved in the protein-DNA complexes, and some Sp2 and Sp3 proteins
are also possibly involved.
|
against Sp1 on the
-58/-34 region was examined next. As shown in Fig. 10, overexpression of Sp1 significantly
increased -58/-1-luc activity (lines 1 and 2) whereas -34/-1-luc
(lines 6 and 7) and mutated -58/-1-luc (lines 9 and 10) activities
were not affected. These data suggest that Sp1 can transactivate the
-58/-34 region most likely via the GC-box-related sequence. When we
overexpressed PPAR- in the presence of Sp1, -58/-1-luc activity
was significantly decreased (line 3), whereas -34/-1-luc (line 8) and
mutated -58/-1-luc (line 11) activities were not affected. In
addition, the decrease of -58/-1-luc activity by PPAR-
overexpression was further augmented by the addition of PPAR-
ligands 15dPGJ2 (line 4) or
troglitazone (line 5). These data suggest that activated
PPAR- can functionally antagonize against Sp1 via the GC-box-related
sequence within the -58/-34 region.
|
on Sp1 binding to the
GC-box-related sequence within the -58/-34 region. As shown in Fig. 11, incubation of VSMC nuclear extracts
with the -58/-34 region probe could form protein-DNA complexes mostly
composed of Sp1 as shown in Fig. 9 (Protein/DNA Complexes with
arrows, lane 1). When 2 µl in vitro translated
PPAR- was coincubated in the reaction, formation of the protein-DNA
complexes was significantly inhibited (lane 2). When the same amounts
of in vitro translated RXR- was used instead of PPAR-,
the inhibition was not observed (lane 3), suggesting that the effect
was PPAR- specific. The addition of both factors did not affect the
Sp1 binding inhibition brought about by PPAR- alone (lane 4).
Similar observations were obtained when we used in vitro
translated Sp1 (data not shown). These data suggest that PPAR- can
specifically inhibit Sp1 binding to the GC-box-related sequence within
the -58/-34 region, and the binding inhibition may contribute to the
functional antagonism of PPAR- against Sp1 (Fig. 10).
|
and Sp1 and Sp1. As observed in
Fig. 12, when GST alone was incubated
with in vitro translated 35S-labeled
Sp1, no interaction between GST and Sp1 was observed (lane 2). However,
when GST-PPAR- fusion protein was incubated with
35S-labeled Sp1, a direct protein-protein
interaction between PPAR- and Sp1 was observed (lane 3), and the
interaction was enhanced approximately to 1.5-fold by incubation with
50 µM troglitazone (lane 4). These
results suggest that PPAR- can physically interact with Sp1 and may
directly inhibit its function.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
ligands such as 15dPGJ2 and
thiazolidinediones including troglitazone, rosiglitazone,
and pioglitazone significantly decreased AT1R mRNA
expression level in VSMCs. In addition, PPAR- ligands also decreased
AT1R protein expression level and led to inhibition of AII-induced
increase of 3H-thymidine incorporation into
VSMCs. Because PPAR- ligands did not affect AT1R mRNA stability and
AT1R gene promoter activity was suppressed by PPAR- ligands, it was
suggested that AT1R expression suppression was mediated at the gene
transcription level. We have also observed that overexpression of
PPAR- further augmented the transcriptional suppression of the AT1R
gene promoter by PPAR- ligands, whereas other nuclear receptors
including PPAR- and RXR- showed no effect. Moreover, consistent
with the previous report (16, 17), endogenous expression
of PPAR- in VSMCs was also confirmed. It is, therefore, suggested
that the transcriptional suppression of AT1R gene by PPAR- ligands
was mediated by activated PPAR-. These present observations suggest
that PPAR- activation can cause suppression of AT1R gene expression
in VSMCs, resulting in inhibition of AT1R-mediated VSMC proliferation.
Different from this genomic effect via PPAR-,
troglitazone has been shown to inhibit translocation of
mitogen-activated protein kinase in VSMCs and inhibit
AII-induced cell proliferation and migration (28, 29).
Here, AT1R gene expression suppression is suggested to be another
effect of PPAR- ligands leading to inhibition of vascular AII
action.
We identified the element(s) responsible for AT1R gene suppression by
activated PPAR- within the -58/-1 region, most likely at the
-58/-34 region, in the AT1R gene promoter. We, however, did not
detect a PPAR-/RXR- heterodimer complex using the radiolabeled
-58/-34 region by EMSA. In addition, PPRE sequence (11)
was not observed within the -58/-34 region (7). Thus,
AT1R gene suppression by activated PPAR- may not be due to a direct
interaction between the AT1R gene promoter and PPAR-/RXR-
heterodimer. Consistent with this observation, transcription of
inducible nitric oxide synthase, gelatinase B, and scavenger receptor A
genes that lack PPREs was shown to be suppressed by activated PPAR-
(13). A protein-protein interaction has been suggested to
be involved in the inhibition of transcriptional activity of activator
protein 1, nuclear factor (NF)-
B, or signal transducers and
activation of transcription (13).
A GC-box-related sequence was suggested to be located within the
-58/-34 region. By mutation analyses, we have observed that the
GC-box-related sequence was responsible for the transcriptional
suppression. EMSA had shown that in vitro translated Sp1
could bind to the GC-box-related sequence. Binding of Sp-family
proteins, especially Sp1, to the GC-box-related sequence was also shown
by antibody supershift experiments using VSMC nuclear extracts.
Moreover, overexpression of Sp1 was shown to transactivate the
GC-box-related sequence. Taken together, it is suggested that Sp1 binds
to and transactivates the GC-box-related sequence within the -58/-34
region in VSMCs. Inhibitory action of PPAR- on Sp1-stimulated
transactivation at the GC-box-related sequence was also observed.
Moreover, Sp1 binding to the GC-box-related sequence was shown to be
inhibited by PPAR-. It is, therefore, suggested that activated
PPAR- suppresses Sp1 function most likely by inhibiting Sp1 binding
to the GC-box-related sequence. Furthermore, GST pull-down assay showed
a direct protein-protein interaction between PPAR- and Sp1. It is
suggested that a direct binding of PPAR- to Sp1 would be involved in
the inhibition of transcription of the GC-box-related sequence within
the -58/-34 region by Sp1. A similar mechanism of gene transcription
inhibition by a direct protein-protein interaction has been suggested
in glucocorticoid receptor and NF-B interaction
(30).
Recently, PPAR- has been shown to suppress several genes related to
atherogenesis. For instance, in macrophages, activated PPAR-
inhibited transcription of inducible nitric oxide synthase, gelatinase
B, and scavenger receptor A genes (13). Production of
inflammatory cytokines was inhibited by PPAR- ligands in monocytes
(14). We have also observed that activated PPAR-
suppresses gene transcription of thromboxane synthase in macrophages
via an interaction with NF-E2-related factor 2 (31). In
VSMCs, matrix metalloproteinase-9 gene suppression by PPAR- has been
reported (16). In addition, we have shown transcriptional
suppression of thromboxane receptor gene by activated PPAR-
(32). In vascular endothelial cells,
troglitazone has been shown to suppress expression of
endothelin-1 (33) and plasminogen activator inhibitor type
1 (34). Because activation of these genes, including the
AT1R gene, are prone to stimulate atherosclerotic changes,
transcriptional suppression of these genes by activated PPAR- may
exert some antiatherosclerotic effects. In addition to these effects on
the transcriptional suppression, troglitazone has been
reported to suppress cell proliferation induced by AII
(28), platelet-derived growth factor, or basic fibroblast
growth factor (35) and cell migration
(16) in VSMCs. On the other hand, activated PPAR- has
also been suggested to promote some atherogenic effects such as
oxidized low-density lipoprotein uptake, transactivation of CD36 in
macrophages/monocytes, and lipid accumulation in these cells to
generate foaming cells (36, 37). Nonetheless, in in
vivo studies, neointimal formation following balloon injury was
shown to be inhibited by troglitazone (35, 38). In clinical studies, some beneficial effects of
troglitazone on hypertension (39),
proteinuria (40), and cardiac function (41)
have also been reported. It seems that PPAR- ligand may have some
favorable clinical efficacy in the treatment of cardiovascular
diseases, although more studies are required to clarify the underlying
molecular mechanisms.
In summary, it is suggested that PPAR- activation can inhibit AT1R
gene expression at the transcriptional level. PPAR- ligands, thus,
may inhibit AII-induced cell growth and hypertrophy in VSMCs by AT1R
expression suppression and may possibly be beneficial for treatment of
diabetic patients to avoid cardiovascular complications.
|
Footnotes |
|---|
Received September 29, 2000.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
12, 14-prostaglandin J2 is a ligand for
the adipocyte determination factor PPAR . Cell 83:803–812[CrossRef][Medline]
(PPAR ). J Biol Chem 270:12953–12956: adipogenic regulator
and thiazolidinedione receptor. Diabetes 47:507–514[Abstract]
is a negative
regulator of macrophage activation. Nature 391:79–82[CrossRef][Medline]
agonists
inhibit production of monocyte inflammatory cytokines. Nature 391:82–86[CrossRef][Medline]
activators inhibit
gene expression and migration in human vascular smooth muscle cells.
Circ Res 83:1097–1103 (PPAR) in rat
aortic smooth muscle cells. Biochem Biophys Res Commun 247:353–356[CrossRef][Medline]
gene expression is elevated
in skeletal muscle of obese and type II diabetic subjects. Diabetes 46:1230–1234[Abstract]
B by activated glucocorticoid receptors. Mol
Cell Biol 15:943–953[Abstract]
12,
14-PGJ2 and troglitazone by
activating PPAR- in vascular smooth muscle cells. J Am Soc
Nephrol 9:358A (Abstract)
on vascular
endothelial function. Biochem Biophys Res Commun 254:757–763[CrossRef][Medline]
in
endothelial function. Biochem Biophys Res Commun 258:431–435[CrossRef][Medline]
promotes monocyte/macrophage differentiation and
uptake of oxidized LDL. Cell 93:241–252[CrossRef][Medline]
. Cell 93:229–240[CrossRef][Medline]
This article has been cited by other articles:
 |
|
 |
|
  Q. Kang and A. Chen Curcumin Inhibits srebp-2 Expression in Activated Hepatic Stellate Cells in Vitro by Reducing the Activity of Specificity Protein-1 Endocrinology, December 1, 2009; 150(12): 5384 - 5394. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Xiao, J. C. K. Leung, L. Y. Y. Chan, H. Guo, and K. N. Lai Protective effect of peroxisome proliferator-activated receptor-gamma agonists on activated renal proximal tubular epithelial cells in IgA nephropathy Nephrol. Dial. Transplant., July 1, 2009; 24(7): 2067 - 2077. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. K. Koh, P. C. Oh, and M. J. Quon Does reversal of oxidative stress and inflammation provide vascular protection? Cardiovasc Res, March 1, 2009; 81(4): 649 - 659. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. M. Necela, W. Su, and E. A. Thompson Peroxisome Proliferator-activated Receptor {gamma} Down-regulates Follistatin in Intestinal Epithelial Cells through SP1 J. Biol. Chem., October 31, 2008; 283(44): 29784 - 29794. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. K. Koh and M. J. Quon Combination Therapy for Treatment or Prevention of Atherosclerosis Hypertension, August 1, 2008; 52(2): e18 - e18. [Full Text] [PDF]
|
|
|
|
|
|
I. Kuipers, P. van der Harst, G. Navis, L. van Genne, F. Morello, W. H. van Gilst, D. J. van Veldhuisen, and R. A. de Boer Nuclear Hormone Receptors as Regulators of the Renin-Angiotensin-Aldosterone System Hypertension, June 1, 2008; 51(6): 1442 - 1448. [Full Text] [PDF]
|
|
|
|
|
|
I. Imayama, T. Ichiki, D. Patton, K. Inanaga, R. Miyazaki, H. Ohtsubo, Q. Tian, K. Yano, and K. Sunagawa Liver X Receptor Activator Downregulates Angiotensin II Type 1 Receptor Expression Through Dephosphorylation of Sp1 Hypertension, June 1, 2008; 51(6): 1631 - 1636. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. M. Beyer, G. L. Baumbach, C. M. Halabi, M. L. Modrick, C. M. Lynch, T. D. Gerhold, S. M. Ghoneim, W. J. de Lange, H. L. Keen, Y.-S. Tsai, et al. Interference With PPAR{gamma} Signaling Causes Cerebral Vascular Dysfunction, Hypertrophy, and Remodeling Hypertension, April 1, 2008; 51(4): 867 - 871. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Z.-G. Xu, H. Yuan, L. Lanting, S.-L. Li, M. Wang, N. Shanmugam, M. Kato, S. G. Adler, M. A. Reddy, and R. Natarajan Products of 12/15-Lipoxygenase Upregulate the Angiotensin II Receptor J. Am. Soc. Nephrol., March 1, 2008; 19(3): 559 - 569. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. T. Weatherford, H. Itani, H. L. Keen, and C. D. Sigmund Is Peroxisome Proliferator-Activated Receptor-{gamma} a New "Pal" of Renin? Hypertension, November 1, 2007; 50(5): 844 - 846. [Full Text] [PDF]
|
|
|
|
 |
|
 Z. Yousefipour, H. Hercule, L. Truong, A. Oyekan, and M. Newaz Ciglitazone, a Peroxisome Proliferator-Activated Receptor {gamma} Inducer, Ameliorates Renal Preglomerular Production and Activity of Angiotensin II and Thromboxane A2 in Glycerol-Induced Acute Renal Failure J. Pharmacol. Exp. Ther., August 1, 2007; 322(2): 461 - 468. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. S. Elton and M. M. Martin Angiotensin II Type 1 Receptor Gene Regulation: Transcriptional and Posttranscriptional Mechanisms Hypertension, May 1, 2007; 49(5): 953 - 961. [Full Text] [PDF]
|
|
|
|
|
|
I. Imayama, T. Ichiki, K. Inanaga, H. Ohtsubo, K. Fukuyama, H. Ono, Y. Hashiguchi, and K. Sunagawa Telmisartan downregulates angiotensin II type 1 receptor through activation of peroxisome proliferator-activated receptor {gamma} Cardiovasc Res, October 1, 2006; 72(1): 184 - 190. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
O. A. Gudbrandsen, M. Hultstrom, S. Leh, L. Monica Bivol, O. Vagnes, R. K. Berge, and B. M. Iversen Prevention of Hypertension and Organ Damage in 2-Kidney, 1-Clip Rats by Tetradecylthioacetic Acid Hypertension, September 1, 2006; 48(3): 460 - 466. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. K. Koh, M. J. Quon, S. H. Han, W.-J. Chung, J. Y. Ahn, J.-a Kim, Y. Lee, and E. K. Shin Additive Beneficial Effects of Fenofibrate Combined With Candesartan in the Treatment of Hypertriglyceridemic Hypertensive Patients Diabetes Care, February 1, 2006; 29(2): 195 - 201. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Deng, S. Shan, P.-P. Li, Z.-F. Shen, X.-P. Lu, J. Cheng, and Z.-Q. Ning Peroxisome Proliferator-Activated Receptor-{gamma} Transcriptionally Up-Regulates Hormone-Sensitive Lipase via the Involvement of Specificity Protein-1 Endocrinology, February 1, 2006; 147(2): 875 - 884. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Benkirane, E. C. Viel, F. Amiri, and E. L. Schiffrin Peroxisome Proliferator-Activated Receptor {gamma} Regulates Angiotensin II-Stimulated Phosphatidylinositol 3-Kinase and Mitogen-Activated Protein Kinase in Blood Vessels In Vivo Hypertension, January 1, 2006; 47(1): 102 - 108. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Houston, M. A. Julien, S. Parthasarathy, and E. L. Chaikof Oxidized linoleic acid regulates expression and shedding of syndecan-4 Am J Physiol Cell Physiol, February 1, 2005; 288(2): C458 - C466. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Kudo, A. Sugawara, A. Uruno, K. Takeuchi, and S. Ito Transcription Suppression of Peroxisome Proliferator-Activated Receptor {gamma}2 Gene Expression by Tumor Necrosis Factor {alpha} via an Inhibition of CCAAT/ Enhancer-binding Protein {delta} during the Early Stage of Adipocyte Differentiation Endocrinology, November 1, 2004; 145(11): 4948 - 4956. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Wakino, K. Hayashi, T. Kanda, S. Tatematsu, K. Homma, K. Yoshioka, I. Takamatsu, and T. Saruta Peroxisome Proliferator-Activated Receptor {gamma} Ligands Inhibit Rho/Rho Kinase Pathway by Inducing Protein Tyrosine Phosphatase SHP-2 Circ. Res., September 3, 2004; 95(5): e45 - e55. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Sassa, Y. Hata, L. P. Aiello, Y. Taniguchi, K. Kohno, and T. Ishibashi Bifunctional Properties of Peroxisome Proliferator-Activated Receptor {gamma}1 in KDR Gene Regulation Mediated via Interaction With Both Sp1 and Sp3 Diabetes, May 1, 2004; 53(5): 1222 - 1229. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. A. Hsueh and D. Bruemmer Peroxisome Proliferator-Activated Receptor {gamma}: Implications for Cardiovascular Disease Hypertension, February 1, 2004; 43(2): 297 - 305. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C.-H. Wang, R. D. Weisel, P. P. Liu, P. W.M. Fedak, and S. Verma Glitazones and Heart Failure: Critical Appraisal for the Clinician Circulation, March 18, 2003; 107(10): 1350 - 1354. [Full Text] [PDF]
|
|
|
|
|
|
M. Fu, J. Zhang, Y. Lin, X. Zhu, M. U. Ehrengruber, and Y. E. Chen Early Growth Response Factor-1 Is a Critical Transcriptional Mediator of Peroxisome Proliferator-activated Receptor-gamma 1 Gene Expression in Human Aortic Smooth Muscle Cells J. Biol. Chem., July 19, 2002; 277(30): 26808 - 26814. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Q. N. Diep, M. El Mabrouk, J. S. Cohn, D. Endemann, F. Amiri, A. Virdis, M. F. Neves, and E. L. Schiffrin Structure, Endothelial Function, Cell Growth, and Inflammation in Blood Vessels of Angiotensin II-Infused Rats: Role of Peroxisome Proliferator-Activated Receptor-{gamma} Circulation, May 14, 2002; 105(19): 2296 - 2302. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. M. Hayes, B. R. Lane, S. R. King, D. M. Markovitz, and M. J. Coffey Peroxisome Proliferator-activated Receptor gamma Agonists Inhibit HIV-1 Replication in Macrophages by Transcriptional and Post-transcriptional Effects J. Biol. Chem., May 3, 2002; 277(19): 16913 - 16919. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Molavi, N. Rasouli, and J. L. Mehta Peroxisome Proliferator-Activated Receptor Ligands as Antiatherogenic Agents: Panacea or Another Pandora's Box? Journal of Cardiovascular Pharmacology and Therapeutics, March 1, 2002; 7(1): 1 - 8. [Abstract] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
) or presence of 1
µM 15dPGJ2 (
) or 10 µM
troglitazone (
) for 12 h. Actinomycin D (5
µg/ml) was then added and incubated for an additional 4 or 8 h.
Extracted RNAs were then processed to Northern blot analysis. The
horizontal line represents mean ± SE
(%) of AT1R mRNA expression levels normalized by densities of 28S rRNA
(time 0 as 100%) (n = 4).
