help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Saji, S.
Right arrow Articles by Gustafsson, J.-A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Saji, S.
Right arrow Articles by Gustafsson, J.-A.
Endocrinology Vol. 142, No. 7 3177-3186
Copyright © 2001 by The Endocrine Society


ARTICLES

Quantitative Analysis of Estrogen Receptor Proteins in Rat Mammary Gland1

Shigehira Saji2, Hideki Sakaguchi, Sandra Andersson, Margaret Warner and Jan-Åke Gustafsson

Department of Medical Nutrition (S.S., H.S., S.A., J.-Å.G.), Department of Bioscience (M.W., J.-Å.G.), Karolinska Institute, Novum, S141–86 Huddinge, Sweden

Address all correspondence and requests for reprints to: Dr. Jan-Åke Gustafsson, Department of Medical Nutrition, Karolinska Institute, F60, Novum, S141–86 Huddinge, Sweden. E-mail: jan-ake.gustafsson{at}mednut.ki.se


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Estrogen receptor {alpha} and ß proteins (ER{alpha} and ERß) at various stages of development of the rat mammary gland were quantified by Western blotting. ER{alpha} and ERß recombinant proteins were used as standards, and their molar concentrations were measured by ligand binding assays. In 3-week-old pregnant, lactating, and postlactating rats the ER{alpha} content ranged from 0.30–1.55 fmol/µg total protein (mean values). The ERß content of the same samples ranged between 1.06–7.50 fmol/µg total protein. At every developmental stage, the ERß content of the mammary gland was higher than that of ER{alpha}. When receptor levels were normalized against ß-actin, it was evident that ER expression changed during development, with maximum expression of both receptors during the lactation period. With an antibody raised against the 18-amino acid insert of the ERß variant, originally called ERß2 but named ERßins in this paper, Western blots revealed that ERßins protein was up-regulated during the lactation period. RT-PCR showed that the levels of messenger RNA of ERßins paralleled those of the protein. Double immunohistochemical staining with anti-ER{alpha} and anti-ERßins antibodies revealed that ERßins protein colocalized with ER{alpha} in 70–80% of the ER{alpha}-expressing epithelial cells during lactation and with 30% of these cells during pregnancy. These observations indicate that expression of ERßins is regulated not only quantitatively, but also with regard to its cellular distribution. As ERßins acts as the dominant repressor of ER{alpha}, we suggest that its coexpression with ER{alpha} quenches ER{alpha} function and may be one of the factors that contribute to the previously described insensitivity of the mammary gland to estrogens during lactation.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
IT IS WELL documented that estrogen is an obligatory factor for the development of the mammary gland (1, 2). Most of the actions of estrogen are mediated by two estrogen receptors (ER), ER{alpha} and ERß, cloned in 1986 (3) and 1996 (4), respectively. In their DNA-binding domains (5), ER{alpha} and ERß share 96% homology and recognize the same estrogen-responsive element (ERE) on genomic DNA. In their ligand-binding domains (LBD) there is only 60% homology, and this results in some degree of ligand selectivity between the receptors; indeed, compared with ER{alpha}, ERß has a lower affinity for estradiol (E2), but a higher affinity for genistein (5, 6). For full transcriptional activity in an ERE reporter assay using 293 cells with transfected ERs, a 10-fold higher concentration of E2 is required for ERß than for ER{alpha}, whereas a 10-fold lower concentration of genistein can activate ERß (7). Although, on classical EREs, both ER{alpha} and ERß activate transcription, they can work in opposite directions on activating protein-1 response elements (8). In the presence of E2, ER{alpha} is an activator, but ERß is an inhibitor or silencer, at activating protein-1 sites (8). Moreover, recent publications provide evidence that ERß is not simply an ER that utilizes ligands other than those used by ER{alpha}, but is an independent regulator with distinct cellular functions (9, 10, 11).

There are three potential translational start sites at the 5'-end of rat ERß messenger RNA (mRNA), which, if used, would produce proteins 485, 530, and 549 amino acids (aa) in length, differing at their N-termini (12). Similar sites are found in the human ERß sequence and result in polypeptide chains that are 477, 485, and 530 aa in length (12, 13). Fuqua et al. reported that 530- and 477-aa proteins can be produced in cells transfected with the human full-length complementary DNA (cDNA) (14). However, it is not yet clear whether products of different sizes are normally expressed in tissues. From the few studies in which Western blotting of tissue extracts have been made, the longest ERß form seems to be the major component (14, 15). As differences at the N-terminus may affect the ligand-independent transcriptional activity of the activating factor-1 domain (16), this issue needs further analysis.

Although these N-terminal differences do not change the ligand-binding character of ERß, some of the alternatively spliced variants, which have been reported in human, mouse, and rat, have weak affinities for E2 and seem to be very important in terms of their relation to the function of ER{alpha}. One ERß variant, first reported as ERß2 by Petersen et al. (17) and named ERßins in this paper, has a 54-bp (18-aa) additional in-frame sequence between exons 5 and 6 of wild-type (wt) rat ERß. This insertion causes about 1/35-fold lower binding affinity for E2 (17, 18). As the capacity for DNA binding and dimerization with ER{alpha} and wt ERß remains intact, ERßins can act as a negative regulator when it is coexpressed with ER{alpha} or wt ERß (17, 18). In humans, a C-terminally truncated variant, named ERß2 by Moore et al. (19) and ERßcx by Ogawa et al. (20), does not bind E2 and is a dominant negative regulator for ER{alpha}, but not for wt ERß (19, 20).

Information about the tissue distribution of ER{alpha} and ERß proteins is necessary for understanding the specific physiological functions of these two receptors. Granulosa cells of ovary and epithelial cells of ventral prostate express ERß exclusively (4, 21), and analysis of these tissues can provide information about which genes are ERß regulated. On the other hand, in the mammary gland, at least in humans and rats, both ER{alpha} and ERß are expressed (15, 22, 23, 24). In this case, interaction between the two receptors in individual cells may be very important for the overall effect of estrogen on the whole tissue.

Recent reports suggested the importance of wt ERß as a regulator of ER{alpha} function. For example, Pettersson et al. reported that wt ERß can dose dependently down-regulate ER{alpha}’s trans-activation potency when the concentration of E2 is not sufficient for activation of ERß (7). As described previously, rat ERßins and human ERßcx are dominant negative regulators of ER{alpha} independent of the E2 concentration (17, 18, 19, 20). All of these findings indicate that for an understanding of the role of ERs in tissues where ER{alpha} and ERß are coexpressed, information is needed about the degree of colocalization of ER{alpha} with ERß and its variants and on the relative quantities of the two receptors.

In this study we evaluated the expression and colocalization of ER{alpha}, ERß, and one ERß variant, ERßins, in rat mammary gland using quantitative Western blotting and immunohistochemistry. The results suggest a possible role for ERßins in silencing of ER{alpha} function during the lactating period.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animals
Preparation and management of mating of Sprague-Dawley rats were performed as described previously (15). Briefly, virgin cycling 6-week-old female rats were mated during proestrus with 9-week-old males. The day when the vaginal plug was evident was designated day 0 of pregnancy. Pregnant females were placed in separate cages and killed on days 2, 7, and 14 of pregnancy. The day of parturition was designated day 0 of lactation. Lactating animals were killed on days 2, 7, and 14. In another group, pups were removed from their mothers on day 22 of lactation. These mothers were killed 7 days after weaning, and female pups were killed at 3, 4, 5, and 6 weeks of age. The inguinal mammary glands were excised and used for further experiments.

Recombinant proteins as positive control
Recombinant ER{alpha} and ERß1 (ERß 530) proteins were purchased from Panvera (Madison, WI). The amount of functional receptor was measured by a tritium-labeled E2 binding assay. Both of the human recombinant proteins were made from baculovirus-infected cells and had ER concentrations of 7.3 pmol/µl (ER{alpha}) and 1 pmol/µl (ERß 530). The ERß 503 protein is composed of the human 485-aa sequence with the rat 18 aa of rat ERßins (17). This was produced by overexpression in SF9 cells by Karo Bio AB (Huddinge, Sweden). This form of ERß (ERßins) has very little binding affinity for E2, but its affinity for 4-hydroxytamoxifen is similar to that of ERß 530. All proteins were divided into small aliquots and thawed only once to avoid degradation.

Antibodies
ER{alpha} 6F11, a mouse monoclonal antibody, was obtained from Novo Castra (Newcastle upon Tyne, UK). ERß LBD rabbit polyclonal antibody was produced by us as described previously (15). To remove any cross-reactivity of ERß LBD antibodies with ER{alpha} protein, 1 µl LBD antibody was preincubated with 10 pmol ER{alpha} recombinant protein for 8 h at 4 C before use.

ERß INS chicken polyclonal antibody was raised against the rat 18-aa insert sequence of ERßins (17). Mouse monoclonal ß-actin antibody AC-15 and horseradish peroxidase-conjugated secondary antibodies were purchased from Sigma (St. Louis, MO). Fluorescence-labeled secondary antibodies for double staining were obtained from Jackson ImmunoResearch Laboratories, Inc. (West Grove, PA).

Protein extraction for Western blotting
For efficient extraction of all nuclear receptors from the tissue and for the visualization of sharp bands that can be correctly measured by the photoimager, modifications were made to the protocols previously reported (15). Tissues were removed from animals, placed in ice-cold lysis buffer, and homogenized immediately. Lysis buffer was composed of 600 mM Tris-HCl, 1 mM EDTA (pH 7.4), and two protease inhibitor tablets (Roche Molecular Biochemicals, Mannheim, Germany)/50 ml. The homogenates were centrifuged for 1 h at 105,000 x g, and the protein concentrations of supernatant were measured by protein assay (Bio-Rad Laboratories, Inc., Hercules, CA) with BSA as standard.

Direct usage of this sample on SDS-PAGE resulted in less stacking as well as fuzzy protein bands, probably due to the high salt concentration. To overcome these problems, 65 µg of each sample were precipitated with trichloroacetic acid (10% final) and resuspended in 100% methanol. Samples were placed on dry ice for 30 min, and the protein was recovered by centrifugation. Precipitates were dissolved in 1 x SDS sample buffer and used for SDS-PAGE.

Western blotting analysis
Samples were resolved on SDS-polyacrylamide gels, either 9% polyacrylamide or preformed gradient gels 4–20% acrylamide (Novex, San Diego, CA), with a Tris-glycine buffer system. Transfer to ProBlot membranes (PE Applied Biosystems, Foster City, CA) by electroblotting was performed either by semidry or wet blotting or in a Tris-glycine buffer. Kaleidoscope prestained standards (Bio-Rad Laboratories, Inc.) and a low mol wt electrophoresis calibration kit (Amersham Pharmacia Biotech, Uppsala, Sweden) were used as mol wt markers.

After 1-h blocking with blocking buffer (10% skim milk in PBS with 0.1% Nonidet P-40) at room temperature, membranes were incubated with a 1:75 dilution of ER{alpha} 6F11 mouse antibodies, a 1:3000 dilution of ERß LBD rabbit antibodies, or a 1:500 dilution of ERßINS chicken antibodies in blocking buffer at 4 C overnight. This was followed by 1-h washing in blocking buffer and then incubation in a 1:7500 dilution of horseradish peroxidase-conjugated secondary antibodies for each species in blocking buffer for 1 h at room temperature. After sequential washing with blocking buffer, PBS with 0.1% Nonidet P-40, and PBS alone, signals were developed using ECL Plus (Amersham Pharmacia Biotech).

For normalization against an intracellular protein, the membranes used for ER{alpha} or ERß detection were sequentially probed with a ß-actin-specific antibody without stripping the membrane as described by Liao et al. (25). Bands on the exposed film were captured with an image analyzer (LAS-1000, Fuji Photo Film Co. Ltd., Tokyo, Japan), and densitometric values were measured with Image Garge (Fuji Photo Film Co., Ltd.). Three sets of densitometric values obtained from three separate blots were used for the calculation.

Calculation of protein amount from Western blotting results
By referring to the data and graph obtained from the control study (left graph in Fig. 1BGo) and the densitometric values of the recombinant protein on the blots (Fig. 2Go, A and B), an approximate formula was drawn by polynomial regression with the StatView program (Abacus Concepts, Inc., Beverly, CA). From triplicate experiments using recombinant proteins, the formula that had the highest r2 value was chosen (r2 = 0.996; P < 0.01 for ER{alpha} and r2 = 0.997; P < 0.01 for ERß). The molar concentration of ER in each lane was calculated by the selected formula and expressed as femtomoles per µg total protein extract. From the calculated value of three independent Western blots using three sets of samples, the mean and SD were calculated.



View larger version (38K):
[in this window]
[in a new window]
 
Figure 1. Representative pictures and graphs of control study for quantitative Western blotting. A, Known amounts of recombinant proteins of ER{alpha} and ERß 530 were resolved on SDS-PAGE, and blotted membranes were labeled with ER{alpha} 6F11 or ERß LBD antibodies. The band densities of the pictures (A) were measured by photoimager and plotted on the graph as a function of the molar concentration of ER (B). The left panels represent narrow range experiments used for calculation of the slope, and right panels represent the wide range test showing the overall fitted line. All experiments were performed in triplicate.

 


View larger version (32K):
[in this window]
[in a new window]
 
Figure 2. Representative pictures of Western blotting using rat mammary gland samples with recombinant proteins. Measured amounts of recombinant proteins and 65 µg total protein from each developmental stage of mammary gland were resolved on SDS-PAGE and blotted onto membranes that were probed with the indicated antibodies. Membranes after detection of ER{alpha}, ERß or ERßins were reblotted with ß-actin antibody directly. A, Detection with ER{alpha} antibody. Triangle, The detected band as ER{alpha} that migrates around 66–67 kDa. ERß 530 is the recombinant protein of human ERß with the longest N-terminal sequence, resulting in a total of 530 aa. B, Detection with ERß LBD antibody. ERß 503 is the recombinant protein possessing human 485-aa ERß with an 18-aa sequence of rat ERßins. This protein was not quantified by ligand binding. Three kinds of triangles indicate the sizes of detected bands using this antibody. For more detailed picture, the results from three individual samples of 3-week-old rat are shown in D. Open, closed, and gray triangles indicate 65, 62, and slightly lower, approximately 62 kDa, respectively. The two lower bands are generally not distinguishable. C, Detection by ERß INS antibody, which only detects ERßins protein. Bands of approximately 62 and 58–59 kDa are indicated by triangles. Three sets of experiments using three individual series of samples were performed and used for calculation of amount of protein and evaluation of expression pattern (Table 1Go and Fig. 4Go).

 
In addition to expressing the receptor content per µg total protein extract, band densities were also normalized against ß-actin on the same membrane. The mean ± SD were expressed graphically in Fig. 4Go. Statistical analysis was performed by unpaired Welch’s t test.



View larger version (20K):
[in this window]
[in a new window]
 
Figure 4. Variations in expression of ER{alpha}, ERß, and ERßins proteins during development of the rat mammary gland. Densitometric values of Western blotting (Fig. 2Go) were standardized against those of ß-actin and expressed as the fold increase when the value for the 3-week-old gland is arbitrarily set at 1. The values were measured in three individual Western blots using three independent sets of samples. Means and SDs are shown on the graph. *, P < 0.05; **, P < 0.01 (by unpaired t test). The 5-week-old sample is compared with samples of other ages.

 
RT-PCR study
Total RNA was extracted from frozen mammary gland tissue using RNAwiz (Ambion, Inc., Austin, TX) according to the manufacturer’s instructions and quantified spectrophotometrically. Two micrograms of total RNA were treated with 5 U ribonuclease-free deoxyribonuclease (DNase; Promega Corp., Madison, WI) for 30 min at 37 C to remove genomic DNA from the RNA samples. After inactivation of DNase for 10 min at 65 C, removing the enzyme by phenol extraction, and ethanol precipitation of the RNA, samples were reverse transcribed using the SuperScript preamplification system (Life Technologies, Inc., Gaithersburg, MD) in a final volume of 20 µl according to the manufacturer’s instructions.

The primer sets for detecting both wt and ßins variants in one reaction were rERß LBD U (5'-GAGCTCAGCCTGTTCGACC) and rERß LBD L (5'-GGCCTTCACACAGAGATACTCC) (18). The primer sets for detecting only ERßins were rERß INS U (5'-ATTATAAATATACTATATCATTAATATTAATCCTCAGAAGACCCT) and rERß INS L (5'-ATATTA ATATATGTATATTAATTATTTAATGGGCAGCACTCTTCA). For detection of the total amount of ERß mRNA, we used rERß EX6 U (5'-AATCTTTGACATGCTCCTGGCG) and rERß EX7 L (5'-AAAGAAGCATCAGGAGGTTGGC). The sizes of respective products are 246 bp for wt and 300 bp for ßins when using rERß LBD U and L primers. Combination of rERß INS U and L primers produces the 110-bp product, and rERß EX6 U with EX7 L primer makes the 263-bp band as a total ERß. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) primers were 5'-CAGCCGCATCTTCTTGTG for sense and 5'-AGTTGTCATATTTCTCGTGGTTCA for antisense.

PCR reactions were 95 C for 5 min, cycle step, and 72 C for 5 min with TaqStart antibody for hot start (CLONTECH Laboratories, Inc. Palo Alto, CA). Cycle steps for each primers were as follows: rERß LBD U and L, 36 cycles at 95 C for 30 sec, 57 C for 40 sed, and 72 C for 60 sec; rERß INS U and L, 39 cycles at 95 C for 30 sec, 51 C for 30 sec, and 72 C for 50 sec; rERß EX6 and EX7U, 35 cycles at 95 C for 30 sec, 57 C for 30 sec, and 72 C for 60 sec; and GAPDH, 26 cycles at 95 C for 30 sec, 56 C for 40 sec, and 72 C for 60 sec. Cycle numbers were decided by the control study, which confirmed the linear phase of reaction (data not shown). For reactions with rERß INS U and L primers, a minimum of 38 cycles was needed for detection of the band.

PCR products were resolved on a 2% agarose gel containing ethidium bromide in 0.5 x Tris-borate EDTA running buffer. Products as total ERß and ERßins were loaded in one lane on an agarose gel (second panel of Fig. 5BGo). The 123-bp DNA ladder obtained from Life Technologies, Inc. was used for calibration. The negative control in each set was a reaction where the cDNA template was replaced with DNase-treated RNA (data not shown), and the identity of the positive band was confirmed by direct sequencing of the representative PCR product or by cloning the PCR product into a TA cloning vector, selection of clones, and sequencing of the insert from the vector.



View larger version (42K):
[in this window]
[in a new window]
 
Figure 5. RT-PCR study for the detection of ERß and ERßins mRNAs. A, The locations of PCR primers. B, Retrotranscribed cDNAs from rat mammary gland samples were used for PCR reaction, and resulting products were visualized on a 2% agarose gel with ethidium bromide. Primers used for reactions are shown at the left, and triangles at the right indicate the estimated sizes of the products. Reactions of EX6 U with EX7 L primers and those of INS U with INS L were performed independently, and resulting products from the same samples were loaded in one lane of the gel. The authenticity of the band was confirmed by DNA sequencing. C, The densitometric values of the pictures were measured by a photoimager. Means with SD from three independent experiments are shown on the graph when the mean value of the 3-week-old sample is arbitrarily set at 1. Variations in ERßins mRNA are expressed as a diagram due to the difficulty of accurate quantification in this system.

 
Band density in three independent experiments was measured by the same system used for evaluation of Western blots. Values of total ERß mRNA were normalized against those of GAPDH and expressed as the fold increase when the mean value of the 3-week-old sample was arbitrarily set at 1. All PCR reactions were performed in triplicate for each target.

Immunohistochemical staining
Double immunohistochemical staining using fluorescence-conjugated secondary antibody was performed as described previously (15). Briefly, frozen sections from rat mammary gland were fixed with ice-cold methanol, acetone, and 4% paraformaldehyde. After treatment with 0.5% Triton X-100 in PBS and 10% normal serum from the same species as the secondary antibody, sections were incubated sequentially as follows: ER{alpha} 6F11 mouse antibody (1:100), fluorescein isothiocyanate (FITC)-conjugated antimouse IgG (1:50), ERß INS chicken antibody (1:500), and Cy3-conjugated anti chicken IgY (1:200). Nuclear staining was performed with 0.1 µg/ml 4',6-diamidino-2-phenylindole (DAPI). The sections were examined under the fluorescence microscope with suitable filters for FITC, Cy3, and DAPI, and images captured by CCD camera were analyzed with OpenLab 2.03 program (Improvision, Covently, UK). To have accurate evaluation, counting of positively labeled cells was assisted by this program, which could clearly mark the labeled cells less ambiguously than the human eye. Counting analysis was performed on six pictures produced from three individual samples in each category.

For the control study of our antibody, 1 µl ERß INS antibody was incubated with an excess of ERß 503 protein or ERß 530 protein in PBS at 4 C overnight. These preadsorbed antibodies with PBS were applied to sections at 1:200–300 dilution.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Control study for quantitative Western blotting
No quantitative data on the relative amounts of ER{alpha} and ERß proteins expressed in tissues are available to date. Such information is essential for evaluation of functional interaction between these receptors. To determine their relative abundance in rat mammary gland, we developed a quantitative Western blot assay for ER{alpha} and ERß. By comparison of the band densities of recombinant proteins whose molar concentrations were predetermined by binding assays and those of samples, we could calculate the content of receptor protein in tissue samples. The receptor concentrations in recombinant human ER{alpha} and ERß proteins, purchased from Panvera, were assessed by a tritium-labeled E2 binding assay. As shown in Fig. 1AGo, both recombinant proteins showed a clear single band with no evidence of degradation. The relationship between the densitometric value of ER{alpha} and ERß bands on the blots and the amount of protein is shown in Fig. 1BGo. From these results, a regression line was drawn, and a formula for calculating the amount of receptor protein from the band densities was made (left graph in Fig. 1BGo). The specific binding activity of Panvera ERß is 6500 pmol/mg protein. With a molecular mass of 63 kDa, there are approximately 16,000 pmol ERß protein for each 6500 pmol binding activity. This means that 40% of the ERß is functional binding protein. For each picomole of binding protein loaded onto the lane, 2.5 pmol ERß protein are loaded. We are, therefore, underestimating our tissue content of ERß by a factor of 2.5. For Panvera ER{alpha} the binding activity is 12,300 pmol/mg protein. It can be calculated that there are 15,000 pmol ER{alpha} for each 12,300 pmol of binding activity. This means that 82% of ER{alpha} is functional binding protein. For each picomole of binding protein, loaded onto a lane, we are actually loading 1.25 pmol ER{alpha} protein. We are, therefore, also underestimating the amount of ER{alpha} in the tissue, but not by much.

Evaluation of ER{alpha} and ERß proteins by quantitative Western blotting
Aliquots containing 65 µg total protein from extracts of mammary glands at each developmental stage were loaded onto gels with calculated amounts of recombinant protein in adjacent lanes (Fig. 2Go). On Western blots, the ER{alpha} antibody detected a single band in tissue samples, and this band comigrated with recombinant ER{alpha} protein, which migrated as a 66- to 67-kDa band (Fig. 2AGo). With the ERß LBD antibody (Fig. 2BGo) there were three bands in rat mammary gland tissues. Figure 2DGo is a high magnification of the bands of the blot of the three individual samples from 3-week-old rats. The main bands were in the 62-kDa range. The largest band was very weak, with a size of approximately 65 kDa. As shown in Fig. 2BGo, ERß LBD antibody did not recognize 0.5 pmol ER{alpha} protein, but clearly detected 0.5 pmol ERß 530 protein, which migrated as a 62-kDa band. The 65-kDa band, therefore, also due to the difference in size, cannot be explained as a cross-reaction with ER{alpha}. As the most likely explanation for this band is that it represented nonspecific reaction, we did not include it in the quantitative analysis. ERß LBD antibody also detected recombinant ERß 503 protein, which is composed of the 485-aa sequence of human ERß with an additional 18-aa rat sequence of ERßins in LBD (Fig. 3Go). ERß 503 protein was observed as a band around 58–59 kDa. This indicates that ERß LBD polyclonal antibody must recognize not only wt, but also ERßins protein. In addition, by comparison of the signal of ERß 530 with that of the LBD antibody, we could make the rough estimate that the amount ERß 503 loaded per lane was approximately 0.5 pmol. From these findings, we conclude that the main 62-kDa bands probably represent 1) wild-type ERß, translated from the first methionine of mRNA resulting in a 530-aa-long protein; and 2) ERßins, expected to have 530 plus 18 aa. We observed that a difference of 18 aa between two ERß proteins is not sufficient to allow separation by SDS-PAGE on 9% gels (data not shown). In addition, we developed a specific antibody that only detects ERßins protein. ERß INS antibody was raised against the specific 18-aa polypeptide of rat ERßins (17). This antibody detected ERß 503 protein, but not ERß 530 protein (Fig. 2CGo). In mammary gland samples, this antibody recognized two bands, one around 62 kDa and the other one around 58–59 kDa (Fig. 2CGo). The relative intensities of these two bands varied between samples. Although the 62-kDa band migrates with the main band observed with the LBD antibody and is expected to be 530 plus 18 aa, the 58- to 59-kDa band is only observed with ERß INS antibody. The source of this lower band is uncertain, and it is being further investigated. It could be an ERßins composed of 485 plus 18 aa (503 aa in total), a combination of an exon 3 deletion with ERßins (17), or a degraded form of ERßins that could not be detected by LBD antibody.



View larger version (36K):
[in this window]
[in a new window]
 
Figure 3. Scheme of the recombinant ERß proteins used. 530 aa ERß indicates the human ERß protein translated from the first methionine of the N-terminal sequence. 503 aa ERß is a chimera protein that has human 485-aa ERß sequence and rat 18-aa sequence (gray zone), which is inserted into the LBD [reported as ERß2 by Petersen et al. (17 )]. For reference, 485-aa ERß is shown. This is the transcript from the second methionine of the human ERß sequence and has an identical size as rat ERß translated from the third methionine as first reported by Kuiper et al. (4 ).

 
Quantification of ER proteins
To compare the amounts of ER proteins per µg tissue, the band densities on the blot were measured by photoimager and calculated as moles of receptor. On the ERß blots with LBD antibody, the largest band was not included. The calculated receptor content ranged between 0.02–0.15 pmol/lane for ER{alpha} and 0.10–0.50 pmol/lane for ERß. As is evident from the results shown in Table 1Go, ERß was more abundant than ER{alpha} at every developmental stage of the mammary gland.


View this table:
[in this window]
[in a new window]
 
Table 1. Amounts of ER{alpha} and ERß proteins in 1 µg total protein extract from rat mammary gland

 
Changes in expression of ERs normalized against ß-actin
As is evident from Fig. 2Go, when equal amounts of cytosolic protein from mammary glands at various stages were loaded in each lane, the increase in the receptor content of the gland at lactation was not evident. This is because at lactation milk proteins contribute significantly to the soluble proteins, and the amount of truly cytosolic protein loaded in the samples is less than that at other stages. In an attempt to circumvent the problem of milk protein contamination of the cytosol, all densitometric values were normalized against ß-actin. The ß-actin level in each sample was evaluated by Western blotting of the membranes after analysis of ER{alpha} or ERß. With ß-actin as an internal standard it is clear that both ER{alpha} and ERß proteins had a peak of expression during lactation (Fig. 4Go, A and B). With the same standardization procedure, Western blots with ERßins-specific antibody revealed that the expression of ERßins protein seemed to be regulated independently of wt ERß (Fig. 4CGo).

Changes in mRNA expression
To determine whether transcription was involved in the change in expression of wt ERß and ERßins, an RT-PCR study detecting wt ERß and ERßins mRNAs was performed. The first set of PCR primers is designed for detecting both wt and ßins in one reaction and for evaluating the ratio of these mRNAs (Fig. 5AGo) (18). However, although Lu et al. reported the exact expression ratio of these mRNAs by using essentially the same approach for mouse samples (26), our experience has been that the ratios of wt to ßins were not reproducible when the difference in amounts of wt and ßins were small. Accordingly, we present these data to indicate the relative abundance of wt and ßins mRNAs. As shown in the upper panel of Fig. 5BGo, the balance between wt and ßins expression changed during mammary gland development. It is notable that 3-week-old (immature) rats as well as rats during early pregnancy and late lactation show increased relative levels of ERßins mRNA, whereas 4- and 6-week-old rats seem to have a low level of ERßins mRNA. To confirm this tendency, we developed two other sets of primers. One set detects the total amount of ERß, and the second set detects only the insert sequence of ERßins. PCR reactions with each set of primers were performed independently, and the resulting products were loaded in one lane on an agarose gel (second panel of Fig. 5BGo). As the source of product amplified by ßins-specific primer is a very low abundance message, the intensity of the band is not reliable as a semiquantitative measurement. The lower PCR products shown in the second panel of Fig. 5BGo is the result of 39-cycle amplification using ßins-specific primers. An increase in cycle number could not enhance the intensity of the bands in a linear way (data not shown). Due to these difficulties of accurate quantification of ßins mRNA, the tendency for a change in ERßins mRNA is expressed diagrammatically at the bottom of Fig. 5CGo. Densitometric values of the bands from total ERß primers were normalized against those of GAPDH. Figure 5CGo shows the change in total ERß mRNA expression. In the graph the mean value of 3-week-old rat samples is arbitrarily set at 1. By comparison between the graphs of Fig. 4Go, B and C, as well as Fig. 5CGo, it is apparent that although the variations in levels of ERßins protein seem to be related to those of ERßins mRNA, the expression of wt ERß protein is not directly correlated to the levels of its mRNA. This suggests that mechanisms other than transcriptional control, such as control of degradation and/or of translational efficiency, are involved in regulation of wt ERß protein.

Colocalization of ERßins with ER{alpha}
In cellular systems, ERßins heterodimerizes with and is a dominant negative regulator of ER{alpha} and wt ERß (17, 18).To gain some insight into the possible physiological role of ERßins, we performed double immunostaining using fluorescence-labeled secondary antibodies to evaluate the colocalization of ERßins with ER{alpha}. Figure 6Go is a control study with lactating mammary gland showing the specificity of ERß INS antibody. ERß INS antibody gave mainly nuclear staining, but there was, in addition, some cytoplasmic staining that appeared as small dots. The staining pattern was not changed by preadsorption of the antibody with ERß 530 protein. However, all nuclear staining was abolished when the antibody was preadsorbed with ERß 503 protein, which has the 18-aa sequence of ERßins (Fig. 3Go). Some cytoplasmic staining was left after preadsorption with ERß 503. These results suggest that the nuclear staining is specific for ERßins. Figure 7Go is a representative picture of double staining using ER{alpha} 6F11 mouse monoclonal antibody with ERß INS chicken polyclonal antibody. The green, red, and yellow signals indicate cells expressing ER{alpha} alone, ERßins alone, and both receptors, respectively. Not only epithelial cells, but also some populations of stromal cells (adipocytes), were stained with ERß INS antibody. To focus on the possible role of ERßins in ER{alpha} function, we calculated what percentage of ER{alpha}-expressing epithelial cells also expressed ERßins. Calculations were made from nuclei in six pictures from three individual samples in each category (bottom of Fig. 7Go). In the pregnant mammary gland only about 30% of ER{alpha}-containing cells express ERßins, indicating that in 70% of ER{alpha}-containing cells this receptor is free from ERßins. On the other hand, during lactation, 70–80% of ER{alpha}-containing epithelial cells coexpress ERßins. This indicates that a major part of ER{alpha} in lactation may be antagonized by ERßins expressed in the same nuclei, and this may contribute to the insensitivity of the lactating mammary gland to estradiol that was reported 2 decades ago (27, 28, 29).



View larger version (103K):
[in this window]
[in a new window]
 
Figure 6. Specificity of ERß INS antibody in immunostaining. Frozen sections from rat mammary gland on day 7 of lactation were stained by the indicated antibodies with Cy-3-conjugated antichicken secondary antibodies. Nuclei were labeled with DAPI, and pictures were taken under a fluorescence microscope with suitable filters. B, ERß INS antibody was preincubated overnight with ERß 503 protein, which possessed the inserted sequence of rat ERßins, and was used for staining. C, ERß INS antibody was preincubated with ERß 530 protein (wild-type), which has no inserted sequence and was used for staining. Bars, 50 µm.

 


View larger version (79K):
[in this window]
[in a new window]
 
Figure 7. Coexpression of ER{alpha} and ERßins proteins in rat mammary gland epithelial cells. Frozen sections of rat mammary gland at the indicated developmental stages were sequentially stained with ER{alpha} 6F11 mouse monoclonal, FITC-conjugated antimouse, ERß INS polyclonal chicken, and Cy-3 conjugated anti-chicken antibodies. Nuclear staining was performed with DAPI. Green, red, and yellow signals indicate the cells with ER{alpha} alone, ERßins alone, and coexpression of both proteins, respectively. Captured pictures of these stainings were analyzed with the Open Labo program, and the numbers of cells with ER{alpha} alone, ßins alone, and both receptors were counted. This was performed on six pictures from three individual samples in each category. The percentage ER{alpha}-positive cells also expressing ERßins is calculated and shown at the bottom of figure as the mean with SD. Bars, 50 µm.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Since 1996 when rat ERß was discovered (4), many laboratories have reported the expression of ERß mRNA in various tissues. However, due to the difficulty of obtaining suitable and specific antibodies, there are not many reports on the tissue regulation of ERß proteins. In several studies ERß mRNA has been measured in the mammary gland, and, in general, compared with ER{alpha}, the level of ERß mRNA in the mammary gland of mice and rats is low (5, 17, 30). We also observed with PCR assays that the level of ERß mRNA appears to be lower than that of ER{alpha}. These PCR studies showed that with ERß primers, at least 33 cycles of amplification are needed for the detection, but with ER{alpha}-specific primers, PCR products were visible after 27 cycles (data not shown). Upon evaluation of the receptor proteins, however, ERß appears to be expressed in more cells than ER{alpha} in rats and mice (15, 31). In the case of human samples, Speirs et al. reported that ERß mRNA, evaluated by RT-PCR, and ERß protein, analyzed by immunohistochemistry, were more frequently detected in epithelial cells of normal mammary gland than ER{alpha} (23).

In this report we show that ERß protein is more abundantly expressed than ER{alpha} protein in the rat mammary gland. This is true before puberty, after puberty, during pregnancy, during lactation, and during the postlactation period. The methods used here are based on the assumption that as proteins separated by SDS-PAGE have no three-dimensional structure, antibodies recognize epitopes of target protein in samples and in recombinant proteins with the same efficiency. For ER{alpha} detection we used ER{alpha} 6F11, which was raised against full-length human ER{alpha}. We cannot rule out the possibility that this antibody recognizes rat ER{alpha} less efficiently than human ER{alpha} protein. However, with the homology between human and rat ER{alpha} of 88% (32) it is unlikely that with the entire protein as antigen there would be significant differences in affinity of the antibody for rat and human ER{alpha}, respectively. Moreover, with another ER{alpha} antibody, ER{alpha} MC-20 (Santa Cruz Biotechnology, Inc.), whose antigen is the C-terminal part of mouse ER{alpha}, we obtained results indistinguishable from those presented here (data not shown). For ERß detection the same logic applies, as ERß LBD antibody was raised against human ERß LBD, whose homology to rat is 93% (5). Even if it may be argued that the numbers generated by our assays do not constitute an accurate representation of the cellular concentrations of the two ERs, it is nonetheless clear that ERß protein is more abundantly expressed than ER{alpha} protein. The differences range from a minimum of 2-fold to a maximum of 10-fold.

In an earlier report we showed Western blotting of ERß using similar samples; with that protocol for sample preparation, however, we could not evaluate the molecular size and accurately measure variations in ERß protein (15). When we use a high salt lysis buffer that effectively extracts all DNA-binding proteins, there is a problem of stacking and of broad fuzzy bands on SDS-PAGE (15). In the present study we overcame this problem with trichloroacetic acid, followed by methanol precipitation (33) and obtained bands that were sharp and strong enough for quantitative evaluation.

It is notable that the changes in ERß protein at various stages of mammary gland development were not always paralleled by changes in ERß mRNA. For example, although ERß mRNA increases in late lactation, ERß protein decreases. This discrepancy between mRNA and protein suggests the existence of other critical regulatory mechanisms, such as control of protein degradation and changes in efficiency of translation of mRNA.

Our working hypothesis is that one of the physiological roles of ERß is to act as a negative regulatory partner of ER{alpha}. We have already presented evidence for this idea in the rat uterus (34). In this context, ERß variants such as ERßins and ERßcx may be more important than wt ERß, because they can heterodimerize with and act as dominant negative regulators of ER{alpha} (17, 18, 19, 20). To be a negative regulator two conditions must be met. These are 1) colocalization with ER{alpha} in same nuclei, and 2) presence of at least an equimolar ratio of ERß and ER{alpha} proteins. Our double immunostaining shows that the first condition is met in the lactating mammary gland. In the pregnant mammary gland where ER{alpha} induces progesterone receptor (35, 36, 37), about 70% of ER{alpha} is expressed alone and is free from potential inhibition by ERßins. However, during the lactation period, colocalization of ERßins with ER{alpha} is increased, and in 70–80% of ER{alpha}-containing cells ER{alpha} may be antagonized by ERßins.

The second condition, an equimolar ratio of ER{alpha} and ERßins, is more difficult to demonstrate directly. However, as the molar ratio of ERß to ER{alpha} is approximately 3 during lactation, and there is a significant increase in ERßins protein in the lactating period, it seems clear that there is sufficient ERßins in ER{alpha}-expressing epithelial cells to affect ER{alpha} function.

It is a well known observation that experimentally the lactating mammary gland is estrogen insensitive, i.e. there is no induction of progesterone receptor by doses of estradiol that are effective in the mammary glands of age-matched virgins (27, 28, 29). We present the hypothesis that antagonism of ER{alpha} by ERßins may be the source of this insensitivity.

An important question that arises from this hypothesis is whether there are ligands that activate estrogen receptors during the period of lactation. E2 levels are very low during lactation (38), but there are several possible conditions during which ERßins may be needed to prevent activation of ER{alpha}. These include high levels of phyto- or xenoestrogens (39) and activation of ER via phosphorylation by epidermal growth factor- or insulin-like growth factor-stimulated pathways (40, 41).

A recent paper reported that in the presence of E2 or raloxifene, ERßins can activate the transforming growth factor-ß promoter as efficiently as ER{alpha} and wt ERß (26). This indicates that in addition to antagonism of ER{alpha}, ERßins may have other functions.

In human tissues ERßins is rarely expressed, although ERßcx is frequently observed in normal human breast tissue (24, 42). We speculate that human ERßcx has a role similar to that we have suggested for rat ERßins. If in human lactating breast ERßcx is also induced, antagonism of ER{alpha} by ERßcx may occur. This may contribute to the reduced risk of breast cancer in women who breastfeed their babies, which has been reported in epidemiological studies (43). Further investigation of ERß variants in the normal human breast is clearly needed.


    Acknowledgments
 
Christina Thulin is acknowledged for her skilful Western blotting technique, and Alexander Kovacs for helping with the RT-PCR studies.


    Footnotes
 
1 This work was supported by the Swedish Cancer Society and Karo Bio AB (Huddinge, Sweden). Back

2 Recipient of a fellowship from Wenner-Gren Foundation (Sweden) and a research grant from Scandinavia Japan Sasakawa Foundation. Back

Received December 18, 2000.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Daniel CW, Silberstein GB, Strickland P 1987 Direct action of 17ß-estradiol on mouse mammary ducts analyzed by sustained release implants and steroid autoradiography. Cancer Res 47:6052–6057[Abstract/Free Full Text]
  2. Russo J, Russo IH 1997 Differentiation and breast cancer. Medicina 57:81–91
  3. Green S, Walter P, Kumar V, Krust A, Bornert JM, Argos P, Chambon P 1986 Human oestrogen receptor cDNA: sequence, expression and homology to v-erb-A. Nature 320:134–139[CrossRef][Medline]
  4. Kuiper GG, Enmark E, Pelto-Huikko M, Nilsson S, Gustafsson JÅ 1996 Cloning of a novel receptor expressed in rat prostate and ovary. Proc Natl Acad Sci USA 93:5925–5930[Abstract/Free Full Text]
  5. Enmark E, Pelto-Huikko M, Grandien K, Lagercrantz S, Lagercrantz J, Fried G, Nordenskjold M, Gustafsson JÅ 1997 Human estrogen receptor b-gene structure, chromosomal localization, and expression pattern. J Clin Endocrinol Metab 82:4258–4265[Abstract/Free Full Text]
  6. Kuiper GG, Lemmen JG, Carlsson B, Corton JC, Safe SH, van der Saag PT, van der Burg B, Gustafsson JÅ 1998 Interaction of estrogenic chemicals and phytoestrogens with estrogen receptor b. Endocrinology 139:4252–4263[Abstract/Free Full Text]
  7. Pettersson K, Delaunay F, Gustafsson JÅ 2000 Estrogen receptor b acts as a dominant regulator of estrogen signaling. Oncogene 19:4970–4978[CrossRef][Medline]
  8. Paech K, Webb P, Kuiper GG, Nilsson S, Gustafsson J, Kushner PJ, Scanlan TS 1997 Differential ligand activation of estrogen receptors ERa and ERb at AP1 sites. Science 277:1508–1510[Abstract/Free Full Text]
  9. Patrone C, Pollio G, Vegeto E, Enmark E, de Curtis I, Gustafsson JÅ, Maggi A 2000 Estradiol induces differential neuronal phenotypes by activating estrogen receptor {alpha} or ß. Endocrinology 141:1839–1845[Abstract/Free Full Text]
  10. Poelzl G, Kasai Y, Mochizuki N, Shaul PW, Brown M, Mendelsohn ME 2000 Specific association of estrogen receptor ß with the cell cycle spindle assembly checkpoint protein, MAD2. Proc Natl Acad Sci USA 97:2836–2839[Abstract/Free Full Text]
  11. Kraichely DM, Sun J, Katzenellenbogen JA, Katzenellenbogen BS 2000 Conformational changes and coactivator recruitment by novel ligands for estrogen receptor-{alpha} and estrogen receptor-ß: correlations with biological character and distinct differences among SRC coactivator family members. Endocrinology 141:3534–3545[Abstract/Free Full Text]
  12. Leygue E, Dotzlaw H, Lu B, Glor C, Watson PH, Murphy LC 1998 Estrogen receptor b: mine is longer than yours? J Clin Endocrinol Metab 83:3754–3755[Free Full Text]
  13. Ogawa S, Inoue S, Watanabe T, Hiroi H, Orimo A, Hosoi T, Ouchi Y, Muramatsu M 1998 The complete primary structure of human estrogen receptor ß (hER ß) and its heterodimerization with ER {alpha} in vivo and in vitro. Biochem Biophys Res Commun 243:122–126[CrossRef][Medline]
  14. Fuqua SA, Schiff R, Parra I, Friedrichs WE, Su JL, McKee DD, Slentz-Kesler K, Moore LB, Willson TM, Moore JT 1999 Expression of wild-type estrogen receptor ß and variant isoforms in human breast cancer. Cancer Res 59:5425–5428[Abstract/Free Full Text]
  15. Saji S, Jensen EV, Nilsson S, Rylander T, Warner M, Gustafsson JÅ 2000 Estrogen receptors {alpha} and ß in the rodent mammary gland. Proc Natl Acad Sci USA 97:337–342[Abstract/Free Full Text]
  16. Delaunay F, Pettersson K, Tujague M, Gustafsson JÅ 2000 Functional differences between the amino-terminal domains of estrogen receptors {alpha} and ß. Mol Pharmacol 58:584–590[Abstract/Free Full Text]
  17. Petersen DN, Tkalcevic GT, Koza-Taylor PH, Turi TG, Brown TA 1998 Identification of estrogen receptor ß2, a functional variant of estrogen receptor b expressed in normal rat tissues. Endocrinology 139:1082–1092[Abstract/Free Full Text]
  18. Maruyama K, Endoh H, Sasaki-Iwaoka H, Kanou H, Shimaya E, Hashimoto S, Kato S, Kawashima H 1998 A novel isoform of rat estrogen receptor ß with 18 amino acid insertion in the ligand binding domain as a putative dominant negative regular of estrogen action. Biochem Biophys Res Commun 246:142–147[CrossRef][Medline]
  19. Moore JT, McKee DD, Slentz-Kesler K, Moore LB, Jones SA, Horne EL, Su JL, Kliewer SA, Lehmann JM, Willson TM 1998 Cloning and characterization of human estrogen receptor ß isoforms. Biochem Biophys Res Commun 247:75–78[CrossRef][Medline]
  20. Ogawa S, Inoue S, Watanabe T, Orimo A, Hosoi T, Ouchi Y, Muramatsu M 1998 Molecular cloning and characterization of human estrogen receptor bcx: a potential inhibitor of estrogen action in human. Nucleic Acids Res 26:3505–3512[Abstract/Free Full Text]
  21. Sar M, Welsch F 1999 Differential expression of estrogen receptor-ß and estrogen receptor-{alpha} in the rat ovary. Endocrinology 140:963–971[Abstract/Free Full Text]
  22. Jarvinen TA, Pelto-Huikko M, Holli K, Isola J 2000 Estrogen receptor ß is coexpressed with ER{alpha} and PR and associated with nodal status, grade, and proliferation rate in breast cancer. Am J Pathol 156:29–35[Abstract/Free Full Text]
  23. Speirs V, Adams IP, Walton DS, Atkin SL 2000 Identification of wild-type and exon 5 deletion variants of estrogen receptor b in normal human mammary gland. J Clin Endocrinol Metab 85:1601–1605[Abstract/Free Full Text]
  24. Iwao K, Miyoshi Y, Egawa C, Ikeda N, Noguchi S 2000 Quantitative analysis of estrogen receptor-ß mRNA and its variants in human breast cancers. Int J Cancer 88:733–736[CrossRef][Medline]
  25. Liao J, Xu X, Wargovich MJ 2000 Direct reprobing with anti-ß-actin antibody as an internal control for Western blotting analysis. BioTechniques 28:216–218[Medline]
  26. Lu B, Leygue E, Dotzlaw H, Murphy LJ, Murphy LC 2000 Functional characteristics of a novel murine estrogen receptor-ß isoform, estrogen receptor-ß2. J Mol Endocrinol 25:229–242[Abstract]
  27. Haslam SZ, Shyamala G 1979 Effect of oestradiol on progesterone receptors in normal mammary glands and its relationship with lactation. Biochem J 182:127–131[Medline]
  28. Shyamala G, Ferenczy A 1982 The nonresponsiveness of lactating mammary gland to estradiol. Endocrinology 110:1249–1256[Abstract/Free Full Text]
  29. Mohla S, Clem-Jackson N, Hunter JB 1981 Estrogen receptors and estrogen-induced gene expression in the rat mammary glands and uteri during pregnancy and lactation: changes in progesterone receptor and RNA polymerase activity. J Steroid Biochem 14:501–508[CrossRef][Medline]
  30. Couse JF, Korach KS 1999 Estrogen receptor null mice: what have we learned and where will they lead us? Endocr Rev 20:358–417[Abstract/Free Full Text]
  31. Zeps N, Bentel JM, Papadimitriou JM, Dawkins HJ 1999 Murine progesterone receptor expression in proliferating mammary epithelial cells during normal pubertal development and adult estrous cycle. Association with ER{alpha} and ERß status. J Histochem Cytochem 47:1323–1330[Abstract/Free Full Text]
  32. Koike S, Sakai M, Muramatsu M 1987 Molecular cloning and characterization of rat estrogen receptor cDNA. Nucleic Acids Res 15:2499–2513[Abstract/Free Full Text]
  33. Wang KK, Posner A, Hajimohammadreza I 1996 Total protein extraction from cultured cells for use in electrophoresis and western blotting. BioTechniques 20:662–668[Medline]
  34. Weihua Z, Saji S, Makinen S, Cheng G, Jensen EV, Warner M, Gustafsson JÅ 2000 Estrogen receptor (ER) ß, a modulator of E Ra in the uterus. Proc Natl Acad Sci USA 97:5936–5941[Abstract/Free Full Text]
  35. Shyamala G, Schneider W, Schott D 1990 Developmental regulation of murine mammary progesterone receptor gene expression. Endocrinology 126:2882–2889[Abstract/Free Full Text]
  36. Lin CL, Buttle HL 1991 Progesterone receptor in the mammary tissue of pregnant and lactating gilts and the effect of tamoxifen treatment during late gestation. J Endocrinol 130:251–257[Abstract/Free Full Text]
  37. Couse JF, Korach KS 1999 Estrogen receptor null mice: what have we learned and where will they lead us? Endocr Rev 20:358–417
  38. Sharoni Y, Feldman B, Teuerstein I, Levy J 1984 Protein kinase activity in the rat mammary gland during pregnancy, lactation, and weaning: a correlation with growth but not with progesterone receptor levels. Endocrinology 115:1918–1924[Abstract/Free Full Text]
  39. Kuller LH 1995 The etiology of breast cancer–from epidemiology to prevention. Public Health Rev 23:157–213[Medline]
  40. Kato S, Endoh H, Masuhiro Y, Kitamoto T, Uchiyama S, Sasaki H, Masushige S, Gotoh Y, Nishida E, Kawashima H, Metzger D, Chambon P 1995 Activation of the estrogen receptor through phosphorylation by mitogen-activated protein kinase. Science 270:1491–1494[Abstract/Free Full Text]
  41. Yee D, Lee AV 2000 Crosstalk between the insulin-like growth factors and estrogens in breast cancer. J Mammary Gland Biol Neoplasia 5:107–115[CrossRef][Medline]
  42. Leygue E, Dotzlaw H, Watson PH, Murphy LC 1999 Expression of estrogen receptor ß1, ß2, and ß5 messenger RNAs in human breast tissue. Cancer Res 59:1175–1179[Abstract/Free Full Text]
  43. Lipworth L, Bailey LR, Trichopoulos D 2000 History of breast-feeding in relation to breast cancer risk: a review of the epidemiologic literature. J Natl Cancer Inst 92:302–312[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
CarcinogenesisHome page
S. N. Sundar, C. N. Marconett, V. B. Doan, J. A. Willoughby Sr, and G. L. Firestone
Artemisinin selectively decreases functional levels of estrogen receptor-alpha and ablates estrogen-induced proliferation in human breast cancer cells
Carcinogenesis, December 1, 2008; 29(12): 2252 - 2258.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
T. F.G Lucas, E. R Siu, C. A Esteves, H. P Monteiro, C. A Oliveira, C. S Porto, and M. F. M Lazari
17Beta-Estradiol Induces the Translocation of the Estrogen Receptors ESR1 and ESR2 to the Cell Membrane, MAPK3/1 Phosphorylation and Proliferation of Cultured Immature Rat Sertoli Cells
Biol Reprod, January 1, 2008; 78(1): 101 - 114.
[Abstract] [Full Text] [PDF]


Home page
J DAIRY SCIHome page
E. E. Connor, M. J. Meyer, R. W. Li, M. E. Van Amburgh, Y. R. Boisclair, and A. V. Capuco
Regulation of Gene Expression in the Bovine Mammary Gland by Ovarian Steroids
J Dairy Sci, June 1, 2007; 90(13_suppl): E55 - E65.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
S. N. Sundar, V. Kerekatte, C. N. Equinozio, V. B. Doan, L. F. Bjeldanes, and G. L. Firestone
Indole-3-Carbinol Selectively Uncouples Expression and Activity of Estrogen Receptor Subtypes in Human Breast Cancer Cells
Mol. Endocrinol., December 1, 2006; 20(12): 3070 - 3082.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
A. Lopez, N. Torres, V. Ortiz, G. Aleman, R. Hernandez-Pando, and A. R. Tovar
Characterization and regulation of the gene expression of amino acid transport system A (SNAT2) in rat mammary gland
Am J Physiol Endocrinol Metab, November 1, 2006; 291(5): E1059 - E1066.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
U. Ohnemus, M. Uenalan, J. Inzunza, J.-A. Gustafsson, and R. Paus
The Hair Follicle as an Estrogen Target and Source
Endocr. Rev., October 1, 2006; 27(6): 677 - 706.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
G. Vallejo, C. Ballare, J. Lino Baranao, M. Beato, and P. Saragueta
Progestin Activation of Nongenomic Pathways via Cross Talk of Progesterone Receptor with Estrogen Receptor {beta} Induces Proliferation of Endometrial Stromal Cells
Mol. Endocrinol., December 1, 2005; 19(12): 3023 - 3037.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
E E Connor, D L Wood, T S Sonstegard, A F da Mota, G L Bennett, J L Williams, and A V Capuco
Chromosomal mapping and quantitative analysis of estrogen-related receptor alpha-1, estrogen receptors alpha and beta and progesterone receptor in the bovine mammary gland
J. Endocrinol., June 1, 2005; 185(3): 593 - 603.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
U. Ohnemus, M. Uenalan, F. Conrad, B. Handjiski, L. Mecklenburg, M. Nakamura, J. Inzunza, J.-A. Gustafsson, and R. Paus
Hair Cycle Control by Estrogens: Catagen Induction via Estrogen Receptor (ER)-{alpha} Is Checked by ER{beta} Signaling
Endocrinology, March 1, 2005; 146(3): 1214 - 1225.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
G. Cheng, Y. Li, Y. Omoto, Y. Wang, T. Berg, M. Nord, P. Vihko, M. Warner, Y.-S. Piao, and J.-A. Gustafsson
Differential Regulation of Estrogen Receptor (ER){alpha} and ER{beta} in Primate Mammary Gland
J. Clin. Endocrinol. Metab., January 1, 2005; 90(1): 435 - 444.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
C. Zhao, L. Xu, M. Otsuki, G. Toresson, K. Koehler, Q. Pan-Hammarstrom, L. Hammarstrom, S. Nilsson, J.-A. Gustafsson, and K. Dahlman-Wright
Identification of a functional variant of estrogen receptor beta in an African population
Carcinogenesis, November 1, 2004; 25(11): 2067 - 2073.
[Abstract] [Full Text] [PDF]


Home page
Exp. Biol. Med.Home page
K. P. Tan, J. Chen, W. E. Ward, and L. U. Thompson
Mammary Gland Morphogenesis Is Enhanced by Exposure to Flaxseed or Its Major Lignan During Suckling in Rats
Experimental Biology and Medicine, February 1, 2004; 229(2): 147 - 157.
[Abstract] [Full Text] [PDF]


Home page
Drug Metab. Dispos.Home page
Y. Hu and D. Kupfer
Enantioselective Metabolism of the Endocrine Disruptor Pesticide Methoxychlor by Human Cytochromes P450 (P450s): Major Differences in Selective Enantiomer Formation by Various P450 Isoforms
Drug Metab. Dispos., December 1, 2002; 30(12): 1329 - 1336.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
K.-i. Matsuda, I. Ochiai, M. Nishi, and M. Kawata
Colocalization and Ligand-Dependent Discrete Distribution of the Estrogen Receptor (ER){alpha} and ER{beta}
Mol. Endocrinol., October 1, 2002; 16(10): 2215 - 2230.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. Saji, Y. Omoto, C. Shimizu, M. Warner, Y. Hayashi, S.-i. Horiguchi, T. Watanabe, S.-i. Hayashi, J.-A. Gustafsson, and M. Toi
Expression of Estrogen Receptor (ER) {beta}cx Protein in ER{alpha}-positive Breast Cancer: Specific Correlation with Progesterone Receptor
Cancer Res., September 1, 2002; 62(17): 4849 - 4853.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
P. T. K. Saunders, M. R. Millar, S. Macpherson, D. S. Irvine, N. P. Groome, L. R. Evans, R. M. Sharpe, and G. A. Scobie
ER{beta}1 and the ER{beta}2 Splice Variant (ER{beta}cx/{beta}2) Are Expressed in Distinct Cell Populations in the Adult Human Testis
J. Clin. Endocrinol. Metab., June 1, 2002; 87(6): 2706 - 2715.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
A. V. Capuco, M. Li, E. Long, S. Ren, K. S. Hruska, K. Schorr, and P. A. Furth
Concurrent Pregnancy Retards Mammary Involution: Effects on Apoptosis and Proliferation of the Mammary Epithelium after Forced Weaning of Mice
Biol Reprod, May 1, 2002; 66(5): 1471 - 1476.
[Abstract] [Full Text]


Home page
Biol. Reprod.Home page
R. Nie, Q. Zhou, E. Jassim, P. T.K. Saunders, and R. A. Hess
Differential Expression of Estrogen Receptors {alpha} and {beta} in the Reproductive Tractsof Adult Male Dogs and Cats
Biol Reprod, April 1, 2002; 66(4): 1161 - 1168.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
S. Nilsson, S. Makela, E. Treuter, M. Tujague, J. Thomsen, G. Andersson, E. Enmark, K. Pettersson, M. Warner, and J.-A. Gustafsson
Mechanisms of Estrogen Action
Physiol Rev, October 1, 2001; 81(4): 1535 - 1565.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Saji, S.
Right arrow Articles by Gustafsson, J.-A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Saji, S.
Right arrow Articles by Gustafsson, J.-A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals