help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pak, T. R.
Right arrow Articles by Tsai, P.-S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pak, T. R.
Right arrow Articles by Tsai, P.-S.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*ESTRADIOL
*MENOTROPINS
*TESTOSTERONE
Endocrinology Vol. 142, No. 8 3309-3316
Copyright © 2001 by The Endocrine Society


ARTICLES

Testosterone and Estrogen Act via Different Pathways to Inhibit Puberty in the Male Siberian Hamster (Phodopus sungorus)

Toni R. Pak, G. Robert Lynch and Pei-San Tsai

Department of Environmental, Population and Organismic Biology, University of Colorado, Boulder, Colorado 80309

Address all correspondence and requests for reprints to: Toni R. Pak, Department of Environmental, Population and Organismic Biology, University of Colorado, Campus Box 334, Boulder Colorado 80309. E-mail: toni.pak{at}colorado.edu


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The peripubertal transition in male mammals is accompanied by a gradual decrease in sensitivity to the inhibitory effects exerted by gonadal hormones, such as T and E2. Here, we investigated the effects of chronic T and its metabolites, 5{alpha}-dihydrotestosterone and E2 on the hypothalamo-pituitary-gonadal axis at puberty. We also examined if T effects are distinct or mediated through its conversion to 5{alpha}-dihydrotestosterone or E2. Twenty-day-old male Siberian hamsters were sc implanted with a SILASTIC brand capsule containing varying doses of T, 5{alpha}-dihydrotestosterone, or E2. Several functional parameters of the hypothalamo-pituitary-gonadal axis were evaluated including hypothalamic GnRH concentration, pituitary and plasma FSH levels, pituitary FSH and LH mRNA, and testicular status. Our results showed that gonadal steroids inhibited puberty in a dose-dependent manner as evaluated by testes mass (undiluted steroid: T, 27 ± 3 mg; 5{alpha}-dihydrotestosterone, 18 ± 1 mg; and E2, 62 ± 4 mg relative to cholesterol-implanted controls, 510 ± 42 mg). Also, T decreased plasma FSH below detectable levels, but pituitary FSH concentration was unaffected (1.37 ± 0.16 ng/µg protein) while E2-treated hamsters had normal plasma FSH levels (3.5 ± 0.98 ng/ml) yet significantly lower pituitary FSH concentration (0.09 ± 0.04 ng/µg protein). These results showed that the pathways of T and E2 action on the hypothalamo-pituitary-gonadal axis are distinct.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
IN MOST VERTEBRATE species studied, GnRH is the governing agent of reproduction. In tetrapods, GnRH peptide is released in a pulsatile manner from neuronal terminals located in the median eminence. Upon release, GnRH travels through the hypothalamo-hypophyseal portal system to stimulate the synthesis and release of FSH and LH from the anterior pituitary. In turn, FSH and LH stimulate steroidogenesis and gametogenesis in the gonads. Gonadal steroid hormones, such as T and E2, can feedback negatively on the hypothalamus and/or anterior pituitary to regulate reproduction in mammals. However, in males, very little inhibitory effects are thought to be from the direct actions of T. Rather, the prevailing hypothesis suggests that metabolites of T, such as 5{alpha}-dihydrotestosterone (DHT) and E2, are primarily responsible for the inhibitory effects exerted by T (1, 2).

Several studies have shown that aromatization of T to E2 is required for embryonic sexual differentiation of the brain in diverse vertebrate species including fish, amphibian, bird, and mammal (3, 4, 5). In addition, the induction of adult sexual behavior requires the conversion of T to E2 (6, 7, 8). Lastly, recent work showed that administration of aromatase inhibitors resulted in abnormal spermiogenesis and lower sperm counts in primates, but not in rats (9, 10, 11). Taken together, these studies implicate aromatization of T to E2 as an important component of reproduction in males. However, it remains to be shown whether T exerts unique effects independent of its conversion to E2.

The Siberian hamster, Phodopus sungorus, during the peripubertal transition, is a good model for studying regulatory inputs on the hypothalamo-pituitary-gonadal (HPG) axis. Several studies have shown that their HPG axis is especially sensitive to negative perturbations during the peripubertal transition. First, puberty was delayed for up to 18 wk when juvenile Siberian hamsters were placed under chronic short-day (8-h light, 16-h dark) photoperiod (12). This result is strikingly different from what occurs in another photoperiodic species of hamster (Mesocricetus aureus), in which juveniles were unresponsive to short-day inhibition (13), and puberty proceeded as normal. Second, hormone treatments, such as daily melatonin infusions (14) and injections of NPY (15), were also effective at delaying puberty in the Siberian hamster. Lastly, and most importantly, preliminary data in our laboratory demonstrated that administration of exogenous T prior to pubertal onset inhibited puberty for at least 10 wk (16). Taken together, the sensitivity of the HPG axis to potential feedback agents during the peripubertal period makes the Siberian hamster a useful model system for studying specific feedback actions exerted by individual steroid hormones.

In this study, we used juvenile male Siberian hamsters to elucidate the differential effects of chronic T, DHT, and E2 on the HPG axis during the peripubertal transition. Specifically, we investigated whether androgens (T or DHT) and estrogens use the same mechanisms to exert their inhibitory effects on gonadal development (Exp 1 and 2). In addition, we determined whether the inhibitory effects exerted by T could be reversed upon the removal of exogenous T to allow pubertal development to proceed (Exp 3).


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animals and accommodations
Male Siberian hamsters were raised from birth under long-day photoperiod (16-h light, 8-h dark; lights on at 0430 h) and weaned at 20 d of age. Animals were singly housed in shoe box cages and given water and rodent chow ad libitum. All experimental procedures are in accord with the animal protocols approved by the University of Colorado at Boulder Institutional Animal Care and Use Committee.

Exp 1: effects of T, DHT, and E2 on testes mass, plasma and pituitary FSH, and hypothalamic GnRH concentration
One hundred and forty-one animals at 20 d of age were separated into four treatment groups: cholesterol (Ch, n = 14), T (n = 44), DHT (n = 40), and E2 (n = 43). All steroid hormones were obtained from Sigma (St. Louis, MO). Each treatment group was further subdivided into groups of 13–16 animals, each receiving a different dose of the steroid. Steroids were delivered in SILASTIC brand capsules (Dow Corning, Midland, MI) containing crystalline Ch as a control, or steroid hormones at one of three doses: 1:0 (undiluted), 1:100, or 1:500. In our preliminary studies, doses of 1:2, 1:10, and 1:50 did not yield different results from the intermediate dose of 1:100. Thus, only the doses 1:0, 1:100, and 1:500 were used in this study. Diluted steroid hormones were prepared by mixing the hormone with Ch in a 1:100 or 1:500 ratio by weight. The mixture was dissolved in 100% ethanol, agitated on an orbital shaker, and ethanol allowed to evaporate overnight to restore the mixture to a powder form. SILASTIC brand tubing (outer diameter = 1.96 mm; inner diameter = 1.47 mm) was filled with 1 mm length of crystalline hormone or diluted hormone and sealed on each end with silicon glue. Each filled capsule was allowed to soak in saline (0.9%) for at least 48 h before implant. Animals were lightly anesthetized with Halothane gas and sc implanted between the scapulae with a SILASTIC brand capsule. At 35 d of age, animals were lightly anesthetized with Halothane gas and bled by retro-orbital puncture. This method allows us to obtain repeated blood samples from the same animal and results in fewer contaminants than a trunk bleed. Following retro-orbital bleed, animals were killed by cervical dislocation, and their pituitaries, hypothalami, and testes removed for either the measurements of mass and histological analysis (testes) or hormone levels (hypothalami and pituitaries). Seminal vesicle mass was also recorded as an indicator of androgen stimulation. All animals were inspected for the presence of a SILASTIC brand capsule containing packed hormone. Animals who lacked a capsule or whose capsule did not contain hormone were excluded from the study.

Exp 2: effects of T and E2 on pituitary FSH and LH mRNA levels
Male Siberian hamsters were sc implanted with a SILASTIC brand capsule containing crystalline (1:0) T (n = 14), E2 (n = 13) or Ch (n = 13) at 20 d of age as described in Exp 1. At 35 d of age, the animals were killed by decapitation followed by the immediate removal of the brain and pituitary. Pituitaries were quick-frozen on dry ice and stored at -70 C until processed for Northern blot analysis.

Exp 3: reversibility of T effects on plasma FSH levels and testes mass
Male Siberian hamsters (n = 8) were sc implanted with a SILASTIC brand capsule containing crystalline T (1:0) at 20 d of age as described in Exp 1. At 35 d of age, a blood sample was taken and the implant removed. The animals were killed by cervical dislocation 15 d post implant removal. At that time, a final blood sample was taken and testes mass recorded. Plasma samples were stored at -35 C until processed for the measurement of FSH by RIA.

Exp 4: determination of plasma T and E2 levels following 15 d of treatment
Male Siberian hamsters were sc implanted with a SILASTIC brand capsule containing crystalline T (1:0; n = 10) or E2 (1:0; n = 7) at 20 d of age as described in Exp 1. To determine if endogenous T contributed to overall plasma levels in intact, T-treated animals, half of the T-treated animals (n = 5) were castrated at the time of implant. At 35 d of age, a blood sample was taken and the animals were killed by cervical dislocation. Plasma samples were stored at -35 C until processed for the measurement of T or E2 by RIA. Plasma hormone levels were compared with those of intact adult male hamsters (140 d old; n = 5).

RIA
Plasma and tissue processing. Plasma, pituitaries, and hypothalami were collected from approximately half of the animals in Exp 1 (n = 81). Blood samples were collected by retro-orbital puncture into heparinized microcentrifuge tubes, centrifuged at 2,000 x g at 4 C for 8 min, and stored at -35 C until processed for the measurement of FSH by RIA. Hypothalami and pituitaries were immediately removed after cervical dislocation and quick-frozen on dry ice. Pituitaries were sonicated in 500 µl 0.1 M phosphate buffer and stored at -70 C until processed by FSH RIA. Hypothalami were sonicated on ice in 500 µl 0.1 M phosphate buffer, boiled for 2 min, quick-frozen on dry ice, and stored at -70 C until processed for the measurement of GnRH by RIA.

FSH RIA. Plasma and pituitary FSH levels were determined by a heterologous rat FSH RIA previously validated for the measurement of FSH in the Siberian hamster (17). FSH was the only gonadotropin assayed by RIA in this study due to the lack of a sufficiently sensitive antiserum for the measurements of LH in juvenile Siberian hamsters. rFSH-I9, rFSH-RP2, and rFSH-S-11 from the NIH National Pituitary Program (obtained from Dr. A. F. Parlow, UCLA, Los Angeles, CA) were used as the iodination stock, RIA standard, and antibody, respectively. Briefly, for RIA, 50 µl sample was mixed with 50 µl antiserum (1:20,000 dilution) and allowed to incubate for 20 h at room temperature. On d 2, 100 µl iodinated tracer (20,000 cpm/100 µl) was added to RIA tubes and allowed to incubate for an additional 20 h at room temperature. Antibody-bound hormone was precipitated by the addition of 1 ml 5% polyethylene glycol containing a cocktail of goat antirabbit IgG (1:1000), normal rabbit serum (1:2000), and normal horse serum (1:2000), and separated from the unbound tracer by centrifugation at 2,000 x g. Using this RIA, we found the displacement curves of all serially-diluted plasma and pituitary samples to be parallel to the rat FSH standard. The detection limit of this RIA is 1 ng/ml, and intraassay and interassay coefficients of variation are 6.6 ± 2.4% and 8.9 ± 1.5%, respectively.

GnRH RIA. GnRH RIA was carried out using an antiserum specific for the mammalian form of GnRH (Antibody DJC, a gift from Dr. David J. Chase). The antiserum was characterized in detail elsewhere (18). Radioiodination of GnRH and GnRH RIA were performed according to the protocol described previously (19).

T and E2 RIAs. T and E2 RIA kits were purchased from Diagostics Systems Laboratories, Inc. (Webster, TX). Plasma samples were assayed according to manufacturer’s directions. Briefly, 50 µl (T) or 100 µl (E2) plasma samples were added to tubes pre-coated with primary antibody, followed by the addition of 500 µl iodinated tracer. Tubes were incubated in 37 C water bath for 1 h (T) or 2 h (E2). Tubes were drained for 10 min and then counted on a {gamma} counter for 1 min each. Assay sensitivities are 0.08 ng/ml and 6.5 pg/ml, respectively for T and E2. Both RIAs are highly specific and cross-react minimally with other forms of steroid hormones.

Northern blot analysis
Isolation of total RNA. Total RNA was isolated from pituitaries using the lithium chloride method previously described by Querat et al. (20). Pituitary RNA was isolated from animals treated with either T (n = 14), E2 (n = 13), or Ch (n = 13; see Exp 2).

Generation of FSHß and LHß cDNA probes. Sense and antisense PCR primers for Siberian hamster FSHß and LHß were designed based on the previously published homologous sequences (21). First strand cDNA was synthesized from 1 µg total pituitary RNA using Superscript Preamplification Kit (Life Technologies, Inc., Grand Island, NY) and amplified by PCR using the following primers for FSHß (sense: 5'CCAACATCACCATCGCAGTA; antisense: 5'ACTGGGTATGTGTAGAAGGA) and LHß (sense: 5'GGGCTGCTGCTATGGCTGTT; antisense: 5'GCCACGGGGAAGGAGACCAT). Consistent with the published sequences, a 217-bp fragment for FSHß and a 299-bp fragment for LHß were amplified. Both fragments were gel-isolated and subcloned into pGEM Easy T vector (Promega Corp., Madison, WI). Both constructs were digested with EcoRI to generate cDNA fragments for probe synthesis. 32P-labeled probes were generated by the randomly primed method using the NE Blot Kit (New England Biolabs, Inc., Beverly, MA) according to the manufacturer’s instructions.

Hybridization. Ten micrograms of total RNA pooled from each treatment group was fractionated on a 1% agarose/formaldehyde gel, and transferred onto a nylon membrane using the capillary blotting method. The RNA was cross-linked to the membrane with UV irradiation and hybridized with a randomly-primed 32P-labeled cDNA probe for FSHß mRNA. The blot was sequentially washed with 2x SSC/0.1% SDS followed by 0.1 x SSC/0.1% SDS. Following visualization by autoradiography, the blot was stripped with 0.1 x SSC/0.1% SDS for 2 h at 65 C and rehybridized with a randomly-primed 32P-labeled cDNA probe for LHß. The blot was visualized for the hybridization signal by autoradiography after 3 (FSHß) or 7 (LHß) d. The 28S RNA stained by methylene blue was used as an internal loading control. Signal intensity was analyzed by NIH Image software.

Protein assay
Pituitary and hypothalamic protein concentrations were determined by the Bradford protein assay (Bio-Rad Laboratories, Inc., Hercules, CA) according to the manufacturer’s instructions.

Histology
Testes from 20-d-old, T-treated, E2-treated, and Ch-treated animals (Exp 1) were fixed in Bouin’s fixative for 18–24 h and then stored in 70% ethanol. Testes were run through a standard dehydration series of increasing concentrations of ethanol, defatted, and embedded in paraffin. Ten-micrometer sections were cut on a microtome, mounted on slides, and subsequently stained with hematoxylin and eosin.

Statistical analysis
Differences among treatment groups were analyzed by one-way ANOVA followed by Tukey’s HSD test. Differences were considered significant when P < 0.05.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Exp 1: effects of gonadal steroids on testes mass, plasma and pituitary FSH, and hypothalamic GnRH concentration
Undiluted T, DHT, and E2 (1:0) significantly inhibited testicular growth compared with Ch-treated controls (P < 0.05; Fig. 1Go, Table 1Go). At 1:0 dose, E2-treated animals tended to have greater final testes weights compared with T and DHT, although there was no significant statistical difference between the three hormones at the undiluted dose (P > 0.05). It is possible that with an increased sample size, E2-treated animals would have significantly larger testes compared with T and DHT. At the lower dose of 1:100, E2 was most effective at inhibiting testes growth, while T and DHT had a smaller yet significant effect (Fig. 1Go, Table 1Go). At the 1:500 dilution, only E2 significantly inhibited testicular growth (Fig. 1Go, Table 1Go). Thus, the potency rank of steroid hormones for inhibiting testicular growth is E2 > T = DHT.



View larger version (28K):
[in this window]
[in a new window]
 
Figure 1. Effects of various doses of T, DHT, and E2 on testes mass. Animals received an sc SILASTIC brand implant containing hormone:cholesterol in one of the following doses: 1:0; 1:100; or 1:500. Sham animals received cholesterol only. Dissimilar letters indicate a statistically significant difference among treatment groups. c*, Statistically significant difference from cholesterol-treated controls but not from T or DHT at the same dose (1:500). Data are expressed as mean ± SEM.

 

View this table:
[in this window]
[in a new window]
 
Table 1. Effect of steroid treatments on testes mass, body mass, and seminal vesicle (SV) mass

 
To determine the effects of gonadal steroid hormones on pituitary function, plasma and pituitary FSH levels were measured by RIA. T (1:0) and DHT (1:0) treatments lowered plasma FSH to undetectable levels after 15 d, at 35 d of age (Fig. 2Go). However, at lower doses of 1:100 and 1:500, T and DHT had no significant effect on plasma FSH levels. Further, despite the potency of E2 in reducing testicular mass, it had no significant effect on plasma FSH at any dose.



View larger version (29K):
[in this window]
[in a new window]
 
Figure 2. Effects of various doses of T, DHT, and E2 on plasma FSH levels. Animals received an sc SILASTIC brand implant as described in Fig. 1Go. ND = plasma FSH level was below the limit of detectability (1 ng/ml). *, Statistical significance among treatment groups. Data are expressed as mean ± SEM.

 
Contrary to the effects of T and E2 on plasma FSH levels, E2 significantly decreased pituitary FSH concentration (Fig. 3Go), whereas T and DHT had no effect on pituitary FSH concentration regardless of the dose. E2-treatment, presumably by inducing hypertrophic changes in lactotropes, significantly increased total pituitary protein content compared with that of T, DHT, and control treatments. However, this increase did not contribute to the overall lower concentration of pituitary FSH in E2-treated animals. Per pituitary, the total amount of FSH present was still significantly lower in E2-treated (1:0) animals (21.7 ± 2.2 ng) compared with T (143.4 ± 17.7 ng), DHT (108.0 ± 12.9 ng) and controls (145.3 ± 31.0 ng). Hypothalamic GnRH concentration in all hormone-treated animals did not differ significantly from controls (data not shown). Because the effects of DHT on testicular mass, plasma FSH, and pituitary FSH concentration were identical to T ( Figs. 1–3GoGoGo), it is very likely that both androgens act via the same mechanism. Therefore, subsequent experiments focused on the differences between T and E2 only.



View larger version (28K):
[in this window]
[in a new window]
 
Figure 3. Effects of various doses of T, DHT, and E2 on total pituitary FSH concentration. Animals received an sc SILASTIC brand implant as described in Fig. 1Go. Dissimilar letters indicate a statistically significant difference among treatment groups. Data are expressed as mean ± SEM.

 
Our histological analysis showed that spermatogenesis, indicated by the presence of numerous primary and secondary spermatocytes, as well mature sperm, proceeded normally in Ch-treated animals (Fig. 4AGo). Interestingly, despite their similar inhibitory actions on testicular mass, T and E2 induced very different changes in testicular morphology. T treatment markedly arrested spermatogenesis (Fig. 4BGo). The seminiferous tubules are shrunken, the interstitial space is enlarged, and no spermatocytes are present. In sharp contrast, E2 treatment reduced testicular mass (Fig. 1Go) without halting spermatogenesis (Fig. 4CGo). Numerous primary and secondary spermatocytes are present within the seminiferous tubules, although there is no evidence of mature sperm. In addition, the interstitial space is not enlarged as seen with T treatment, and the seminiferous tubule size is similar to Ch-treated controls (mean tubule diameter = 0.103 ± 0.006 (E2) and 0.12 ± 0.005 (Ch). The differences in testicular morphology suggest that T and E2 act via different mechanisms to induce gonadal regression in juvenile male Siberian hamsters.



View larger version (84K):
[in this window]
[in a new window]
 
Figure 4. Histology of testes from animals treated with (A) Ch, (B) T, or (C) E2. Bar, 20 µm. Note mature sperm in Ch-treated controls (arrows), enlarged interstitial space in T-treated animals (arrowheads in B), and abundant secondary spermatocytes (arrowheads in C) in E2-treated animals.

 
Although gonadal growth was inhibited with steroid hormones during the peripubertal phase, overall somatic growth was unaffected (Table 1Go). All animals gained weight and the final mean body mass for each treatment group was similar to Ch-treated animals (Table 1Go). As expected, animals treated with T at doses 1:0 and 1:100 had larger seminal vesicles than cholesterol-implanted controls (P < 0.05; Table 1Go). Seminal vesicle mass was also significantly greater in animals treated with T or DHT compared with those treated with E2 (P < 0.05).

Exp 2: effect of T and E2 on pituitary FSH and LH mRNA levels
Consistent with the previous report (21), a single 0.6-kb transcript for LHß and 1.7-kb transcript for FSHß were observed (Fig. 5Go). Both T and E2 treatments markedly decreased pituitary FSH mRNA levels, with E2 treatment having a more pronounced effect than T. E2 and T treatments caused a 62.5% and 37.5% reduction, respectively, in steady-state FSHß mRNA levels compared with the Ch control (Fig. 5Go). Further, both T and E2 suppressed pituitary steady-state LHß mRNA down to undetectable levels (Fig. 5Go).



View larger version (75K):
[in this window]
[in a new window]
 
Figure 5. Northern blot analysis of LHß (upper panel) and FSHß (middle panel) mRNA isolated from T and E2-treated hamsters. Size markers are indicated at the right, and the arrows indicate positions of LHß and FSHß transcripts. Lower panel shows 28S RNA stained with methylene blue to demonstrate equal loading.

 
Exp 3: reversibility of T effects on plasma FSH levels and testes mass
Similar to the results from Exp 1, T-treated hamsters at 35 d of age (immediately before implant removal) had undetectable plasma FSH levels (data not shown). However, 15 d post implant removal, FSH levels in T-treated animals (4.26 ± 1.02 ng/ml) were restored to the same level as Ch-treated controls (3.09 ± 0.74 ng/ml). In addition, testes mass was significantly increased from an initial regressed size of 27 ± 3 mg (values from Exp 1) before implant removal to 216 ± 15 mg 15 d post implant removal. Histological analysis also revealed evidence of spermatogenesis, indicating restored function (data not shown).

Exp 4: determination of plasma T and E2 levels following 15 d of treatment
T-treated animals had similar plasma T levels as those found in adult intact animals (Fig. 6AGo). Of the T-treated group, there was no difference between castrated and intact animals. Thus, the testes of juvenile T-treated animals do not substantially add to the overall levels of plasma T. Unexpectedly, E2-treated animals also had similar plasma E2 levels as adult intact animals (Fig. 6BGo). Although previous measurements of plasma E2 levels in male Siberian hamsters have not been reported, the dose of E2 we administered is clearly within the normal physiological range of adult males.



View larger version (22K):
[in this window]
[in a new window]
 
Figure 6. Effects of T (1:0) and E2 (1:0) SILASTIC brand implants on plasma T (A) and E2 (B) levels. Animals received an sc SILASTIC brand implant as described in Fig. 1Go. Data are expressed as mean ± SEM. There were no statistical differences among groups in either treatment.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Our study revealed two novel outcomes. First, T and its metabolites, DHT and E2,, inhibited puberty in male Siberian hamsters, as evidenced by their regressed gonads (Fig. 1Go). This is contrary to what was expected as many studies have reported an observed decrease in sensitivity to the inhibitory effects of gonadal steroids during the pubertal transition (22). Our study is the first to report an inhibitory effect of gonadal steroids on puberty in a rodent species. Second, T and E2 act through distinct mechanisms to inhibit reproductive function. Because both T and E2 were given at adult physiological levels, we expected similar effects based on the prevailing view that the actions of T in males are primarily through its conversion to E2. The greatest divergence of T and E2 actions came from their differential effects on 1) circulating and pituitary FSH (Figs. 2Go and 3Go), and 2) testicular morphology (Fig. 4Go).

Our data for pituitary and plasma FSH levels indicate the inhibitory actions of T and E2 on the HPG axis are clearly distinct. Our results showed that T treatment decreased plasma FSH levels without affecting pituitary FSH, whereas E2 treatment decreased pituitary FSH concentration without affecting plasma FSH (Figs. 2Go and 3Go). Therefore, the inhibitory actions exerted by T might be primarily at the level of the pituitary to inhibit FSH release. In T-treated animals, pituitary FSH concentration was normal. Although FSH steady-state mRNA was reduced (Fig. 5Go), the reduction was less than that in E2-treated animals. This suggests that the pituitary is still capable of synthesizing FSH in sufficient quantities to maintain normal FSH stores in the pituitary. However, circulating FSH was not detectable with T treatment, suggesting appropriate amounts of FSH were not released from the pituitary. Conversely, the observed normal circulating level of FSH with E2 treatment suggests that E2 did not affect pituitary FSH release. Rather, the very low levels of pituitary FSH concentration coupled with the dramatic decrease in steady-state mRNA suggests that the actions of E2 might be at the level of FSH synthesis and accumulation. In fact, in E2-treated animals, there is a clear dissociation between FSH synthesis and release. E2-treated animals need to release disproportionately higher amounts of FSH to maintain normal circulating FSH levels. This dissociation could be due to 1) attenuated pituitary responsiveness to GnRH, leading to decreased synthesis, and 2) an increase in basal FSH secretion independent of GnRH stimuli. Ebling et al. (23) found that E2 treatment of adult hypogonadal mice resulted in enhanced circulating FSH and spermatogenesis. Because hypogonadal mice lack endogenous GnRH, this finding lends support to the hypothesis that E2 stimulates basal FSH release from the anterior pituitary independent of GnRH.

Despite their similar inhibitory actions on testicular mass, T and E2 induced very different changes in testicular morphology (Fig. 4Go). Although both hormone treatments significantly decreased testicular mass, spermatogenesis proceeded in E2-treated, but not T-treated animals. These differences in testicular morphology suggest that T and E2 act via different mechanisms to induce gonadal regression in juvenile male Siberian hamsters. In addition, the testicular morphology of E2- and T-treated animals correlated well with plasma FSH levels. Because FSH is required for normal spermatogenesis, low plasma FSH levels in T-treated animals correspond to the observed arrest of spermatogenesis. However, plasma FSH was unaffected by E2 treatment (Fig. 2Go) and consequently, spermatogenesis proceeded (Fig. 4Go). Evidence that E2 is important for normal testicular function was recently reported by Pentikainen et al. (24). They discovered that germ cell apoptosis in cultured human seminiferous tubules could be prevented with E2 treatment. However, it is interesting to note that in our peripubertal hamsters, E2-treatment significantly reduced testes mass despite the appearance of normal spermatogenesis. In our study, E2 treatment also reduced steady-state LH mRNA to undetectable levels (Fig. 4Go). This raises the possibility that LH, but not FSH, is required for the normal increase in testicular mass during the peripubertal transition in Siberian hamsters. Studies on the estrogen receptor-{alpha} null (ERKO) mice further support a critical role of E2 in normal spermatogenesis. ERKO mice lack mature sperm in the testes and are therefore infertile (25). Although ERKO mice have normal spermatogenesis through puberty, by 3–5 months of age the testes show significant morphological differences and lower sperm counts compared with wild-type males (25). Thus, it appears that E2 is required for the postpubertal maintenance of spermatogenesis in mice. We also observed that the negative feedback actions of T during puberty did not permanently affect testicular growth. Upon the removal of T implant, plasma FSH levels were significantly higher after 1 d (data not shown), and by 15 d post implant removal, testes mass increased significantly, and plasma FSH levels were similar to controls. These results suggest that the administration of exogenous T to Siberian hamsters during the peripubertal period did not permanently damage the normal processes required for testicular growth and spermatogenesis.

The Siberian hamster is an extremely photoperiodic species; consequently gonadal regression occurs within 4–6 wk after chronic exposure to a short-day photoperiod (8-h light, 16-h dark) (26). It is possible that in this species gonadal steroids do not act directly on the HPG axis but act more upstream through a common neural pathway that controls photoperiod-induced regression (i.e. the retinal-suprachiasmatic nucleus-pineal axis). However, given some of the divergent responses between photoinhibited and steroid- inhibited animals, we do not believe this is likely. For instance, photoperiod-induced testicular regression was accompanied by physiological changes, such as weight loss and pelage color change, that were not observed in animals induced to regress with steroids. While a common pathway more downstream may exist, there is clearly a photoperiodic component distinct from the pathway of steroid-induced inhibition.

The mechanisms by which gonadal steroids modulate the HPG axis during the pubertal transition remain enigmatic. Despite strong evidence supporting an inhibitory role for sex steroids on GnRH neurosecretory cells (27, 28), little is known about the mechanisms by which steroids exert negative feedback effects on GnRH neurons. Until recently, it was generally accepted that GnRH neurons do not have androgen or estrogen receptors (29, 30, 31), and the effects of steroid hormones are mediated indirectly by noradrenergic and opiatergic afferents that synapse on GnRH neurons (32, 33, 34). More recently, the presence of E2 receptors (ER) on GnRH neuronal cell bodies have been detected (35, 36, 37). However, a direct physiological role of ER on the overall secretory activity of GnRH neurons has not yet been established.

Our results showed that the plasma T and E2 levels of juvenile hamsters implanted with undiluted (1:0) T or E2 capsules was similar to that of adult, intact, male hamsters. While these levels are certainly higher than the circulating T or E2 of juvenile males, they did not exceed the physiological limit of the species. Our measurements of plasma levels of T and E2 also revealed that different levels of circulating T (0.96 ± 0.4 ng/ml) and E2 (0.38 ± 0.07 ng/ml) resulted from SILASTIC brand implants of the same size (1 mm). Although we acknowledge the importance of administering "equivalent" doses of hormones for making meaningful physiological comparisons, we do not believe the differences in the doses of T and E2 administered contribute to the differences in their effects. When comparing different hormones, it is difficult to interpret what "equivalent" doses are. First, these hormones all have different levels of receptors, binding proteins, and clearance rates. Therefore, even if the same dose was administered initially, the physiological properties of each hormone are sufficiently different to render this kind of comparison inconsequential. Second, because T can be converted intracellulary to either DHT or E2, we cannot determine precisely how much of each hormone to administer exogenously to achieve "equivalent" circulating doses. Third, both T and E2 are within normal adult physiological levels; thus, we do not believe that the divergent effects of T and E2 are the result of administering either hormone at pharmacological levels. Overall, our experimental design was not aimed to mimic normal physiological hormonal milieu at the time of puberty, but rather to try and discern the differential actions of each hormone during this developmental transition.

To our knowledge, this is the first report of steroidinduced inhibition of puberty in rodents. Collectively our results are similar to the work of Godfrey et al. (38) who found gonadal steroids (T, DHT, and E2) inhibited testicular development in prepubertal bull calves. In their study, testicular function, evaluated based on spermatogenic activity, was impaired for at least 6 months after steroid implant removal. However, by 23 months of age (17 months after implant removal), the bull calves had similar testes size and degree of spermatogenic activity as untreated controls. Interestingly, Godfrey et al. (38) showed that the effects of T, DHT, and E2, on plasma FSH and spermatogenesis are indistinguishable, whereas our data showed that E2 and T act via distinct pathways. Our data and the work of Godfrey et al. (38) suggest that a change in the sensitivity of the reproductive axis to inhibitory steroid feedback might be one of the critical cues needed for normal puberty to occur.

In summary, our data indicate T and E2 act via different mechanisms to induce gonadal regression in prepubertal male Siberian hamsters. Although it is unlikely that male peripubertal hamsters normally experience high circulating levels of T and E2, this is one approach for understanding how androgens and estrogens act differently to modulate reproductive function. Further, preliminary experiments in our laboratory showed that peripubertal hamsters respond very differently to E2 than adult hamsters (data not shown). This provides evidence for the idea that the HPG axis changes in its response to steroid hormones as the animal attains reproductive maturity. Thus, the Siberian hamster provides an excellent model for the study of steroid negative feedback mechanisms during pubertal development. Further, the prevailing hypothesis suggests that in male mammals, the conversion of T to E2 is the primary mechanism regulating steroid hormone feedback during reproduction. However, our data clearly indicate a separate pathway for the actions of E2 on the male reproductive system.


    Acknowledgments
 
We would like to thank Kim Henderson and Karen Stevenson for their help in data collection.


    Footnotes
 
This work was supported in part by National Science Foundation IBN-9996398 (to P.-S.T.) and a Research Grant from the University of Colorado (to G.R.L.).

Abbreviations: Ch, Cholesterol; DHT, 5{alpha}-dihydrotestosterone; ER, E2 receptors; ERKO, estrogen receptor-{alpha} null; HPG, hypothalamo-pituitary-gonadal.

Received March 19, 2001.

Accepted for publication April 5, 2001.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Hileman SM, Jackson GL 1999 Regulation of gonadotropin-releasing hormone secretion by testosterone in male sheep. J Reprod Fertil Suppl 54:231–242[Medline]
  2. Roselli CE, Resko JA 1993 Aromatase activity in the rat brain: hormonal regulation and sex differences. J Steroid Biochem Mol Biol 44:499–508[CrossRef][Medline]
  3. Balthazart J 1997 Steroid control and sexual differentiation of brain aromatase. J Steroid Biochem Mol Biol 61:323–339[CrossRef][Medline]
  4. Tsai CL, Wang LH, Chang CF, Kao CC 2000 Effects of gonadal steroids on brain serotonergic and aromatase activity during the critical period of sexual differentiation in tilapia, Oreochromis mossambicus. J Neuroendocrinol 12:894–898[CrossRef][Medline]
  5. Hutchison JB, Wozniak A, Beyer C, Karolczak M, Hutchison RE 1999 Steroid metabolising enzymes in the determination of brain gender. J Steroid Biochem Mol Biol 69:85–96[CrossRef][Medline]
  6. Romeo RD, Wade J, Venier JE, Sisk CL 1999 Androgenic regulation of hypothalamic aromatase activity in prepubertal and postpubertal male golden hamsters. Endocrinology 140:112–117[Abstract/Free Full Text]
  7. Balthazart J, Foidart A 1993 Brain aromatase and the control of male sexual behavior. J Steroid Biochem Mol Biol 44:521–540[CrossRef][Medline]
  8. Vagell ME, McGinnis MY 1997 The role of aromatization in the restoration of male rat reproductive behavior. J Neuroendocrinol 9:415–421[CrossRef][Medline]
  9. Turner KJ, Morley M, Atanassova N, Swanston ID, Sharpe RM 2000 Effect of chronic administration of an aromatase inhibitor to adult male rats on pituitary and testicular function and fertility. J Endocrinol 164:225–238[Abstract]
  10. Shetty G, Krishnamurthy H, Krishnamurthy HN, Bhatnagar S, Moudgal RN 1997 Effect of estrogen deprivation on the reproductive physiology of male and female primates. J Steroid Biochem Mol Biol 61:157–166[CrossRef][Medline]
  11. Shetty G, Krishnamurthy H, Krishnamurthy HN, Bhatnagar S, Moudgal RN 1998 Effect of long-term treatment with aromatase inhibitor on testicular function of adult male bonnet monkeys (M. radiata). Steroids 63:414–420[CrossRef][Medline]
  12. Hoffman K 1978 Effects of short photoperiods on puberty, growth, and moult in the Djungarian hamster (Phodopus sungorus). J Reprod Fert 54:29–35[Abstract/Free Full Text]
  13. Rissman EF 1980 Prepubertal sensitivity to melatonin in male hamsters. Biol Reprod 22:277–280[Abstract]
  14. Carter DS, Goldman BD 1983 Antigonadal effects of timed melatonin infusion in pinealectomized male Djungarian hamsters (Phodopus sungorus sungorus): duration is the critical parameter. Endocrinology 113:1261–1267[Abstract/Free Full Text]
  15. Lynch GR, Sisitski M 1999 Neuropeptide Y inhibits puberty in Siberian hamsters. Program of the 29th Annual Meeting of the Society for Neuroscience, Miami Beach, FL, 1999, 25:796 (Abstract)
  16. Pak TR, Henderson K, Lynch GR 1998 Steroid feedback delays puberty in male Siberian hamsters. Program of the 28th Annual Meeting of the Society for Neuroscience, Los Angeles, CA 24:1381 (Abstract)
  17. Prendergast BJ, Hugenberger JL 1999 Frequency coding of melatonin signals sufficient to induce testicular growth in photoregressed Siberian hamsters. J Neuroendocrinol 11:237–241[CrossRef][Medline]
  18. Zhang L, Wayne NL, Sherwood NM, Postigo HR, Tsai P-S 2000 Biological and immunological characterization of multiple GnRH in an opisthobranch mollusk, Aplysia californica. Gen Comp Endocrinol 118:77–89[CrossRef][Medline]
  19. Tsai P-S, Licht P 1993 In vivo GnRH responsiveness of LH secretion in the female turtle, Trachemys scripta, in relation to the reproductive stage. Gen Comp Endocrinol 90:328–337[CrossRef][Medline]
  20. Querat B, Hardy A, Fontaine YA 1991 Regulation of the type-II gonadotrophin {alpha} and ß subunit mRNAs by oestradiol and testosterone in the European eel. J Mol Endocrinol 7:81–86[Abstract/Free Full Text]
  21. Bernard DJ, Abuav-Nussbaum R, Horton TH, Turek FW 1999 Photoperiodic effects on gonadotropin-releasing hormone (GnRH) content and the GnRHimmunoreactive neuronal system of male Siberian hamsters. Biol Reprod 60:272–276[Abstract/Free Full Text]
  22. Reiter EO 1982 Neuroendocrine control mechanisms and the onset of puberty. Ann Rev Physiol 44:595–613[CrossRef][Medline]
  23. Ebling FJ, Brooks AN, Cronin AS, Ford H, Kerr JB 2000 Estrogenic induction of spermatogenesis in the hypogonadal mouse. Endocrinology 141:2861–2869[Abstract/Free Full Text]
  24. Pentikainen V, Erkkila K, Suomalainen L, Parvinen M, Dunkel L 2000 Estradiol acts as a germ cell survival factor in the human testis in vitro. J Clin Endocrinol Metab 85:2057–2067[Abstract/Free Full Text]
  25. Eddy EM, Washburn TF, Bunch DO, et al. 1996 Targeted disruption of the estrogen receptor gene in male mice causes alteration of spermatogenesis and infertility. Endocrinology 137:4796–4805[Abstract]
  26. Anchordoquy HC, Lynch GR 2000 Timing of testicular recrudescence in Siberian hamsters is unaffected by pinealectomy or long-day photoperiod after 9 weeks in short-day. J Biol Rhythms 15:404–416
  27. Angelini NL, Belsham DD 1999 Estrogen directly represses gonadotropin-releasing hormone (GnRH) gene expression in estrogen receptor-alpha (ER{alpha})- and ERß-expressing GT1–7 GnRH neurons. Endocrinology 140:5045–5053[Abstract/Free Full Text]
  28. Belsham DD, Evangelou A, Roy D, Duc VL, Brown TJ 1998 Regulation of gonadotropin-releasing hormone (GnRH) gene expression by 5{alpha}-dihydrotestosterone in GnRH-secreting GT1–7 hypothalamic neurons. Endocrinology 139:1108–1114[Abstract/Free Full Text]
  29. Herbison AE, Theodosis DT 1992 Localization of oestrogen receptors in preoptic neurons containing neurotensis but not tyrosine hydroxylase, cholecystokinin or luteinizing hormone-releasing hormone in the male and female rat. Neuroscience 50:283–298[CrossRef][Medline]
  30. Lehman MN, Karsch FJ 1993 Do gonadotropin-releasing hormone, tyrosine hydroxylase, and ß-endorphin-immunoreactive neurons contain estrogen receptors? A double-label immunocytochemical study in the Suffolk ewe. Endocrinology 133:887–995[Abstract/Free Full Text]
  31. Herbison AE, Horvath TL, Naftolin F, Leranth C 1995 Distribution of estrogen receptor-immunoreactive cells in monkey hypothalamus: relationship to neurones containing luteinizing hormone-releasing hormone and tyrosine hydroxylase. Neuroendocrinol 61:1–10[CrossRef][Medline]
  32. Kalra SP, Horvath T, Naftolin F, Xu B, Pu S, Kalra PS 1997 The interactive language of the hypothalamus for the gonadotropin releasing hormone (GnRH) system. J Neuroendocrinol 9:569–576[CrossRef][Medline]
  33. Kimura F, Funabashi T 1998 Two subgroups of gonadotropin-releasing hormone neurons control gonadotropin secretion in rats. News Physiol Sci 13:225–231[Abstract/Free Full Text]
  34. Terasawa E 1998 Cellular mechanisms of pulsatile LHRH release. Gen Comp Endocrinol 112:283–295[CrossRef][Medline]
  35. Butler JA, Sjöberg M, Coen CW 1999 Evidence for oestrogen receptor {alpha}immunoreactivity in gonadotrophin-releasing hormone-expressing neurons. J Neuroendocrinol 11:331–335[CrossRef][Medline]
  36. Skynner MJ, Sim JA, Herbison AE 1999 Detection of estrogen receptor {alpha} and ß messenger ribonucleic acids in adult gonadotropin-releasing hormone neurons. Endocrinology 140:5195–5201[Abstract/Free Full Text]
  37. Hrabovszky E, Shughrue PJ, Merchenthaler I, et al. 2000 Detection of estrogen receptor-ß messenger ribonucleic acid and 125I-estrogen binding sites in luteinizing hormone-releasing hormone neurons of the rat brain. Endocrinology 141:3506–3509[Abstract/Free Full Text]
  38. Godfrey RW, Lunstra DD, Schanbacher BD 1992 Effect of implanting bull calves with testosterone propionate, dihydrotestosterone propionate or oestradiol-17ß prepubertally on the pituitary-testicular axis and on postpubertal social and sexual behavior. J Reprod Fertil 94:57–69[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J EndocrinolHome page
S. J Meachem, S. Schlatt, S. M Ruwanpura, and P. G Stanton
The effect of testosterone, dihydrotestosterone and oestradiol on the re-initiation of spermatogenesis in the adult photoinhibited Djungarian hamster
J. Endocrinol., March 1, 2007; 192(3): 553 - 561.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
P.-S. Tsai, S. M. Moenter, H. R. Postigo, M. El Majdoubi, T. R. Pak, J. C. Gill, S. Paruthiyil, S. Werner, and R. I. Weiner
Targeted Expression of a Dominant-Negative Fibroblast Growth Factor (FGF) Receptor in Gonadotropin-Releasing Hormone (GnRH) Neurons Reduces FGF Responsiveness and the Size of GnRH Neuronal Population
Mol. Endocrinol., January 1, 2005; 19(1): 225 - 236.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
T. S. McMullin, M. E. Andersen, A. Nagahara, T. D. Lund, T. Pak, R. J. Handa, and W. H. Hanneman
Evidence That Atrazine and Diaminochlorotriazine Inhibit the Estrogen/Progesterone Induced Surge of Luteinizing Hormone in Female Sprague-Dawley Rats Without Changing Estrogen Receptor Action
Toxicol. Sci., June 1, 2004; 79(2): 278 - 286.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
B. T. Akingbemi, C. M. Sottas, A. I. Koulova, G. R. Klinefelter, and M. P. Hardy
Inhibition of Testicular Steroidogenesis by the Xenoestrogen Bisphenol A Is Associated with Reduced Pituitary Luteinizing Hormone Secretion and Decreased Steroidogenic Enzyme Gene Expression in Rat Leydig Cells
Endocrinology, February 1, 2004; 145(2): 592 - 603.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
T. R. Pak, G. R. Lynch, D. M. Ziegler, J. B. Lunden, and P.-S. Tsai
Disruption of pubertal onset by exogenous testosterone and estrogen in two species of rodents
Am J Physiol Endocrinol Metab, January 1, 2003; 284(1): E206 - E212.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
T. R. Pak, G. R. Lynch, and P.-S. Tsai
Differential Alteration of the Reproductive Axis by Testosterone and Estrogen in Peripubertal and Adult Male Siberian Hamsters (Phodopus sungorus)
Biol Reprod, September 1, 2002; 67(3): 706 - 711.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pak, T. R.
Right arrow Articles by Tsai, P.-S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pak, T. R.
Right arrow Articles by Tsai, P.-S.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*ESTRADIOL
*MENOTROPINS
*TESTOSTERONE


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals