| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Department of Environmental, Population and Organismic Biology, University of Colorado, Boulder, Colorado 80309
Address all correspondence and requests for reprints to: Toni R. Pak, Department of Environmental, Population and Organismic Biology, University of Colorado, Campus Box 334, Boulder Colorado 80309. E-mail: toni.pak{at}colorado.edu
| Abstract |
|---|
|
|
|---|
-dihydrotestosterone and E2 on
the hypothalamo-pituitary-gonadal axis at puberty. We also examined if
T effects are distinct or mediated through its conversion to
5
-dihydrotestosterone or E2. Twenty-day-old male Siberian hamsters
were sc implanted with a SILASTIC brand capsule containing varying
doses of T, 5
-dihydrotestosterone, or E2. Several functional
parameters of the hypothalamo-pituitary-gonadal axis were evaluated
including hypothalamic GnRH concentration, pituitary and plasma FSH
levels, pituitary FSH and LH mRNA, and testicular status. Our results
showed that gonadal steroids inhibited puberty in a dose-dependent
manner as evaluated by testes mass (undiluted steroid: T, 27 ± 3
mg; 5
-dihydrotestosterone, 18 ± 1 mg; and E2, 62 ± 4 mg
relative to cholesterol-implanted controls, 510 ± 42 mg). Also, T
decreased plasma FSH below detectable levels, but pituitary FSH
concentration was unaffected (1.37 ± 0.16 ng/µg protein) while
E2-treated hamsters had normal plasma FSH levels (3.5 ± 0.98
ng/ml) yet significantly lower pituitary FSH concentration (0.09
± 0.04 ng/µg protein). These results showed that the pathways of T
and E2 action on the hypothalamo-pituitary-gonadal axis are
distinct. | Introduction |
|---|
|
|
|---|
-dihydrotestosterone (DHT)
and E2, are primarily responsible for the inhibitory effects
exerted by T (1, 2). Several studies have shown that aromatization of T to E2 is required for embryonic sexual differentiation of the brain in diverse vertebrate species including fish, amphibian, bird, and mammal (3, 4, 5). In addition, the induction of adult sexual behavior requires the conversion of T to E2 (6, 7, 8). Lastly, recent work showed that administration of aromatase inhibitors resulted in abnormal spermiogenesis and lower sperm counts in primates, but not in rats (9, 10, 11). Taken together, these studies implicate aromatization of T to E2 as an important component of reproduction in males. However, it remains to be shown whether T exerts unique effects independent of its conversion to E2.
The Siberian hamster, Phodopus sungorus, during the peripubertal transition, is a good model for studying regulatory inputs on the hypothalamo-pituitary-gonadal (HPG) axis. Several studies have shown that their HPG axis is especially sensitive to negative perturbations during the peripubertal transition. First, puberty was delayed for up to 18 wk when juvenile Siberian hamsters were placed under chronic short-day (8-h light, 16-h dark) photoperiod (12). This result is strikingly different from what occurs in another photoperiodic species of hamster (Mesocricetus aureus), in which juveniles were unresponsive to short-day inhibition (13), and puberty proceeded as normal. Second, hormone treatments, such as daily melatonin infusions (14) and injections of NPY (15), were also effective at delaying puberty in the Siberian hamster. Lastly, and most importantly, preliminary data in our laboratory demonstrated that administration of exogenous T prior to pubertal onset inhibited puberty for at least 10 wk (16). Taken together, the sensitivity of the HPG axis to potential feedback agents during the peripubertal period makes the Siberian hamster a useful model system for studying specific feedback actions exerted by individual steroid hormones.
In this study, we used juvenile male Siberian hamsters to elucidate the differential effects of chronic T, DHT, and E2 on the HPG axis during the peripubertal transition. Specifically, we investigated whether androgens (T or DHT) and estrogens use the same mechanisms to exert their inhibitory effects on gonadal development (Exp 1 and 2). In addition, we determined whether the inhibitory effects exerted by T could be reversed upon the removal of exogenous T to allow pubertal development to proceed (Exp 3).
| Materials and Methods |
|---|
|
|
|---|
Exp 1: effects of T, DHT, and E2 on testes mass, plasma and
pituitary FSH, and hypothalamic GnRH concentration
One hundred and forty-one animals at 20 d of age were
separated into four treatment groups: cholesterol (Ch, n = 14), T
(n = 44), DHT (n = 40), and E2 (n = 43). All steroid
hormones were obtained from Sigma (St. Louis, MO). Each
treatment group was further subdivided into groups of 1316 animals,
each receiving a different dose of the steroid. Steroids were delivered
in SILASTIC brand capsules (Dow Corning, Midland, MI) containing
crystalline Ch as a control, or steroid hormones at one of three doses:
1:0 (undiluted), 1:100, or 1:500. In our preliminary studies, doses of
1:2, 1:10, and 1:50 did not yield different results from the
intermediate dose of 1:100. Thus, only the doses 1:0, 1:100, and 1:500
were used in this study. Diluted steroid hormones were prepared by
mixing the hormone with Ch in a 1:100 or 1:500 ratio by weight. The
mixture was dissolved in 100% ethanol, agitated on an orbital shaker,
and ethanol allowed to evaporate overnight to restore the mixture to a
powder form. SILASTIC brand tubing (outer diameter = 1.96 mm;
inner diameter = 1.47 mm) was filled with 1 mm length of
crystalline hormone or diluted hormone and sealed on each end with
silicon glue. Each filled capsule was allowed to soak in saline (0.9%)
for at least 48 h before implant. Animals were lightly
anesthetized with Halothane gas and sc implanted between the scapulae
with a SILASTIC brand capsule. At 35 d of age, animals were
lightly anesthetized with Halothane gas and bled by retro-orbital
puncture. This method allows us to obtain repeated blood samples from
the same animal and results in fewer contaminants than a trunk bleed.
Following retro-orbital bleed, animals were killed by cervical
dislocation, and their pituitaries, hypothalami, and testes removed for
either the measurements of mass and histological analysis (testes) or
hormone levels (hypothalami and pituitaries). Seminal vesicle mass was
also recorded as an indicator of androgen stimulation. All animals were
inspected for the presence of a SILASTIC brand capsule containing
packed hormone. Animals who lacked a capsule or whose capsule did not
contain hormone were excluded from the study.
Exp 2: effects of T and E2 on pituitary FSH and LH mRNA
levels
Male Siberian hamsters were sc implanted with a SILASTIC brand
capsule containing crystalline (1:0) T (n = 14), E2 (n = 13)
or Ch (n = 13) at 20 d of age as described in Exp 1. At
35 d of age, the animals were killed by decapitation followed by
the immediate removal of the brain and pituitary. Pituitaries were
quick-frozen on dry ice and stored at -70 C until processed for
Northern blot analysis.
Exp 3: reversibility of T effects on plasma FSH levels and testes
mass
Male Siberian hamsters (n = 8) were sc implanted with a
SILASTIC brand capsule containing crystalline T (1:0) at 20 d of
age as described in Exp 1. At 35 d of age, a blood sample was
taken and the implant removed. The animals were killed by cervical
dislocation 15 d post implant removal. At that time, a final blood
sample was taken and testes mass recorded. Plasma samples were stored
at -35 C until processed for the measurement of FSH by RIA.
Exp 4: determination of plasma T and E2 levels following 15 d
of treatment
Male Siberian hamsters were sc implanted with a SILASTIC brand
capsule containing crystalline T (1:0; n = 10) or E2 (1:0; n
= 7) at 20 d of age as described in Exp 1. To determine if
endogenous T contributed to overall plasma levels in intact, T-treated
animals, half of the T-treated animals (n = 5) were castrated at
the time of implant. At 35 d of age, a blood sample was taken and
the animals were killed by cervical dislocation. Plasma samples were
stored at -35 C until processed for the measurement of T or E2 by RIA.
Plasma hormone levels were compared with those of intact adult male
hamsters (140 d old; n = 5).
RIA
Plasma and tissue processing. Plasma, pituitaries, and
hypothalami were collected from approximately half of the animals in
Exp 1 (n = 81). Blood samples were collected by retro-orbital
puncture into heparinized microcentrifuge tubes, centrifuged at
2,000 x g at 4 C for 8 min, and stored at -35 C until
processed for the measurement of FSH by RIA. Hypothalami and
pituitaries were immediately removed after cervical dislocation and
quick-frozen on dry ice. Pituitaries were sonicated in 500 µl 0.1
M phosphate buffer and stored at -70 C until
processed by FSH RIA. Hypothalami were sonicated on ice in 500 µl 0.1
M phosphate buffer, boiled for 2 min,
quick-frozen on dry ice, and stored at -70 C until processed for the
measurement of GnRH by RIA.
FSH RIA. Plasma and pituitary FSH levels were determined by a heterologous rat FSH RIA previously validated for the measurement of FSH in the Siberian hamster (17). FSH was the only gonadotropin assayed by RIA in this study due to the lack of a sufficiently sensitive antiserum for the measurements of LH in juvenile Siberian hamsters. rFSH-I9, rFSH-RP2, and rFSH-S-11 from the NIH National Pituitary Program (obtained from Dr. A. F. Parlow, UCLA, Los Angeles, CA) were used as the iodination stock, RIA standard, and antibody, respectively. Briefly, for RIA, 50 µl sample was mixed with 50 µl antiserum (1:20,000 dilution) and allowed to incubate for 20 h at room temperature. On d 2, 100 µl iodinated tracer (20,000 cpm/100 µl) was added to RIA tubes and allowed to incubate for an additional 20 h at room temperature. Antibody-bound hormone was precipitated by the addition of 1 ml 5% polyethylene glycol containing a cocktail of goat antirabbit IgG (1:1000), normal rabbit serum (1:2000), and normal horse serum (1:2000), and separated from the unbound tracer by centrifugation at 2,000 x g. Using this RIA, we found the displacement curves of all serially-diluted plasma and pituitary samples to be parallel to the rat FSH standard. The detection limit of this RIA is 1 ng/ml, and intraassay and interassay coefficients of variation are 6.6 ± 2.4% and 8.9 ± 1.5%, respectively.
GnRH RIA. GnRH RIA was carried out using an antiserum specific for the mammalian form of GnRH (Antibody DJC, a gift from Dr. David J. Chase). The antiserum was characterized in detail elsewhere (18). Radioiodination of GnRH and GnRH RIA were performed according to the protocol described previously (19).
T and E2 RIAs. T and E2 RIA kits were purchased from
Diagostics Systems Laboratories, Inc. (Webster, TX).
Plasma samples were assayed according to manufacturers directions.
Briefly, 50 µl (T) or 100 µl (E2) plasma samples were added to
tubes pre-coated with primary antibody, followed by the addition of 500
µl iodinated tracer. Tubes were incubated in 37 C water bath for
1 h (T) or 2 h (E2). Tubes were drained for 10 min and then
counted on a
counter for 1 min each. Assay sensitivities are 0.08
ng/ml and 6.5 pg/ml, respectively for T and E2. Both RIAs are highly
specific and cross-react minimally with other forms of steroid
hormones.
Northern blot analysis
Isolation of total RNA. Total RNA was isolated from
pituitaries using the lithium chloride method previously described by
Querat et al. (20). Pituitary RNA was isolated
from animals treated with either T (n = 14), E2 (n = 13), or
Ch (n = 13; see Exp 2).
Generation of FSHß and LHß cDNA probes. Sense and antisense PCR primers for Siberian hamster FSHß and LHß were designed based on the previously published homologous sequences (21). First strand cDNA was synthesized from 1 µg total pituitary RNA using Superscript Preamplification Kit (Life Technologies, Inc., Grand Island, NY) and amplified by PCR using the following primers for FSHß (sense: 5'CCAACATCACCATCGCAGTA; antisense: 5'ACTGGGTATGTGTAGAAGGA) and LHß (sense: 5'GGGCTGCTGCTATGGCTGTT; antisense: 5'GCCACGGGGAAGGAGACCAT). Consistent with the published sequences, a 217-bp fragment for FSHß and a 299-bp fragment for LHß were amplified. Both fragments were gel-isolated and subcloned into pGEM Easy T vector (Promega Corp., Madison, WI). Both constructs were digested with EcoRI to generate cDNA fragments for probe synthesis. 32P-labeled probes were generated by the randomly primed method using the NE Blot Kit (New England Biolabs, Inc., Beverly, MA) according to the manufacturers instructions.
Hybridization. Ten micrograms of total RNA pooled from each treatment group was fractionated on a 1% agarose/formaldehyde gel, and transferred onto a nylon membrane using the capillary blotting method. The RNA was cross-linked to the membrane with UV irradiation and hybridized with a randomly-primed 32P-labeled cDNA probe for FSHß mRNA. The blot was sequentially washed with 2x SSC/0.1% SDS followed by 0.1 x SSC/0.1% SDS. Following visualization by autoradiography, the blot was stripped with 0.1 x SSC/0.1% SDS for 2 h at 65 C and rehybridized with a randomly-primed 32P-labeled cDNA probe for LHß. The blot was visualized for the hybridization signal by autoradiography after 3 (FSHß) or 7 (LHß) d. The 28S RNA stained by methylene blue was used as an internal loading control. Signal intensity was analyzed by NIH Image software.
Protein assay
Pituitary and hypothalamic protein concentrations were
determined by the Bradford protein assay (Bio-Rad Laboratories, Inc., Hercules, CA) according to the manufacturers
instructions.
Histology
Testes from 20-d-old, T-treated, E2-treated, and Ch-treated
animals (Exp 1) were fixed in Bouins fixative for 1824 h and then
stored in 70% ethanol. Testes were run through a standard dehydration
series of increasing concentrations of ethanol, defatted, and embedded
in paraffin. Ten-micrometer sections were cut on a microtome, mounted
on slides, and subsequently stained with hematoxylin and eosin.
Statistical analysis
Differences among treatment groups were analyzed by one-way
ANOVA followed by Tukeys HSD test. Differences were considered
significant when P < 0.05.
| Results |
|---|
|
|
|---|
|
|
|
|
|
Exp 2: effect of T and E2 on pituitary FSH and LH mRNA
levels
Consistent with the previous report (21), a single
0.6-kb transcript for LHß and 1.7-kb transcript for FSHß were
observed (Fig. 5
). Both T and E2
treatments markedly decreased pituitary FSH mRNA levels, with E2
treatment having a more pronounced effect than T. E2 and T treatments
caused a 62.5% and 37.5% reduction, respectively, in steady-state
FSHß mRNA levels compared with the Ch control (Fig. 5
). Further, both
T and E2 suppressed pituitary steady-state LHß mRNA down to
undetectable levels (Fig. 5
).
|
Exp 4: determination of plasma T and E2 levels following 15 d
of treatment
T-treated animals had similar plasma T levels as those found in
adult intact animals (Fig. 6A
). Of the
T-treated group, there was no difference between castrated and intact
animals. Thus, the testes of juvenile T-treated animals do not
substantially add to the overall levels of plasma T. Unexpectedly,
E2-treated animals also had similar plasma E2 levels as adult intact
animals (Fig. 6B
). Although previous measurements of plasma E2 levels
in male Siberian hamsters have not been reported, the dose of E2 we
administered is clearly within the normal physiological range of adult
males.
|
| Discussion |
|---|
|
|
|---|
Our data for pituitary and plasma FSH levels indicate the inhibitory
actions of T and E2 on the HPG axis are clearly distinct. Our results
showed that T treatment decreased plasma FSH levels without affecting
pituitary FSH, whereas E2 treatment decreased pituitary FSH
concentration without affecting plasma FSH (Figs. 2
and 3
). Therefore,
the inhibitory actions exerted by T might be primarily at the level of
the pituitary to inhibit FSH release. In T-treated animals, pituitary
FSH concentration was normal. Although FSH steady-state mRNA was
reduced (Fig. 5
), the reduction was less than that in E2-treated
animals. This suggests that the pituitary is still capable of
synthesizing FSH in sufficient quantities to maintain normal FSH stores
in the pituitary. However, circulating FSH was not detectable with T
treatment, suggesting appropriate amounts of FSH were not released from
the pituitary. Conversely, the observed normal circulating level of FSH
with E2 treatment suggests that E2 did not affect pituitary FSH
release. Rather, the very low levels of pituitary FSH concentration
coupled with the dramatic decrease in steady-state mRNA suggests that
the actions of E2 might be at the level of FSH synthesis and
accumulation. In fact, in E2-treated animals, there is a clear
dissociation between FSH synthesis and release. E2-treated animals need
to release disproportionately higher amounts of FSH to maintain normal
circulating FSH levels. This dissociation could be due to 1) attenuated
pituitary responsiveness to GnRH, leading to decreased synthesis, and
2) an increase in basal FSH secretion independent of GnRH stimuli.
Ebling et al. (23) found that E2 treatment of
adult hypogonadal mice resulted in enhanced circulating FSH and
spermatogenesis. Because hypogonadal mice lack endogenous GnRH, this
finding lends support to the hypothesis that E2 stimulates basal FSH
release from the anterior pituitary independent of GnRH.
Despite their similar inhibitory actions on testicular mass,
T and E2 induced very different changes in testicular morphology
(Fig. 4
). Although both hormone treatments significantly decreased
testicular mass, spermatogenesis proceeded in E2-treated, but not
T-treated animals. These differences in testicular morphology suggest
that T and E2 act via different mechanisms to induce gonadal regression
in juvenile male Siberian hamsters. In addition, the testicular
morphology of E2- and T-treated animals correlated well with plasma FSH
levels. Because FSH is required for normal spermatogenesis, low plasma
FSH levels in T-treated animals correspond to the observed arrest of
spermatogenesis. However, plasma FSH was unaffected by E2 treatment
(Fig. 2
) and consequently, spermatogenesis proceeded (Fig. 4
). Evidence
that E2 is important for normal testicular function was recently
reported by Pentikainen et al. (24). They
discovered that germ cell apoptosis in cultured human seminiferous
tubules could be prevented with E2 treatment. However, it is
interesting to note that in our peripubertal hamsters, E2-treatment
significantly reduced testes mass despite the appearance of normal
spermatogenesis. In our study, E2 treatment also reduced steady-state
LH mRNA to undetectable levels (Fig. 4
). This raises the possibility
that LH, but not FSH, is required for the normal increase in testicular
mass during the peripubertal transition in Siberian hamsters. Studies
on the estrogen receptor-
null (ERKO) mice further support a
critical role of E2 in normal spermatogenesis. ERKO mice lack mature
sperm in the testes and are therefore infertile (25).
Although ERKO mice have normal spermatogenesis through puberty, by 35
months of age the testes show significant morphological differences and
lower sperm counts compared with wild-type males (25).
Thus, it appears that E2 is required for the postpubertal maintenance
of spermatogenesis in mice. We also observed that the negative feedback
actions of T during puberty did not permanently affect testicular
growth. Upon the removal of T implant, plasma FSH levels were
significantly higher after 1 d (data not shown), and by 15 d
post implant removal, testes mass increased significantly, and plasma
FSH levels were similar to controls. These results suggest that the
administration of exogenous T to Siberian hamsters during the
peripubertal period did not permanently damage the normal processes
required for testicular growth and spermatogenesis.
The Siberian hamster is an extremely photoperiodic species; consequently gonadal regression occurs within 46 wk after chronic exposure to a short-day photoperiod (8-h light, 16-h dark) (26). It is possible that in this species gonadal steroids do not act directly on the HPG axis but act more upstream through a common neural pathway that controls photoperiod-induced regression (i.e. the retinal-suprachiasmatic nucleus-pineal axis). However, given some of the divergent responses between photoinhibited and steroid- inhibited animals, we do not believe this is likely. For instance, photoperiod-induced testicular regression was accompanied by physiological changes, such as weight loss and pelage color change, that were not observed in animals induced to regress with steroids. While a common pathway more downstream may exist, there is clearly a photoperiodic component distinct from the pathway of steroid-induced inhibition.
The mechanisms by which gonadal steroids modulate the HPG axis during the pubertal transition remain enigmatic. Despite strong evidence supporting an inhibitory role for sex steroids on GnRH neurosecretory cells (27, 28), little is known about the mechanisms by which steroids exert negative feedback effects on GnRH neurons. Until recently, it was generally accepted that GnRH neurons do not have androgen or estrogen receptors (29, 30, 31), and the effects of steroid hormones are mediated indirectly by noradrenergic and opiatergic afferents that synapse on GnRH neurons (32, 33, 34). More recently, the presence of E2 receptors (ER) on GnRH neuronal cell bodies have been detected (35, 36, 37). However, a direct physiological role of ER on the overall secretory activity of GnRH neurons has not yet been established.
Our results showed that the plasma T and E2 levels of juvenile hamsters implanted with undiluted (1:0) T or E2 capsules was similar to that of adult, intact, male hamsters. While these levels are certainly higher than the circulating T or E2 of juvenile males, they did not exceed the physiological limit of the species. Our measurements of plasma levels of T and E2 also revealed that different levels of circulating T (0.96 ± 0.4 ng/ml) and E2 (0.38 ± 0.07 ng/ml) resulted from SILASTIC brand implants of the same size (1 mm). Although we acknowledge the importance of administering "equivalent" doses of hormones for making meaningful physiological comparisons, we do not believe the differences in the doses of T and E2 administered contribute to the differences in their effects. When comparing different hormones, it is difficult to interpret what "equivalent" doses are. First, these hormones all have different levels of receptors, binding proteins, and clearance rates. Therefore, even if the same dose was administered initially, the physiological properties of each hormone are sufficiently different to render this kind of comparison inconsequential. Second, because T can be converted intracellulary to either DHT or E2, we cannot determine precisely how much of each hormone to administer exogenously to achieve "equivalent" circulating doses. Third, both T and E2 are within normal adult physiological levels; thus, we do not believe that the divergent effects of T and E2 are the result of administering either hormone at pharmacological levels. Overall, our experimental design was not aimed to mimic normal physiological hormonal milieu at the time of puberty, but rather to try and discern the differential actions of each hormone during this developmental transition.
To our knowledge, this is the first report of steroidinduced inhibition of puberty in rodents. Collectively our results are similar to the work of Godfrey et al. (38) who found gonadal steroids (T, DHT, and E2) inhibited testicular development in prepubertal bull calves. In their study, testicular function, evaluated based on spermatogenic activity, was impaired for at least 6 months after steroid implant removal. However, by 23 months of age (17 months after implant removal), the bull calves had similar testes size and degree of spermatogenic activity as untreated controls. Interestingly, Godfrey et al. (38) showed that the effects of T, DHT, and E2, on plasma FSH and spermatogenesis are indistinguishable, whereas our data showed that E2 and T act via distinct pathways. Our data and the work of Godfrey et al. (38) suggest that a change in the sensitivity of the reproductive axis to inhibitory steroid feedback might be one of the critical cues needed for normal puberty to occur.
In summary, our data indicate T and E2 act via different mechanisms to induce gonadal regression in prepubertal male Siberian hamsters. Although it is unlikely that male peripubertal hamsters normally experience high circulating levels of T and E2, this is one approach for understanding how androgens and estrogens act differently to modulate reproductive function. Further, preliminary experiments in our laboratory showed that peripubertal hamsters respond very differently to E2 than adult hamsters (data not shown). This provides evidence for the idea that the HPG axis changes in its response to steroid hormones as the animal attains reproductive maturity. Thus, the Siberian hamster provides an excellent model for the study of steroid negative feedback mechanisms during pubertal development. Further, the prevailing hypothesis suggests that in male mammals, the conversion of T to E2 is the primary mechanism regulating steroid hormone feedback during reproduction. However, our data clearly indicate a separate pathway for the actions of E2 on the male reproductive system.
| Acknowledgments |
|---|
| Footnotes |
|---|
Abbreviations: Ch, Cholesterol; DHT, 5
-dihydrotestosterone;
ER, E2 receptors; ERKO, estrogen receptor-
null; HPG,
hypothalamo-pituitary-gonadal.
Received March 19, 2001.
Accepted for publication April 5, 2001.
| References |
|---|
|
|
|---|
and ß subunit mRNAs by oestradiol and
testosterone in the European eel. J Mol Endocrinol 7:8186
)- and ERß-expressing GT17 GnRH
neurons. Endocrinology 140:50455053
-dihydrotestosterone in GnRH-secreting GT17
hypothalamic neurons. Endocrinology 139:11081114
immunoreactivity in
gonadotrophin-releasing hormone-expressing neurons. J
Neuroendocrinol 11:331335[CrossRef][Medline]
and ß messenger ribonucleic acids in adult
gonadotropin-releasing hormone neurons. Endocrinology 140:51955201This article has been cited by other articles:
![]() |
S. J Meachem, S. Schlatt, S. M Ruwanpura, and P. G Stanton The effect of testosterone, dihydrotestosterone and oestradiol on the re-initiation of spermatogenesis in the adult photoinhibited Djungarian hamster J. Endocrinol., March 1, 2007; 192(3): 553 - 561. [Abstract] [Full Text] [PDF] |
||||
![]() |
P.-S. Tsai, S. M. Moenter, H. R. Postigo, M. El Majdoubi, T. R. Pak, J. C. Gill, S. Paruthiyil, S. Werner, and R. I. Weiner Targeted Expression of a Dominant-Negative Fibroblast Growth Factor (FGF) Receptor in Gonadotropin-Releasing Hormone (GnRH) Neurons Reduces FGF Responsiveness and the Size of GnRH Neuronal Population Mol. Endocrinol., January 1, 2005; 19(1): 225 - 236. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. S. McMullin, M. E. Andersen, A. Nagahara, T. D. Lund, T. Pak, R. J. Handa, and W. H. Hanneman Evidence That Atrazine and Diaminochlorotriazine Inhibit the Estrogen/Progesterone Induced Surge of Luteinizing Hormone in Female Sprague-Dawley Rats Without Changing Estrogen Receptor Action Toxicol. Sci., June 1, 2004; 79(2): 278 - 286. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. T. Akingbemi, C. M. Sottas, A. I. Koulova, G. R. Klinefelter, and M. P. Hardy Inhibition of Testicular Steroidogenesis by the Xenoestrogen Bisphenol A Is Associated with Reduced Pituitary Luteinizing Hormone Secretion and Decreased Steroidogenic Enzyme Gene Expression in Rat Leydig Cells Endocrinology, February 1, 2004; 145(2): 592 - 603. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. R. Pak, G. R. Lynch, D. M. Ziegler, J. B. Lunden, and P.-S. Tsai Disruption of pubertal onset by exogenous testosterone and estrogen in two species of rodents Am J Physiol Endocrinol Metab, January 1, 2003; 284(1): E206 - E212. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. R. Pak, G. R. Lynch, and P.-S. Tsai Differential Alteration of the Reproductive Axis by Testosterone and Estrogen in Peripubertal and Adult Male Siberian Hamsters (Phodopus sungorus) Biol Reprod, September 1, 2002; 67(3): 706 - 711. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |