Endocrinology Vol. 142, No. 8 3405-3413
Copyright © 2001 by The Endocrine Society
Relaxin Positively Regulates Matrix Metalloproteinase Expression in Human Lower Uterine Segment Fibroblasts Using a Tyrosine Kinase Signaling Pathway
Smita Palejwala,
Daniel E. Stein1,
Gerson Weiss,
Brett P. Monia,
Drew Tortoriello2 and
Laura T. Goldsmith
Department of Obstetrics, Gynecology, and Womens Health, New
Jersey Medical School, Newark, New Jersey 07103; and Isis
Pharmaceuticals (B.P.M.), Carlsbad, California 92008
Address all correspondence and requests for reprints to: Dr. Laura T. Goldsmith, Department of Obstetrics, Gynecology, and Womens Health, New Jersey Medical School, 185 South Orange Avenue, Newark, New Jersey 07103. E-mail: goldsmit{at}umdnj.edu
 |
Abstract
|
|---|
Despite the importance of relaxin to normal parturition in various
species and its potential as an etiological agent in preterm delivery
in women, knowledge regarding the mechanisms by which relaxin alters
cervical connective tissue is extremely limited. An established
in vitro model for human pregnancy cervix, human lower
uterine segment fibroblasts, was used to determine the effects of
relaxin as well as those of progesterone on the expression of matrix
metalloproteinases and tissue inhibitor of metalloproteinase-1. The
results demonstrate that relaxin is a positive regulator of matrix
metalloproteinase expression, as it stimulates the expression of
procollagenase protein and mRNA levels, stimulates prostromelysin-1
protein and mRNA levels, and inhibits tissue inhibitor of
metalloproteinase-1 protein expression. Stimulation of procollagenase
and prostromelysin-1 expression by relaxin does not involve
phorbol-12-myristate-13-acetate- sensitive PKCs. Relaxin-stimulated
tyrosine phosphorylation of the putative receptor and inhibition by a
receptor tyrosine kinase inhibitor suggest that the relaxin receptor is
probably a tyrosine kinase receptor. Inhibition of c-Raf protein
expression using an antisense oligonucleotide inhibits relaxin
regulation of matrix metalloproteinase and tissue inhibitor of
metalloproteinase-1, suggesting that a signaling pathway involving
c-Raf kinase mediates relaxin action.
 |
Introduction
|
|---|
THE MAMMALIAN CERVIX undergoes marked
connective tissue remodeling for successful parturition to occur.
Despite the significance of this process, the physiological and
biochemical mechanisms responsible remain poorly defined. In a wide
variety of mammalian species, the protein hormone relaxin is a powerful
agent in the reorganization of reproductive tract connective tissue. In
several species, relaxin is obligatory for normal delivery due to this
marked ability to rearrange reproductive tract connective tissue,
especially in the cervix (1, 2). In women, elevated
maternal circulating relaxin levels are significantly correlated to an
increased risk of premature delivery (3, 4). However,
despite the importance of relaxin to normal reproductive function and
its potential as an etiological agent in preterm delivery in women,
knowledge regarding the mechanisms by which relaxin alters cervical
connective tissue is extremely limited. In addition, little is known
regarding the cellular mechanism of action of relaxin in any cell type.
The structure of the relaxin receptor is unknown, and no complete
signaling pathway has been identified. Relaxin action in several cell
types is associated with the cAMP/adenylate cyclase/PKA pathway
(5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17). However, no data that demonstrate coupling of a
relaxin-receptor complex to a heterotrimeric G protein have been
provided.
The maintenance of connective tissue architecture requires a precise
balance between the action of matrix metalloproteinases (MMPs), which
degrade the extracellular matrix, and the endogenous tissue inhibitors
of metalloproteinases, which regulate the activity of the
metalloproteinases (18). The present studies were designed
to determine the effects of relaxin on the regulation of human cervical
MMP expression and to elucidate the mechanism of action of relaxin in
these effects using an established in vitro model of human
pregnancy cervix, lower uterine segment fibroblasts
(19, 20, 21, 22, 23). As type I collagen is the major collagen type in
human cervix, we evaluated the effects of relaxin on the expression of
interstitial collagenase, stromelysin, and their endogenous inhibitor
tissue inhibitor of metalloproteinase-1 (TIMP-1).
 |
Materials and Methods
|
|---|
Materials
Earles Balanced Salt Solution (EBSS), DMEM, penicillin,
streptomycin sulfate, lactalbumin hydrolysate, trypsin/EDTA, Opti-MEM,
and Lipofectin reagent were purchased from Life Technologies, Inc. (Grand Island, NY). 17ß-Estradiol, progesterone,
phorbol-12-myristate-13- acetate (PMA), donkey antisheep IgG,
polyvinylidene difluoride membranes and guanosine
5'-O-(3-thiotriphosphate) tetralithium salt were purchased
from Sigma (St. Louis, MO). FBS was purchased from
HyClone Laboratories, Inc. (Logan, UT). Enhanced
chemiluminescence reagents were purchased from Amersham Pharmacia Biotech (Arlington Heights, IL). Platelet-derived growth factor
(PDGF), epidermal growth factor (EGF), hydroxy-2-naphthalenyl methyl
phosphonic acid trisacetoxymethyl ester (HNMPA), and tyrphostin AG 18
were obtained from Calbiochem (San Diego, CA). Tyrphostin
AG 1478 was purchased from BIOMOL Research Laboratories, Inc. (Plymouth Meeting, PA). Human H2 relaxin was a gift from
Genentech, Inc. (South San Francisco, CA). The
staurosporine derivative PKC inhibitor CGP41251 and the inactive,
similarly structured molecule CGP42700 were provided by Dr. T. Meyer,
(Ciba-Geigy, Basel, Switzerland). Sheep antihuman
pro-MMP-3 and TIMP-1 antibodies and pure pro-MMP-1, pro-MMP-3, and
TIMP-1 proteins were provided by Dr. Hideaki Nagase (University of
Kansas Medical Center, Kansas City, KS). Additional antibodies were
purchased. Mouse monoclonal antibody to residues 332350 of human
MMP-1 (Ab-1, catalogue no. IM35L) was obtained from
Calbiochem (San Diego, CA), and it recognizes both pro-
and active MMP-1. MMP-2 antibody, a mouse monoclonal antibody raised
against human MMP-2, was obtained from Calbiochem
[anti-MMP-2 (Ab-4), catalogue no. IM 51L] and recognizes both pro-
and active MMP-2. c-Raf-1 antibody, a mouse monoclonal antibody to
residues 162378 of human c-Raf (R19120) that specifically recognizes
the 74-kDa c-Raf-1 protein, and phosphotyrosine antibody, a horseradish
peroxidase-conjugated recombinant antiphosphotyrosine PY20 (RC20H),
were purchased from Transduction Laboratories (Lexington, KY).
Peroxidase-conjugated goat antimouse IgG was obtained from
Calbiochem (San Diego, CA). Peroxidase-conjugated donkey
antisheep IgG was obtained from Sigma. The MMP-1 probe was
a 1970-bp cDNA insert in plasmid pCol185.2 provided by Dr. Gregory
Goldberg (24). The MMP-3 probe was a full-length cDNA
insert in the expression vector pEE6 provided by Dr. M. Kurkinen
(25). The TIMP-1 probe was a 39-mer oligonucleotide
(GGAATTGCAGAAGGCCGTCTGTGGGTGGGGTGGGACACA, a sequence complementary to
nucleotides 138176 sequence of the TIMP gene) (26) that
was synthesized at Genosys Biotechnologies, Inc. (The Woodlands, TX).
The ß-actin probe was an 1800-bp cDNA that hybridizes to a 1.7-kb
human ß-actin mRNA transcript (CLONTECH Laboratories, Inc., Palo Alto, CA) (27). These probes have all
been used in hybridization studies of their respective mRNAs
(24, 25, 26, 27).
Regulation of MMP expression
The isolation, primary culture, and characterization of the
human lower uterine segment fibroblasts have been described in precise
detail previously (23). Briefly, lower uterine segment
tissue was removed at term pregnancy from a nonlaboring patient at the
time of cesarean section delivery following informed consent. The
protocol was approved by the institutional review board. Isolated,
cultured cells were characterized as fibroblasts free of contaminating
epithelial cells by immunohistochemistry of specific markers
(23). Cells were plated at 1 x
106 cells/well in 35-mm tissue culture dishes
(Becton Dickinson and Co., Lincoln Park, NJ) and
maintained in DMEM supplemented with 10% FBS, 5000 U/ml penicillin,
and 5000 µg/ml streptomycin sulfate (complete medium) overnight in an
atmosphere of 5% CO2/95% air. Medium was
removed from the cells and replaced with complete medium containing 1
µM 17ß-estradiol. This was repeated 24 and 48 h
later for a total of 72 h of estradiol priming. Medium was then
removed and replaced with serum-free DMEM supplemented with 0.2%
lactalbumin hydrolysate (LAH) without or with various amounts of
relaxin. Cells in replicate wells were also incubated with PMA (10
nM) as a positive control. After 65 h of incubation,
cells were removed from the plate using trypsin/EDTA and counted using
a Coulter counter (Miami, FL). Conditioned medium was maintained frozen
at -20 C until Western blotting was performed. Cells from replicate
wells were used to prepare RNA for Northern blotting.
Role of PKC in relaxin signaling
Cells were plated as described above. After 72 h of
estradiol priming, medium was removed and replaced with serum-free DMEM
supplemented with 0.2% LAH either without or with 0.5, 1, or 10 ng/ml
relaxin or 10 nM PMA. With each of these relaxin
concentrations as well as with the PMA group, two additional sets of
wells were treated with 0.2 µM CGP41251 or 0.2
µM CGP42700, respectively. The activities of these
compounds has been described previously (28). Cells were
incubated in an atmosphere of 5% CO2/95% air at
37 C for 65 h; the medium was then collected and frozen at -20 C
until Western blotting was performed. Cells were removed from the plate
by incubation with trypsin/EDTA and counted.
Role of receptor tyrosine kinase inhibition in relaxin
signaling
Cells were seeded at 1 x 105
cells/well in 24-well trays in complete DMEM and incubated for 48
h, after which they were serum-starved for 24 h. Subsequently,
they were pretreated with receptor tyrosine kinase inhibitors (5
µM HNMPA, 100 µM AG18, or 100
nM AG1478) in serum-free medium overnight. The next day,
cells were treated without or with either 1 nM relaxin, 10
ng/ml PDGF, or 10 ng/ml EGF (stimulators) in the absence or presence of
5 µM HNMPA, 100 µM AG18, or 100
nM AG1478 (inhibitors) as follows. Medium was replaced with
serum-free vanadate containing DMEM, and cells were incubated in the
absence or presence of stimulators with or without inhibitors for the
specified time periods, after which protein extracts were prepared and
subjected to phosphotyrosine Western blotting analysis as described
previously (23). For each stimulator, phosphorylation of
their respective receptor protein was assessed. HNMPA is a potent
inhibitor highly specific for tyrosine kinases over serine kinases
(29, 30).
Role of c-Raf in relaxin signaling
Two oligonucleotides that contain
2'-O-methoxyethyl/phosphodiester residues flanking a
2'-deoxynucleotide/phosphorothioate region that supports ribonuclease H
activation in cells, were used in these experiments, as used previously
(31, 32). The sequences are TCC-CGC-CTG-TGA-CAT-GCA-TT
(ISIS 12854) and TCC-CGC-CTA-CTA-CAT-GCA-TT (ISIS 14729, control for
ISIS 12854). ISIS 12854 has been used previously to inhibit c-Raf
protein expression in human cells (32). Cells were seeded
at 1.5 x 105 cells/well in 24-well trays.
The next day, cells were primed with 1 µM
17ß-estradiol for 48 h in complete medium. After 48 h, the
first oligonucleotide treatment was performed as follows. Cells were
washed with 0.5 ml EBSS, and 225 µl Opti-MEM containing 10 µl
Lipofectin/ml were added. Untreated, control cells received an
additional 25 µl Opti-MEM. Treated cells received 25 µl 2
µM oligonucleotide (final concentration, 200
nM) in Opti-MEM, either c-Raf antisense ISIS
12854 or c-Raf antisense mismatched ISIS 14729. Cells were then
incubated for 5 h at 37 C, after which the medium was aspirated
and replaced with complete medium containing 1
µM 17ß-estradiol, and cells were incubated
overnight. The next day, this complete protocol was repeated exactly as
described above. After this 5-h incubation, cells were washed once with
EBSS and fed with serum-free DMEM containing 0.2% LAH. Cells were then
incubated for 65 h at 37 C, without or with 10 ng/ml relaxin, and
conditioned medium was collected for MMP analysis by Western blotting.
For each category of cell treatment, the cells in one well were taken
for counting, and the remaining wells (three for each category) were
used in preparation of protein extracts.
Preparation of cell protein extracts for Western blotting
Cell protein extracts for Western blotting were prepared as
follows. Medium was aspirated, and the cells were rapidly washed with
EBSS. Cells were lysed by the addition of 50 µl nonreducing,
dye-free, boiling 2 x SDS-PAGE buffer/well. Lysates were
collected into small microfuge tubes (aided by scraping the wells with
a cell scraper) and boiled for 2 min. After cooling on ice, cell
lysates were passed through a 25-gauge needle four times to shear DNA.
An aliquot was removed for protein assay, and 5 µl 2-mercaptoethanol
and 0.5 µl 0.2% bromophenol blue solution (per 100 µl) were then
added to the extracts, which were boiled for 2 min and immediately
frozen at -20 C. Protein extracts were assessed for protein content
using the Protein Assay DC kit (Bio-Rad Laboratories, Inc., Hercules, CA) and BSA as standard.
Western blot analysis
SDS-PAGE and Western transfers were performed as previously
described (23, 33). Equivalent amounts of cell-conditioned
medium (10 µl medium heat treated with 5 µl 3 x SDS-PAGE
buffer, except for TIMP-1, for which 40 µl medium heat treated with
10 µl 5 x SDS-PAGE buffer were used) were used. For
phosphotyrosine immunoblotting, 10 µg protein equivalents of frozen
cell extracts (prepared as described) were used. Samples were loaded
onto 4% stacking and 10% (for MMPs), 12.5% (for TIMP-1 and c-Raf),
or 8% (for phosphotyrosine) separating gels and electrophoresed at 200
V for 45 min. Pure MMP and TIMP-1 proteins were used as controls, and
broad range, prestained kaleidoscope mol wt standards (Bio-Rad Laboratories, Inc.) were used to estimate the mol wt. Proteins
were electrotransferred at 100 V for 1.5 h onto PVDF membranes and
immunoblotted with specific antibodies. Membranes were blocked for 30
min with 3% BSA/Tris-buffered saline/0.1% Tween 20, pH 7.4, and
incubated with the primary antibodies overnight. The specificity of
these antibodies and their use in Western blot analysis to identify
human pro-MMP-1, pro-MMP-3, and TIMP-1 have been previously described
(34, 35, 36). After washing, membranes were incubated for
1 h with horseradish peroxidase-conjugated secondary antibodies
diluted in 3% BSA in Tris-buffered saline/0.1% Tween 20 (pH
7.4). Blots were developed by the enhanced chemiluminescence method as
described previously (23, 33) and exposed to
Kodak BioMax ML or MR film (Sigma).
RNA isolation and Northern blot analysis
Total RNA was isolated using the acid guanidinium
thiocyanate-phenol-chloroform extraction procedure (37).
Enrichment for poly(A)+ RNA was performed using
batch affinity chromatography on oligo(deoxythymidine) cellulose
(38). RNAs were denatured in the presence of formaldehyde
and formamide and fractionated on 1.2% agarose-formaldehyde gels. RNAs
were then transferred to nylon membranes (Roche,
Indianapolis, IN) using a Turbo-Blotter rapid downward transfer
apparatus (Schleicher & Schuell, Inc., Keene, NH) in
20 x SSC. RNAs were fixed by UV cross-linking, and the membranes
were probed with 32P-labeled cDNAs or
oligonucleotides. Blots were prehybridized in buffer containing 50%
formamide, 10% dextran sulfate, 0.5% SDS, 1 M NaCl, and
5 x Denhardts solution at 42 C for 2 h in a glass bottle
in a minihybridization oven (Hybaid, Labnet, Woodbridge, NJ). Denatured
labeled probe was added to the buffer, and the membranes were incubated
for an additional 18 h at 42 C. Membranes were then washed twice
in 2 x SSC at 42 C for 5 min each time, followed by two washings
in 2 x SSC-1% SDS at 60 C for 30 min each time, followed by two
washings in 0.1 x SSC at room temperature for 30 min each time.
After washing, blots were subjected to autoradiography. cDNAs were
labeled by random priming with
[
-32P]deoxy-CTP using the Random Primers DNA
Labeling System (Life Technologies, Inc., Grand Island,
NY) following the instructions supplied by the manufacturer. The TIMP-1
oligomer was end labeled with [
-32P]ATP
using T4 polynucleotide kinase (New England Biolabs, Inc.,
Beverly, MA). Labeled probes were separated from free nucleotides using
Chroma Spin+ TE-10 Columns (CLONTECH Laboratories, Inc., Palo Alto, CA). Blots were exposed to
Hyperfilm-MP (Amersham Pharmacia Biotech, Arlington
Heights, IL) at -80 C.
Densitometric analysis
The intensities of the signals obtained on developed films were
determined using a computing densitometer (300B, Molecular Dynamics, Inc., Sunnyvale, CA) using the volume integration
method with appropriate corrections for background absorption, as
described previously (23, 33).
Statistical analyses
Densitometric values for control untreated cells were
arbitrarily set at 100, and values for treatment groups are expressed
as a percentage of the control. All data generated (except for the PKC
inhibitor studies) were normally distributed, as assessed using the
Shapiro-Wilk test, and of equal variances, and thus were compared
parametrically using two-tailed t tests. Control and
treatment values from experiments using the PKC inhibitor and the PKC
inhibitor analog were not normally distributed; therefore, analyses of
these data were performed nonparametrically using Kruskal-Wallis
rank-sum testing. All comparisons were performed using JMP statistical
software (SAS Institute, Inc., Cary, NC) written for
the Macintosh Computer (Apple Computers, Cupertino, CA).
 |
Results
|
|---|
Relaxin is a positive regulator of MMPs
Effect of relaxin on procollagenase (pro-MMP-)1 expression.
The results of the Western blot analyses demonstrated that relaxin
significantly increased the expression of procollagenase protein from
lower uterine segment fibroblast cells, as shown in Fig. 1A
. Both 1 and 10 ng/ml relaxin
significantly increased procollagenase protein expression to mean
(±SEM) levels of 204 ± 26% (P =
0.006) and 211 ± 21% (P = 0.02; n = 5
experiments for each dose) of the control, respectively. Relaxin (10
ng/ml) also caused a significant increase in the expression of the
2.2-kb procollagenase mRNA transcript to 214 ± 35% (n = 4
experiments; P = 0.04) above the control value, as
shown in Fig. 1B
.

View larger version (37K):
[in this window]
[in a new window]
|
Figure 1. Relaxin stimulates procollagenase (pro-MMP-1)
expression. A, Effect of relaxin on levels of pro-MMP-1 protein. Cell
culture and Western blotting of conditioned medium were performed as
described in Materials and Methods.
Densitometric values from controls were set at 100, and data from
relaxin-treated cells are expressed as a percentage of the control.
Each bar shows the mean ± SEM of five
independent experiments. A film developed after exposure to a blot from
a representative experiment is shown above. The
asterisks indicate significant increases above the
control in pro-MMP-1 expression caused by relaxin at 1 ng/ml
(P = 0.006) and 10 ng/ml (P =
0.02). B, Effect of relaxin on levels of procollagenase mRNA.
Preparation of cellular RNA and Northern blots were performed as
described in Materials and Methods.
Densitometric values from controls were normalized to ß-actin mRNA
and set at 100. Densitometric values from relaxin-treated cells were
normalized to ß-actin mRNA and are expressed as a percentage of the
control. Each bar shows the mean ± SEM
of four independent experiments. The asterisk indicates
a significant increase above the control in procollagenase mRNA caused
by relaxin at 10 ng/ml (P = 0.04). A film developed
after exposure to a blot hybridized to the pro-MMP-1 probe from a
representative experiment is shown above. The row
labeled ß-actin shows a film developed after exposure of the same
blot was hybridized to the ß-actin probe.
|
|
Effect of relaxin on prostromelysin (pro-MM-3) expression.
Relaxin significantly increased the expression of prostromelysin
protein from lower uterine segment fibroblast cells, as shown in Fig. 2A
. Both 1 and 10 ng/ml relaxin
significantly increased prostromelysin expression to mean levels of
241 ± 46% (P = 0.04) and 198 ± 31%
(P = 0.04; n = 5 experiments for both) of the
control, respectively. Relaxin at 10 ng/ml also caused a significant
increase in the expression of the 1.9-kb prostromelysin mRNA transcript
to 189 ± 26% (n = 4 experiments; P = 0.04)
above the control value, as shown in Fig. 2B.

View larger version (38K):
[in this window]
[in a new window]
|
Figure 2. Relaxin stimulates prostromelysin 1 (pro-MMP-3)
expression. Data were generated and are expressed as described in Fig. 1 . A, Effect of relaxin on levels of pro-MMP-3 protein. Each
bar shows the mean ± SEM of five
independent experiments. The asterisks indicate
significant increases above the control in pro-MMP-3 expression caused
by relaxin at 1 ng/ml (P = 0.04) and 10 ng/ml
(P = 0.04). B, Effect of relaxin on levels of
prostromelysin 1 mRNA. Each bar shows the mean ±
SEM of four independent experiments. The
asterisk indicates a significant increase above the
control in prostromelysin 1 mRNA caused by relaxin at 10 ng/ml
(P = 0.04).
|
|
Effect of relaxin on TIMP-1 expression. The results of the
Western blot analyses demonstrated that relaxin significantly reduced
the expression of TIMP-1 protein from lower uterine segment fibroblast
cells. As shown in Fig. 3
, relaxin at
0.5, 1, or 10 ng/ml significantly decreased TIMP-1 expression to
67 ± 9% (P = 0.02), 50 ± 7%
(P = 0.001), and 45 ± 5% (P <
0.001) of the control value, respectively (n = 6 experiments). In
contrast to its effect at the level of the protein, relaxin at 10 ng/ml
did not affect steady state levels of the 0.9-kb TIMP-1 mRNA transcript
(data not shown).

View larger version (35K):
[in this window]
[in a new window]
|
Figure 3. Relaxin inhibits levels of TIMP-1 protein. Data
were generated and are expressed as described in Fig. 1 . Each
bar shows the mean ± SEM of six
independent experiments. The asterisks indicate
significant inhibition below the control in TIMP-1 expression by
relaxin at 0.5 ng/ml (P = 0.02), 1 ng/ml
(P = 0.001), and 10 ng/ml (P <
0.001).
|
|
Progesterone is a negative regulator of MMP expression
Effects of progesterone on pro-MMP-1, pro-MMP-3, and TIMP-1
expression. As shown in Fig. 4
, treatment of human lower uterine segment fibroblasts with 0.1, 1, 10,
100, or 1000 nM progesterone significantly decreased
procollagenase protein expression to 63 ± 4%, 58 ± 4%,
54 ± 10%, 52 ± 5%, and 57 ± 3% (mean ±
SEM; n = 4 experiments; P < 0.05 at
all amounts) of the control value, respectively. Expression of
prostromelysin protein levels was similarly inhibited by these amounts
of progesterone to 59 ± 13%, 53 ± 9%, 58 ± 8%,
60 ± 4%, and 64 ± 8% (mean ±
SEM; n = 4 experiments; P <
0.05 at all amounts) of the control, respectively. In contrast,
expression of TIMP-1 protein levels was not affected by treatment with
progesterone at these doses. Levels remained at 100 ± 4%,
93 ± 9%, 96 ± 11%, 106 ± 9%, and 117 ± 11%
(mean ± SEM; n = 4 experiments;
P > 0.05 at all amounts) of the control,
respectively.

View larger version (37K):
[in this window]
[in a new window]
|
Figure 4. Effects of progesterone on pro-MMP-1 (A),
pro-MMP-3 (B), and TIMP-1 (C) expression. Cells were incubated in
serum-free medium without and with the concentrations of progesterone
shown for 65 h. Western blotting of conditioned medium was
performed as described in Materials and Methods. Data
are expressed as described in Fig. 1 . Each bar shows the
mean ± SEM of four independent experiments, each
performed in duplicate. The asterisks indicate
significant inhibition below the control in pro-MMP-1 and pro-MMP-3
expression caused by progesterone at all amounts shown
(P < 0.05). TIMP-1 levels were not altered by
progesterone.
|
|
Effects of relaxin and progesterone on expression of gelatinase A
(72-kDa gelatinase, MMP-2). We examined the effects of both
relaxin and progesterone on the expression of gelatinase A protein
levels. As shown in Fig. 5
, treatment of
the cells with 1 or 10 ng/ml relaxin caused a significant increase in
MMP-2 expression to 210 ± 31% (mean ± SEM;
n = 4 experiments; P = 0.039) and 193 ± 18%
(P = 0.014) of the control value, respectively. The
increase in MMP-2 expression caused by treatment of the cells with 0.5
ng/ml relaxin was less pronounced (154 ± 25%; P
= 0.11). In contrast, MMP-2 protein levels were not affected by
incubation with progesterone at 0.1, 1, 10, 100, or 1000
nM. Levels remained at 109 ± 20%, 117
± 15%, 107 ± 13%, 94 ± 7%, and 97 ± 10%
(mean ± SEM; n = 4 experiments;
P > 0.05 at all amounts) of the control,
respectively.
Inhibition of relaxin-stimulated tyrosine phosphorylation by
receptor tyrosine kinase inhibitors
As we have previously demonstrated that relaxin stimulates
tyrosine phosphorylation of an approximately 220-kDa protein, which is
probably the relaxin receptor, in human lower uterine segment
fibroblasts (10), we determined the effect of a potent
receptor tyrosine kinase inhibitor on tyrosine phosphorylation of the
approximately 220-kDa protein. Figure 6A
shows a representative phosphotyrosine Western blot of total cellular
proteins from cells incubated in the absence or presence of 1
nM relaxin without or with 5 µM HNMPA. Figure 6B
shows the reproducibility and consistency of this finding. HNMPA
significantly inhibited relaxin-stimulated tyrosine phosphorylation of
the approximately 220-kDa protein to 33.3 ± 8%
(±SEM; P = 0.004; n = 4 experiments)
and 39.2 ± 7% (P = 0.003; n = 4
experiments) of uninhibited, relaxin-stimulated levels at 15 and 30 min
of treatment, respectively, similar to nonrelaxin treated levels at the
same treatment times. In contrast, two other receptor tyrosine kinase
inhibitors, selective for PDGF (AG18) and EGF (AG1478), had no effect
on relaxin-stimulated 220-kDa protein tyrosine phosphorylation, as
shown in Table 1
. Demonstration of the
inhibitory activity of AG 18 and AG 1478 on PDGF and EGF receptor
phosphorylation (positive controls) is also shown in Table 1
.

View larger version (21K):
[in this window]
[in a new window]
|
Figure 6. Effect of receptor tyrosine kinase inhibition on
relaxin-stimulated protein tyrosine phosphorylation. A, A film
developed after exposure to a blot from a representative experiment.
Treatment of cultured cells without or with relaxin and/or receptor
tyrosine kinase inhibitor, and phosphotyrosine Western blotting were
performed as described in Materials and Methods. B,
Results from four independent experiments, each performed in duplicate.
The mean ± SEM densitometric values for the
phosphorylated 220-kDa protein in cells treated with relaxin were set
at 100, and values for cells treated with both relaxin and HNMPA (R+H)
and for cells not given relaxin (U) are expressed as a percentage of
the control (relaxin stimulation). The asterisks
indicate significant inhibition of relaxin-stimulated tyrosine
phosphorylation of the 220-kDa protein at both 15 min
(P = 0.004) and 30 min (P =
0.003) of treatment with the receptor tyrosine kinase inhibitor, HNMPA.
The stimulation by relaxin is shown by the significantly lower values
of phosphorylation of the 220-kDa protein in the nonrelaxin, control
(U) cells at both 15 min (P = 0.002) and 30 min
(P = 0.0002).
|
|
View this table:
[in this window]
[in a new window]
|
Table 1. Effect of receptor tyrosine kinase (RTK) inhibitors
on relaxin-stimulated receptor tyrosine phosphorylation
|
|
Role of c-Raf in relaxin signaling
Transfection of human lower uterine segment fibroblasts with a
highly specific c-Raf mRNA-targeted antisense oligonucleotide resulted
in effective inhibition of c-Raf protein levels to 48.6 ± 10%
(±SEM; P = 0.036; n = 3 experiments,
each performed in triplicate for all data; Fig. 7
) and 61.2 ± 1.5% (P =
0.0016) of mismatched oligonucleotide-treated levels in untreated and
relaxin-treated cells, respectively (Fig. 7A
). Inhibition of c-Raf
protein resulted in significant down-regulation of relaxin-stimulated
pro-MMP-1 to 60.5 ± 3.3% (P = 0.007; Fig. 7B
)
and of relaxin stimulated pro-MMP-3 protein levels to 56 ± 8.8%
(P = 0.037; Fig. 7C
) of those in relaxin-treated cells
transfected with the mismatched oligonucleotide control. Reduction of
c-Raf protein levels also resulted in a reversal of relaxin inhibition
of TIMP-1 protein levels to 146 ± 3.3% (P = 0.005) of
those in relaxin-treated cells transfected with the mismatched
oligonucleotide control (Fig. 7D
). Expression of pro-MMP-1, pro-MMP-3,
and TIMP-1 protein levels in nonrelaxin-treated cells were not altered
by inhibition of c-Raf protein levels (Fig. 7
, BD).

View larger version (58K):
[in this window]
[in a new window]
|
Figure 7. Effects of transfection with c-Raf antisense
oligonucleotide on relaxin-stimulated pro-MMP-1 and pro-MMP-3 and
relaxin inhibited TIMP-1 levels. Treatment of cells with c-Raf specific
or control (mismatched) antisense oligonucleotides and relaxin, and
Western blot analysis of pro-MMP-1, pro-MMP-3, and TIMP-1 levels were
performed as described in Materials and Methods.
Densitometric values from control cells (transfected with mismatched
antisense nucleotide) were set at 100, and values from c-Raf
antisense-treated cells are expressed as a percentage of the control.
Each bar shows the mean ± SEM of three
independent experiments, each performed in triplicate. c-Raf antisense
oligonucleotide significantly inhibited c-Raf protein levels in
untreated (P = 0.036) and relaxin-treated
(P = 0.002) cells (A), significantly inhibited
relaxin-stimulated pro-MMP-1 (P = 0.007; B) and
pro-MMP-3 (P = 0.037; C), and significantly
reversed the relaxin inhibition of TIMP-1 expression
(P = 0.005; D).
|
|
Role of PKC in relaxin-stimulated MMP expression
Inhibition of PKC activity did not influence relaxin stimulation
of pro-MMP-1 and pro-MMP-3 protein levels. As shown in Table 2
, the highly selective PKC inhibitor
used in these experiments markedly inhibited PMA-stimulated pro-MMP-1
and pro-MMP-3 expression, yet no effect on relaxin-stimulated
levels was observed. A structurally similar, yet inactive, compound was
used as a negative control (28).
 |
Discussion
|
|---|
Although relaxin is an important factor in the remodeling of
reproductive tract connective tissue in various mammalian species,
little information regarding the effects of relaxin on MMP expression
in the human cervix exists. As type I collagen is the major collagen
type in human cervix, we evaluated the effects of relaxin on the
expression of interstitial collagenase (MMP-1), stromelysin (MMP-3),
and their endogenous inhibitor TIMP-1. The data presented here
demonstrate that relaxin is a positive regulator of MMP expression in
human lower uterine segment fibroblasts, an established in
vitro model for human pregnancy cervix (19, 20, 21, 22, 23).
Relaxin up-regulates the expression of interstitial collagenase and
stromelysin at the level of both protein and mRNA and decreases
expression of the endogenous inhibitor TIMP-1 protein. The signaling
pathway that appears to be used by relaxin involves a tyrosine kinase
receptor and the serine/threonine kinase c-Raf. PMA-sensitive PKCs are
not involved in relaxin action in this cell type, nor, as suggested by
our previous data, is cAMP.
Relaxin action on certain target organs, for example, the rat uterus,
is synergistic with the actions of progesterone (39).
However, other data suggest that this may not be the case in all target
organs. To determine whether relaxin and progesterone have similar or
different actions on metalloproteinase expression in the human cervix,
we determined the effects of progesterone on the expression of MMPs and
TIMP-1. Our data demonstrate that progesterone action on MMP expression
in human lower uterine segment fibroblasts is opposite that of relaxin.
Progesterone negatively regulates MMP expression. In the present
studies progesterone inhibited the expression of pro-MMP-1 and
pro-MMP-3 and had no effect on TIMP-1.
As a hallmark of cervical dilatation at term pregnancy in women
involves infiltration of leukocytes, we examined the effect of relaxin
on MMP-2 (gelatinase A), which degrades basement membrane collagens,
elastin, laminin, and fibronectin (18). The data presented
here demonstrate that relaxin significantly stimulates the expression
of MMP-2, suggesting a mechanism by which relaxin may foster the
infiltration of leukocytes and other cell types into the cervix. This
effect of relaxin could serve to enhance the direct positive regulatory
effect of relaxin on MMP expression by increasing the local
concentrations of various MMP stimulatory cytokines secreted by these
cells. The stimulatory action of relaxin on MMP-2 expression in this
cell type differs from that of progesterone, which the present data
demonstrate has no effect.
We previously demonstrated that the response of human lower uterine
segment fibroblasts to relaxin is associated with an increase in
tyrosine phosphorylation of an approximately 220-kDa protein, probably
the relaxin receptor (23). To advance our understanding of
the mechanisms of relaxin signaling in the cervix and test the
hypothesis that the relaxin receptor is a tyrosine kinase receptor, the
effects of inhibition of receptor tyrosine kinase activity on
relaxin-stimulated tyrosine phosphorylation of the 220-kDa protein were
studied. Treatment with a potent, specific receptor tyrosine kinase
inhibitor (29, 30) demonstrated a significant inhibition
of relaxin-stimulated tyrosine phosphorylation of the 220-kDa protein.
In contrast, two other receptor tyrosine kinase inhibitors, selective
for PDGF (AG18) and EGF (AG1478), had no effect on
relaxin-stimulated tyrosine phosphorylation. These data support the
concept that the relaxin receptor is a tyrosine kinase receptor
distinct from the PDGF and EGF receptors.
The most well characterized signaling cascade used by tyrosine kinase
receptors bound to ligand involves the successive activation of Ras,
c-Raf, mitogen-activated protein kinase kinase 1 and 2 (MEK) and
mitogen-activated protein kinases (ERK1 and ERK2). To elucidate the
components of the pathway that is used in relaxin signaling, we studied
the effect of specific inhibition of synthesis of c-Raf kinase.
Transfection with a specific c-Raf mRNA-targeted antisense
oligonucleotide (31, 32) resulted in effective inhibition
of c-Raf protein levels, which, in turn, caused a significant
down-regulation of relaxin-stimulated pro-MMP-1 and relaxin-stimulated
pro-MMP-3 protein levels. Reduction of c-Raf protein levels also
resulted in a reversal of relaxin inhibition of TIMP-1 protein levels.
Expression of pro-MMP-1, pro-MMP-3, and TIMP-1 protein levels in
nonrelaxin-treated cells was not altered by inhibition of c-Raf protein
levels. These data point to the involvement of c-Raf in relaxin
signaling and, as MEK is the only known kinase directly downstream of
c-Raf, suggest the utilization of a MEK-ERK kinase cascade. However,
some evidence supports the concept that Raf can also activate other
effectors (40, 41, 42). The complete pathway used by relaxin
requires further study.
Thus, the present data demonstrate that relaxin appears to positively
regulate MMP expression in human lower uterine segment fibroblasts
using a signaling pathway that involves a tyrosine kinase receptor and
c-Raf kinase. Our previous data, which demonstrate that relaxin does
not increase intracellular levels of cAMP in human lower uterine
segment fibroblasts, suggest that the relaxin receptor is not a
heterotrimeric G protein-associated receptor (23).
Although increased intracellular cAMP concentrations in several cell
types are associated with relaxin treatment (5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17), to
date no data have been provided by any studies that demonstrate
coupling of a relaxin-receptor complex to a heterotrimeric G
protein-coupled receptor.
Various cytokines and other stimulators of MMP expression in several
cell types use PKCs in mediating their effects (43). In
contrast, inhibition of the activity of PMA-sensitive PKCs did not
influence relaxin stimulation of pro-MMP-1 and pro-MMP-3 protein
levels. Inhibition of PKC activity in these experiments markedly
inhibited PMA-stimulated pro-MMP-1 and pro-MMP-3 expression, yet had no
effect on relaxin-stimulated levels. The structurally similar inactive
compound demonstrated no effect on relaxin-regulated expression of
pro-MMP-1 or pro-MMP-3 or upon PMA-stimulated pro-MMP-1 and pro-MMP-3
expression. These data demonstrate that relaxin stimulation of MMPs
does not involve PMA-sensitive PKCs. However, the involvement of
recently described PMA-insensitive PKCs (44) remains
unknown. Involvement of a PMA-insensitive isotype has been shown in
PDGF activation of the stromelysin promoter (45).
Our data and those of others suggest that relaxin action on connective
tissue may be unique. Cytokines such as interleukin-1
stimulate the
production of MMP-1 and MMP-3 in human cervical fibroblasts in
vitro (35). However, unlike relaxin, which inhibits
the expression of TIMP-1 in our model system and in dermal fibroblasts
(46), interleukin-1
increases TIMP-1 production in
human cervical fibroblasts and in fibroblasts from other organs
(34, 46, 47, 48). Other growth factors and cytokines, such as
EGF and TNF
also stimulate the production of MMP-1, and MMP-3.
However, in addition, these agents either stimulate TIMP-1 production
in human fibroblasts or have no effect (36, 49). Other
factors, such as retinoids, interferons, and glucocorticoids, inhibit
TIMP-1 expression, yet they inhibit MMP expression as well
(50). Thus, relaxin may be unique in its ability to have
inhibitory effects on the endogenous inhibitor of MMPs while
stimulating the MMPs. This activity of inhibition of TIMP-1 expression
by relaxin may account for the more modest stimulatory effects of
relaxin on MMP-1 and MMP-3 expression compared with the effects of
cytokines such as interleukin-1
, which also stimulate levels of the
inhibitor. This may have a biological basis; a more modest effect of
relaxin may be necessary to allow connective tissue remodeling, yet not
cause the kind of connective tissue destruction that may occur in
reactions mediated by inflammatory cytokines. Unlike relaxin, MMP
stimulatory activities of cytokines such as interleukin-1 require
PMA-sensitive PKCs in certain cell types, including human cervical
fibroblasts (34). Yet, similar to relaxin, cAMP is not a
second messenger for interleukin-1 action in this system
(34). Certain aspects of relaxin signaling that regulate
MMP expression in human lower uterine segment fibroblasts may be common
to those of other regulators. For example, stromelysin-1 gene induction
by PDGF is dependent upon Ras, which then directs two distinct
pathways, one of which is c-Raf dependent (which may resemble relaxin
signaling) and another of which is c-Raf independent. Cytokines and
growth factors have been shown to regulate the production of each MMP
and endogenous tissue inhibitor using many different pathways in a
ligand-, developmental, and tissue-specific manner. Thus, understanding
of the complete signaling pathway and even multiple paths that
regulate relaxin signaling will require additional study in this cell
type.
The effects of relaxin on cervical connective tissue must be considered
in relation to the actions of the steroid hormones, estrogen and
progesterone. In contrast to the previously demonstrated synergistic
effect of relaxin and progesterone on the uterus (39),
relaxin and progesterone appear to have opposing influences on cervical
MMP expression, which may maintain a balance that results in a net
effect of maintaining cervical connective tissue integrity during
pregnancy. At term pregnancy in women or during premature labor,
alterations in progesterone metabolism or progesterone action, such as
that proposed to be caused by repression of the progesterone receptor,
may allow the balance to be shifted to a more pronounced effect of
relaxin in concert with a lesser effect of progesterone, resulting in
the rearrangement of connective tissue caused by the resultant relative
increase in MMP activity and decrease in TIMP-1 activity. The present
data allow for the hypothesis that progesterone may to some extent
block or prevent the effects of relaxin on the cervix. A greater effect
of relaxin may thus occur when progesterone concentrations are
decreased or when the action of progesterone is suppressed. Thus, in
women, relaxin action on the cervix may be more robust at term
pregnancy when progesterone biological activity may be decreased. Also,
at very high concentrations, relaxin may overcome this blockage by
progesterone, causing an increase in prematurity risk.
The mechanisms used to accomplish cervical ripening during human
pregnancy are extremely complex and require the actions of multiple
interacting peptide and steroid hormones and other factors and cellular
responses. The evidence that relaxin is a positive regulator of the
MMPs that affect type I collagen, in contrast to the negative effects
of progesterone, and that relaxin stimulates pro-MMP-2 provides a
potential explanation for the relationship between increased
circulating maternal levels of relaxin and the increased risk of
prematurity. In addition, these findings allow for the formulation of a
new hypothesis regarding the role of the relative actions of relaxin
and progesterone at term delivery. The collective data now
suggest that the relaxin receptor is a tyrosine kinase receptor that,
when bound to relaxin, activates a signaling pathway(s) mediated by the
c-Raf kinase, a pathway that does not involve PMA-sensitive PKCs or
cAMP.
 |
Acknowledgments
|
|---|
 |
Footnotes
|
|---|
This work was supported by NIH Grant HD-22338.
1 Present address: Department of Obstetrics and Gynecology,
Roosevelt-St. Lukes Medical Center, 1000 Tenth Avenue, New York, New
York 10019. 
2 Present address: Reproductive Endocrine Unit, Massachusetts
General Hospital, 55 Fruit Street, Boston, Massachusetts
02114. 
Abbreviations: EBSS, Earles Balanced salt solution; EGF,
epidermal growth factor; HNMPA, hydroxy-2-naphthalenyl methyl
phosphonic acid trisacetoxymethyl ester; LAH, lactalbumin hydrolysate;
MMP, matrix metalloproteinase; PDGF, platelet-derived growth
factor; PMA, phorbol-12-myristate-13-acetate; TIMP-1, tissue
inhibitor of metalloproteinase-1.
Received November 27, 2000.
Accepted for publication April 4, 2001.
 |
References
|
|---|
-
Sherwood OD 1994 Relaxin. In: Knobil E, Neill
J, eds. The physiology of reproduction, 2nd Ed. New York: Raven Press;
8611009
-
Steinetz BG, OByrne EM, Kroc RL 1980 The role of
relaxin in cervical softening in mammals. In: Naftolin F, Stubblefield
PG, eds. Dilation of the Uterine Cervix. Raven Press, New York,
157177
-
Petersen LK, Skajaa K, Uldbjerg N 1992 Serum
relaxin as a potential marker for preterm labor. Br J Obstet
Gynecol 99:292295[Medline]
-
Weiss G, Goldsmith LT, Sachdev R, Von Hagen S, Lederer
K 1993 Elevated first-trimester serum relaxin concentrations in
pregnant women following ovarian stimulation predict prematurity risk
and preterm delivery. Obstet Gynecol 82:821828[Abstract/Free Full Text]
-
Kramer SM, Gibson UEM, Fendley BM, et al. 1990 Increase in cyclic AMP levels by relaxin in newborn rhesus kidney
monkey uterus cell culture. In Vitro Cell Dev Biol 26:647656[Medline]
-
Braddon SA 1978 Relaxin-dependent adenosine
3',5'-monophosphate concentration changes in the mouse pubic symphysis.
Endocrinology 102:12921299[Abstract]
-
Sanborn BM, Kuo HS, Weisbrot NW, Sherwood OD 1980 The interaction of relaxin with the rat uterus. I. Effect on cyclic
nucleotide levels and spontaneous contractile activity. Endocrinology 106:12101215[Abstract]
-
Hsu CJ, McCormack SM, Sanborn BM 1985 The effect
of relaxin on cyclic adenosine 3',5'-monophosphate concentrations in
rat myometrial cells in culture. Endocrinology 116:20292035[Abstract]
-
Meera P, Anwer K, Monga M, et al. 1995 Relaxin
stimulates myometrial calcium-activated potassium channel activity via
protein kinase A. Am J Physiol 269:C312C317
-
Sanborn BM, Anwer K, Monga M, et al. 1995 Mechanisms controlling the acute effects of relaxin on the myometrium.
In: MacLennan AH, Tregear GW, Bryant-Greenwood GD, eds. Progress in
relaxin research, chapt 19. Singapore: World Scientific; 289297
-
Osa T, Inoue H, Okabe K 1991 Effects of porcine
relaxin on contraction, membrane response and cyclic AMP content in rat
myometrium in comparison with the effects of isoprenaline and
forskolin. Br J Pharmacol 104:950960[Medline]
-
Hughes SJ, Hollingsworth M, Elliott KRF 1997 The
role of a cAMP-dependent pathway in the uterine relaxant action of
relaxin in rats. J Reprod Fertil 109:289296[Abstract]
-
Fei DTW, Gross MC, Lofgren JL, Mora-Worms M, Chen
AB 1990 Cyclic AMP responses to recombinant human relaxin by
cultured human endometrial cells-a specific and high throughput in
vitro bioassay. Biochem Biophys Res Commun 170:214222[CrossRef][Medline]
-
Bigazzi M, Brandi ML, Bani G, BaniSacchi T 1992 Relaxin influences the growth of MCF-7 breast cancer cells. Cancer 70:639643[CrossRef][Medline]
-
Chen G, Huang JR, Tseng L 1988 The effect of
relaxin on cyclic adenosine 3',5'-monophosphate concentrations in human
endometrial glandular epithelial cells. Biol Reprod 39:519525[Abstract]
-
Tseng L, Lane B 1995 Role of relaxin in the
decidualization of human endometrial cells. In: MacLennan AH, Tregear
GW, Bryant-Greenwood GD, eds. Progress in relaxin research, chapt 23.
Singapore: World Scientific; 325338
-
Cronin MJ, Malaska T, Bakhit C 1987 Human relaxin
increases cyclic AMP levels in cultured anterior pituitary cells.
Biochem Biophys Res Commun 148:12461251[CrossRef][Medline]
-
Nagase H, Woessner JF 1999 Matrix
metalloproteinases. J Biol Chem 274:2149121494[Free Full Text]
-
Granstrom LM, Ekman GE, Malmstrom A, Ulmsten U, Woessner
JF 1992 Serum collagenase levels in relation to the state of the
human cervix during pregnancy and labor. Am J Obstet Gynecol 167:12841288[Medline]
-
Rajabi MR, Dean DD, Beydoun SN, Woessner JF 1988 Elevated tissue levels of collagenase during dilation of uterine cervix
in human parturition. Am J Obstet Gynecol 159:971976[Medline]
-
Rechberger T, Woessner JF 1993 Collagenase,
its inhibitors, and decorin in the lower uterine segment in pregnant
women. Am J Obstet Gynecol 168:15981603[Medline]
-
Wiqvist I, Norstrom A, OByrne E, Wiqvist N 1984 Regulatory influence of relaxin on human cervical and uterine
connective tissue. Acta Endocrinol (Copenh) 106:127132[Medline]
-
Palejwala S, Stein DE, Wotjczuk A, Weiss G, Goldsmith
LT 1998 Demonstration of a relaxin receptor and relaxin stimulated
tyrosine phosphorylation in human lower uterine segment fibroblasts.
Endocrinology 139:12081212[Abstract/Free Full Text]
-
Goldberg GI, Wilhelm SM, Kronberger A, Bauer EA, Grant
GA, Eisen AZ 1986 Human fibroblast collagenase complete primary
structure and homology to an oncogene transformation-induced rat
protein. J Biol Chem 261:66006605[Abstract/Free Full Text]
-
Benbow U, Buttice G, Nagase H, Kurkinen M 1996 Characterization of the 46-kDa intermediates of matrix
metalloproteinase 3 (stromelysin 1) obtained by site-directed mutation
of phenylalanine 83. J Biol Chem 271:1071510722[Abstract/Free Full Text]
-
Chua CC, Chua BHL 1990 Tumor necrosis factor-
induces mRNA for collagenase and TIMP in human skin fibroblasts.
Connect Tissue Res 25:161170[Medline]
-
Anzick SL, Kononen J, Walker RL, et al. 1997 AIB1,
a steroid receptor coactivator amplified in breast and ovarian cancer.
Science 277:965968[Abstract/Free Full Text]
-
Meyer T, Regenass U, Fabbro D 1989 A derivative of
staurosporine (CGP 41 251) shows selectivity for protein kinase C
inhibition and in vitro anti-proliferative as well as
in-vivo anti-tumor activity. Int J Cancer 43:851859[Medline]
-
Saperstein R, Vicario PP, Strout HV, et al. 1989 Design of a selective insulin receptor tyrosine kinase inhibitor and
its effect on glucose uptake and metabolism in intact cells.
Biochemistry 28:56945701[CrossRef][Medline]
-
Baltensperger K, Lewis RE, Woon C-W, et al. 1992 Catalysis of serine and tyrosine autophosphorylation by the human
insulin receptor. Proc Natl Acad Sci USA 89:78857889[Abstract/Free Full Text]
-
Monia BP, Johnston JF, Geiger T, Muller M, Fabbro D 1996 Antitumor activity of a phosphorothioate antisense
oligodeoxynucleotide targeted against C-raf kinase. Nat Med 6:668675
-
Xu XS, Vanderziel C, Bennett CF, Monia BP 1998 A
role for c-Raf kinase and Ha-Ras in cytokine-mediated induction of cell
adhesion molecules. J Biol Chem 273:3323033238[Abstract/Free Full Text]
-
Palejwala S, Goldsmith LT 1992 Ovarian expression
of cellular Ki-ras p21 varies with physiological status.
Proc Natl Acad Sci USA 89:42024206[Abstract/Free Full Text]
-
Takahashi S, Ito A, Nagano M, et al. 1991 Cyclic
adenosine 3',5'-monophosphate suppresses interleukin 1-induced
synthesis of matrix metalloproteinases but not of tissue inhibitor of
metalloproteinases in human uterine cervical fibroblasts. J Biol
Chem 266:1989419899[Abstract/Free Full Text]
-
Takahashi S, Sato T, Ito A, et al. 1993 Involvement
of protein kinase C in the interleukin 1
-induced gene expression of
matrix metalloproteinases and tissue inhibitor-1 of metalloproteinases
(TIMP-1) in human uterine cervical fibroblasts. Biochim Biophys Acta 1220:5765[Medline]
-
Hosono T, Ito A, Sato T, Nagase H, Mori Y 1996 Translational augmentation of pro-matrix metalloproteinase 3
(prostromelysin 1) and tissue inhibitor of metalloproteinases (TIMP)-1
mRNAs induced by epidermal growth factor in human uterine cervical
fibroblasts. FEBS Lett 381:115118[CrossRef][Medline]
-
Chomczynski P, Sacchi N 1987 Single-step method of
RNA isolation by acid guanidium thiocyanate-phenol-chloroform
extraction. Anal Biochem 162:156159[Medline]
-
Aviv H, Leder P 1972 Purification of biologically
active globin messenger RNA by chromatography on oligothymidylic
acid-cellulose Proc Natl Acad Sci. USA. 69:14081412
-
Grazi RV, Goldsmith LT, Schmidt CL, VonHagen S, Weiss
G 1988 Synergistic effect of relaxin and progesterone on cyclic
adenosine 3',5'-monophosphate levels in the rat uterus. Am J
Obstet Gynecol 159:14021406[Medline]
-
Chung K-C, Gomes I, Wang D, Lau LF, Rosner MR 1998 Raf and fibroblast growth factor phosphorylate Elk1 and activate the
serum response element of the immediate early gene pip92 by
mitogen-activated protein kinase-independent as well as -dependent
signaling pathways. Mol Cell Biol 18:22722281[Abstract/Free Full Text]
-
Lin J-H, Makris A, McMahon C, et al. 1999 The
ankyrin repeat-containing adapter protein Tvl-1 is a novel substrate
and regulator of Raf-1. J Biol Chem 274:1470614715[Abstract/Free Full Text]
-
Jette C, Thorburn A 2000 A Raf-induced
MEK-independent signaling pathway regulates atrial natriuretic factor
gene expression in cardiac muscle cells. FEBS Lett 467:16[CrossRef][Medline]
-
Newton AC 1995 Protein kinase C: structure,
function and regulation. J Biol Chem 270:289528498
-
Ron D, Kazanietz MG 1999 New insights into the
regulation of protein kinase C and novel phorbol ester receptors. FASEB
J 13:16581676[Abstract/Free Full Text]
-
Sanz L, Berra E, Municio MM, et al. 1994
PKC
plays a critical role during stromelysin promoter activation by
platelet-derived growth factor through a novel palindromic element.
J Biol Chem 269:1004410049[Abstract/Free Full Text]
-
Unemori EN, Amento EP 1990 Relaxin modulates
synthesis and secretion of procollagenase and collagen by human dermal
fibroblasts. J Biol Chem 265:1068110685[Abstract/Free Full Text]
-
Murphy G, Reynolds JJ, Werb Z 1985 Biosynthesis of
tissue inhibitor of metalloproteinases by human fibroblasts in culture.
Stimulation by 12-O- tetradecanoylphorbol 13-acetate and
interleukin 1 in parallel with collagenase. J Biol Chem 260:30793083[Abstract/Free Full Text]
-
Sato T, Ito A, Mori Y 1990 Interleukin 6 enhances
the production of tissue inhibitor of metalloproteinases (TIMP) but not
that of matrix metalloproteinases by human fibroblasts. Biochem Biophys
Res Commun 170:824829[CrossRef][Medline]
-
Chua CC, Chua BHL 1990 Tumor necrosis factor-
induces mRNA for collagenase and TIMP in human skin fibroblasts.
Connect Tissue Res 25:161170
-
Brinckerhoff CE, Auble D 1990 Regulation of
collagenase gene expression in synovial fibroblasts. Ann NY Acad Sci.
580:355374
This article has been cited by other articles:

|
 |

|
 |
 
C. S. Samuel, T. D. Hewitson, Y. Zhang, and D. J. Kelly
Relaxin Ameliorates Fibrosis in Experimental Diabetic Cardiomyopathy
Endocrinology,
July 1, 2008;
149(7):
3286 - 3293.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Yan Wen, Y.-Y. Zhao, M. L. Polan, and B. Chen
Effect of Relaxin on TGF-{beta}1 Expression in Cultured Vaginal Fibroblasts From Women With Stress Urinary Incontinence
Reproductive Sciences,
March 1, 2008;
15(3):
312 - 320.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Needle, K. Piparo, D. Cole, C. Worrall, I. Whitehead, G. Mahon, and L. T. Goldsmith
Protein Kinase A-Independent cAMP Stimulation of Progesterone in a Luteal Cell Model Is Tyrosine Kinase Dependent but Phosphatidylinositol-3-Kinase and Mitogen-Activated Protein Kinase Independent
Biol Reprod,
July 1, 2007;
77(1):
147 - 155.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Jeyabalan, J. Novak, K. D. Doty, J. Matthews, M. C. Fisher, L. J. Kerchner, and K. P. Conrad
Vascular Matrix Metalloproteinase-9 Mediates the Inhibition of Myogenic Reactivity in Small Arteries Isolated from Rats after Short-Term Administration of Relaxin
Endocrinology,
January 1, 2007;
148(1):
189 - 197.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. L. Halls, R. A. D. Bathgate, and R. J. Summers
Comparison of Signaling Pathways Activated by the Relaxin Family Peptide Receptors, RXFP1 and RXFP2, Using Reporter Genes
J. Pharmacol. Exp. Ther.,
January 1, 2007;
320(1):
281 - 290.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. J. Scott, S. Layfield, Y. Yan, S. Sudo, A. J. W. Hsueh, G. W. Tregear, and R. A. D. Bathgate
Characterization of Novel Splice Variants of LGR7 and LGR8 Reveals That Receptor Signaling Is Mediated by Their Unique Low Density Lipoprotein Class A Modules
J. Biol. Chem.,
November 17, 2006;
281(46):
34942 - 34954.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Jeyabalan, L. J. Kerchner, M. C. Fisher, J. T. McGuane, K. D. Doty, and K. P. Conrad
Matrix metalloproteinase-2 activity, protein, mRNA, and tissue inhibitors in small arteries from pregnant and relaxin-treated nonpregnant rats
J Appl Physiol,
June 1, 2006;
100(6):
1955 - 1963.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. A. Bathgate, R. Ivell, B. M. Sanborn, O. D. Sherwood, and R. J. Summers
International Union of Pharmacology LVII: Recommendations for the Nomenclature of Receptors for Relaxin Family Peptides.
Pharmacol. Rev.,
March 1, 2006;
58(1):
7 - 31.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. A. Figueiredo, A. L. Mui, C. C. Nelson, and M. E. Cox
Relaxin Stimulates Leukocyte Adhesion and Migration through a Relaxin Receptor LGR7-dependent Mechanism
J. Biol. Chem.,
February 10, 2006;
281(6):
3030 - 3039.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. S. Samuel
Relaxin: Antifibrotic Properties and Effects in Models of Disease
Clin. Med. Res.,
November 1, 2005;
3(4):
241 - 249.
[Abstract]
[Full Text]
[PDF]
 |