help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Palejwala, S.
Right arrow Articles by Goldsmith, L. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Palejwala, S.
Right arrow Articles by Goldsmith, L. T.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*L-TYROSINE
*PROGESTERONE
Endocrinology Vol. 142, No. 8 3405-3413
Copyright © 2001 by The Endocrine Society


ARTICLES

Relaxin Positively Regulates Matrix Metalloproteinase Expression in Human Lower Uterine Segment Fibroblasts Using a Tyrosine Kinase Signaling Pathway

Smita Palejwala, Daniel E. Stein1, Gerson Weiss, Brett P. Monia, Drew Tortoriello2 and Laura T. Goldsmith

Department of Obstetrics, Gynecology, and Women’s Health, New Jersey Medical School, Newark, New Jersey 07103; and Isis Pharmaceuticals (B.P.M.), Carlsbad, California 92008

Address all correspondence and requests for reprints to: Dr. Laura T. Goldsmith, Department of Obstetrics, Gynecology, and Women’s Health, New Jersey Medical School, 185 South Orange Avenue, Newark, New Jersey 07103. E-mail: goldsmit{at}umdnj.edu


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Despite the importance of relaxin to normal parturition in various species and its potential as an etiological agent in preterm delivery in women, knowledge regarding the mechanisms by which relaxin alters cervical connective tissue is extremely limited. An established in vitro model for human pregnancy cervix, human lower uterine segment fibroblasts, was used to determine the effects of relaxin as well as those of progesterone on the expression of matrix metalloproteinases and tissue inhibitor of metalloproteinase-1. The results demonstrate that relaxin is a positive regulator of matrix metalloproteinase expression, as it stimulates the expression of procollagenase protein and mRNA levels, stimulates prostromelysin-1 protein and mRNA levels, and inhibits tissue inhibitor of metalloproteinase-1 protein expression. Stimulation of procollagenase and prostromelysin-1 expression by relaxin does not involve phorbol-12-myristate-13-acetate- sensitive PKCs. Relaxin-stimulated tyrosine phosphorylation of the putative receptor and inhibition by a receptor tyrosine kinase inhibitor suggest that the relaxin receptor is probably a tyrosine kinase receptor. Inhibition of c-Raf protein expression using an antisense oligonucleotide inhibits relaxin regulation of matrix metalloproteinase and tissue inhibitor of metalloproteinase-1, suggesting that a signaling pathway involving c-Raf kinase mediates relaxin action.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
THE MAMMALIAN CERVIX undergoes marked connective tissue remodeling for successful parturition to occur. Despite the significance of this process, the physiological and biochemical mechanisms responsible remain poorly defined. In a wide variety of mammalian species, the protein hormone relaxin is a powerful agent in the reorganization of reproductive tract connective tissue. In several species, relaxin is obligatory for normal delivery due to this marked ability to rearrange reproductive tract connective tissue, especially in the cervix (1, 2). In women, elevated maternal circulating relaxin levels are significantly correlated to an increased risk of premature delivery (3, 4). However, despite the importance of relaxin to normal reproductive function and its potential as an etiological agent in preterm delivery in women, knowledge regarding the mechanisms by which relaxin alters cervical connective tissue is extremely limited. In addition, little is known regarding the cellular mechanism of action of relaxin in any cell type. The structure of the relaxin receptor is unknown, and no complete signaling pathway has been identified. Relaxin action in several cell types is associated with the cAMP/adenylate cyclase/PKA pathway (5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17). However, no data that demonstrate coupling of a relaxin-receptor complex to a heterotrimeric G protein have been provided.

The maintenance of connective tissue architecture requires a precise balance between the action of matrix metalloproteinases (MMPs), which degrade the extracellular matrix, and the endogenous tissue inhibitors of metalloproteinases, which regulate the activity of the metalloproteinases (18). The present studies were designed to determine the effects of relaxin on the regulation of human cervical MMP expression and to elucidate the mechanism of action of relaxin in these effects using an established in vitro model of human pregnancy cervix, lower uterine segment fibroblasts (19, 20, 21, 22, 23). As type I collagen is the major collagen type in human cervix, we evaluated the effects of relaxin on the expression of interstitial collagenase, stromelysin, and their endogenous inhibitor tissue inhibitor of metalloproteinase-1 (TIMP-1).


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Materials
Earle’s Balanced Salt Solution (EBSS), DMEM, penicillin, streptomycin sulfate, lactalbumin hydrolysate, trypsin/EDTA, Opti-MEM, and Lipofectin reagent were purchased from Life Technologies, Inc. (Grand Island, NY). 17ß-Estradiol, progesterone, phorbol-12-myristate-13- acetate (PMA), donkey antisheep IgG, polyvinylidene difluoride membranes and guanosine 5'-O-(3-thiotriphosphate) tetralithium salt were purchased from Sigma (St. Louis, MO). FBS was purchased from HyClone Laboratories, Inc. (Logan, UT). Enhanced chemiluminescence reagents were purchased from Amersham Pharmacia Biotech (Arlington Heights, IL). Platelet-derived growth factor (PDGF), epidermal growth factor (EGF), hydroxy-2-naphthalenyl methyl phosphonic acid trisacetoxymethyl ester (HNMPA), and tyrphostin AG 18 were obtained from Calbiochem (San Diego, CA). Tyrphostin AG 1478 was purchased from BIOMOL Research Laboratories, Inc. (Plymouth Meeting, PA). Human H2 relaxin was a gift from Genentech, Inc. (South San Francisco, CA). The staurosporine derivative PKC inhibitor CGP41251 and the inactive, similarly structured molecule CGP42700 were provided by Dr. T. Meyer, (Ciba-Geigy, Basel, Switzerland). Sheep antihuman pro-MMP-3 and TIMP-1 antibodies and pure pro-MMP-1, pro-MMP-3, and TIMP-1 proteins were provided by Dr. Hideaki Nagase (University of Kansas Medical Center, Kansas City, KS). Additional antibodies were purchased. Mouse monoclonal antibody to residues 332–350 of human MMP-1 (Ab-1, catalogue no. IM35L) was obtained from Calbiochem (San Diego, CA), and it recognizes both pro- and active MMP-1. MMP-2 antibody, a mouse monoclonal antibody raised against human MMP-2, was obtained from Calbiochem [anti-MMP-2 (Ab-4), catalogue no. IM 51L] and recognizes both pro- and active MMP-2. c-Raf-1 antibody, a mouse monoclonal antibody to residues 162–378 of human c-Raf (R19120) that specifically recognizes the 74-kDa c-Raf-1 protein, and phosphotyrosine antibody, a horseradish peroxidase-conjugated recombinant antiphosphotyrosine PY20 (RC20H), were purchased from Transduction Laboratories (Lexington, KY). Peroxidase-conjugated goat antimouse IgG was obtained from Calbiochem (San Diego, CA). Peroxidase-conjugated donkey antisheep IgG was obtained from Sigma. The MMP-1 probe was a 1970-bp cDNA insert in plasmid pCol185.2 provided by Dr. Gregory Goldberg (24). The MMP-3 probe was a full-length cDNA insert in the expression vector pEE6 provided by Dr. M. Kurkinen (25). The TIMP-1 probe was a 39-mer oligonucleotide (GGAATTGCAGAAGGCCGTCTGTGGGTGGGGTGGGACACA, a sequence complementary to nucleotides 138–176 sequence of the TIMP gene) (26) that was synthesized at Genosys Biotechnologies, Inc. (The Woodlands, TX). The ß-actin probe was an 1800-bp cDNA that hybridizes to a 1.7-kb human ß-actin mRNA transcript (CLONTECH Laboratories, Inc., Palo Alto, CA) (27). These probes have all been used in hybridization studies of their respective mRNAs (24, 25, 26, 27).

Regulation of MMP expression
The isolation, primary culture, and characterization of the human lower uterine segment fibroblasts have been described in precise detail previously (23). Briefly, lower uterine segment tissue was removed at term pregnancy from a nonlaboring patient at the time of cesarean section delivery following informed consent. The protocol was approved by the institutional review board. Isolated, cultured cells were characterized as fibroblasts free of contaminating epithelial cells by immunohistochemistry of specific markers (23). Cells were plated at 1 x 106 cells/well in 35-mm tissue culture dishes (Becton Dickinson and Co., Lincoln Park, NJ) and maintained in DMEM supplemented with 10% FBS, 5000 U/ml penicillin, and 5000 µg/ml streptomycin sulfate (complete medium) overnight in an atmosphere of 5% CO2/95% air. Medium was removed from the cells and replaced with complete medium containing 1 µM 17ß-estradiol. This was repeated 24 and 48 h later for a total of 72 h of estradiol priming. Medium was then removed and replaced with serum-free DMEM supplemented with 0.2% lactalbumin hydrolysate (LAH) without or with various amounts of relaxin. Cells in replicate wells were also incubated with PMA (10 nM) as a positive control. After 65 h of incubation, cells were removed from the plate using trypsin/EDTA and counted using a Coulter counter (Miami, FL). Conditioned medium was maintained frozen at -20 C until Western blotting was performed. Cells from replicate wells were used to prepare RNA for Northern blotting.

Role of PKC in relaxin signaling
Cells were plated as described above. After 72 h of estradiol priming, medium was removed and replaced with serum-free DMEM supplemented with 0.2% LAH either without or with 0.5, 1, or 10 ng/ml relaxin or 10 nM PMA. With each of these relaxin concentrations as well as with the PMA group, two additional sets of wells were treated with 0.2 µM CGP41251 or 0.2 µM CGP42700, respectively. The activities of these compounds has been described previously (28). Cells were incubated in an atmosphere of 5% CO2/95% air at 37 C for 65 h; the medium was then collected and frozen at -20 C until Western blotting was performed. Cells were removed from the plate by incubation with trypsin/EDTA and counted.

Role of receptor tyrosine kinase inhibition in relaxin signaling
Cells were seeded at 1 x 105 cells/well in 24-well trays in complete DMEM and incubated for 48 h, after which they were serum-starved for 24 h. Subsequently, they were pretreated with receptor tyrosine kinase inhibitors (5 µM HNMPA, 100 µM AG18, or 100 nM AG1478) in serum-free medium overnight. The next day, cells were treated without or with either 1 nM relaxin, 10 ng/ml PDGF, or 10 ng/ml EGF (stimulators) in the absence or presence of 5 µM HNMPA, 100 µM AG18, or 100 nM AG1478 (inhibitors) as follows. Medium was replaced with serum-free vanadate containing DMEM, and cells were incubated in the absence or presence of stimulators with or without inhibitors for the specified time periods, after which protein extracts were prepared and subjected to phosphotyrosine Western blotting analysis as described previously (23). For each stimulator, phosphorylation of their respective receptor protein was assessed. HNMPA is a potent inhibitor highly specific for tyrosine kinases over serine kinases (29, 30).

Role of c-Raf in relaxin signaling
Two oligonucleotides that contain 2'-O-methoxyethyl/phosphodiester residues flanking a 2'-deoxynucleotide/phosphorothioate region that supports ribonuclease H activation in cells, were used in these experiments, as used previously (31, 32). The sequences are TCC-CGC-CTG-TGA-CAT-GCA-TT (ISIS 12854) and TCC-CGC-CTA-CTA-CAT-GCA-TT (ISIS 14729, control for ISIS 12854). ISIS 12854 has been used previously to inhibit c-Raf protein expression in human cells (32). Cells were seeded at 1.5 x 105 cells/well in 24-well trays. The next day, cells were primed with 1 µM 17ß-estradiol for 48 h in complete medium. After 48 h, the first oligonucleotide treatment was performed as follows. Cells were washed with 0.5 ml EBSS, and 225 µl Opti-MEM containing 10 µl Lipofectin/ml were added. Untreated, control cells received an additional 25 µl Opti-MEM. Treated cells received 25 µl 2 µM oligonucleotide (final concentration, 200 nM) in Opti-MEM, either c-Raf antisense ISIS 12854 or c-Raf antisense mismatched ISIS 14729. Cells were then incubated for 5 h at 37 C, after which the medium was aspirated and replaced with complete medium containing 1 µM 17ß-estradiol, and cells were incubated overnight. The next day, this complete protocol was repeated exactly as described above. After this 5-h incubation, cells were washed once with EBSS and fed with serum-free DMEM containing 0.2% LAH. Cells were then incubated for 65 h at 37 C, without or with 10 ng/ml relaxin, and conditioned medium was collected for MMP analysis by Western blotting. For each category of cell treatment, the cells in one well were taken for counting, and the remaining wells (three for each category) were used in preparation of protein extracts.

Preparation of cell protein extracts for Western blotting
Cell protein extracts for Western blotting were prepared as follows. Medium was aspirated, and the cells were rapidly washed with EBSS. Cells were lysed by the addition of 50 µl nonreducing, dye-free, boiling 2 x SDS-PAGE buffer/well. Lysates were collected into small microfuge tubes (aided by scraping the wells with a cell scraper) and boiled for 2 min. After cooling on ice, cell lysates were passed through a 25-gauge needle four times to shear DNA. An aliquot was removed for protein assay, and 5 µl 2-mercaptoethanol and 0.5 µl 0.2% bromophenol blue solution (per 100 µl) were then added to the extracts, which were boiled for 2 min and immediately frozen at -20 C. Protein extracts were assessed for protein content using the Protein Assay DC kit (Bio-Rad Laboratories, Inc., Hercules, CA) and BSA as standard.

Western blot analysis
SDS-PAGE and Western transfers were performed as previously described (23, 33). Equivalent amounts of cell-conditioned medium (10 µl medium heat treated with 5 µl 3 x SDS-PAGE buffer, except for TIMP-1, for which 40 µl medium heat treated with 10 µl 5 x SDS-PAGE buffer were used) were used. For phosphotyrosine immunoblotting, 10 µg protein equivalents of frozen cell extracts (prepared as described) were used. Samples were loaded onto 4% stacking and 10% (for MMPs), 12.5% (for TIMP-1 and c-Raf), or 8% (for phosphotyrosine) separating gels and electrophoresed at 200 V for 45 min. Pure MMP and TIMP-1 proteins were used as controls, and broad range, prestained kaleidoscope mol wt standards (Bio-Rad Laboratories, Inc.) were used to estimate the mol wt. Proteins were electrotransferred at 100 V for 1.5 h onto PVDF membranes and immunoblotted with specific antibodies. Membranes were blocked for 30 min with 3% BSA/Tris-buffered saline/0.1% Tween 20, pH 7.4, and incubated with the primary antibodies overnight. The specificity of these antibodies and their use in Western blot analysis to identify human pro-MMP-1, pro-MMP-3, and TIMP-1 have been previously described (34, 35, 36). After washing, membranes were incubated for 1 h with horseradish peroxidase-conjugated secondary antibodies diluted in 3% BSA in Tris-buffered saline/0.1% Tween 20 (pH 7.4). Blots were developed by the enhanced chemiluminescence method as described previously (23, 33) and exposed to Kodak BioMax ML or MR film (Sigma).

RNA isolation and Northern blot analysis
Total RNA was isolated using the acid guanidinium thiocyanate-phenol-chloroform extraction procedure (37). Enrichment for poly(A)+ RNA was performed using batch affinity chromatography on oligo(deoxythymidine) cellulose (38). RNAs were denatured in the presence of formaldehyde and formamide and fractionated on 1.2% agarose-formaldehyde gels. RNAs were then transferred to nylon membranes (Roche, Indianapolis, IN) using a Turbo-Blotter rapid downward transfer apparatus (Schleicher & Schuell, Inc., Keene, NH) in 20 x SSC. RNAs were fixed by UV cross-linking, and the membranes were probed with 32P-labeled cDNAs or oligonucleotides. Blots were prehybridized in buffer containing 50% formamide, 10% dextran sulfate, 0.5% SDS, 1 M NaCl, and 5 x Denhardt’s solution at 42 C for 2 h in a glass bottle in a minihybridization oven (Hybaid, Labnet, Woodbridge, NJ). Denatured labeled probe was added to the buffer, and the membranes were incubated for an additional 18 h at 42 C. Membranes were then washed twice in 2 x SSC at 42 C for 5 min each time, followed by two washings in 2 x SSC-1% SDS at 60 C for 30 min each time, followed by two washings in 0.1 x SSC at room temperature for 30 min each time. After washing, blots were subjected to autoradiography. cDNAs were labeled by random priming with [{alpha}-32P]deoxy-CTP using the Random Primers DNA Labeling System (Life Technologies, Inc., Grand Island, NY) following the instructions supplied by the manufacturer. The TIMP-1 oligomer was end labeled with [{gamma}-32P]ATP using T4 polynucleotide kinase (New England Biolabs, Inc., Beverly, MA). Labeled probes were separated from free nucleotides using Chroma Spin+ TE-10 Columns (CLONTECH Laboratories, Inc., Palo Alto, CA). Blots were exposed to Hyperfilm-MP (Amersham Pharmacia Biotech, Arlington Heights, IL) at -80 C.

Densitometric analysis
The intensities of the signals obtained on developed films were determined using a computing densitometer (300B, Molecular Dynamics, Inc., Sunnyvale, CA) using the volume integration method with appropriate corrections for background absorption, as described previously (23, 33).

Statistical analyses
Densitometric values for control untreated cells were arbitrarily set at 100, and values for treatment groups are expressed as a percentage of the control. All data generated (except for the PKC inhibitor studies) were normally distributed, as assessed using the Shapiro-Wilk test, and of equal variances, and thus were compared parametrically using two-tailed t tests. Control and treatment values from experiments using the PKC inhibitor and the PKC inhibitor analog were not normally distributed; therefore, analyses of these data were performed nonparametrically using Kruskal-Wallis rank-sum testing. All comparisons were performed using JMP statistical software (SAS Institute, Inc., Cary, NC) written for the Macintosh Computer (Apple Computers, Cupertino, CA).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Relaxin is a positive regulator of MMPs
Effect of relaxin on procollagenase (pro-MMP-)1 expression. The results of the Western blot analyses demonstrated that relaxin significantly increased the expression of procollagenase protein from lower uterine segment fibroblast cells, as shown in Fig. 1AGo. Both 1 and 10 ng/ml relaxin significantly increased procollagenase protein expression to mean (±SEM) levels of 204 ± 26% (P = 0.006) and 211 ± 21% (P = 0.02; n = 5 experiments for each dose) of the control, respectively. Relaxin (10 ng/ml) also caused a significant increase in the expression of the 2.2-kb procollagenase mRNA transcript to 214 ± 35% (n = 4 experiments; P = 0.04) above the control value, as shown in Fig. 1BGo.



View larger version (37K):
[in this window]
[in a new window]
 
Figure 1. Relaxin stimulates procollagenase (pro-MMP-1) expression. A, Effect of relaxin on levels of pro-MMP-1 protein. Cell culture and Western blotting of conditioned medium were performed as described in Materials and Methods. Densitometric values from controls were set at 100, and data from relaxin-treated cells are expressed as a percentage of the control. Each bar shows the mean ± SEM of five independent experiments. A film developed after exposure to a blot from a representative experiment is shown above. The asterisks indicate significant increases above the control in pro-MMP-1 expression caused by relaxin at 1 ng/ml (P = 0.006) and 10 ng/ml (P = 0.02). B, Effect of relaxin on levels of procollagenase mRNA. Preparation of cellular RNA and Northern blots were performed as described in Materials and Methods. Densitometric values from controls were normalized to ß-actin mRNA and set at 100. Densitometric values from relaxin-treated cells were normalized to ß-actin mRNA and are expressed as a percentage of the control. Each bar shows the mean ± SEM of four independent experiments. The asterisk indicates a significant increase above the control in procollagenase mRNA caused by relaxin at 10 ng/ml (P = 0.04). A film developed after exposure to a blot hybridized to the pro-MMP-1 probe from a representative experiment is shown above. The row labeled ß-actin shows a film developed after exposure of the same blot was hybridized to the ß-actin probe.

 
Effect of relaxin on prostromelysin (pro-MM-3) expression. Relaxin significantly increased the expression of prostromelysin protein from lower uterine segment fibroblast cells, as shown in Fig. 2AGo. Both 1 and 10 ng/ml relaxin significantly increased prostromelysin expression to mean levels of 241 ± 46% (P = 0.04) and 198 ± 31% (P = 0.04; n = 5 experiments for both) of the control, respectively. Relaxin at 10 ng/ml also caused a significant increase in the expression of the 1.9-kb prostromelysin mRNA transcript to 189 ± 26% (n = 4 experiments; P = 0.04) above the control value, as shown in Fig. 2B.



View larger version (38K):
[in this window]
[in a new window]
 
Figure 2. Relaxin stimulates prostromelysin 1 (pro-MMP-3) expression. Data were generated and are expressed as described in Fig. 1Go. A, Effect of relaxin on levels of pro-MMP-3 protein. Each bar shows the mean ± SEM of five independent experiments. The asterisks indicate significant increases above the control in pro-MMP-3 expression caused by relaxin at 1 ng/ml (P = 0.04) and 10 ng/ml (P = 0.04). B, Effect of relaxin on levels of prostromelysin 1 mRNA. Each bar shows the mean ± SEM of four independent experiments. The asterisk indicates a significant increase above the control in prostromelysin 1 mRNA caused by relaxin at 10 ng/ml (P = 0.04).

 
Effect of relaxin on TIMP-1 expression. The results of the Western blot analyses demonstrated that relaxin significantly reduced the expression of TIMP-1 protein from lower uterine segment fibroblast cells. As shown in Fig. 3Go, relaxin at 0.5, 1, or 10 ng/ml significantly decreased TIMP-1 expression to 67 ± 9% (P = 0.02), 50 ± 7% (P = 0.001), and 45 ± 5% (P < 0.001) of the control value, respectively (n = 6 experiments). In contrast to its effect at the level of the protein, relaxin at 10 ng/ml did not affect steady state levels of the 0.9-kb TIMP-1 mRNA transcript (data not shown).



View larger version (35K):
[in this window]
[in a new window]
 
Figure 3. Relaxin inhibits levels of TIMP-1 protein. Data were generated and are expressed as described in Fig. 1Go. Each bar shows the mean ± SEM of six independent experiments. The asterisks indicate significant inhibition below the control in TIMP-1 expression by relaxin at 0.5 ng/ml (P = 0.02), 1 ng/ml (P = 0.001), and 10 ng/ml (P < 0.001).

 
Progesterone is a negative regulator of MMP expression
Effects of progesterone on pro-MMP-1, pro-MMP-3, and TIMP-1 expression. As shown in Fig. 4Go, treatment of human lower uterine segment fibroblasts with 0.1, 1, 10, 100, or 1000 nM progesterone significantly decreased procollagenase protein expression to 63 ± 4%, 58 ± 4%, 54 ± 10%, 52 ± 5%, and 57 ± 3% (mean ± SEM; n = 4 experiments; P < 0.05 at all amounts) of the control value, respectively. Expression of prostromelysin protein levels was similarly inhibited by these amounts of progesterone to 59 ± 13%, 53 ± 9%, 58 ± 8%, 60 ± 4%, and 64 ± 8% (mean ± SEM; n = 4 experiments; P < 0.05 at all amounts) of the control, respectively. In contrast, expression of TIMP-1 protein levels was not affected by treatment with progesterone at these doses. Levels remained at 100 ± 4%, 93 ± 9%, 96 ± 11%, 106 ± 9%, and 117 ± 11% (mean ± SEM; n = 4 experiments; P > 0.05 at all amounts) of the control, respectively.



View larger version (37K):
[in this window]
[in a new window]
 
Figure 4. Effects of progesterone on pro-MMP-1 (A), pro-MMP-3 (B), and TIMP-1 (C) expression. Cells were incubated in serum-free medium without and with the concentrations of progesterone shown for 65 h. Western blotting of conditioned medium was performed as described in Materials and Methods. Data are expressed as described in Fig. 1Go. Each bar shows the mean ± SEM of four independent experiments, each performed in duplicate. The asterisks indicate significant inhibition below the control in pro-MMP-1 and pro-MMP-3 expression caused by progesterone at all amounts shown (P < 0.05). TIMP-1 levels were not altered by progesterone.

 
Effects of relaxin and progesterone on expression of gelatinase A (72-kDa gelatinase, MMP-2). We examined the effects of both relaxin and progesterone on the expression of gelatinase A protein levels. As shown in Fig. 5Go, treatment of the cells with 1 or 10 ng/ml relaxin caused a significant increase in MMP-2 expression to 210 ± 31% (mean ± SEM; n = 4 experiments; P = 0.039) and 193 ± 18% (P = 0.014) of the control value, respectively. The increase in MMP-2 expression caused by treatment of the cells with 0.5 ng/ml relaxin was less pronounced (154 ± 25%; P = 0.11). In contrast, MMP-2 protein levels were not affected by incubation with progesterone at 0.1, 1, 10, 100, or 1000 nM. Levels remained at 109 ± 20%, 117 ± 15%, 107 ± 13%, 94 ± 7%, and 97 ± 10% (mean ± SEM; n = 4 experiments; P > 0.05 at all amounts) of the control, respectively.



View larger version (36K):
[in this window]
[in a new window]
 
Figure 5. A, Relaxin stimulates pro-MMP-2 levels. Data were generated and are expressed as described in Fig. 1Go. Each bar shows the mean ± SEM of five independent experiments. The asterisks indicate significant increases above the control in pro-MMP-2 expression caused by relaxin at 1 ng/ml (P = 0.039) and 10 ng/ml (P = 0.014). B, Progesterone does not alter pro-MMP-2 levels. Data were generated and expressed as described in Fig. 4Go. Each bar shows the mean ± SEM of four independent experiments, each performed in duplicate.

 
Inhibition of relaxin-stimulated tyrosine phosphorylation by receptor tyrosine kinase inhibitors
As we have previously demonstrated that relaxin stimulates tyrosine phosphorylation of an approximately 220-kDa protein, which is probably the relaxin receptor, in human lower uterine segment fibroblasts (10), we determined the effect of a potent receptor tyrosine kinase inhibitor on tyrosine phosphorylation of the approximately 220-kDa protein. Figure 6AGo shows a representative phosphotyrosine Western blot of total cellular proteins from cells incubated in the absence or presence of 1 nM relaxin without or with 5 µM HNMPA. Figure 6BGo shows the reproducibility and consistency of this finding. HNMPA significantly inhibited relaxin-stimulated tyrosine phosphorylation of the approximately 220-kDa protein to 33.3 ± 8% (±SEM; P = 0.004; n = 4 experiments) and 39.2 ± 7% (P = 0.003; n = 4 experiments) of uninhibited, relaxin-stimulated levels at 15 and 30 min of treatment, respectively, similar to nonrelaxin treated levels at the same treatment times. In contrast, two other receptor tyrosine kinase inhibitors, selective for PDGF (AG18) and EGF (AG1478), had no effect on relaxin-stimulated 220-kDa protein tyrosine phosphorylation, as shown in Table 1Go. Demonstration of the inhibitory activity of AG 18 and AG 1478 on PDGF and EGF receptor phosphorylation (positive controls) is also shown in Table 1Go.



View larger version (21K):
[in this window]
[in a new window]
 
Figure 6. Effect of receptor tyrosine kinase inhibition on relaxin-stimulated protein tyrosine phosphorylation. A, A film developed after exposure to a blot from a representative experiment. Treatment of cultured cells without or with relaxin and/or receptor tyrosine kinase inhibitor, and phosphotyrosine Western blotting were performed as described in Materials and Methods. B, Results from four independent experiments, each performed in duplicate. The mean ± SEM densitometric values for the phosphorylated 220-kDa protein in cells treated with relaxin were set at 100, and values for cells treated with both relaxin and HNMPA (R+H) and for cells not given relaxin (U) are expressed as a percentage of the control (relaxin stimulation). The asterisks indicate significant inhibition of relaxin-stimulated tyrosine phosphorylation of the 220-kDa protein at both 15 min (P = 0.004) and 30 min (P = 0.003) of treatment with the receptor tyrosine kinase inhibitor, HNMPA. The stimulation by relaxin is shown by the significantly lower values of phosphorylation of the 220-kDa protein in the nonrelaxin, control (U) cells at both 15 min (P = 0.002) and 30 min (P = 0.0002).

 

View this table:
[in this window]
[in a new window]
 
Table 1. Effect of receptor tyrosine kinase (RTK) inhibitors on relaxin-stimulated receptor tyrosine phosphorylation

 
Role of c-Raf in relaxin signaling
Transfection of human lower uterine segment fibroblasts with a highly specific c-Raf mRNA-targeted antisense oligonucleotide resulted in effective inhibition of c-Raf protein levels to 48.6 ± 10% (±SEM; P = 0.036; n = 3 experiments, each performed in triplicate for all data; Fig. 7Go) and 61.2 ± 1.5% (P = 0.0016) of mismatched oligonucleotide-treated levels in untreated and relaxin-treated cells, respectively (Fig. 7AGo). Inhibition of c-Raf protein resulted in significant down-regulation of relaxin-stimulated pro-MMP-1 to 60.5 ± 3.3% (P = 0.007; Fig. 7BGo) and of relaxin stimulated pro-MMP-3 protein levels to 56 ± 8.8% (P = 0.037; Fig. 7CGo) of those in relaxin-treated cells transfected with the mismatched oligonucleotide control. Reduction of c-Raf protein levels also resulted in a reversal of relaxin inhibition of TIMP-1 protein levels to 146 ± 3.3% (P = 0.005) of those in relaxin-treated cells transfected with the mismatched oligonucleotide control (Fig. 7DGo). Expression of pro-MMP-1, pro-MMP-3, and TIMP-1 protein levels in nonrelaxin-treated cells were not altered by inhibition of c-Raf protein levels (Fig. 7Go, B–D).



View larger version (58K):
[in this window]
[in a new window]
 
Figure 7. Effects of transfection with c-Raf antisense oligonucleotide on relaxin-stimulated pro-MMP-1 and pro-MMP-3 and relaxin inhibited TIMP-1 levels. Treatment of cells with c-Raf specific or control (mismatched) antisense oligonucleotides and relaxin, and Western blot analysis of pro-MMP-1, pro-MMP-3, and TIMP-1 levels were performed as described in Materials and Methods. Densitometric values from control cells (transfected with mismatched antisense nucleotide) were set at 100, and values from c-Raf antisense-treated cells are expressed as a percentage of the control. Each bar shows the mean ± SEM of three independent experiments, each performed in triplicate. c-Raf antisense oligonucleotide significantly inhibited c-Raf protein levels in untreated (P = 0.036) and relaxin-treated (P = 0.002) cells (A), significantly inhibited relaxin-stimulated pro-MMP-1 (P = 0.007; B) and pro-MMP-3 (P = 0.037; C), and significantly reversed the relaxin inhibition of TIMP-1 expression (P = 0.005; D).

 
Role of PKC in relaxin-stimulated MMP expression
Inhibition of PKC activity did not influence relaxin stimulation of pro-MMP-1 and pro-MMP-3 protein levels. As shown in Table 2Go, the highly selective PKC inhibitor used in these experiments markedly inhibited PMA-stimulated pro-MMP-1 and pro-MMP-3 expression, yet no effect on relaxin-stimulated levels was observed. A structurally similar, yet inactive, compound was used as a negative control (28).


View this table:
[in this window]
[in a new window]
 
Table 2. Inhibition of PKC does not alter relaxin-stimulated expression of pro-MMP-1 and pro-MMP-3

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Although relaxin is an important factor in the remodeling of reproductive tract connective tissue in various mammalian species, little information regarding the effects of relaxin on MMP expression in the human cervix exists. As type I collagen is the major collagen type in human cervix, we evaluated the effects of relaxin on the expression of interstitial collagenase (MMP-1), stromelysin (MMP-3), and their endogenous inhibitor TIMP-1. The data presented here demonstrate that relaxin is a positive regulator of MMP expression in human lower uterine segment fibroblasts, an established in vitro model for human pregnancy cervix (19, 20, 21, 22, 23). Relaxin up-regulates the expression of interstitial collagenase and stromelysin at the level of both protein and mRNA and decreases expression of the endogenous inhibitor TIMP-1 protein. The signaling pathway that appears to be used by relaxin involves a tyrosine kinase receptor and the serine/threonine kinase c-Raf. PMA-sensitive PKCs are not involved in relaxin action in this cell type, nor, as suggested by our previous data, is cAMP.

Relaxin action on certain target organs, for example, the rat uterus, is synergistic with the actions of progesterone (39). However, other data suggest that this may not be the case in all target organs. To determine whether relaxin and progesterone have similar or different actions on metalloproteinase expression in the human cervix, we determined the effects of progesterone on the expression of MMPs and TIMP-1. Our data demonstrate that progesterone action on MMP expression in human lower uterine segment fibroblasts is opposite that of relaxin. Progesterone negatively regulates MMP expression. In the present studies progesterone inhibited the expression of pro-MMP-1 and pro-MMP-3 and had no effect on TIMP-1.

As a hallmark of cervical dilatation at term pregnancy in women involves infiltration of leukocytes, we examined the effect of relaxin on MMP-2 (gelatinase A), which degrades basement membrane collagens, elastin, laminin, and fibronectin (18). The data presented here demonstrate that relaxin significantly stimulates the expression of MMP-2, suggesting a mechanism by which relaxin may foster the infiltration of leukocytes and other cell types into the cervix. This effect of relaxin could serve to enhance the direct positive regulatory effect of relaxin on MMP expression by increasing the local concentrations of various MMP stimulatory cytokines secreted by these cells. The stimulatory action of relaxin on MMP-2 expression in this cell type differs from that of progesterone, which the present data demonstrate has no effect.

We previously demonstrated that the response of human lower uterine segment fibroblasts to relaxin is associated with an increase in tyrosine phosphorylation of an approximately 220-kDa protein, probably the relaxin receptor (23). To advance our understanding of the mechanisms of relaxin signaling in the cervix and test the hypothesis that the relaxin receptor is a tyrosine kinase receptor, the effects of inhibition of receptor tyrosine kinase activity on relaxin-stimulated tyrosine phosphorylation of the 220-kDa protein were studied. Treatment with a potent, specific receptor tyrosine kinase inhibitor (29, 30) demonstrated a significant inhibition of relaxin-stimulated tyrosine phosphorylation of the 220-kDa protein. In contrast, two other receptor tyrosine kinase inhibitors, selective for PDGF (AG18) and EGF (AG1478), had no effect on relaxin-stimulated tyrosine phosphorylation. These data support the concept that the relaxin receptor is a tyrosine kinase receptor distinct from the PDGF and EGF receptors.

The most well characterized signaling cascade used by tyrosine kinase receptors bound to ligand involves the successive activation of Ras, c-Raf, mitogen-activated protein kinase kinase 1 and 2 (MEK) and mitogen-activated protein kinases (ERK1 and ERK2). To elucidate the components of the pathway that is used in relaxin signaling, we studied the effect of specific inhibition of synthesis of c-Raf kinase. Transfection with a specific c-Raf mRNA-targeted antisense oligonucleotide (31, 32) resulted in effective inhibition of c-Raf protein levels, which, in turn, caused a significant down-regulation of relaxin-stimulated pro-MMP-1 and relaxin-stimulated pro-MMP-3 protein levels. Reduction of c-Raf protein levels also resulted in a reversal of relaxin inhibition of TIMP-1 protein levels. Expression of pro-MMP-1, pro-MMP-3, and TIMP-1 protein levels in nonrelaxin-treated cells was not altered by inhibition of c-Raf protein levels. These data point to the involvement of c-Raf in relaxin signaling and, as MEK is the only known kinase directly downstream of c-Raf, suggest the utilization of a MEK-ERK kinase cascade. However, some evidence supports the concept that Raf can also activate other effectors (40, 41, 42). The complete pathway used by relaxin requires further study.

Thus, the present data demonstrate that relaxin appears to positively regulate MMP expression in human lower uterine segment fibroblasts using a signaling pathway that involves a tyrosine kinase receptor and c-Raf kinase. Our previous data, which demonstrate that relaxin does not increase intracellular levels of cAMP in human lower uterine segment fibroblasts, suggest that the relaxin receptor is not a heterotrimeric G protein-associated receptor (23). Although increased intracellular cAMP concentrations in several cell types are associated with relaxin treatment (5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17), to date no data have been provided by any studies that demonstrate coupling of a relaxin-receptor complex to a heterotrimeric G protein-coupled receptor.

Various cytokines and other stimulators of MMP expression in several cell types use PKCs in mediating their effects (43). In contrast, inhibition of the activity of PMA-sensitive PKCs did not influence relaxin stimulation of pro-MMP-1 and pro-MMP-3 protein levels. Inhibition of PKC activity in these experiments markedly inhibited PMA-stimulated pro-MMP-1 and pro-MMP-3 expression, yet had no effect on relaxin-stimulated levels. The structurally similar inactive compound demonstrated no effect on relaxin-regulated expression of pro-MMP-1 or pro-MMP-3 or upon PMA-stimulated pro-MMP-1 and pro-MMP-3 expression. These data demonstrate that relaxin stimulation of MMPs does not involve PMA-sensitive PKCs. However, the involvement of recently described PMA-insensitive PKCs (44) remains unknown. Involvement of a PMA-insensitive isotype has been shown in PDGF activation of the stromelysin promoter (45).

Our data and those of others suggest that relaxin action on connective tissue may be unique. Cytokines such as interleukin-1{alpha} stimulate the production of MMP-1 and MMP-3 in human cervical fibroblasts in vitro (35). However, unlike relaxin, which inhibits the expression of TIMP-1 in our model system and in dermal fibroblasts (46), interleukin-1{alpha} increases TIMP-1 production in human cervical fibroblasts and in fibroblasts from other organs (34, 46, 47, 48). Other growth factors and cytokines, such as EGF and TNF{alpha} also stimulate the production of MMP-1, and MMP-3. However, in addition, these agents either stimulate TIMP-1 production in human fibroblasts or have no effect (36, 49). Other factors, such as retinoids, interferons, and glucocorticoids, inhibit TIMP-1 expression, yet they inhibit MMP expression as well (50). Thus, relaxin may be unique in its ability to have inhibitory effects on the endogenous inhibitor of MMPs while stimulating the MMPs. This activity of inhibition of TIMP-1 expression by relaxin may account for the more modest stimulatory effects of relaxin on MMP-1 and MMP-3 expression compared with the effects of cytokines such as interleukin-1{alpha}, which also stimulate levels of the inhibitor. This may have a biological basis; a more modest effect of relaxin may be necessary to allow connective tissue remodeling, yet not cause the kind of connective tissue destruction that may occur in reactions mediated by inflammatory cytokines. Unlike relaxin, MMP stimulatory activities of cytokines such as interleukin-1 require PMA-sensitive PKCs in certain cell types, including human cervical fibroblasts (34). Yet, similar to relaxin, cAMP is not a second messenger for interleukin-1 action in this system (34). Certain aspects of relaxin signaling that regulate MMP expression in human lower uterine segment fibroblasts may be common to those of other regulators. For example, stromelysin-1 gene induction by PDGF is dependent upon Ras, which then directs two distinct pathways, one of which is c-Raf dependent (which may resemble relaxin signaling) and another of which is c-Raf independent. Cytokines and growth factors have been shown to regulate the production of each MMP and endogenous tissue inhibitor using many different pathways in a ligand-, developmental, and tissue-specific manner. Thus, understanding of the complete signaling pathway and even multiple paths that regulate relaxin signaling will require additional study in this cell type.

The effects of relaxin on cervical connective tissue must be considered in relation to the actions of the steroid hormones, estrogen and progesterone. In contrast to the previously demonstrated synergistic effect of relaxin and progesterone on the uterus (39), relaxin and progesterone appear to have opposing influences on cervical MMP expression, which may maintain a balance that results in a net effect of maintaining cervical connective tissue integrity during pregnancy. At term pregnancy in women or during premature labor, alterations in progesterone metabolism or progesterone action, such as that proposed to be caused by repression of the progesterone receptor, may allow the balance to be shifted to a more pronounced effect of relaxin in concert with a lesser effect of progesterone, resulting in the rearrangement of connective tissue caused by the resultant relative increase in MMP activity and decrease in TIMP-1 activity. The present data allow for the hypothesis that progesterone may to some extent block or prevent the effects of relaxin on the cervix. A greater effect of relaxin may thus occur when progesterone concentrations are decreased or when the action of progesterone is suppressed. Thus, in women, relaxin action on the cervix may be more robust at term pregnancy when progesterone biological activity may be decreased. Also, at very high concentrations, relaxin may overcome this blockage by progesterone, causing an increase in prematurity risk.

The mechanisms used to accomplish cervical ripening during human pregnancy are extremely complex and require the actions of multiple interacting peptide and steroid hormones and other factors and cellular responses. The evidence that relaxin is a positive regulator of the MMPs that affect type I collagen, in contrast to the negative effects of progesterone, and that relaxin stimulates pro-MMP-2 provides a potential explanation for the relationship between increased circulating maternal levels of relaxin and the increased risk of prematurity. In addition, these findings allow for the formulation of a new hypothesis regarding the role of the relative actions of relaxin and progesterone at term delivery. The collective data now suggest that the relaxin receptor is a tyrosine kinase receptor that, when bound to relaxin, activates a signaling pathway(s) mediated by the c-Raf kinase, a pathway that does not involve PMA-sensitive PKCs or cAMP.


    Acknowledgments
 


    Footnotes
 
This work was supported by NIH Grant HD-22338.

1 Present address: Department of Obstetrics and Gynecology, Roosevelt-St. Lukes Medical Center, 1000 Tenth Avenue, New York, New York 10019. Back

2 Present address: Reproductive Endocrine Unit, Massachusetts General Hospital, 55 Fruit Street, Boston, Massachusetts 02114. Back

Abbreviations: EBSS, Earle’s Balanced salt solution; EGF, epidermal growth factor; HNMPA, hydroxy-2-naphthalenyl methyl phosphonic acid trisacetoxymethyl ester; LAH, lactalbumin hydrolysate; MMP, matrix metalloproteinase; PDGF, platelet-derived growth factor; PMA, phorbol-12-myristate-13-acetate; TIMP-1, tissue inhibitor of metalloproteinase-1.

Received November 27, 2000.

Accepted for publication April 4, 2001.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Sherwood OD 1994 Relaxin. In: Knobil E, Neill J, eds. The physiology of reproduction, 2nd Ed. New York: Raven Press; 861–1009
  2. Steinetz BG, O’Byrne EM, Kroc RL 1980 The role of relaxin in cervical softening in mammals. In: Naftolin F, Stubblefield PG, eds. Dilation of the Uterine Cervix. Raven Press, New York, 157–177
  3. Petersen LK, Skajaa K, Uldbjerg N 1992 Serum relaxin as a potential marker for preterm labor. Br J Obstet Gynecol 99:292–295[Medline]
  4. Weiss G, Goldsmith LT, Sachdev R, Von Hagen S, Lederer K 1993 Elevated first-trimester serum relaxin concentrations in pregnant women following ovarian stimulation predict prematurity risk and preterm delivery. Obstet Gynecol 82:821–828[Medline]
  5. Kramer SM, Gibson UEM, Fendley BM, et al. 1990 Increase in cyclic AMP levels by relaxin in newborn rhesus kidney monkey uterus cell culture. In Vitro Cell Dev Biol 26:647–656[Medline]
  6. Braddon SA 1978 Relaxin-dependent adenosine 3',5'-monophosphate concentration changes in the mouse pubic symphysis. Endocrinology 102:1292–1299[Abstract/Free Full Text]
  7. Sanborn BM, Kuo HS, Weisbrot NW, Sherwood OD 1980 The interaction of relaxin with the rat uterus. I. Effect on cyclic nucleotide levels and spontaneous contractile activity. Endocrinology 106:1210–1215[Abstract/Free Full Text]
  8. Hsu CJ, McCormack SM, Sanborn BM 1985 The effect of relaxin on cyclic adenosine 3',5'-monophosphate concentrations in rat myometrial cells in culture. Endocrinology 116:2029–2035[Abstract/Free Full Text]
  9. Meera P, Anwer K, Monga M, et al. 1995 Relaxin stimulates myometrial calcium-activated potassium channel activity via protein kinase A. Am J Physiol 269:C312–C317
  10. Sanborn BM, Anwer K, Monga M, et al. 1995 Mechanisms controlling the acute effects of relaxin on the myometrium. In: MacLennan AH, Tregear GW, Bryant-Greenwood GD, eds. Progress in relaxin research, chapt 19. Singapore: World Scientific; 289–297
  11. Osa T, Inoue H, Okabe K 1991 Effects of porcine relaxin on contraction, membrane response and cyclic AMP content in rat myometrium in comparison with the effects of isoprenaline and forskolin. Br J Pharmacol 104:950–960[Medline]
  12. Hughes SJ, Hollingsworth M, Elliott KRF 1997 The role of a cAMP-dependent pathway in the uterine relaxant action of relaxin in rats. J Reprod Fertil 109:289–296[Abstract/Free Full Text]
  13. Fei DTW, Gross MC, Lofgren JL, Mora-Worms M, Chen AB 1990 Cyclic AMP responses to recombinant human relaxin by cultured human endometrial cells-a specific and high throughput in vitro bioassay. Biochem Biophys Res Commun 170:214–222[CrossRef][Medline]
  14. Bigazzi M, Brandi ML, Bani G, BaniSacchi T 1992 Relaxin influences the growth of MCF-7 breast cancer cells. Cancer 70:639–643[CrossRef][Medline]
  15. Chen G, Huang JR, Tseng L 1988 The effect of relaxin on cyclic adenosine 3',5'-monophosphate concentrations in human endometrial glandular epithelial cells. Biol Reprod 39:519–525[Abstract]
  16. Tseng L, Lane B 1995 Role of relaxin in the decidualization of human endometrial cells. In: MacLennan AH, Tregear GW, Bryant-Greenwood GD, eds. Progress in relaxin research, chapt 23. Singapore: World Scientific; 325–338
  17. Cronin MJ, Malaska T, Bakhit C 1987 Human relaxin increases cyclic AMP levels in cultured anterior pituitary cells. Biochem Biophys Res Commun 148:1246–1251[CrossRef][Medline]
  18. Nagase H, Woessner JF 1999 Matrix metalloproteinases. J Biol Chem 274:21491–21494[Free Full Text]
  19. Granstrom LM, Ekman GE, Malmstrom A, Ulmsten U, Woessner JF 1992 Serum collagenase levels in relation to the state of the human cervix during pregnancy and labor. Am J Obstet Gynecol 167:1284–1288[Medline]
  20. Rajabi MR, Dean DD, Beydoun SN, Woessner JF 1988 Elevated tissue levels of collagenase during dilation of uterine cervix in human parturition. Am J Obstet Gynecol 159:971–976[Medline]
  21. Rechberger T, Woessner JF 1993 Collagenase, its inhibitors, and decorin in the lower uterine segment in pregnant women. Am J Obstet Gynecol 168:1598–1603[Medline]
  22. Wiqvist I, Norstrom A, O’Byrne E, Wiqvist N 1984 Regulatory influence of relaxin on human cervical and uterine connective tissue. Acta Endocrinol (Copenh) 106:127–132[Abstract/Free Full Text]
  23. Palejwala S, Stein DE, Wotjczuk A, Weiss G, Goldsmith LT 1998 Demonstration of a relaxin receptor and relaxin stimulated tyrosine phosphorylation in human lower uterine segment fibroblasts. Endocrinology 139:1208–1212[Abstract/Free Full Text]
  24. Goldberg GI, Wilhelm SM, Kronberger A, Bauer EA, Grant GA, Eisen AZ 1986 Human fibroblast collagenase complete primary structure and homology to an oncogene transformation-induced rat protein. J Biol Chem 261:6600–6605[Abstract/Free Full Text]
  25. Benbow U, Buttice G, Nagase H, Kurkinen M 1996 Characterization of the 46-kDa intermediates of matrix metalloproteinase 3 (stromelysin 1) obtained by site-directed mutation of phenylalanine 83. J Biol Chem 271:10715–10722[Abstract/Free Full Text]
  26. Chua CC, Chua BHL 1990 Tumor necrosis factor-{alpha} induces mRNA for collagenase and TIMP in human skin fibroblasts. Connect Tissue Res 25:161–170[Medline]
  27. Anzick SL, Kononen J, Walker RL, et al. 1997 AIB1, a steroid receptor coactivator amplified in breast and ovarian cancer. Science 277:965–968[Abstract/Free Full Text]
  28. Meyer T, Regenass U, Fabbro D 1989 A derivative of staurosporine (CGP 41 251) shows selectivity for protein kinase C inhibition and in vitro anti-proliferative as well as in-vivo anti-tumor activity. Int J Cancer 43:851–859[Medline]
  29. Saperstein R, Vicario PP, Strout HV, et al. 1989 Design of a selective insulin receptor tyrosine kinase inhibitor and its effect on glucose uptake and metabolism in intact cells. Biochemistry 28:5694–5701[CrossRef][Medline]
  30. Baltensperger K, Lewis RE, Woon C-W, et al. 1992 Catalysis of serine and tyrosine autophosphorylation by the human insulin receptor. Proc Natl Acad Sci USA 89:7885–7889[Abstract/Free Full Text]
  31. Monia BP, Johnston JF, Geiger T, Muller M, Fabbro D 1996 Antitumor activity of a phosphorothioate antisense oligodeoxynucleotide targeted against C-raf kinase. Nat Med 6:668–675
  32. Xu XS, Vanderziel C, Bennett CF, Monia BP 1998 A role for c-Raf kinase and Ha-Ras in cytokine-mediated induction of cell adhesion molecules. J Biol Chem 273:33230–33238[Abstract/Free Full Text]
  33. Palejwala S, Goldsmith LT 1992 Ovarian expression of cellular Ki-ras p21 varies with physiological status. Proc Natl Acad Sci USA 89:4202–4206[Abstract/Free Full Text]
  34. Takahashi S, Ito A, Nagano M, et al. 1991 Cyclic adenosine 3',5'-monophosphate suppresses interleukin 1-induced synthesis of matrix metalloproteinases but not of tissue inhibitor of metalloproteinases in human uterine cervical fibroblasts. J Biol Chem 266:19894–19899[Abstract/Free Full Text]
  35. Takahashi S, Sato T, Ito A, et al. 1993 Involvement of protein kinase C in the interleukin 1{alpha}-induced gene expression of matrix metalloproteinases and tissue inhibitor-1 of metalloproteinases (TIMP-1) in human uterine cervical fibroblasts. Biochim Biophys Acta 1220:57–65[Medline]
  36. Hosono T, Ito A, Sato T, Nagase H, Mori Y 1996 Translational augmentation of pro-matrix metalloproteinase 3 (prostromelysin 1) and tissue inhibitor of metalloproteinases (TIMP)-1 mRNAs induced by epidermal growth factor in human uterine cervical fibroblasts. FEBS Lett 381:115–118[CrossRef][Medline]
  37. Chomczynski P, Sacchi N 1987 Single-step method of RNA isolation by acid guanidium thiocyanate-phenol-chloroform extraction. Anal Biochem 162:156–159[Medline]
  38. Aviv H, Leder P 1972 Purification of biologically active globin messenger RNA by chromatography on oligothymidylic acid-cellulose Proc Natl Acad Sci. USA. 69:1408–1412
  39. Grazi RV, Goldsmith LT, Schmidt CL, VonHagen S, Weiss G 1988 Synergistic effect of relaxin and progesterone on cyclic adenosine 3',5'-monophosphate levels in the rat uterus. Am J Obstet Gynecol 159:1402–1406[Medline]
  40. Chung K-C, Gomes I, Wang D, Lau LF, Rosner MR 1998 Raf and fibroblast growth factor phosphorylate Elk1 and activate the serum response element of the immediate early gene pip92 by mitogen-activated protein kinase-independent as well as -dependent signaling pathways. Mol Cell Biol 18:2272–2281[Abstract/Free Full Text]
  41. Lin J-H, Makris A, McMahon C, et al. 1999 The ankyrin repeat-containing adapter protein Tvl-1 is a novel substrate and regulator of Raf-1. J Biol Chem 274:14706–14715[Abstract/Free Full Text]
  42. Jette C, Thorburn A 2000 A Raf-induced MEK-independent signaling pathway regulates atrial natriuretic factor gene expression in cardiac muscle cells. FEBS Lett 467:1–6[CrossRef][Medline]
  43. Newton AC 1995 Protein kinase C: structure, function and regulation. J Biol Chem 270:2895–28498
  44. Ron D, Kazanietz MG 1999 New insights into the regulation of protein kinase C and novel phorbol ester receptors. FASEB J 13:1658–1676[Abstract/Free Full Text]
  45. Sanz L, Berra E, Municio MM, et al. 1994 {zeta}PKC plays a critical role during stromelysin promoter activation by platelet-derived growth factor through a novel palindromic element. J Biol Chem 269:10044–10049[Abstract/Free Full Text]
  46. Unemori EN, Amento EP 1990 Relaxin modulates synthesis and secretion of procollagenase and collagen by human dermal fibroblasts. J Biol Chem 265:10681–10685[Abstract/Free Full Text]
  47. Murphy G, Reynolds JJ, Werb Z 1985 Biosynthesis of tissue inhibitor of metalloproteinases by human fibroblasts in culture. Stimulation by 12-O- tetradecanoylphorbol 13-acetate and interleukin 1 in parallel with collagenase. J Biol Chem 260:3079–3083[Abstract/Free Full Text]
  48. Sato T, Ito A, Mori Y 1990 Interleukin 6 enhances the production of tissue inhibitor of metalloproteinases (TIMP) but not that of matrix metalloproteinases by human fibroblasts. Biochem Biophys Res Commun 170:824–829[CrossRef][Medline]
  49. Chua CC, Chua BHL 1990 Tumor necrosis factor-{alpha} induces mRNA for collagenase and TIMP in human skin fibroblasts. Connect Tissue Res 25:161–170
  50. Brinckerhoff CE, Auble D 1990 Regulation of collagenase gene expression in synovial fibroblasts. Ann NY Acad Sci. 580:355–374



This article has been cited by other articles:


Home page
Hum ReprodHome page
M. Koizumi, M. Momoeda, H. Hiroi, F. Nakazawa, H. Nakae, T. Ohno, T. Yano, and Y. Taketani
Inhibition of proteases involved in embryo implantation by cholesterol sulfate
Hum. Reprod., November 7, 2009; (2009) dep370v1.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
C. Simon and A. Einspanier
The hormonal induction of cervical remodeling in the common marmoset monkey (Callithrix jacchus)
Reproduction, March 1, 2009; 137(3): 517 - 525.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
M. L. Halls, E. T. van der Westhuizen, J. D. Wade, B. A. Evans, R. A. D. Bathgate, and R. J. Summers
Relaxin Family Peptide Receptor (RXFP1) Coupling to G{alpha}i3 Involves the C-Terminal Arg752 and Localization within Membrane Raft Microdomains
Mol. Pharmacol., February 1, 2009; 75(2): 415 - 428.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
C. S. Samuel, T. D. Hewitson, Y. Zhang, and D. J. Kelly
Relaxin Ameliorates Fibrosis in Experimental Diabetic Cardiomyopathy
Endocrinology, July 1, 2008; 149(7): 3286 - 3293.
[Abstract] [Full Text] [PDF]


Home page
Reproductive SciencesHome page
Yan Wen, Y.-Y. Zhao, M. L. Polan, and B. Chen
Effect of Relaxin on TGF-{beta}1 Expression in Cultured Vaginal Fibroblasts From Women With Stress Urinary Incontinence
Reproductive Sciences, March 1, 2008; 15(3): 312 - 320.
[Abstract] [PDF]


Home page
Biol. Reprod.Home page
E. Needle, K. Piparo, D. Cole, C. Worrall, I. Whitehead, G. Mahon, and L. T. Goldsmith
Protein Kinase A-Independent cAMP Stimulation of Progesterone in a Luteal Cell Model Is Tyrosine Kinase Dependent but Phosphatidylinositol-3-Kinase and Mitogen-Activated Protein Kinase Independent
Biol Reprod, July 1, 2007; 77(1): 147 - 155.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. Jeyabalan, J. Novak, K. D. Doty, J. Matthews, M. C. Fisher, L. J. Kerchner, and K. P. Conrad
Vascular Matrix Metalloproteinase-9 Mediates the Inhibition of Myogenic Reactivity in Small Arteries Isolated from Rats after Short-Term Administration of Relaxin
Endocrinology, January 1, 2007; 148(1): 189 - 197.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
M. L. Halls, R. A. D. Bathgate, and R. J. Summers
Comparison of Signaling Pathways Activated by the Relaxin Family Peptide Receptors, RXFP1 and RXFP2, Using Reporter Genes
J. Pharmacol. Exp. Ther., January 1, 2007; 320(1): 281 - 290.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. J. Scott, S. Layfield, Y. Yan, S. Sudo, A. J. W. Hsueh, G. W. Tregear, and R. A. D. Bathgate
Characterization of Novel Splice Variants of LGR7 and LGR8 Reveals That Receptor Signaling Is Mediated by Their Unique Low Density Lipoprotein Class A Modules
J. Biol. Chem., November 17, 2006; 281(46): 34942 - 34954.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
A. Jeyabalan, L. J. Kerchner, M. C. Fisher, J. T. McGuane, K. D. Doty, and K. P. Conrad
Matrix metalloproteinase-2 activity, protein, mRNA, and tissue inhibitors in small arteries from pregnant and relaxin-treated nonpregnant rats
J Appl Physiol, June 1, 2006; 100(6): 1955 - 1963.
[Abstract] [Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
R. A. Bathgate, R. Ivell, B. M. Sanborn, O. D. Sherwood, and R. J. Summers
International Union of Pharmacology LVII: Recommendations for the Nomenclature of Receptors for Relaxin Family Peptides.
Pharmacol. Rev., March 1, 2006; 58(1): 7 - 31.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. A. Figueiredo, A. L. Mui, C. C. Nelson, and M. E. Cox
Relaxin Stimulates Leukocyte Adhesion and Migration through a Relaxin Receptor LGR7-dependent Mechanism
J. Biol. Chem., February 10, 2006; 281(6): 3030 - 3039.
[Abstract] [Full Text] [PDF]


Home page
Clin Med ResHome page
C. S. Samuel
Relaxin: Antifibrotic Properties and Effects in Models of Disease
Clin. Med. Res., November 1, 2005; 3(4): 241 - 249.
[Abstract] [Full Text] [PDF]


Home page
BMJHome page
R W. Stones and K. Vits
Pelvic girdle pain in pregnancy
BMJ, July 30, 2005; 331(7511): 249 - 250.
[Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
B. T. Nguyen and C. W. Dessauer
Relaxin Stimulates Protein Kinase C {zeta} Translocation: Requirement for Cyclic Adenosine 3',5'-Monophosphate Production
Mol. Endocrinol., April 1, 2005; 19(4): 1012 - 1023.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
H.-Y. Lee, S. Zhao, P. A. Fields, and O. D. Sherwood
The Extent to which Relaxin Promotes Proliferation and Inhibits Apoptosis of Cervical Epithelial and Stromal Cells Is Greatest during Late Pregnancy in Rats
Endocrinology, January 1, 2005; 146(1): 511 - 518.
[Abstract] [Full Text] [PDF]


Home page
Reproductive SciencesHome page
K. P. Conrad
Mechanisms of Renal Vasodilation and Hyperfiltration During Pregnancy
Reproductive Sciences, October 1, 2004; 11(7): 438 - 448.
[Abstract] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
K. P. Conrad and J. Novak
Emerging role of relaxin in renal and cardiovascular function
Am J Physiol Regulatory Integrative Comp Physiol, August 1, 2004; 287(2): R250 - R261.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
O. D. Sherwood
Relaxin's Physiological Roles and Other Diverse Actions
Endocr. Rev., April 1, 2004; 25(2): 205 - 234.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
L. T. Goldsmith, G. Weiss, S. Palejwala, T. M. Plant, A. Wojtczuk, W. C. Lambert, N. Ammur, D. Heller, J. H. Skurnick, D. Edwards, et al.
Relaxin regulation of endometrial structure and function in the rhesus monkey
PNAS, March 30, 2004; 101(13): 4685 - 4689.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
A. Jeyabalan, J. Novak, L. A. Danielson, L. J. Kerchner, S. L. Opett, and K. P. Conrad
Essential Role for Vascular Gelatinase Activity in Relaxin-Induced Renal Vasodilation, Hyperfiltration, and Reduced Myogenic Reactivity of Small Arteries
Circ. Res., December 12, 2003; 93(12): 1249 - 1257.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
J. D. Silvertown, B. J. Geddes, and A. J. S. Summerlee
Adenovirus-Mediated Expression of Human Prorelaxin Promotes the Invasive Potential of Canine Mammary Cancer Cells
Endocrinology, August 1, 2003; 144(8): 3683 - 3691.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
B. T. Nguyen, L. Yang, B. M. Sanborn, and C. W. Dessauer
Phosphoinositide 3-Kinase Activity Is Required for Biphasic Stimulation of Cyclic Adenosine 3',5'-Monophosphate by Relaxin
Mol. Endocrinol., June 1, 2003; 17(6): 1075 - 1084.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
T. Dschietzig, C. Bartsch, C. Richter, M. Laule, G. Baumann, and K. Stangl
Relaxin, a Pregnancy Hormone, Is a Functional Endothelin-1 Antagonist: Attenuation of Endothelin-1-Mediated Vasoconstriction by Stimulation of Endothelin Type-B Receptor Expression via ERK-1/2 and Nuclear Factor-{kappa}B
Circ. Res., January 10, 2003; 92(1): 32 - 40.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
R. H. Renegar and C. R. Owens III
Measurement of Plasma and Tissue Relaxin Concentrations in the Pregnant Hamster and Fetus Using a Homologous Radioimmunoassay
Biol Reprod, August 1, 2002; 67(2): 500 - 505.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
S. Palejwala, L. Tseng, A. Wojtczuk, G. Weiss, and L. T. Goldsmith
Relaxin Gene and Protein Expression and Its Regulation of Procollagenase and Vascular Endothelial Growth Factor in Human Endometrial Cells
Biol Reprod, June 1, 2002; 66(6): 1743 - 1748.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Palejwala, S.
Right arrow Articles by Goldsmith, L. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Palejwala, S.
Right arrow Articles by Goldsmith, L. T.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*L-TYROSINE
*PROGESTERONE


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals