help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Grattan, D. R.
Right arrow Articles by Davey, H. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Grattan, D. R.
Right arrow Articles by Davey, H. W.
Endocrinology Vol. 142, No. 9 3935-3940
Copyright © 2001 by The Endocrine Society

ARTICLES

Feedback Regulation of PRL Secretion Is Mediated by the Transcription Factor, Signal Transducer, and Activator of Transcription 5b

David R. Grattan, Junjie Xu, Michael J. McLachlan, Ilona C. Kokay, Stephen J. Bunn, Russell C. Hovey and Helen W. Davey

Department of Anatomy and Structural Biology, University of Otago (D.R.G., J.X., I.C.K., S.J.B.), Dunedin, New Zealand; AgResearch, Ruakura Research Center (M.J.M., H.W.D.), Hamilton, New Zealand; and Molecular and Cellular Endocrinology Section, Center for Cancer Research, National Cancer Institute, National Institutes of Health (R.C.H.), Bethesda, Maryland 20892

Address all correspondence and requests for reprints to: Dr. Dave Grattan, Department of Anatomy and Structural Biology, University of Otago, P.O. Box 913, Dunedin, New Zealand.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
PRL secretion from the anterior pituitary gland is inhibited by dopamine produced in the tuberoinfundibular dopamine neurons of the hypothalamus. The activity of tuberoinfundibular dopamine neurons is stimulated by PRL; thus, PRL regulates its own secretion by a negative feedback mechanism. PRL receptors are expressed on tuberoinfundibular dopamine neurons, but the intracellular signaling pathway is not known. We have observed that mice with a disrupted signal transducer and activator of transcription 5b gene have grossly elevated serum PRL concentrations. Despite this hyperprolactinemia, mRNA levels and immunoreactivity of tyrosine hydroxylase, the key enzyme in dopamine synthesis, were significantly lower in the tuberoinfundibular dopamine neurons of these signal transducer and activator of transcription 5b-deficient mice. Concentrations of the dopamine metabolite dihydroxyphenylacetic acid in the median eminence were also significantly lower in signal transducer and activator of transcription 5b-deficient mice than in wild-type mice. No changes were observed in nonhypothalamic dopaminergic neuronal populations, indicating that the effects were selective to tuberoinfundibular dopamine neurons. These data indicate that in the absence of signal transducer and activator of transcription 5b, PRL signal transduction in tuberoinfundibular dopamine neurons is impaired, and they demonstrate that this transcription factor plays an obligatory and nonredundant role in mediating the negative feedback action of PRL on tuberoinfundibular dopamine neurons.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
PRL IS A multifunctional hormone secreted from the anterior pituitary gland, with over 300 known actions in mammalian tissues (1). Under most conditions, PRL secretion is inhibited by dopamine that is released from neurosecretory neurons within the hypothalamus and acts on D2 receptors on the pituitary lactotrophs to inhibit PRL secretion (2). The tuberoinfundibular dopamine (TIDA) neurons, located in the arcuate nucleus of the hypothalamus with terminals in the median eminence, represent the major source of dopamine in the hypophyseal portal blood (2). In addition, it is thought that periventricular hypophyseal and tuberohypophyseal dopamine neurons, which release dopamine from terminals in the intermediate and posterior lobes of the pituitary, respectively, also contribute to the tonic inhibition of PRL secretion (2). It is well established that PRL activates all three populations of hypothalamic dopamine neurons (3), thereby regulating its own secretion by short-loop negative feedback. PRL receptors are expressed on hypothalamic dopamine neurons (4, 5, 6), but the intracellular signaling pathway that is activated after PRL stimulation of these neurons is not known.

When PRL binds to its receptor, it simultaneously activates multiple intracellular signaling proteins, including those involved in Janus kinase-signal transducer and activator of transcription (STAT) pathways (1, 2). Our investigations in mice lacking STAT5b revealed a pleiotropic phenotype with characteristics of PRL insensitivity, including impaired luteotropic support leading to spontaneous abortion during pregnancy and failure of milk production at parturition (7). However, we also found signs of PRL excess, such as exaggerated lobulo-alveolar development and milk secretion in the mammary glands of nulliparous animals (Davey, H. W., et al., unpublished data). We hypothesized that these somewhat paradoxical observations might be explained by a failure of the negative feedback regulation of PRL secretion in STAT5b-deficient mice. Thus, although functions requiring PRL signaling through STAT5b would be impaired, the hyperprolactinemia resulting from a lack of negative feedback would cause increased PRL signaling through alternative intracellular signaling cascades, including pathways involving other STAT molecules or the MAPK pathway (1). To test this hypothesis, we have investigated the neuroendocrine regulation of PRL secretion in STAT5b-deficient mice.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Animals
The Stat5b gene was disrupted by the insertion of a neomycin resistance cassette into the codon for amino acid 181 using homologous recombination in embryonic stem cells. Details of the generation of these mice have been described previously (7). Homozygous Stat5b-/- mice were bred by mating heterozygous females with homozygous Stat5b-/- males, whereas wild-type 129xBALB/c outcrossed mice were bred from wild-type parents. The Stat5b genotypes of all mice used in the experiments were determined by PCR using the following primers: forward primer (Stat5b gene), 5'-CCCAAGAGTACTTCATCATCCAG-3'; and reverse primers, wild-type allele (Stat5b gene), 5'-GAGCTTGCTCCTACGACCTTACT-3'; Stat5b disrupted allele (PGK promoter), 5' TGACTAGGGGAGGAGTAGAAGGTGG 3'.

Male and female mice (~5 months old, 26–30 g) were selected at random and killed by CO2 inhalation. Blood was collected by cardiac puncture, and brains were removed and either rapidly frozen in liquid nitrogen and stored at -80 C or immersion-fixed in 4% paraformaldehyde for 24 h, then stored in 70% ethanol. All procedures were approved by the Ruakura animal ethics committee.

RIA
Serum PRL concentrations were determined by RIA using reagents provided by Dr. A. F. Parlow through the National Hormone and Pituitary Program of the NIH. Purified mouse PRL (AFP10777D) was iodinated by the chloramine-T method and used at a concentration of 20,000 cpm/tube. Primary antiserum (AFP131078Rb) was added at a final tube dilution of 1:200,000. The reference preparation was mouse PRL (AEP-6476-C). The sensitivity of the assay, based on 15% displacement of the total radioactivity binding, was 0.25 ng/tube. All samples were run in a single assay, with an intraassay coefficient of variation of 7.4%.

Brain microdissection
Thick (300 µm) frozen coronal sections through the brain were prepared in a cryostat at -9 C, thaw-mounted onto glass microscope slides, and immediately refrozen. Specific brain regions were microdissected from these slices using the punch technique (8). All punches were collected with a microdissection needle of 500-µm diameter. The median eminence was dissected from two consecutive sections using two overlapping punches. After removal of the median eminence, the arcuate nuclei were dissected bilaterally using a single punch centered on the third ventricle. The caudate putamen and substantia nigra were each dissected using bilateral punches from two consecutive sections (four punches in total). The arcuate nucleus and substantia nigra punches were placed into 300 µl lysis buffer (Lysate RPA Kit, Ambion, Inc., Austin, TX), and the tissue was disrupted by sonication. The tissue lysate was then stored at -80 C until the mRNA levels were measured using a lysate ribonuclease protection assay. Median eminence and striatal tissue were placed into 50 µl tissue buffer (0.05 M sodium phosphate and 0.03 M citric acid in 12% methanol, pH 3.0) for HPLC analysis. The tissue was disrupted by sonication, and then centrifuged at 10,000 x g for 5 min. The supernatant was stored at -80 C until the catecholamine content was measured by HPLC. The remaining pellet was redissolved in 1 M NaOH, and the tissue protein content was measured (Protein Assay Kit, Bio-Rad Laboratories, Inc.) as an index of the amount of tissue in the dissection.

Lysate ribonuclease protection assay
Templates for riboprobes directed against mouse tyrosine hydroxylase mRNA were generated by RT-PCR from cDNA prepared from mouse brain tissue. Specific primers were designed with a phage promoter attached to their 5'-end, as described previously (9), and 33P-labeled antisense riboprobes were synthesized using an in vitro transcription system (Promega Corp.). Mouse glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal control (template from Ambion, Inc.). The probes were added directly to the tissue lysate and hybridized overnight at 37 C. Ribonuclease was added to degrade unhybridized RNA (Lysate RPA Kit, Ambion, Inc.), and the protected double stranded fragments were precipitated and separated on a 5% nondenaturing polyacrylamide gel. Gels were dried and exposed to x-ray film for 18–24 h, and the band intensities were quantified by densitometry (using NIH Image 1.61).

Immunohistochemistry
Paraformaldehyde-fixed brains were immersed overnight in a cryoprotectant solution (30% sucrose in 0.1 M phosphate buffer, pH 7.4), then rapidly frozen in isopentane cooled in liquid nitrogen. Coronal sections of 10 µm were cut through the hypothalamus in a cryostat at -10 C and thaw-mounted onto 3-aminopropyltriethoxysilane-coated slides. Two adjacent brain sections were collected at intervals of 50 µm throughout the arcuate nucleus, one for tyrosine hydroxylase immunostaining and the other for nonspecific immunostaining. Sections were immunostained using a rabbit polyclonal antibody directed against tyrosine hydroxylase (1:3000 dilution; AB151, Chemicon International, Inc., Temecula, CA), followed by the avidin-biotin complex method, as described previously (10). Tyrosine hydroxylase-like immunoreactivity was visualized using diaminobenzidine as the chromogen. Throughout each staining procedure, one wild-type and one STAT5b-deficient brain of the same sex were processed in parallel. There was no significant staining of sections when the primary antibody was replaced with normal rabbit serum.

HPLC
Concentrations of dopamine and dihydroxyphenylacetic acid (DOPAC) were measured by isocratic HPLC with electrochemical detection. The mobile phase consisted of tissue buffer (see above) containing 0.015% octane sulfonic acid and 0.1 mM EDTA (pH 3.0), and was passed through a C18 reverse phase column (Luna 3 µm, 150 x 4.6 mm, Phenomenex New Zealand, Ltd., Auckland, New Zealand) at 1 ml/min. Catecholamines were detected using a conditioning cell (+350 mV) and a dual electrode analytical cell (model 5011, ESA, Bedford, MA) with electrodes set at -150 and +350 mV. Changes in current at the second analytical electrode were measured by an electrochemical detector (Coulochem II, ESA). Dopamine and DOPAC were quantified by comparison with external standards. All values were corrected for the total protein content in the tissue punches.

Statistical analysis
All data are presented as the mean ± SEM. For serum PRL concentrations, comparisons between groups were made by ANOVA, followed by Fisher’s protected least significant difference post-hoc test. The mRNA data were normalized using the ratio of tyrosine hydroxylase mRNA to GAPDH mRNA. DOPAC concentrations are presented as nanograms of DOPAC per µg tissue protein. Normalized data were compared using the Mann-Whitney U test for nonparametric data. All statements of statistical significance refer to a probability level of less than 5% (i.e. P < 0.05).


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Serum PRL levels in STAT5b-deficient mice
In both males and females, serum PRL concentrations were grossly elevated (>10-fold) in STAT5b-deficient mice compared with age- and sex-matched wild-type mice (Fig. 1Go). In addition, females had approximately 2-fold higher serum PRL levels than males. This sex difference was also found in wild-type mice, albeit at lower levels, and is consistent with previous findings (11). Treatment with the dopamine D2 agonist bromocriptine markedly suppressed serum PRL levels in both male and female STAT5b-deficient mice to a level that was not significantly different from that in wild-type mice (Fig. 1Go). This suggested that the high PRL levels observed in mice lacking STAT5b were not due to pituitary insensitivity to dopamine, but to an absence of endogenous dopaminergic inhibition from the TIDA neurons. The apparent failure of bromocriptine to significantly suppress mean serum PRL levels in the wild-type female mice (Fig. 1Go) reflects aberrantly high values in two individual mice.



View larger version (20K):
[in this window]
[in a new window]
  		Figure 1. Serum PRL concentrations (mean ± SEM) in wild-type (+/+) female (n = 11) and male (n = 10) mice and STAT5b-deficient (-/-) female (n = 11) and male (n = 10) mice. Additional groups of mice were administered bromocriptine (BC; 100 µg, sc, every 12 h for 3 d; n = 6 of each sex and genotype). *, Significantly increased compared with wild-type mice; {dagger}, significantly different from non-BC-treated mice of the same sex and genotype; {ddagger}, significantly different from female mice of the same genotype (by ANOVA, followed by Fisher’s protected least significant difference post-hoc test, P < 0.05).

 
TIDA neuronal activity in STAT5b-deficient mice
Tyrosine hydroxylase is the rate-limiting enzyme for dopamine synthesis. In brain regions such as the hypothalamus, in which dopaminergic neurons are the only catecholamine-producing neurons, tyrosine hydroxylase serves as a marker for dopaminergic neurons (12). The levels of tyrosine hydroxylase mRNA in the arcuate nucleus reflect TIDA neuronal activity and increase in response to PRL (13, 14, 15, 16). Hence, we used a lysate ribonuclease protection assay to quantify the level of tyrosine hydroxylase mRNA within the microdissected arcuate nucleus as an index of expression in the TIDA neurons. Tyrosine hydroxylase mRNA expression in the arcuate nucleus was significantly lower in STAT5b- deficient compared with wild-type mice (Fig. 2Go). In contrast, there was no significant difference between STAT5b-deficient and wild-type mice in the levels of tyrosine hydroxylase mRNA in the substantia nigra pars compacta, which contains the neuronal cell bodies of the nigrostriatal dopaminergic pathway.



View larger version (44K):
[in this window]
[in a new window]
  		Figure 2. Tyrosine hydroxylase (TH) mRNA expression in female STAT5b-deficient (-/-; n = 9) and wild-type (+/+; n = 8) mice. The mRNA fragments that are protected by the TH (548 bp) and GAPDH (433 bp) probes in the arcuate nucleus and substantia nigra pars compacta are shown in representative gels in A. The ratio of TH mRNA to GAPDH mRNA (mean ± SEM), are summarized in B. *, Significantly different from wild-type mice (Mann-Whitney U test for nonparametric data, P < 0.05).

 
Immunohistochemistry was used to visualize tyrosine hydroxylase expression in the cell bodies of the TIDA neurons in the arcuate nucleus and in dopaminergic nerve terminals in the median eminence (n = 3 mice of each sex and genotype). Although the distribution of TIDA neurons was similar in wild-type and STAT5b-deficient mice (Fig. 3Go, A and B), the levels of tyrosine hydroxylase immunoreactivity were markedly lower in STAT5b-deficient mice (Fig. 3EGo) than in wild-type mice (Fig. 3CGo). In contrast, tyrosine hydroxylase immunoreactivity in the zona incerta, which is visible in the same sections as the arcuate nucleus, was not different between STAT5b-deficient and wild-type mice (Fig. 3Go, D and F). There was no apparent difference between males and females of either genotype. These observations suggested that tyrosine hydroxylase expression was selectively reduced in the TIDA neurons of STAT5b-deficient mice.



View larger version (58K):
[in this window]
[in a new window]
  		Figure 3. Immunohistochemistry for tyrosine hydroxylase in the arcuate nucleus and median eminence in a wild-type (A) and a STAT5b-deficient (B) male mouse. 3V, Third ventricle. C, Magnification of the box in A, showing tyrosine hydroxylase-immunoreactive neurons. D, A dopaminergic neuron in the zona incerta, which is located at the dorsal margin of the hypothalamus and is visible in the same coronal section as the arcuate nucleus. E, Magnification of the box in B, showing faintly stained tyrosine hydroxylase-immunoreactive neurons in the arcuate nucleus of STAT5b-deficient mice. F, Dopaminergic neuron in the zona incerta in the same section as B. Staining is comparable to that in the zona incerta of wild-type animals (C). Scale bars, 100 µm (A and B) or 20 µm (C–F).

 
Dopamine nerve terminals in the median eminence contain specific dopamine transporters that take up a proportion of released dopamine into the axon terminals (17). This captured dopamine is rapidly metabolized in the median eminence to DOPAC, and thus, measurement of DOPAC provides an index of TIDA neuronal activity (18). Concentrations of DOPAC in the median eminence of STAT5b-deficient females were significantly lower than in wild-type female mice (Fig. 4Go), suggesting that dopamine release from TIDA neurons was markedly reduced in the STAT5b-deficient mice. DOPAC concentrations were also measured in the striatum, the nerve terminal region of the well characterized nigrostriatal dopaminergic pathway (19). There were no differences in striatal DOPAC concentrations between STAT5b-deficient and wild-type female mice (Fig. 4Go). The suppression of dopamine release in the absence of STAT5b was therefore selective to the hypothalamic TIDA neurons.



View larger version (17K):
[in this window]
[in a new window]
  		Figure 4. Concentration of DOPAC (mean ± SEM) in brain tissue of female STAT5b-deficient mice (n = 9) and wild-type controls (n = 8), normalized using the total protein content in the tissue. *, Significantly different from wild-type mice (by Mann-Whitney U test for nonparametric data, P < 0.05).

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
The activity of TIDA neurons is normally very sensitive to the concentration of PRL circulating in the blood, such that an increase in PRL results in the increased synthesis and secretion of dopamine in mice (20, 21) and rats (14, 22, 23). In the absence of STAT5b, however, the TIDA neurons appear to be unresponsive to PRL. Despite the markedly elevated PRL concentrations in the blood of STAT5b-deficient mice, the TIDA neurons express less tyrosine hydroxylase and secrete less dopamine than in the wild-type mice. Administration of a dopamine agonist, bromocriptine, resulted in the reduction of serum PRL concentrations to a low level that was similar in both STAT5b-deficient and wild-type mice, indicating that the inhibition of pituitary PRL secretion by dopamine was unaffected by STAT5b deficiency. These data suggest that STAT5b specifically mediates the negative feedback action of PRL on TIDA neurons.

The phenotypes resulting from several mouse gene disruption experiments have emphasized the relationship between dopamine and PRL. Chronic elevation in PRL secretion occurs in mice lacking a functional D2 dopamine receptor (24, 25) due to an absence of inhibition in the pituitary gland. Similarly, serum PRL levels are markedly elevated in PRL receptor-deficient mice (26), presumably due to lack of feedback stimulation of TIDA neurons (27). Conversely, mice lacking the dopamine transporter, which normally removes extracellular dopamine and thus terminates dopamine signaling, are incapable of nursing their young (28) and exhibit suppressed PRL secretion (17). Although such phenotypes could have been predicted from what was previously known about the negative feedback regulation of PRL secretion, our observation of hyperprolactinemia and low TIDA activity in STAT5b-deficient mice is unexpected. In different tissues, PRL signaling occurs through a variety of intracellular pathways, including STAT1, STAT3, STAT5a, and STAT5b, as well as a number of signaling cascades not involving the STAT proteins (1, 2). Hence, it was reasonable to expect a certain amount of redundancy in PRL signaling pathways in TIDA neurons. In particular, we expected that the highly homologous STAT5a protein, which shares 96% amino acid identity with STAT5b (29), might be able to compensate for the absence of STAT5b. This did not appear to happen. Indeed, serum PRL levels in mice lacking STAT5a are normal (30), further demonstrating the specificity of the role of STAT5b in this pathway.

The elevated levels of serum PRL in PRL receptor-deficient mice (27) demonstrate the requirement for functional PRL receptors in the regulation of serum PRL concentrations. We have not measured PRL receptor expression in TIDA neurons, but we have data from other tissues that provide strong evidence for functional PRL receptors in STAT5b-deficent mice. In liver, Northern analysis showed that PRL receptor mRNA levels were similar in STAT5b-deficient and wild-type females, whereas in males there was an increase in PRL receptor expression in STAT5b-deficient mice (7). The most compelling evidence for functional PRL receptors is the precocious lobuloalveolar development in the mammary glands of nulliparous mice, which results from the hyperprolactinemia and is evident from 6 wk of age (Davey, H. W., et al., unpublished data). Although there is some evidence for decreased expression of PRL receptors in mammary gland epithelial cells, we showed that PRL induced milk protein expression in mammary gland explant cultures and induced ductal branching in whole organ cultures (Davey, H. W., et al., unpublished data).

Gene disruption studies have indicated that there may be both distinct and redundant functions for STAT5a and STAT5b (7, 31, 32, 33), but conclusions from the phenotypes of these mice are confounded by differences in the expression of Stat5a and Stat5b in various tissues (29, 34). Thus, there are at least two alternative explanations for the PRL resistance observed in the TIDA neurons in STAT5b-deficient mice. First, Stat5b may be expressed at much higher levels than Stat5a, as is found in the liver (34), so that the amount of STAT5a alone is insufficient to transduce the PRL-initiated signal. Second, STAT5b may have a specific role in mediating PRL signaling in these neurons that cannot be compensated for by other STAT proteins. Regardless of the specific mechanism involved, our results clearly show that STAT5b is absolutely required for PRL signaling in TIDA neurons and that STAT5b deficiency results in hyperprolactinemia. Hence, the paradox of the STAT5b-deficient phenotype, which shows specific defects in PRL signaling as well as signs of PRL excess, is explained by our data.

There have been few previous studies of the PRL signal transduction pathways in the brain. Although PRL has been shown to stimulate the translocation of STAT5 from the cytoplasm to the nucleus in TIDA neurons (35), direct involvement of STAT5 in the induction of tyrosine hydroxylase gene expression has not been demonstrated. The tyrosine hydroxylase 5'-flanking DNA contains a number of potential STAT5-binding sites with the most proximal consensus binding site at about -1 kb relative to the start of transcription (GenBank accession no. AF014956 rat, X53503 mouse) (36). Additionally, tetrameric STAT5 proteins may well interact with some of the low affinity binding sites (37) and increase transcription from the tyrosine hydroxylase gene. Other potentially important promoter elements in the tyrosine hydroxylase gene include binding sites for activator protein 1 (AP-1), AP-2, SP1, the cAMP response element, Ptx1/3, Nurr1, and Glil1/2 as well as an E box, the Oct/HEPT motif, a GT dinucleotide repeat, and a neural restrictive silencer element (38, 39, 40, 41, 42, 43). It is possible that STAT5b may also induce tyrosine hydroxylase expression indirectly through one or more of these sites. For example, there is a STAT5-binding site in the promoter of the c-fos gene, and c-Fos has been implicated in PRL regulation of TIDA neurons (44, 45, 46), presumably acting at the AP-1 site in the tyrosine hydroxylase promoter.

Although our data provide compelling evidence implicating STAT5b in mediating PRL signaling in TIDA neurons, it is unknown whether this would hold true for other neuronal populations that express PRL receptors (10, 47, 48, 49, 50). PRL is involved in regulating a number of hypothalamic functions, including stimulation of food intake (51, 52), and maternal behavior (53, 54). It would be interesting to determine whether STAT5b is also obligatory for these other actions of PRL in the brain.

The data presented above provide the first description of the specific intracellular pathways mediating PRL negative feedback in the hypothalamus, and as such represent a fundamental advance in our understanding of this important neuroendocrine regulatory mechanism. In addition, they provide novel evidence of a surprising specificity of different STAT proteins within neuronal signal transduction pathways.


   Acknowledgments
 
The authors thank Rob Porteous and Frank Fischer for technical assistance, and Dick Wilkins for editorial advice.


   Footnotes
 
This work was supported by a grant from the Health Research Council of New Zealand (to D.R.G.) and grants from the New Zealand Foundation of Research Science and Technology (to H.W.D.).

Abbreviations: AP-1, Activator protein 1; DOPAC, dihydroxyphenylacetic acid; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; STAT, signal transducer and activator of transcription; TIDA, tuberoinfundibular dopamine.

Received March 8, 2001.

Accepted for publication May 24, 2001.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Bole-Feysot C, Goffin V, Edery M, Binart N, Kelly PA 1998 Prolactin (PRL) and its receptor: actions, signal transduction pathways and phenotypes observed in PRL receptor knockout mice. Endocr Rev 19:225–268[Abstract/Free Full Text]
  2. Freeman ME, Kanyicska B, Lerant A, Nagy G 2000 Prolactin: structure, function, and regulation of secretion. Physiol Rev 80:1523–1631[Abstract/Free Full Text]
  3. DeMaria JE, Lerant AA, Freeman ME 1999 Prolactin activates all three populations of hypothalamic neuroendocrine dopaminergic neurons in ovariectomized rats. Brain Res 837:236–241[CrossRef][Medline]
  4. Arbogast LA, Voogt JL 1997 Prolactin (PRL) receptors are colocalized in dopaminergic neurons in fetal hypothalamic cell cultures: effect of PRL on tyrosine hydroxylase activity. Endocrinology 138:3016–3023[Abstract/Free Full Text]
  5. Grattan DR The actions of prolactin in the brain during pregnancy and lactation. In: Russell JA, Douglas AJ, Windle RJ, Ingram CD, eds. The maternal brain. Progress in brain research, vol 133. Amsterdam: Elsevier, in press
  6. Lerant A, Freeman ME 1998 Ovarian steroids differentially regulate the expression of prolactin receptors in neuroendocrine dopaminergic neuron populations: a double-label confocal microscopic study. Brain Res 802:141–154[CrossRef][Medline]
  7. Udy GB, Towers RP, Snell RG, et al. 1997 Requirement of Stat5b for sexual dimorphism of body growth rates and liver gene expression. Proc Natl Acad Sci USA 94:7239–7244[Abstract/Free Full Text]
  8. Palkovits M, Brownstein MJ 1988 Maps and guide to microdissection of the rat brain. New York: Elsevier
  9. Grattan DR, Rocca MS, Strauss KI, et al. 1996 GABAergic neuronal activity and mRNA levels for both forms of glutamic acid decarboxylase (GAD65 and GAD67) are reduced in the diagonal band of Broca during the afternoon of proestrus. Brain Res 733:46–55[CrossRef][Medline]
  10. Pi XJ, Grattan DR 1998 Distribution of prolactin receptor immunoreactivity in the brain of estrogen-treated, ovariectomized rats. J Comp Neurol 394:462–474[CrossRef][Medline]
  11. Sasaki F, Iwama Y 1988 Sex difference in prolactin and growth hormone cells in mouse adenohypophysis: stereological, morphometric, and immunohistochemical studies by light and electron microscopy. Endocrinology 123:905–912[Abstract/Free Full Text]
  12. Moore KE, Lookingland KJ 1995 Dopaminergic neuronal systems in the hypothalamus. In: Bloom FE, Kupfer DJ, eds. Psychopharmacology: the fourth generation of progress. New York: Raven Press; 245–256
  13. Selmanoff M, Shu C, Hartman RD, Barraclough CA, Petersen SL 1991 Tyrosine hydroxylase and POMC mRNA in the arcuate region are increased by castration and hyperprolactinemia. Mol Brain Res 10:277–281[Medline]
  14. Arbogast LA, Voogt JL 1991 Hyperprolactinemia increases and hypoprolactinemia decreases tyrosine hydroxylase messenger ribonucleic acid levels in the arcuate nuclei, but not the substantia nigra or zona incerta. Endocrinology 128:997–1005[Abstract/Free Full Text]
  15. Arbogast LA, Voogt JL 1995 Hypoprolactinemia decreases tyrosine hydroxylase activity in the tuberoinfundibular dopaminergic neurons acutely by protein dephosphorylation and chronically by changes in gene expression. Endocrine 3:801–806[CrossRef]
  16. Li C, Chen P, Smith MS 1999 Neuropeptide Y and tuberoinfundibular dopamine activities are altered during lactation: role of prolactin. Endocrinology 140:118–123[Abstract/Free Full Text]
  17. Bosse R, Fumagalli F, Jaber M, et al. 1997 Anterior pituitary hypoplasia and dwarfism in mice lacking the dopamine transporter. Neuron 19:127–138[CrossRef][Medline]
  18. Lookingland KJ, Jarry HD, Moore KE 1987 The metabolism of dopamine in the median eminence reflects the activity of tuberoinfundibular neurons. Brain Res 419:303–310[CrossRef][Medline]
  19. Roth R, Murrin L, Walters J 1976 Central dopaminergic neurons: effects of alterations in impulse flow on the accumulation of dihydroxyphenylacetic acid. Eur J Pharmacol 36:163–171[CrossRef][Medline]
  20. Romero MI, Phelps CJ 1995 Prolactin replacement in adult dwarf mice does not reverse the deficit in tuberoinfundibular dopaminergic neuron number. Endocrinology 136:3238–3246[Abstract]
  21. Bartke A, Morgan WW, Clayton RN, et al. 1987 Neuroendocrine studies in hyperprolactinaemic male mice. J Endocrinol 112:215–220[Abstract/Free Full Text]
  22. Demarest KT, Riegle GD, Moore KE 1984 Prolactin-induced activation of tuberoinfundibular dopaminergic neurons: evidence for both a rapid ‘tonic’ and a delayed ‘induction’ component. Neuroendocrinology 38:467–475[Medline]
  23. Selmanoff M 1985 Rapid effects of hyperprolactinemia on basal prolactin secretion and dopamine turnover in the medial and lateral median eminence. Endocrinology 116:1943–1952[Abstract/Free Full Text]
  24. Kelly MA, Rubinstein M, Asa SL, et al. 1997 Pituitary lactotroph hyperplasia and chronic hyperprolactinemia in dopamine D2 receptor-deficient mice. Neuron 19:103–113[CrossRef][Medline]
  25. Saiardi A, Bozzi Y, Baik JH, Borrelli E 1997 Antiproliferative role of dopamine: loss of D2 receptors causes hormonal dysfunction and pituitary hyperplasia. Neuron 19:115–126[CrossRef][Medline]
  26. Binart N, Helloco C, Ormandy C, et al. 2000 Rescue of preimplantatory egg development in prolactin receptor-deficient mice after progesterone administration. Endocrinology 141:2691–2697[Abstract/Free Full Text]
  27. Kelly PA, Binart N, Lucas B, Bouchard B, Goffin V 2001 Implications of multiple phenotypes observed in prolactin receptor knockout mice. Front Neuroendocrinol 22:140–145[CrossRef][Medline]
  28. Giros B, Jaber M, Jones SR, Wightman RM, Caron MG 1996 Hyperlocomotion and indifference to cocaine and amphetamine in mice lacking the dopamine transporter. Nature 379:606–612[CrossRef][Medline]
  29. Liu X, Robinson GW, Gouilleux F, Groner B, Hennighausen L 1995 Cloning and expression of Stat5 and an additional homologue (Stat5b) involved in prolactin signal transduction in mouse mammary tissue. Proc Natl Acad Sci USA 92:8831–8835[Abstract/Free Full Text]
  30. Nevalainen M, Ahonen T, Yamashita H, et al. 2000 Epithelial defect in prostates of Stat5a-null mice. Lab Invest 80:993–1006[Medline]
  31. Liu X, Robinson GW, Wagner KU, Garrett L, Wynshaw-Boris A, Hennighausen L 1997 Stat5a is mandatory for adult mammary gland development and lactogenesis. Genes Dev 11:179–186[Abstract/Free Full Text]
  32. Teglund S, McKay C, Schuetz E, et al. 1998 Stat5a and Stat5b proteins have essential and nonessential, or redundant, roles in cytokine responses. Cell 93:841–850[CrossRef][Medline]
  33. Davey HW, Park SH, Grattan DR, McLachlan MJ, Waxman DJ 1999 STAT5b-deficient mice are growth hormone pulse-resistant. Role of STAT5b in sex-specific liver P450 expression. J Biol Chem 274:35331–35336[Abstract/Free Full Text]
  34. Park SH, Liu X, Hennighausen L, Davey HW, Waxman DJ 1999 Distinctive roles of STAT5a and STAT5b in sexual dimorphism of hepatic P450 gene expression. Impact of STAT5a gene disruption. J Biol Chem 274:7421–7430[Abstract/Free Full Text]
  35. Lerant A, Kanyicska B, DeMaria J, Freeman M 1998 Nuclear translocation of STAT5 in the neuroendocrine dopaminergic neurons of female rats following ovine prolactin injection. INABIS ’98 5th Internet World Congress on Biomedical Sciences. McMaster University, Canada (http://www.mcmaster.ca/inabis98/neuroscience/lerant0748)
  36. Quandt K, Frech K, Karas H, Wingender E, Werner T 1995 MatInd and MatInspector: new fast and versatile tools for detection of consensus matches in nucleotide sequence data. Nucleic Acids Res 23:4878–4884[Abstract/Free Full Text]
  37. Soldaini E, John S, Moro S, Bollenbacher J, Schindler U, Leonard WJ 2000 DNA binding site selection of dimeric and tetrameric Stat5 proteins reveals a large repertoire of divergent tetrameric Stat5a binding sites. Mol Cell Biol 20:389–401[Abstract/Free Full Text]
  38. Trocme C, Sarkis C, Hermel JM, et al. 1998 CRE and TRE sequences of the rat tyrosine hydroxylase promoter are required for TH basal expression in adult mice but not in the embryo. Eur J Neurosci 10:508–521[CrossRef][Medline]
  39. Yang C, Kim HS, Seo H, Kim KS 1998 Identification and characterization of potential cis-regulatory elements governing transcriptional activation of the rat tyrosine hydroxylase gene. J Neurochem 71:1358–1368[Medline]
  40. Lim J, Yang C, Hong S, Kim K 2000 Regulation of tyrosine hydroxylase gene transcription by the cAMP-signaling pathway: involvement of multiple transcription factors. Mol Cell Biochem 212:51–60[CrossRef][Medline]
  41. Iwawaki T, Kohno K, Kobayashi K 2000 Identification of a potential nurr1 response element that activates the tyrosine hydroxylase gene promoter in cultured cells. Biochem Biophys Res Commun 274:590–595[CrossRef][Medline]
  42. Cazorla P, Smidt MP, O’Malley KL, Burbach JP 2000 A response element for the homeodomain transcription factor Ptx3 in the tyrosine hydroxylase gene promoter. J Neurochem 74:1829–1837[CrossRef][Medline]
  43. Kumer SC, Vrana KE 1996 Intricate regulation of tyrosine hydroxylase activity and gene expression. J Neurochem 67:443–462[Medline]
  44. Lee Y, Voogt JL 1999 Feedback effects of placental lactogens on prolactin levels and Fos-related antigen immunoreactivity of tuberoinfundibular dopaminergic neurons in the arcuate nucleus during pregnancy in the rat. Endocrinology 140:2159–2166[Abstract/Free Full Text]
  45. Hou Y, Voogt JL 1999 Effects of naloxone infusion on nocturnal prolactin secretion and Fos/FRA expression in pregnant rats. Endocrine 10:145–152[CrossRef][Medline]
  46. Hentschel K, Moore KE, Lookingland KJ 2000 Effects of prolactin on expression of Fos-related antigens in tyrosine hydroxylase-immunoreactive neurons in subdivisions of the arcuate nucleus. Brain Res 857:110–118[CrossRef][Medline]
  47. Pi XJ, Grattan DR 1999 Increased prolactin receptor immunoreactivity in the hypothalamus of lactating rats [published erratum appears in J Neuroendocrinol 2000 Jan;12(1):97–8]. J Neuroendocrinol 11:693–705[CrossRef][Medline]
  48. Crumeyrolle Arias M, Latouche J, Jammes H, et al. 1993 Prolactin receptors in the rat hypothalamus: autoradiographic localization and characterization. Neuroendocrinology 57:457–466[Medline]
  49. Bakowska JC, Morrell JI 1997 Atlas of the neurons that express mRNA for the long form of the prolactin receptor in the forebrain of the female rat. J Comp Neurol 386:161–177[CrossRef][Medline]
  50. Chiu S, Wise PM 1994 Prolactin receptor mRNA localization in the hypothalamus by in situ hybridization. J Neuroendocrinol 6:191–199[CrossRef][Medline]
  51. Heil SH 1999 Sex-specific effects of prolactin on food intake by rats. Horm Behav 35:47–54[CrossRef][Medline]
  52. Sauvé D, Woodside B 1996 The effect of central administration of prolactin on food intake in virgin female rats is dose-dependent, occurs in the absence of ovarian hormones and the latency to onset varies with feeding regimen. Brain Res 729:75–81[Medline]
  53. Bridges RS, Mann PE 1994 Prolactin-brain interactions in the induction of maternal behavior in rats. Psychoneuroendocrinology 19:611–622[CrossRef][Medline]
  54. Bridges RS, Robertson MC, Shiu RP, Sturgis JD, Henriquez BM, Mann PE 1997 Central lactogenic regulation of maternal behavior in rats: steroid dependence, hormone specificity, and behavioral potencies of rat prolactin and rat placental lactogen I. Endocrinology 138:756–763[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 EndocrinologyHome page
C. V. Helena, D. T. McKee, R. Bertram, A. M. Walker, and M. E. Freeman
The Rhythmic Secretion of Mating-Induced Prolactin Secretion Is Controlled by Prolactin Acting Centrally
Endocrinology, July 1, 2009; 150(7): 3245 - 3251.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
A. Blume, L. Torner, Y. Liu, S. Subburaju, G. Aguilera, and I. D. Neumann
Prolactin Activates Mitogen-Activated Protein Kinase Signaling and Corticotropin Releasing Hormone Transcription in Rat Hypothalamic Neurons
Endocrinology, April 1, 2009; 150(4): 1841 - 1849.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
F. J. Steyn, G. M. Anderson, and D. R. Grattan
Hormonal Regulation of Suppressors of Cytokine Signaling (SOCS) Messenger Ribonucleic Acid in the Arcuate Nucleus during Late Pregnancy
Endocrinology, June 1, 2008; 149(6): 3206 - 3214.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
D. R. Grattan, C. L. Jasoni, X. Liu, G. M. Anderson, and A. E. Herbison
Prolactin Regulation of Gonadotropin-Releasing Hormone Neurons to Suppress Luteinizing Hormone Secretion in Mice
Endocrinology, September 1, 2007; 148(9): 4344 - 4351.
[Abstract] [Full Text] [PDF]

Home page
 Eur J EndocrinolHome page
M J E Walenkamp and J M Wit
Genetic disorders in the GH IGF-I axis in mouse and man
Eur. J. Endocrinol., August 1, 2007; 157(suppl_1): S15 - S26.
[Abstract] [Full Text] [PDF]

Home page
 J EndocrinolHome page
A J Craven, A J Nixon, M G Ashby, C J Ormandy, K Blazek, R J Wilkins, and A J Pearson
Prolactin delays hair regrowth in mice.
J. Endocrinol., November 1, 2006; 191(2): 415 - 425.
[Abstract] [Full Text] [PDF]

Home page
 PediatricsHome page
A. Bernasconi, R. Marino, A. Ribas, J. Rossi, M. Ciaccio, M. Oleastro, A. Ornani, R. Paz, M. A. Rivarola, M. Zelazko, et al.
Characterization of Immunodeficiency in a Patient With Growth Hormone Insensitivity Secondary to a Novel STAT5b Gene Mutation
Pediatrics, November 1, 2006; 118(5): e1584 - e1592.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
G. M. Anderson, P. Beijer, A. S. Bang, M. A. Fenwick, S. J. Bunn, and D. R. Grattan
Suppression of Prolactin-Induced Signal Transducer and Activator of Transcription 5b Signaling and Induction of Suppressors of Cytokine Signaling Messenger Ribonucleic Acid in the Hypothalamic Arcuate Nucleus of the Rat during Late Pregnancy and Lactation
Endocrinology, October 1, 2006; 147(10): 4996 - 5005.
[Abstract] [Full Text] [PDF]

Home page
 J. Clin. Endocrinol. Metab.Home page
S. Vidarsdottir, M. J. E. Walenkamp, A. M. Pereira, M. Karperien, J. van Doorn, H. A. van Duyvenvoorde, S. White, M. H. Breuning, F. Roelfsema, M. F. Kruithof, et al.
Clinical and Biochemical Characteristics of a Male Patient with a Novel Homozygous STAT5b Mutation
J. Clin. Endocrinol. Metab., September 1, 2006; 91(9): 3482 - 3485.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Endocrinol. Metab.Home page
M. Egli, R. Bertram, N. Toporikova, M. T. Sellix, W. Blanco, and M. E. Freeman
Prolactin secretory rhythm of mated rats induced by a single injection of oxytocin
Am J Physiol Endocrinol Metab, March 1, 2006; 290(3): E566 - E572.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
S. T. Anderson, J. L. Barclay, K. J. Fanning, D. H. L. Kusters, M. J. Waters, and J. D. Curlewis
Mechanisms Underlying the Diminished Sensitivity to Prolactin Negative Feedback during Lactation: Reduced STAT5 Signaling and Up-Regulation of Cytokine-Inducible SH2 Domain-Containing Protein (CIS) Expression in Tuberoinfundibular Dopaminergic Neurons
Endocrinology, March 1, 2006; 147(3): 1195 - 1202.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
F. Y. Ma, G. M. Anderson, T. D. Gunn, V. Goffin, D. R. Grattan, and S. J. Bunn
Prolactin Specifically Activates Signal Transducer and Activator of Transcription 5b in Neuroendocrine Dopaminergic Neurons
Endocrinology, December 1, 2005; 146(12): 5112 - 5119.
[Abstract] [Full Text] [PDF]

Home page
 J ANIM SCIHome page
C. Farmer and M.-F. Palin
Exogenous prolactin stimulates mammary development and alters expression of prolactin-related genes in prepubertal gilts
J Anim Sci, April 1, 2005; 83(4): 825 - 832.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
F. Y. Ma, D. R. Grattan, V. Goffin, and S. J. Bunn
Prolactin-Regulated Tyrosine Hydroxylase Activity and Messenger Ribonucleic Acid Expression in Mediobasal Hypothalamic Cultures: The Differential Role of Specific Protein Kinases
Endocrinology, January 1, 2005; 146(1): 93 - 102.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Grattan, D. R.
Right arrow Articles by Davey, H. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Grattan, D. R.
Right arrow Articles by Davey, H. W.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals