help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Liu, S.
Right arrow Articles by Quarles, L. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liu, S.
Right arrow Articles by Quarles, L. D.
Endocrinology Vol. 142, No. 9 3987-3995
Copyright © 2001 by The Endocrine Society


ARTICLES

Cloning and Characterization of the Proximal Murine Phex Promoter

Shiguang Liu, Rong Guo and L. Darryl Quarles

Department of Medicine, Duke University Medical Center, Durham, North Carolina 27710

Address all correspondence and requests for reprints to: L. D. Quarles, M.D., Duke University Medical Center, P.O. Box 3036, Durham, North Carolina 27710. E-mail: Quarl001{at}mc.duke.edu


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Phex is an endopetidase that regulates systemic phosphate homeostasis. We investigated Phex gene transcription by cloning and performing functional analysis of the 2736 bp of the 5' flanking region of the mouse Phex gene containing its promoter. We identified a transcription start site, a consensus TATA-box, and multiple potential cis-acting regulator elements. To determine whether the promoter directs cell-type restricted Phex expression, we transfected full-length and 5'-deleted Phex luciferase reporter constructs into various cell lines. Phex-expressing C5.18 chondrocytes displayed the highest activity of the transfected Phex promoter constructs compared with non-Phex-expressing COS-7 cells, whereas promoter activity was intermediate in ROS 17/2.8 osteoblasts and maturation stage-dependent in MC3T3-E1 osteoblasts. Analysis of sequential 5'-deletion mutants of the Phex promoter in ROS 17/2.8 cells revealed bimodal activity, suggesting that both positive and negative cis-acting regions may be present. The chondrogenic factor SOX9 markedly stimulated Phex promoter activity, whereas Cbfa1, PTH, and 1,25(OH)2D3 had no effect. Our findings are consistent with the predominant expression of Phex in bone and cartilage. Additional studies will be needed to confirm the regulatory regions in the Phex promoter that function in a cell-restricted manner.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
PHEX IS A zinc metalloproteinase whose physiologic function is to regulate unidentified substrates controlling circulating phosphate concentrations and skeletal mineralization (1, 2). Phex is expressed in the skeleton, as well as in a limited number of other tissues including lung, ovary, testis, parathyroid gland, and brain (3, 4, 5, 6). Investigations of the hereditary diseases X-linked hypophosphatemia and the Hyp mouse animal homologue, which have inactivating Phex mutations, have provided insights into the complex pathogenesis of phosphaturia and impaired skeletal mineralization (1, 2, 7). It is likely that inactivating mutations of Phex indirectly causes renal phosphate wasting and hypophosphatemia by its failure to metabolize a putative phosphate-regulating hormone, phosphatonin, that has not yet been identified (2, 8, 9). In addition, Phex seems to play a role in regulating skeletal mineralization independent of hypophosphatemia, as evidenced by Phex expression in mature osteoblasts (3, 5), the finding that the loss of Phex function in osteoblasts derived from Hyp mice causes an intrinsic defect in mineralization of extracellular matrix in vitro (10, 11) and the partial rescue of the phenotype by bone marrow transplantation (12).

Limited information is available regarding the regulation of Phex. Given its role in systemic phosphate homeostasis and skeletal mineralization, and the multitude of factors regulating mineral ion homeostasis, such as age, sex, diet, PTH, and vitamin D, it is likely that Phex expression is regulated (2). Recent studies demonstrate that Phex expression in bone is increased by IGF-I and down-regulated by PTH administration and aging (13). Other studies indicate that a low phosphorus diet increases Phex transcripts in the pituitary gland but not in bone as assessed by semiquantitative RT-PCR analysis (14). In the skeleton, Phex is one of a group of cell-restricted genes that displays a late developmental expression pattern in mineralizing bone and cartilage, where this endopeptidase is predominantly expressed in mature osteoblasts and hypertrophic chondrocytes that are involved in regulation mineralization of extracellular matrix (3, 10, 15). Thus, cell-type and/or tissue-specific factors are likely responsible for the restricted pattern of Phex expression. Additional studies are needed to characterize molecular mechanisms of cell-type and tissue-specific expression of Phex and its regulation by factors controlling mineral homeostasis. Identification and characterization of the Phex gene promoter are important steps in defining the role of transcriptional regulation of the Phex gene.

In the current studies, we describe the cloning, sequencing, and functional analysis of the murine Phex promoter. We found that osteoblasts and chondrocytes express Phex endogenously and have the trans-acting factors necessary to direct transcription of the transfected Phex promoter. In contrast, COS-7 cells lack the necessary transcriptional machinery needed for Phex expression, suggesting that regulatory regions of the murine Phex promoter may function in a cell-specific manner. SOX9, a master regulatory factor for chondrocyte differentiation, stimulated the promoter activity, whereas the osteoblastic differentiation factor Cbfa1 had no effect on Phex promoter activity. We failed to identify either 1,25(OH)2D3 or PTH regulation of the transfected Phex promoter, suggesting any effects of these agents on Phex may not be mediated by transcriptional mechanisms or that the Phex promoter region lacks the necessary regulatory elements.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Isolation of the murine Phex 5'-flanking region
A mouse 129 SVJ genomic library (Stratagene, La Jolla, CA) was screened with a cDNA probe derived from mouse Phex exon 1 (oligonucloeotides +432 to +547). The probe was labeled with {alpha}-32P dCTP (800Ci/mmol) using a random primer DNA labeling kit (Life Technologies, Inc., Grand Island, NY). Plaque lifting, prehybridization, hybridization, washing of the filters, and autoradiography were performed by standard methods. Nine positive clones were identified after screening 1 x 106 pfu at a density of 5 x 104 pfu/plate. Putative positive clones were purified by secondary and tertiary rounds of screening. Restriction digests with Nsi I and Southern blot analysis with the exon 1 cDNA probe identified two clones containing identical 5'-flanking regions. A 12-kb fragment was released from this phage clone and partially sequenced, revealing 1104 bp of intron 1, 674 bp exon 1, and approximately 10.2 kb of the 5'-flanking sequence. This promoter sequence has been entered in GenBank, accession number AF299334.

The promoter analysis program Neural Network Promoter Prediction (http://www.fruitfly.org/seq_tools/promoter.html) was used to predict the transcription start site. The promoter sequence was analyzed by the Transcription Element Search System (TESS of the Computational Biology and Informatics Laboratory, School of Medicine, University of Pennsylvania, http://agave.humgen.upenn.edu/tess/index.html) by using a 6-bp minimum element size limit, a 5% mismatch allowance, a minimum log-likelihood of homology of 10, and a secondary log-likelihood density threshold of 1.6. Further analysis of the promoter sequence was conduced using TFSEARCH (http://pdap1.trc.rwcp.or.jp/research/db/TFSEARCH.html). In addition, we used the sequence information from the mouse Phex promoter and Blast analysis (http://www.ncbi.nlm.nih.gov/BLAST/) to identify the corresponding region of the human promoter (accession number Y10196) (16). The respective regions of the mouse Phex and human PHEX promoter were compared using TRES Transcription Regulatory Element Search, a tool for Comparative Promoter Analysis (http://www.bic.nus.edu.sg:8888/tres/) and BestFit analysis.

RT-PCR analysis
RT-PCR was performed using a two-step RNA PCR kit (Perkin-Elmer Corp., Branchburg, NJ). DNase-treated total RNA (2.5 µg) was reverse transcribed into cDNA in a total volume of 50 µl with random primers. The RT reaction was incubated at 42 C for 15 min. The resulting cDNA was PCR amplified using various sets of primers. Forward primers included Phex-22F (5'-GGGACTAACACACTGAAAGAGT-3') and Phex+1F (5'-AACTTTTGACGACGACAGTTCA-3'). The reverse primer was Phex+697R (5'-GAAACTTAGGAGACCTTGAC-3'), located in exon 2. PCR was performed with thermal cycling parameters of 94 C for 30 sec, 60 C for 30 sec, and 72 C for 60 sec for 35 cycles, followed by a final extension at 72 C for 7 min. For evaluation of Phex expression in different cell lines, we used the forward primer Phex+1866F (5'-AATTGATTGAGGGTGTTCGC-3') and the reverse primer Phex+2943R (5'-ACCCAAATAATGAAAATGCA-3). For RT-PCR analysis of 4 and 9-d-old MC3T3-E1 osteoblasts, we used Phex-specific primers Phex+1419F (5'-TTGGCAAAAGTTGGCTATCCAG-3') and Phex+965R (5'-TATCCATTTCCTGTAAGCCC-3') as described previously (3). Samples without RT treatment were analyzed as controls. For evaluation of SOX9 expression, we used the forward primer 5'-ATCTGAAGAAGGAGGAGCGAG-3' and the reverse primer 5'-TCAGAAGTCTCCAGAGCTTG-3', which are to regions conserved across species including mouse and primates (17). Glyceraldehyde-3-phosphate dehydrogenase (G3PDH) or mouse ß-actin were amplified as controls for the amounts and integrity of RNA in the PCR reactions. RT-PCR products were identified by autoradiography using radiolabeled Phex and ß-actin cDNA probes as described previously (3) or by ethidium bromide staining.

RNase protection analysis
RNase protection assays were used to estimate the Phex mRNA transcription start site. The riboprobe (-130, +132) consisted of a 262-bp fragment of the mouse Phex subcloned into pBSK(-) (Stratagene). Single-stranded antisense radiolabeled RNA probes were transcribed from BamHI linearized Phex 262/pBSK(-) using T7 RNA polymerase and [32P-]UTP (NEN Life Science Products, Boston, MA). The riboprobe was purified on a 6% polyacrylamide gel. RNase protection assays were conducted using the RPA III kit (Ambion, Inc., Austin, TX). Twenty micrograms of total RNA from each cell line and the labeled riboprobe (100,000 cpm) were precipitated, redissolved in 10 µl Hybridization III Buffer and incubated overnight at 42 C. Products were digested with RNase A/RNase T1 mix (1:100 dilution) for 30 min, and the protected RNA fragments were separated on a 5% denaturing polyacrylamide gel. The resultant products were assessed by autoradiography using BioMax MS film at -70 C.

Cell culture
ROS17/2.8 osteoblasts were grown in a 1:1 mixture of DMEM and Nutrient Mixture F-12 (Life Technologies, Inc.), as described previously (18). The MC3T3-E1 osteoblast cell line was grown in {alpha}-MEM (Life Technologies, Inc.) and was grown in {alpha}-MEM supplemented with 0.13 mM ascorbic acid and 5 mM ß-glycerol phosphate for differentiation, as described previously (18). COS-7 cells were maintained in DMEM (Life Technologies, Inc.) (19). C5.18 chondrocytes (20) were provided by Dr. Jane E. Aubin (University of Toronto, Toronto, Canada) and maintained in {alpha}-MEM containing 15% FBS. All cell lines, except C5.18, were supplemented with 10% (vol/vol) FBS. All cultures were supplemented with 100 µg/ml penicillin and streptomycin and cultured in a humidified incubator with 5% CO2 at a temperature of 37 C.

Preparation of constructs
To generate the Phex reporter gene constructs, 2790 bp of the genomic fragment from -2736 to +54 of Phex was amplified with PCR SuperMix High Fidelity (Life Technologies, Inc.) using a set of primers (-2736 F, 5'-GGGGTACCGCCAGTGGGGTCTTGTATGT; +54 R, 5'-GGGGTACCAGATTTCTGCTATGACAGCC), and the resultant product was subcloned into KpnI site of pGL2-Basic vector named p2736Phex-luc. Sequentially, 5'-deletion with different primers generated constructs from -2736 to -22, including p1606Phex-luc with primer -1606 F, 5'-GGGGTACCATGCATTTGCTGTCACATAT; p964Phex-luc with primer -964 F, 5'-GGGGTACCTGGTTAAGATATGTTAGG; p472Phex-luc with primer -472 F, 5'-GGGGTACCCTTAATCCTCAGGAAGCT; p178Phex-luc with primer -178 F, 5'-GGGGTACCAGTTCCAGTCCAAACCATCA; p130Phex-luc with primer -130 F, 5'- GGGGTACCTTGCACTGCAATGGACTATG; and p22 F with primer -22 F, 5'-GGGGTACC- GGGACTAACACACTGAAAGAGT. We used the previously described SOX9 (21) and the Cbfa1 mammalian expression constructs (22).

Transient transfection and reporter assays
Transient transfection experiments were performed using the TransFast Reagent (Promega Corp., Madison, WI) as described previously (22). Briefly, cells were plated at a density of 1.5 x 105 cells/well in 6-well plates 16 h before transfection. We used 1.0 µg Phex promoter constructs and 0.25 µg pSV ß-galactosidase, and in cotransfection experiments we added 0.5 µg SOX9 or Cbfa1 expression constructs. Luciferase activity was measured using the Luciferase Assay Kit (Promega Corp.). ß- Galactosidase activity was measured by ß-Galactosidase Enzyme Assay System (Promega Corp.). For the transient transfection studies, the luciferase activity was normalized by ß-galactosidase activity by dividing luciferase activity by ß-gal. The relative luciferase activity was then calculated by dividing the normalized luciferase activity by that obtained with the empty pGL2-Basic vector. We observed higher ß-gal activity in Cos-7 cells, but this did not influence the relative comparisons between cell lines. For stable transfection studies in MC3T3-E1 osteoblasts, the luciferase activity was normalized for cell number by dividing luciferase activity by DNA content. The relative luciferase activity was then calculated by dividing the normalized luciferase activity by that obtained with the MC3T3-E cells stably transfected with the empty pGL2-Basic vector. For the stimulation studies, cells were incubated in serum-free medium containing 0.1%BSA for 24 h before adding different concentration of various reagents, including PTH 1–34, forskolin, 12-O-tetradecanoylphorbol-13-acetate (TPA; Sigma, St. Louis, MO), and 1,25(OH)2D3, as described previously (17). We previously have determined the concentration of PTH and forskolin to stimulate cAMP and the concentration of TPA to stimulate PKC activity in osteoblasts (data not shown).

Stable transfection of MC3T3-E1 with Phex promoter/luciferase reporter construct
Stable transfection of MC3T3-E1 was performed by a pooled protocol as described previously (18). MC3T3 cells were cotransfected with p2736Phex-luc and pSV2-neo in a 15:1 molecular ratio. Transfectants were selected in the presence of 700 µg/ml G418 for 14 d. The cells were plated in {alpha}-MEM complemented with ascorbic acid and ß-glycerol phosphate. The luciferase activities were measured on different days using the Luciferase Assay Kit (Promega Corp.). Total DNA content was determined using Picogreen dsDNA Quantitation Reagent and Kits (Molecular Probes, Inc., Eugene, OR).

Statistical analysis
We evaluated differences between groups by one-way ANOVA. All values are expressed as mean ± SEM. All computations were performed using the Statgraphic statistical graphics system (STSC, Inc., Rockville, MD).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Isolation and cloning of the mouse Phex promoter and its 5' untranslated region (UTR)
At the time we initiated our studies the Phex promoter had not been isolated or cloned and the full extent of the 5' UTR had not been defined. To locate the Phex promoter, we isolated and cloned the region of the mouse Phex gene containing exon 1 and upstream sequences (Fig. 1Go). RT-PCR and RNase protection analysis (Fig. 2Go) demonstrated that exon 1 contains 556 bp of the 5' UTR and evidence for TATA- containing promoter in the 2736 bp of upstream sequence (Fig. 1Go). Using computer prediction programs, we initially located the putative transcription start site 556 bp upstream of the ATG in exon 1. We performed RNase protection to confirm the location of the transcription start site (Fig. 2AGo). Using a riboprobe (-130, +132), which contained 262 oligonucleotides overlapping the putative start site, we identified a single 132 bp protected fragment in both mature MC3T3-E1 and TM-Ob osteoblasts. To provide additional evidence for the location of the transcription start site, we performed RT-PCR using intron-spanning primers flanking the initiation sites and RNA derived from differentiated, Phex-expressing MC3T3-E1 osteoblasts (Fig. 2BGo). Forward primer +1 F in combination with the reverse primer +697 R in exon 2 generated the predicted size product. In contrast, the upstream primer -22 F in combination with +697 R did not amplify any product, indicating that transcription initiation begins in the segment flanked by primers -22 F and +1 F (Fig. 2BGo). Consistent with the designated start site, we found a consensus TATA-box at position -32 to -23 from the transcription start site (Fig. 1Go).



View larger version (94K):
[in this window]
[in a new window]
 
Figure 1. Nucleotide sequence of the 5'-flanking region of the Phex gene. The sequence encompasses 3410 bp of the 5'-flanking region of the Phex gene. The transcription start site based on RNase protection and RT-PCR analysis (Fig. 2Go) is shown by an arrow. Consensus cis-acting elements for known transcription factors conserved between mouse and human are underlined. The sequence is numbered relative to the transcription start site.

 


View larger version (42K):
[in this window]
[in a new window]
 
Figure 2. Determination of the transcription start site of the mouse Phex gene. A, RNase protection was performed with 20 µg total RNA hybridized to 32P-labeled 327-bp riboprobe complementary to nucleotide from -130 to +132. The approximate position of the 5' ends was estimated by the size of the protected fragment. B, RT-PCR mapping was performed with total RNA derived from mature MC3T3-E1 osteoblasts. The reverse primer, Phex+697R in exon 2 was used in combination with respective forward primers Phex -22F, Phex +1F. The position of the forward primers relative to the transcription start site is shown in Fig. 1Go. +RT, with RT; -RT, without RT.

 
We used the mouse Phex promoter sequence to search for homologies in the corresponding 5'-flanking region of the human Phex gene that has recently been sequenced (16). The overall homology was 71% over the 2736-bp region corresponding to the mouse Phex promoter. In addition, we found five nearly identical regions between the 2736 bp of the mouse Phex promoter and the 5'-flanking region of the human PHEX gene. These include an identity of 96% over the first 182 bp from the transcription start site (position -182 to +1) and regions exhibiting more than 82% identity at positions -2425 to -2233 (192 bp), -1959 to -1906 (53 bp), -1317 to -1267 (50 bp), and -541 to -491 (37 bp) of the mouse promoter. In addition, we observed in both human and mouse sequence many conserved consensus elements including a GRE at position -2634 (23); several SRY sites at positions -2340, -2199, -700, -468, -388, and -313 (24); GATA-1 at positions -2402, -1920, and -166 (25); AP1 at position -673 (26); MZF1 at position -1909 (27); HMG box at position -1900 (28); E-box at position -1934 (29); EF1 repressor at position -1643; Bcd at the position -1573 (30); AP-4 at position -1263 (31); NF-Y at position -1057 (32); C/EBP at position -928 (33); C-Rel at position -897 (34); Lmo2 complex at position -625 (35); Nkx-2.5 at position -143 (36); Skn-1 at position -94 (37); GATA-2 at position -58 (38); and a TATA box at position -32 (39). We also observed several putative cis-acting elements in the mouse sequence that were not conserved with the corresponding human 5'-flanking region, including a possible AML-1a binding site at position -277 (40).

Cell specificity and abundance of Phex mRNA
Before proceeding with the functional analysis of the 5'-flanking region of the Phex gene, we identified Phex-expressing and -nonexpressing cells. By RNase protection analysis we confirmed the osteoblast expression and differentiation stage dependency of Phex expression (Fig. 2AGo and Fig. 3Go). We detected a high level of Phex expression by RNase protection assay in mature MC3T3-E1(14 d of culture) and TM-Ob (15 d of culture) osteoblasts, but failed to detect Phex transcripts in NIH3T3 fibroblasts and undifferentiated TM-Ob cells cultured for 5 d. Using RT-PCR analysis, we detected Phex transcripts in differentiated MC3T3-E1 osteoblasts, C5.18 chondrocytes and ROS17/2.8 osteosarcoma cells, but not in COS-7 cells (Fig. 3Go).



View larger version (37K):
[in this window]
[in a new window]
 
Figure 3. RT-PCR analysis of Phex mRNA expression in various cell lines. RT-PCR was performed with 2.5 µg total RNA from MC3T3-E1, C5.18, ROS 17/2.8, and COS-7 cells. MC3T3-E1 cells were induced to differentiate by 14 d of culture in {alpha}-MEM containing ascorbic acid and ß-glycerol phosphate. Phex was amplified by PCR using the forward primer +1866F and the reverse primer +2943R (top). A 1.1-kb product was amplified from 14-d-old MC3T3-E1, C5.18, and ROS17/2.8 osteoblasts. No product was amplified from COS-7 cells. G3PDH primers, which amplify a 0.9-kb product, were used as controls for RNA integrity (bottom). +RT, with RT; -RT, without RT.

 
Functional characterization of the Phex promoter in ROS17/2.8 osteoblasts
To begin to examine the transcription of the Phex gene, we evaluated serial deletions of Phex-luc promoter constructs in ROS17/2.8 osteosarcoma cells (Fig. 4Go). Progressive 5'-deletion mutations of the promoter revealed a bimodal pattern of functional activity in transiently transfected ROS17/2.8 cells (Fig. 4Go). The full-length promoter construct (-2736/+54) was active in ROS 17/2.8 cells, and displayed a progressive reduction in promoter activity as the 5'-deletion mutations approached 1606 bp, relative to the transcription start site. Further deletions from 1606 to 946 bp, however, lead to an increase in promoter activity that exceed that of the full-length promoter. Successive deletions from -946 bp lead to a progressive reduction in promoter activity in ROS17/2.8 cells, resulting in a near complete ablation with -22/+54 construct.



View larger version (20K):
[in this window]
[in a new window]
 
Figure 4. Function analysis of 5' deletion mutants of the mouse Phex promoter-luciferase chimeric gene by DNA transient transfection experiments. Activity of deletion mutants of the Phex-luc constructs were assessed in ROS 17/2.8 cells that express the Phex (Fig. 3Go). The promoter/reporter construct, p2736Phex-luc, consists of sequence -2736 to +54 subcloned into the pGL2-Basic vector. Deletions were generated by PCR as described in Materials and Methods. In DNA transfection experiments, successive deletions of Phex-luc from -2336 to -472 decreased the level of expression 40%, whereas deletions from -130 to -22 abolished activity, indicating critical cis-acting elements are present between -947 and -472, as well as between -130 and -22. Luciferase activity is relative to pGL2-Basic vector alone and expressed as a ratio to ß-galactosidase activity to correct for transfection efficiency. Values represent the mean ± SEM of a minimum of three separate transfection experiments. Values sharing the same superscript are not significantly different at P < 0.05.

 
Cell-restricted activity of the 2.7 kb and 946 bp Phex promoter constructs
Phex transgene constructs containing 946 bp and 2736 bp of upstream sequence (p946Phex-luc and p2736Phex-luc) were further tested to define the DNA regulatory regions that might direct the tissue-specific expression of Phex (Fig. 5Go). Because Phex is strongly expressed in osteoblasts and chondrocytes but is not expressed in COS-7 cells, these two Phex promoter constructs were transiently transfected into these three different cell lines. The full-length promoter construct (-2763/+54) was expressed to a higher extent (approximately 3-fold) in C5.18 chondrocytes compared with COS-7 cells. The expression was also significantly greater in ROS 17/2.8 osteosarcoma cells compared with COS-7 cells, but was quantitatively less than expected from the level of Phex mRNA in osteoblasts (Fig. 3Go). In all three cell lines, the overall activity of the (2736/+54) construct was lower than that observed with the truncated promoter construct (-946/+54). Indeed, deletion of the initial 1789 bp of the promoter resulted in nearly a 3-fold increase in promoter activity in C5.18 chondrocytes and nearly a 2-fold activity in ROS17/2.8 osteosarcoma cells and COS-7 cells. These findings suggest that the distal region of the promoter from -946 to -2736 contains inhibitory elements and the proximal 946 bp of the promoter has regulatory elements that contribute to the differential expression of Phex between osteoblasts, chondrocytes and nonosteoblastic cell lines. The results in COS-7 cells need to be interpreted with caution, because they may not simply reflect the nonosteoblastic phenotype of the cells, but the effects of their expression of SV40 T antigen.



View larger version (17K):
[in this window]
[in a new window]
 
Figure 5. Function analysis of the murine Phex promoter in different cell lines: evidence for positive and negative regulators. We compared constructs p2736Phex-luc and p946Phex-luc that, respectively, contain 2790 bp and 946 bp of the 5'-flanking portion of the Phex gene inserted immediately upstream from the firefly luciferase in pGL2-Basic. One microgram of pPhex-luc and 0.25 µg pSV ß-galactosidase were cotransfected into cells using TransFast reagent. The luciferase activity was normalized by ß-galactosidase activity and expressed relative to the pGL2-basic vector. The p946Phex-luc construct demonstrated greater activity in C5.18 chondrocytes and ROS17/2.8 osteoblasts compared with non-Phex-expressing COS-7 cells. This suggests the presence of elements in the Phex promoter directing cell-restricted expression as well as nonspecific elements directing high-expression in COS-7 cells. In contrast, the p2736Phex-luc construct expressed less activity in all cell types, but maintained the relative greater activity in Phex-expressing chondrocytes compared with osteoblasts and COS-7 cells. The values represent the mean ± SEM of three separate transfections. Values sharing the same superscript are not significantly different at P < 0.05.

 
SOX9 enhances Phex promoter activity
Because of the high levels of expression of chondrocytes, we tested the effect of transcription factors regulating chondrogenesis on Phex promoter activity. SOX9 is a transcription factor that plays a key role in chondrogenesis (21). To examine whether SOX9 regulates the transcriptional activity of the Phex gene, the full-length Phex promoter construct (-2736/+54) was cotransfected with a SOX9 expression vector into ROS17/2.8 cells(Fig. 6AGo). SOX9 overexpression in C5.18 chondrocytes, ROS17/2.8 osteosarcoma cells, and COS-7 cells enhanced by approximately 6-, 4-, and 3-fold, respectively, the transcriptional activity of the full-length Phex promoter. In contrast, SOX9 failed to stimulate activity above the control plasmid using the (-946/+54) construct (Fig. 6BGo). These observations suggest that SOX9 may regulate Phex gene transcription through upstream SRY-like elements, possibly at positions -2340, and -2199 (23). Additional studies will be needed to confirm the importance of the putative SRY sites and identify the transcription factors that bind to them. Other factors also are likely to be involved in mediating the preferential expression of Phex in chondrocytes. Indeed, SOX9 mRNA was detected in all three cell lines (Fig. 6CGo), but its ability to up-regulate promoter activity was greatest in chondrocytes. In addition, the unexpected high activity of the Phex promoter in COS-7 cells may be explained by their high level of endogenous SOX9 transcripts.



View larger version (32K):
[in this window]
[in a new window]
 
Figure 6. Effect of SOX9 on Phex promoter activity and expression of SOX9 in various cell lines. A and B, The effect of the chondrocyte differentiation factor SOX9 on Phex promoter activity in various cell lines. C5.18, ROS 17/2.8, or COS-7 cells were cotransfected with the SOX9 expression construct or the empty vector (pcDNA3.1) along with p2736Phex-luc (A) or p946Phex-luc (B), as described in Materials and Methods. Overexpression of SOX9 resulted in an increase in activity of the full-length Phex promoter construct in all cell lines, but not in the truncated p946Phex-luc construct, consistent with the presence of putative SRY-like elements between 946 and 2736 (Fig. 1Go). C, RT-PCR analysis of SOX9 expression. Total RNA derived from the indicated cell lines was RT-PCR using a primer pair capable of amplifying SOX9 from both rodent and primate species. We identified the predicted size product in C5.18, ROS17/2.8 and COS-7 cells. +RT, with RT; -RT, without RT. G3PDH primers that amplify a 0.9-kb product were used as controls for RNA integrity (bottom).

 
Failure of other factors to regulate the Phex promoter
We performed additional studies evaluating the effects of Cbfa1, PTH, calcium, forskolin, 1,25(OH)2D3, phosphorus, and TPA on either Phex promoter construct (-2736/+54) in ROS17/2.8 cells. In contrast to the potent stimulation by SOX9 (Fig. 6Go), none of these factors stimulated Phex promoter activity (data not shown). In particular, we observed no stimulation by cotransfecting the Cbfa1 expression plasmid (22) with the Phex promoter, whereas this Cbfa1 expression plasmid has been previously used by us to stimulate an osteocalcin promoter construct (22). Similarly, 1,25(OH)2D3 at concentrations that stimulated an osteocalcin promoter construct failed to stimulate the Phex promoter construct in ROS17/2.8 (Fig. 7Go) or MC3T3-E1 osteoblasts. PTH at concentration ranging from 5–100 nM as well as the addition of calcium to the media at concentrations ranging from 1–5 mM also failed to stimulate Phex promoter activity in ROS17/2.8 cells (data not shown). Finally, neither stimulation of cAMP by forskolin at a dose ranging from 10-7 to 10-5M, or activation of PKC by treatment of cells with TPA at concentrations of 0.16 µM and 1.6 µM stimulated the Phex promoter construct in MC3T3-E1 osteoblasts (data not shown).



View larger version (43K):
[in this window]
[in a new window]
 
Figure 7. Effect of 1,25-(OH)2D3 on the Phex promoter fragment. ROS 17/2.8 cells were transiently transfected with either p2736Phex-luc (solid bars) or the rat osteocalcin promoter p637Oc-luc (hatched bars) containing a vitamin D response element (VDRE). One microgram of DNA from each reporter plasmid was used for each transfection experiment in ROS 17/2.8 cells. In each case, cells were treated with either 10-10 M or 10-8 M 1,25-(OH) 2D3 or with vehicle for 24 h before harvest. We observed a dose-dependent effect of 1,25-(OH)2D3 to increase luciferase activity in ROS17/2.8 cells transfected with p637Oc-luc, but with p1606Phex-luc, consistent with the absence of a VDRE in the Phex promoter (Fig. 1Go). Data represent relative luciferase activity expressed as the mean ± SEM of at least three independent transfection experiments. Values not sharing the same superscript are significantly different at P < 0.05.

 
Developmental Stage-specific Transcriptional up-regulation of the Phex promoter in MC3T3-E1 cells
Different stages of maturation were accomplished by growing MC3T3-E1 cells in media containing serum with supplemented with ascorbic acid and ß-glycerol phosphate for various time periods (18). To confirm the maturational up-regulation of Phex expression, we evaluated Phex promoter activity in stably transfected MC3T3-E1 osteoblasts after 4 and 9 d of culture (Fig. 8AGo). We found that Phex promoter activity relative to the empty vector alone increased during this maturation period, paralleling the culture duration dependent up-regulation of endogenous Phex mRNA in these cells (Fig. 8BGo).



View larger version (25K):
[in this window]
[in a new window]
 
Figure 8. Analysis of Phex promoter activity and mRNA expression in MC3T3-E1 osteoblasts. A, MC3T3-E1 cells were stably transfected with the p2736Phex-luc or the pGL2-Basic vector and cultured in the presence of ascorbic acid and ß-glycerol phosphate for up to 9 d to induce differentiation. Luciferase activity (corrected for DNA content and the activity of the empty vector) significantly increased as a function of osteoblastic maturation. Values represent the mean ± SEM of three separate determinations. B, RT-PCR of Phex in MC3T3-E1 osteoblasts at different developmental stages. Phex was amplified using primers predicted to generate a 566-bp Phex fragment (arrow). A 245-bp region of ß-actin was amplified at each day point as an internal control for RNA amount and integrity (arrow, bottom panel). Phex mRNA increased in 9-d-old compared with 4-d-old osteoblasts consistent with the observed increase in Phex promoter activity (A). -/+RT, absence and presence of RT, respectively.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
To initiate studies directed at identifying pathways regulating Phex expression, we have isolated, sequenced, and characterized the functional activity of the murine Phex promoter in chondrocytes, osteoblasts, and COS-7 cells. A single transcription start site was mapped, and a promoter construct containing up to 2736 bp of the 5'-flanking sequence was identified and shown to display functional activity in cells expressing Phex endogenously. The promoter region that we identified is the same as that independently isolated from a mouse genomic BAC clone (41). Searching the DNA database with the mouse promoter sequence identified a corresponding highly homologous region upstream of the human PHEX coding sequence and conservation of many of the same putative regulatory cis-acting elements in the mouse and human 5'-flanking regions (Fig. 1Go). We have begun investigations with the murine Phex promoter to determine the role that transcriptional regulation plays in the cell type-specific and hormonal regulation of Phex. To date, our analysis of the Phex promoter identifies three important features, namely the presence of transcriptional control of cell-restricted expression, a bimodal pattern of functional activity in 5' deletion mutants indicative of both positive and negative regulatory elements, and the lack of regulation by several factors involved in calcium and phosphate homeostasis.

Although the activity of this Phex promoter construct was greater in the cell lines C5.18 chondrocytes and ROS 17/2.8 osteoblasts that express Phex mRNA than nonexpressing COS-7 cells (Figs. 4Go and 5Go), the difference in promoter activity was not as great as expected based on the marked differences in Phex mRNA levels in C5.18 and ROS 17/2.8 compared with COS-7 cells (Fig. 3Go). This is especially true for ROS17/2.8, which express high levels of Phex transcripts but have promoter activity only 50% greater than nonspecific activity of the promoter observed in COS-7 cells. Thus, there may be additional elements outside the existing Phex promoter construct or nontranscriptional mechanisms that may account for the apparent disparity between the level of Phex transcripts and promoter activity in ROS 17/2.8 osteoblasts. In addition, COS-7 cells, which are of the SV40 transformed monkey kidney cell line, may have high nonspecific activity of the Phex promoter construct in the absence of endogenous Phex expression, due to the transcriptional effects of the T antigen or to the expression of SOX9, which is expressed in COS-7 kidney-derived cells (Fig. 6Go) as well as in the developing collecting ducts of the metanephric kidney (42). Nevertheless, complementary studies in MC3T3-E1 osteoblasts (Fig. 8Go) demonstrated maturational stage-dependent expression of Phex transcriptional activity (Fig. 2Go) that mirrors our previously reported increase of Phex transcripts in mature osteoblasts (3, 43). Thus, the differential expression of the Phex promoter in chondrocytes and MC3T3-E1 osteoblasts and to a lesser extent in the ROS 17/2.8 osteoblasts, indicate that cis-acting elements are present in the Phex promoter necessary for its expression in skeletal cells. The finding of Phex in cartilage-derived cells, similar to its expression in osteoblasts, also further strengthens the association of Phex expression and the process of mineralization of extracellular matrix.

The high expression in skeletal cells lead us to investigate whether transcription factors that regulate chondrogenesis and osteoblastogenesis also regulate the Phex promoter. We examined the effects on Phex promoter activity of SOX9, a member of the family of SOX (SRY-type high mobility group box) genes that plays central role in chondrogenesis (41), and Cbfa1 (core-binding factor) gene (also known as Runx2), a transcription factor that has a critical role in osteoblastic differentiation (44). Consistent with the presence of several putative SRY sites in the Phex promoter, we found that cotransfection of SOX9 expression plasmid with the p2736 Phex-luc Phex promoter, but not the p946Phex-luc promoter, resulted in an increase in Phex promoter activity in all cells, indicating that the chondrocyte and osteoblast cells as well as the kidney-derived cell line COS-7 provide an environment to assess SOX9 effects. The response was greater in C5.18 chondroctyes (Fig. 6Go). The fact that SOX9 collaborates with other transcription factors potentially explains its greater effect in C5/18 chondrocytes (45, 46). Additional studies will be needed to determine which of the several potential SRY sites or other sites are important in mediating SOX9 effects and the factors that cooperatively activate the Phex gene. Unexpectedly, and despite the presence of a putative AML-1-binding site at position -276 of the mouse (but not the human) promoter, cotransfection of a Cbfa1 expression plasmid with the -1606/+54 Phex promoter had no effect on Phex promoter activity in ROS17/2.8. It is possible that other factors or unique combinations of known factors direct the restricted expression of Phex in osteoblasts.

Deletional analysis identified both positive and negative regulatory elements in the murine Phex promoter (Fig. 4Go). Promoter activity was altered in ROS17/2.8 osteosarcoma cells by progressive 5'-deletion mutations and was characterized by a bimodal pattern of activity. The highest activity was observed with the -946/+54 promoter construct. We found that deletions from -2736 to -1606 bp resulted in a decrease in promoter activity, but further deletion from to -946 bp restored promoter activity to their highest levels, consistent with the presence of repressor elements between -2736 and -946. In this region, we identified conserved sequences similar to the EF1 repressor TGCCACCTGAGG at position -1643/-1632 (30) and the osteocalcin gene silencer CCCCTNTCT at position -1985/-1977 (47). Further deletions from 946 to 22 bp resulted in progressive loss of promoter activity. Significant promoter activity was lost between 178 and 130 bp, suggesting that the region from 946 to 130 contains important positive cis-acting elements that regulate Phex transcription. This region contained the highest density of possible cis-acting elements conserved between the mouse and human sequences. These included two C/EBP sites, one C-Rel site, four SRY sites, two Nkx-2.5 sites, one AP-1 site, and one GATA-1 site. Whether these sites bind transcription factors and control Phex transcription will require further studies.

Finally, because of its role in the maintenance of normal serum phosphate levels and skeletal mineralization, our a priori hypothesis was that Phex gene transcription might be modulated by factors controlling calcium and phosphate homeostasis. We have been unable to demonstrate such regulation. PTH and 1,25(OH)2D3, two factors important in regulating systemic phosphate homeostasis, failed to affect the Phex promoter activity in ROS17/2.8 cells (Fig. 7Go) that have PTH receptors and respond to 1,25(OH)2D3 at the concentrations used in this study. Despite potential AP-2 and c-REL sites, neither TPA or forskolin increased the activity of the Phex luciferase reporter gene in osteoblasts. These data suggest that any effect of PTH and/or vitamin D to modulate Phex expression may be indirect or involve elements outside the 2.7-kb region.

In conclusion, we have confirmed the presence of a functional promoter in the 5'-flanking region of the murine Phex gene and have identified a corresponding homologous sequence in humans. Our initial characterizations of the murine Phex promoter are consistent with cell-type and maturational stage-specific transcriptional control but not control by hormones and other factors known to control phosphate homeostasis. The induction of promoter activity by SOX9 is consistent with the expression of Phex in chondrocytes. Our cell culture data, however, may not accurately reflect the physiological and in vivo regulation of Phex, and additional studies are needed to clarify the regulation of the promoter in a more physiologically relevant setting. Indeed, understanding the transcriptional regulation of Phex in osteoblasts as well as the location of particular cis-acting elements controlling Phex expression await further analysis that include assessment of protein/DNA interactions and testing Phex promoter function in the context of transgenic mice.


    Acknowledgments
 


    Footnotes
 
This work was supported in part by Grants R01-AR37308 and R01-AR43468 from the NIH, National Institute of Arthritis and Musculoskeletal and Skin Diseases. The nucleotide sequences reported in this paper have been submitted to GenBank /EMBL Data Bank with accession number AF299334.

Abbreviations: G3PDH, Glyceraldehyde-3-phosphate dehydrogenase; RT, reverse transcriptase; TPA, 12-O-tetradecanoylphorbol-13- acetate; UTR, untranslated region.

Received January 23, 2001.

Accepted for publication June 1, 2001.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. The HYP Consortium 1995 A gene (Pex) with homologies to endopeptidases is mutated in patients with X-linked hypophosphatemic rickets. Nat Genet 11:130–136[CrossRef][Medline]
  2. Quarles LD, Drezner MK 2001 The pathophysiology of XLH, ADH, and TOM: a perPHEXing problem. J Clin Endocrinol Metab, in press
  3. Guo R, Quarles LD 1997 Cloning and sequencing of human Pex from a bone cDNA library: evidence for its developmental stage-specific regulation in osteoblasts. J Bone Miner Res 12:1009–1017[CrossRef][Medline]
  4. Blydt-Hansen TD, Tenenhouse HS, Goodyer P 1999 Phex expression in parathyroid gland and parathyroid hormone dysregulation in x-linked hypophosphatemia. Pediatr Nephrol 13:607–611[Medline]
  5. Beck L, Soumounou Y, Martel J, et al. 1997 Pex/Pex tissue distribution and evidence for a deletion in the 3' region of the Pex gene in X-linked hypophosphatemic mice. J Clin Invest 99:1200–1209[Medline]
  6. Lipman ML, Pandab D, Hugh PJ, et al. 1998 Cloning of human Pex cDNA: expression, subcellular localization, and endopeptidase activity. J Biol Chem 273:13729–13737[Abstract/Free Full Text]
  7. Hruska KA, Rifas L, Cheng SL, Gupta A, Halstead L, Avioli L 1995 X-linked hypophosphatemic rickets and the murine Hyp homologue. Am J Physiol 268:F357–F362
  8. Nesbitt T, Coffman TM, Griffiths R, Drezner MK 1992 Cross transplantation of kidneys in normal and Hyp mice. Evidence that the Hyp mouse phenotype is unrelated to an intrinsic renal defect. J Clin Invest 89:1453–1459
  9. Nesbitt T, Econs MJ, Byun JK, Martel J, Tenenhouse Jr HS, Drezner MK 1995 Phosphate transport in immortalized cell cultures from the renal proximal tubule of normal and Hyp mice: evidence that the Hyp gene locus product is an extrarenal factor. J Bone Miner Res 10:1327–1333[Medline]
  10. Xiao ZS, Crenshaw M, Guo R, Nesbitt T, Drezner MK, Quarles LD 1998 Intrinsic mineralization defect in Hyp mouse osteoblasts. Am J Physiol 275:E700–E708
  11. Ecarot B, Glorieux FH, Desbarats M, Travers R, Labelle L 1992 Defective bone formation by Hyp mouse bone cells transplanted into normal mice: evidence in favor of an intrinsic osteoblast defect. J Bone Miner Res 7:215–220[Medline]
  12. Miyamura T, Tanaka H, Inoue M, Ichinose Y, Seino Y 2000 The effects of bone marrow transplantation on X-linked hypophosphatemic mice. J Bone Miner Res 15:1451–1458[CrossRef][Medline]
  13. Alos N, Ecarot B 2000 In vitro and in vivo down regulation of osteoblastic Phex expression by PTH. J Bone Miner Res 15:s211
  14. Meyer MH, Meyer Jr RA 2000 mRNA expression of Phex in mice and rats: the effect of low phosphate diet. Endocrine 13:81–87[CrossRef][Medline]
  15. Miao D, Bai X, Panda DK, Karaplis AC, Goltzman D, McKee MD 2000 Cartilage abnormalities are associated with abnormal Phex expression and altered matrix protein and MMP-9 expression in Hyp mice. J Bone Miner Res 15:s474
  16. Francis F, Strom TM, Hennig S, et al. 1997 Genomic organization of the human Pex gene mutated in X-linked dominant hypophosphatemic rickets. Genome Res 7:573–585[Abstract/Free Full Text]
  17. Zehentner GK, Dony C, Burtscher H 1999 The transcription factor sox9 is involved in BMP-2 signaling. J Bone Miner Res 14:1734–1741[CrossRef][Medline]
  18. Quarles LD, Siddhanti SR, Medda S 1997 Developmental regulation of osteocalcin expression in MC3T3–E1osteoblasts: minimal role of the proximal E-box cis-acting promoter elements. J Cell Biochem 65:11–24[CrossRef][Medline]
  19. Quarles LD, Hartle II JE, Siddhanti SR, Guo R, Hinson TK 1997 A distinct cation-sensing mechanism in MC3T3–E1 osteoblasts functionally related to the calcium receptor. J Bone Miner Res 12:393–402[CrossRef][Medline]
  20. Grigoriadis AE, Aubin JE, Heersche JN 1989 Effects of dexamethasone and vitamin D3 on cartilage differentiation in a clonal chondrogenic cell population. Endocrinology 125:2103–2110[Abstract]
  21. Lefebvre V, Huang W, Harley VR, Goodfellow PN, de Crombrugghe B 1997 SOX9 is a potent activator of the chondrocyte-specific enhance of the pro{alpha}1(II) collagen gene. Mol Cell Biol 17:2336–2346[Abstract]
  22. Xiao ZS, Hinson TK, Quarles LD 1999 Cbfa1 isoform overexpression up-regulates osteocalcin gene expression in non-osteoblastic and pre-osteoblastic cells. J Cell Biochem 74:596–605[CrossRef][Medline]
  23. Drouin J, Trifiro MA, Plante RK, Nemer M, Eriksson P, Wrange O 1989 Glucocorticoid receptor binding to a specific DNA sequence is required for hormone-dependent repression of pro-opiomelanocortin gene transcription. Mol Cell Biol 9:5305–5314[Abstract/Free Full Text]
  24. Pontiggia A, Rimini R, Harley VR, Goodfellow PN, Lovell-Badge R, Bianchi ME 1994 Sex-reversing mutations affect the architecture of SRY-DNA complexes. EMBO J 13:6115–6124[Medline]
  25. Merika M, Orkin SH 1993 DNA-binding specificity of GATA family transcription factors. Mol Cell Biol 13:3999–4010[Abstract/Free Full Text]
  26. Mermod N, Williams TJ, Tjian R 1988 Enhancer binding factors AP-4 and AP-1 act in concert to activate SV40 late transcription in vitro. Nature 332:557–561[CrossRef][Medline]
  27. Morris JF, Hromas R, Rauscher III FJ 1994 Characterization of the DNA-binding properties of the myeloid zinc finger protein MZF1: two independent DNA-binding domains recognize two DNA consensus sequences with a common G-rich core. Mol Cell Biol 14:1786–1795[Abstract/Free Full Text]
  28. Mertin S, McDowall SG, Harley VR 1999 The DNA-binding specificity of SOX9 and other SOX proteins. Nucleic Acids Res 27:1359–1364[Abstract/Free Full Text]
  29. Ephrussi A, Church GM, Tonegawa S, Gilbert W 1985 B lineage-specific interactions of an immunoglobulin enhancer with cellular factors in vivo. Science 227:134–140[Abstract/Free Full Text]
  30. Sekido R, Murai K, Funahashi J, et al. 1994 The delta-crystallin enhancer-binding protein delta EF1 is a repressor of E2-box-mediated gene activation. Mol Cell Biol 14:5692–5700[Abstract/Free Full Text]
  31. Unk I, Kiss-Toth E, Boros I 1994 Transcription factor AP-4 participates in activation of bovine leukemia virus long terminal repeat by p34 Tax. Nucleic Acids Res 22:4872–4875[Abstract/Free Full Text]
  32. Mantovani R 1998 A survey of 178 NF-Y binding CCAAT boxes. Nucleic Acids Res 26:1135–1143[Abstract/Free Full Text]
  33. Milos PM, Zaret KS 1992 A ubiquitous factor is required for C/EBP-related proteins to form stable transcription complexes on an albumin promoter segment in vitro. Genes Dev 6:991–1004[Abstract/Free Full Text]
  34. Kunsch C, Ruben SM, Rosen CA 1992 Selection of optimal {kappa}B/Rel DNA-binding motifs: interaction of both subunits of NF-{kappa}B with DNA is required for transcriptional activation. Mol Cell Biol 12:4412–4421[Abstract/Free Full Text]
  35. Wadman IA, Osada H, Grutz GG, et al. 1997 The LIM-only protein LMO2 is a bridging molecule assembling an erythroid, DNA-binding complex which includes the TAL1, E47, GATA-1 and LDB1/NLI proteins. EMBO J 16:3145–3157[CrossRef][Medline]
  36. Chen CY, Schwartz RJ 1995 Identification of novel DNA binding targets and regulatory domains of a murine tinman homeodomain factor, NKX-2.5. J Biol Chem 270:15628–15633[Abstract/Free Full Text]
  37. Blackwell TK, Bowerman B, Priess JR, Weintraub H 1994 Formation of a monomeric DNA binding domain by Skn-1 bZIP and homeodomain elements. Science 266:621–628[Abstract/Free Full Text]
  38. Merika M, Orkin SH 1993 DNA-binding specificity of GATA family transcription factors. Mol Cell Biol 13:3999–4010
  39. Tamura TA, Sumita K, Hirose S, Mikoshiba K 1990 Core promoter of the mouse myelin basic protein gene governs brain-specific transcription in vitro. EMBO J 9:3101–3108[Medline]
  40. Meyers S, Downing JR, Hiebert SW 1993 Identification of AML-1 and the 8;21 translocation protein (AML-1/ETO) as sequence-specific DNA-binding proteins: the runt homology domain is required for DNA binding and protein-protein interactions. Mol Cell Biol 13:6336–6345[Abstract/Free Full Text]
  41. Hines ER, Colling JF, Ghishan FK 2000 Molecular cloning of the murine Phex gene promoter (1). Biochim Biophys Acta 1493:333–336[Medline]
  42. Ecarot B, Desbarats M 1999 1,25-(OH)2D3 down-regulates expression of Phex, a marker of the mature osteoblast. Endocrinology 140:1192–1199[Abstract/Free Full Text]
  43. Kent J, Wheatley SC, Andrews JE, Sinclair AH, Koopman P 1996 A male-specific role for SOX9 in vertebrate sex determination. Development 122:2813–2822[Abstract]
  44. Komori T, Yagi H, Nomura S, et al. 1997 Targeted disruption of Cbfa1 results in a complete lack of bone formation owing to maturational arrest of osteoblasts. Cell 89:755–764[CrossRef][Medline]
  45. Ambrosetti D-C, Basilico C, Dailey L 1997 Synergistic activation of the fibroblast growth factor 4 enhancer by Sox2 and Oct-3 depends on protein-protein interactions facilitated by a specific spatial arrangement of factor binding sites. Mol Cell Biol 17:6321–6329[Abstract]
  46. Lefebvre V, Li P, de Crombrugghe B 1998 A new long form of Sox5 (L-Sox5), Sox6 and Sox9 are coexpressed in chondrogenesis and cooperatively activate the type II collagen gene. EMBO J 17:5718–5733[CrossRef][Medline]
  47. Montecino FB, Stein JL, Lian JB, Stein GS 1994 A composite intragenic silencer domain exhibits negative and positive transcriptional control of the bone-specific osteocalcin gene: promoter and cell type requirements. Proc Natl Acad Sci USA 91:10923–10927[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Am. Soc. Nephrol.Home page
S. Liu, W. Tang, J. Zhou, J. R. Stubbs, Q. Luo, M. Pi, and L. D. Quarles
Fibroblast Growth Factor 23 Is a Counter-Regulatory Phosphaturic Hormone for Vitamin D
J. Am. Soc. Nephrol., May 1, 2006; 17(5): 1305 - 1315.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
L. Wang, S. Liu, L. D. Quarles, and R. F. Spurney
Targeted overexpression of G protein-coupled receptor kinase-2 in osteoblasts promotes bone loss
Am J Physiol Endocrinol Metab, April 1, 2005; 288(4): E826 - E834.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. R. Hines, O. I. Kolek, M. D. Jones, S. H. Serey, N. B. Sirjani, P. R. Kiela, P. W. Jurutka, M. R. Haussler, J. F. Collins, and F. K. Ghishan
1,25-Dihydroxyvitamin D3 Down-regulation of PHEX Gene Expression Is Mediated by Apparent Repression of a 110 kDa Transfactor That Binds to a Polyadenine Element in the Promoter
J. Biol. Chem., November 5, 2004; 279(45): 46406 - 46414.
[Abstract] [Full Text] [PDF]


Home page
Crit. Rev. Oral Biol. Med.Home page
P. S.N. Rowe
THE WRICKKENED PATHWAYS OF FGF23, MEPE AND PHEX
Crit. Rev. Oral. Biol. Med., September 1, 2004; 15(5): 264 - 281.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Biol.Home page
P. Blache, M. van de Wetering, I. Duluc, C. Domon, P. Berta, J.-N. Freund, H. Clevers, and P. Jay
SOX9 is an intestine crypt transcription factor, is regulated by the Wnt pathway, and represses the CDX2 and MUC2 genes
J. Cell Biol., July 5, 2004; 166(1): 37 - 47.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
A. J. Brewer, L. Canaff, G. N. Hendy, and H. S. Tenenhouse
Differential regulation of PHEX expression in bone and parathyroid gland by chronic renal insufficiency and 1,25-dihydroxyvitamin D3
Am J Physiol Renal Physiol, April 1, 2004; 286(4): F739 - F748.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
E. R. Hines, J. F. Collins, M. D. Jones, S. H. Serey, and F. K. Ghishan
Glucocorticoid regulation of the murine PHEX gene
Am J Physiol Renal Physiol, August 1, 2002; 283(2): F356 - F363.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Liu, S.
Right arrow Articles by Quarles, L. D.