| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLES |
Department of Medicine, Duke University Medical Center, Durham, North Carolina 27710
Address all correspondence and requests for reprints to: L. D. Quarles, M.D., Duke University Medical Center, P.O. Box 3036, Durham, North Carolina 27710. E-mail: Quarl001{at}mc.duke.edu
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Limited information is available regarding the regulation of Phex. Given its role in systemic phosphate homeostasis and skeletal mineralization, and the multitude of factors regulating mineral ion homeostasis, such as age, sex, diet, PTH, and vitamin D, it is likely that Phex expression is regulated (2). Recent studies demonstrate that Phex expression in bone is increased by IGF-I and down-regulated by PTH administration and aging (13). Other studies indicate that a low phosphorus diet increases Phex transcripts in the pituitary gland but not in bone as assessed by semiquantitative RT-PCR analysis (14). In the skeleton, Phex is one of a group of cell-restricted genes that displays a late developmental expression pattern in mineralizing bone and cartilage, where this endopeptidase is predominantly expressed in mature osteoblasts and hypertrophic chondrocytes that are involved in regulation mineralization of extracellular matrix (3, 10, 15). Thus, cell-type and/or tissue-specific factors are likely responsible for the restricted pattern of Phex expression. Additional studies are needed to characterize molecular mechanisms of cell-type and tissue-specific expression of Phex and its regulation by factors controlling mineral homeostasis. Identification and characterization of the Phex gene promoter are important steps in defining the role of transcriptional regulation of the Phex gene.
In the current studies, we describe the cloning, sequencing, and functional analysis of the murine Phex promoter. We found that osteoblasts and chondrocytes express Phex endogenously and have the trans-acting factors necessary to direct transcription of the transfected Phex promoter. In contrast, COS-7 cells lack the necessary transcriptional machinery needed for Phex expression, suggesting that regulatory regions of the murine Phex promoter may function in a cell-specific manner. SOX9, a master regulatory factor for chondrocyte differentiation, stimulated the promoter activity, whereas the osteoblastic differentiation factor Cbfa1 had no effect on Phex promoter activity. We failed to identify either 1,25(OH)2D3 or PTH regulation of the transfected Phex promoter, suggesting any effects of these agents on Phex may not be mediated by transcriptional mechanisms or that the Phex promoter region lacks the necessary regulatory elements.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-32P dCTP (800Ci/mmol) using a
random primer DNA labeling kit (Life Technologies, Inc.,
Grand Island, NY). Plaque lifting, prehybridization, hybridization,
washing of the filters, and autoradiography were performed by standard
methods. Nine positive clones were identified after screening 1 x
106 pfu at a density of 5 x
104 pfu/plate. Putative positive clones were
purified by secondary and tertiary rounds of screening. Restriction
digests with Nsi I and Southern blot analysis with the exon
1 cDNA probe identified two clones containing identical 5'-flanking
regions. A 12-kb fragment was released from this phage clone and
partially sequenced, revealing 1104 bp of intron 1, 674 bp exon 1, and
approximately 10.2 kb of the 5'-flanking sequence. This promoter
sequence has been entered in GenBank, accession number AF299334. The promoter analysis program Neural Network Promoter Prediction (http://www.fruitfly.org/seq_tools/promoter.html) was used to predict the transcription start site. The promoter sequence was analyzed by the Transcription Element Search System (TESS of the Computational Biology and Informatics Laboratory, School of Medicine, University of Pennsylvania, http://agave.humgen.upenn.edu/tess/index.html) by using a 6-bp minimum element size limit, a 5% mismatch allowance, a minimum log-likelihood of homology of 10, and a secondary log-likelihood density threshold of 1.6. Further analysis of the promoter sequence was conduced using TFSEARCH (http://pdap1.trc.rwcp.or.jp/research/db/TFSEARCH.html). In addition, we used the sequence information from the mouse Phex promoter and Blast analysis (http://www.ncbi.nlm.nih.gov/BLAST/) to identify the corresponding region of the human promoter (accession number Y10196) (16). The respective regions of the mouse Phex and human PHEX promoter were compared using TRES Transcription Regulatory Element Search, a tool for Comparative Promoter Analysis (http://www.bic.nus.edu.sg:8888/tres/) and BestFit analysis.
RT-PCR analysis
RT-PCR was performed using a two-step RNA PCR kit
(Perkin-Elmer Corp., Branchburg, NJ). DNase-treated total
RNA (2.5 µg) was reverse transcribed into cDNA in a total volume of
50 µl with random primers. The RT reaction was incubated at 42 C for
15 min. The resulting cDNA was PCR amplified using various sets of
primers. Forward primers included Phex-22F
(5'-GGGACTAACACACTGAAAGAGT-3') and Phex+1F
(5'-AACTTTTGACGACGACAGTTCA-3'). The reverse primer was
Phex+697R (5'-GAAACTTAGGAGACCTTGAC-3'), located in exon 2.
PCR was performed with thermal cycling parameters of 94 C for 30 sec,
60 C for 30 sec, and 72 C for 60 sec for 35 cycles, followed by a final
extension at 72 C for 7 min. For evaluation of Phex
expression in different cell lines, we used the forward primer
Phex+1866F (5'-AATTGATTGAGGGTGTTCGC-3') and the reverse
primer Phex+2943R (5'-ACCCAAATAATGAAAATGCA-3). For RT-PCR
analysis of 4 and 9-d-old MC3T3-E1 osteoblasts, we used
Phex-specific primers Phex+1419F
(5'-TTGGCAAAAGTTGGCTATCCAG-3') and Phex+965R
(5'-TATCCATTTCCTGTAAGCCC-3') as described previously (3).
Samples without RT treatment were analyzed as controls. For evaluation
of SOX9 expression, we used the forward primer
5'-ATCTGAAGAAGGAGGAGCGAG-3' and the reverse primer
5'-TCAGAAGTCTCCAGAGCTTG-3', which are to regions conserved across
species including mouse and primates (17).
Glyceraldehyde-3-phosphate dehydrogenase (G3PDH) or mouse
ß-actin were amplified as controls for the amounts and integrity of
RNA in the PCR reactions. RT-PCR products were identified by
autoradiography using radiolabeled Phex and ß-actin cDNA
probes as described previously (3) or by ethidium bromide
staining.
RNase protection analysis
RNase protection assays were used to estimate the
Phex mRNA transcription start site. The riboprobe (-130,
+132) consisted of a 262-bp fragment of the mouse Phex
subcloned into pBSK(-) (Stratagene). Single-stranded
antisense radiolabeled RNA probes were transcribed from
BamHI linearized Phex 262/pBSK(-) using T7 RNA
polymerase and [32P-]UTP (NEN Life Science Products, Boston, MA). The riboprobe was purified
on a 6% polyacrylamide gel. RNase protection assays were conducted
using the RPA III kit (Ambion, Inc., Austin, TX). Twenty
micrograms of total RNA from each cell line and the labeled riboprobe
(100,000 cpm) were precipitated, redissolved in 10 µl Hybridization
III Buffer and incubated overnight at 42 C. Products were digested with
RNase A/RNase T1 mix (1:100 dilution) for 30 min, and the protected RNA
fragments were separated on a 5% denaturing polyacrylamide gel. The
resultant products were assessed by autoradiography using BioMax MS
film at -70 C.
Cell culture
ROS17/2.8 osteoblasts were grown in a 1:1 mixture of DMEM and
Nutrient Mixture F-12 (Life Technologies, Inc.), as
described previously (18). The MC3T3-E1 osteoblast cell
line was grown in -MEM (Life Technologies, Inc.) and
was grown in -MEM supplemented with 0.13 mM ascorbic
acid and 5 mM ß-glycerol phosphate for differentiation,
as described previously (18). COS-7 cells were maintained
in DMEM (Life Technologies, Inc.) (19). C5.18
chondrocytes (20) were provided by Dr. Jane E. Aubin
(University of Toronto, Toronto, Canada) and maintained in -MEM
containing 15% FBS. All cell lines, except C5.18, were supplemented
with 10% (vol/vol) FBS. All cultures were supplemented with 100
µg/ml penicillin and streptomycin and cultured in a humidified
incubator with 5% CO2 at a temperature of 37
C.
Preparation of constructs
To generate the Phex reporter gene constructs, 2790
bp of the genomic fragment from -2736 to +54 of Phex was
amplified with PCR SuperMix High Fidelity (Life Technologies, Inc.) using a set of primers (-2736 F,
5'-GGGGTACCGCCAGTGGGGTCTTGTATGT; +54 R,
5'-GGGGTACCAGATTTCTGCTATGACAGCC), and the resultant product was
subcloned into KpnI site of pGL2-Basic vector named
p2736Phex-luc. Sequentially, 5'-deletion with different
primers generated constructs from -2736 to -22, including
p1606Phex-luc with primer -1606 F,
5'-GGGGTACCATGCATTTGCTGTCACATAT; p964Phex-luc with primer -964 F,
5'-GGGGTACCTGGTTAAGATATGTTAGG; p472Phex-luc with primer
-472 F, 5'-GGGGTACCCTTAATCCTCAGGAAGCT; p178Phex-luc with
primer -178 F, 5'-GGGGTACCAGTTCCAGTCCAAACCATCA;
p130Phex-luc with primer -130 F, 5'-
GGGGTACCTTGCACTGCAATGGACTATG; and p22 F with primer
-22 F, 5'-GGGGTACC- GGGACTAACACACTGAAAGAGT. We used the
previously described SOX9 (21) and the Cbfa1
mammalian expression constructs (22).
Transient transfection and reporter assays
Transient transfection experiments were performed using the
TransFast Reagent (Promega Corp., Madison, WI) as
described previously (22). Briefly, cells were plated at a
density of 1.5 x 105 cells/well in 6-well
plates 16 h before transfection. We used 1.0 µg Phex
promoter constructs and 0.25 µg pSV ß-galactosidase, and in
cotransfection experiments we added 0.5 µg SOX9 or Cbfa1
expression constructs. Luciferase activity was measured using the
Luciferase Assay Kit (Promega Corp.). ß-
Galactosidase activity was measured by ß-Galactosidase Enzyme
Assay System (Promega Corp.). For the transient
transfection studies, the luciferase activity was normalized by
ß-galactosidase activity by dividing luciferase activity by ß-gal.
The relative luciferase activity was then calculated by dividing the
normalized luciferase activity by that obtained with the empty
pGL2-Basic vector. We observed higher ß-gal activity in Cos-7 cells,
but this did not influence the relative comparisons between cell lines.
For stable transfection studies in MC3T3-E1 osteoblasts, the luciferase
activity was normalized for cell number by dividing luciferase activity
by DNA content. The relative luciferase activity was then calculated by
dividing the normalized luciferase activity by that obtained with the
MC3T3-E cells stably transfected with the empty pGL2-Basic vector. For
the stimulation studies, cells were incubated in serum-free medium
containing 0.1%BSA for 24 h before adding different concentration
of various reagents, including PTH 1–34, forskolin,
12-O-tetradecanoylphorbol-13-acetate (TPA;
Sigma, St. Louis, MO), and
1,25(OH)2D3, as described
previously (17). We previously have determined the
concentration of PTH and forskolin to stimulate cAMP and the
concentration of TPA to stimulate PKC activity in osteoblasts (data not
shown).
Stable transfection of MC3T3-E1 with Phex promoter/luciferase
reporter construct
Stable transfection of MC3T3-E1 was performed by a pooled
protocol as described previously (18). MC3T3 cells were
cotransfected with p2736Phex-luc and pSV2-neo in a 15:1 molecular
ratio. Transfectants were selected in the presence of 700 µg/ml G418
for 14 d. The cells were plated in -MEM complemented with
ascorbic acid and ß-glycerol phosphate. The luciferase activities
were measured on different days using the Luciferase Assay Kit
(Promega Corp.). Total DNA content was determined using
Picogreen dsDNA Quantitation Reagent and Kits (Molecular Probes, Inc., Eugene, OR).
Statistical analysis
We evaluated differences between groups by one-way ANOVA.
All values are expressed as mean ± SEM. All
computations were performed using the Statgraphic statistical graphics
system (STSC, Inc., Rockville, MD).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
). RT-PCR
and RNase protection analysis (Fig. 2)
demonstrated that exon 1 contains 556 bp of the 5' UTR and evidence for
TATA- containing promoter in the 2736 bp of upstream sequence (Fig. 1). Using computer prediction programs, we initially located the
putative transcription start site 556 bp upstream of the ATG in exon 1.
We performed RNase protection to confirm the location of the
transcription start site (Fig. 2A). Using a riboprobe (-130, +132),
which contained 262 oligonucleotides overlapping the putative start
site, we identified a single 132 bp protected fragment in both mature
MC3T3-E1 and TM-Ob osteoblasts. To provide additional evidence for the
location of the transcription start site, we performed RT-PCR using
intron-spanning primers flanking the initiation sites and RNA derived
from differentiated, Phex-expressing MC3T3-E1 osteoblasts
(Fig. 2B). Forward primer +1 F in combination with the reverse primer
+697 R in exon 2 generated the predicted size product. In contrast, the
upstream primer -22 F in combination with +697 R did not amplify any
product, indicating that transcription initiation begins in the segment
flanked by primers -22 F and +1 F (Fig. 2B). Consistent with the
designated start site, we found a consensus TATA-box at position -32
to -23 from the transcription start site (Fig. 1).
|
|
Cell specificity and abundance of Phex mRNA
Before proceeding with the functional analysis of the 5'-flanking
region of the Phex gene, we identified
Phex-expressing and -nonexpressing cells. By RNase
protection analysis we confirmed the osteoblast expression and
differentiation stage dependency of Phex expression (Fig. 2A
and Fig. 3). We detected a high level of
Phex expression by RNase protection assay in mature
MC3T3-E1(14 d of culture) and TM-Ob (15 d of culture) osteoblasts, but
failed to detect Phex transcripts in NIH3T3 fibroblasts and
undifferentiated TM-Ob cells cultured for 5 d. Using RT-PCR
analysis, we detected Phex transcripts in differentiated
MC3T3-E1 osteoblasts, C5.18 chondrocytes and ROS17/2.8 osteosarcoma
cells, but not in COS-7 cells (Fig. 3).
|
). Progressive 5'-deletion mutations of
the promoter revealed a bimodal pattern of functional activity in
transiently transfected ROS17/2.8 cells (Fig. 4). The full-length
promoter construct (-2736/+54) was active in ROS 17/2.8 cells, and
displayed a progressive reduction in promoter activity as the
5'-deletion mutations approached 1606 bp, relative to the transcription
start site. Further deletions from 1606 to 946 bp, however, lead to an
increase in promoter activity that exceed that of the full-length
promoter. Successive deletions from -946 bp lead to a progressive
reduction in promoter activity in ROS17/2.8 cells, resulting in a near
complete ablation with -22/+54 construct.
|
). Because
Phex is strongly expressed in osteoblasts and chondrocytes
but is not expressed in COS-7 cells, these two Phex promoter
constructs were transiently transfected into these three different cell
lines. The full-length promoter construct (-2763/+54) was expressed to
a higher extent (approximately 3-fold) in C5.18 chondrocytes compared
with COS-7 cells. The expression was also significantly greater in ROS
17/2.8 osteosarcoma cells compared with COS-7 cells, but was
quantitatively less than expected from the level of Phex mRNA in
osteoblasts (Fig. 3). In all three cell lines, the overall activity of
the (2736/+54) construct was lower than that observed with the
truncated promoter construct (-946/+54). Indeed, deletion of the
initial 1789 bp of the promoter resulted in nearly a 3-fold increase in
promoter activity in C5.18 chondrocytes and nearly a 2-fold activity in
ROS17/2.8 osteosarcoma cells and COS-7 cells. These findings suggest
that the distal region of the promoter from -946 to -2736 contains
inhibitory elements and the proximal 946 bp of the promoter has
regulatory elements that contribute to the differential expression of
Phex between osteoblasts, chondrocytes and nonosteoblastic
cell lines. The results in COS-7 cells need to be interpreted with
caution, because they may not simply reflect the nonosteoblastic
phenotype of the cells, but the effects of their expression of SV40 T
antigen.
|
). SOX9
overexpression in C5.18 chondrocytes, ROS17/2.8 osteosarcoma cells, and
COS-7 cells enhanced by approximately 6-, 4-, and 3-fold, respectively,
the transcriptional activity of the full-length Phex
promoter. In contrast, SOX9 failed to stimulate activity above the
control plasmid using the (-946/+54) construct (Fig. 6B). These
observations suggest that SOX9 may regulate Phex gene
transcription through upstream SRY-like elements, possibly at positions
-2340, and -2199 (23). Additional studies will be needed
to confirm the importance of the putative SRY sites and identify the
transcription factors that bind to them. Other factors also are likely
to be involved in mediating the preferential expression of
Phex in chondrocytes. Indeed, SOX9 mRNA was detected in all
three cell lines (Fig. 6C), but its ability to up-regulate promoter
activity was greatest in chondrocytes. In addition, the unexpected high
activity of the Phex promoter in COS-7 cells may be
explained by their high level of endogenous SOX9 transcripts.
|
), none of these factors stimulated Phex promoter activity
(data not shown). In particular, we observed no stimulation by
cotransfecting the Cbfa1 expression plasmid
(22) with the Phex promoter, whereas this
Cbfa1 expression plasmid has been previously used by us to
stimulate an osteocalcin promoter construct (22).
Similarly, 1,25(OH)2D3 at
concentrations that stimulated an osteocalcin promoter construct failed
to stimulate the Phex promoter construct in ROS17/2.8 (Fig. 7) or MC3T3-E1 osteoblasts. PTH at
concentration ranging from 5–100 nM as well as
the addition of calcium to the media at concentrations ranging from
1–5 mM also failed to stimulate Phex
promoter activity in ROS17/2.8 cells (data not shown). Finally, neither
stimulation of cAMP by forskolin at a dose ranging from
10-7 to 10-5M, or activation of PKC by treatment of cells
with TPA at concentrations of 0.16 µM and 1.6
µM stimulated the Phex promoter
construct in MC3T3-E1 osteoblasts (data not shown).
|
). We found that
Phex promoter activity relative to the empty vector alone
increased during this maturation period, paralleling the culture
duration dependent up-regulation of endogenous Phex mRNA in
these cells (Fig. 8B).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
). We have begun investigations with
the murine Phex promoter to determine the role that
transcriptional regulation plays in the cell type-specific and hormonal
regulation of Phex. To date, our analysis of the
Phex promoter identifies three important features, namely
the presence of transcriptional control of cell-restricted expression,
a bimodal pattern of functional activity in 5' deletion mutants
indicative of both positive and negative regulatory elements, and the
lack of regulation by several factors involved in calcium and
phosphate homeostasis.
Although the activity of this Phex promoter construct was
greater in the cell lines C5.18 chondrocytes and ROS 17/2.8 osteoblasts
that express Phex mRNA than nonexpressing COS-7 cells (Figs. 4 and 5), the difference in promoter activity was not as great as
expected based on the marked differences in Phex mRNA levels
in C5.18 and ROS 17/2.8 compared with COS-7 cells (Fig. 3). This is
especially true for ROS17/2.8, which express high levels of
Phex transcripts but have promoter activity only 50%
greater than nonspecific activity of the promoter observed in COS-7
cells. Thus, there may be additional elements outside the existing
Phex promoter construct or nontranscriptional mechanisms
that may account for the apparent disparity between the level of
Phex transcripts and promoter activity in ROS 17/2.8
osteoblasts. In addition, COS-7 cells, which are of the SV40
transformed monkey kidney cell line, may have high nonspecific activity
of the Phex promoter construct in the absence of endogenous
Phex expression, due to the transcriptional effects of the T
antigen or to the expression of SOX9, which is expressed in COS-7
kidney-derived cells (Fig. 6) as well as in the developing collecting
ducts of the metanephric kidney (42). Nevertheless,
complementary studies in MC3T3-E1 osteoblasts (Fig. 8) demonstrated
maturational stage-dependent expression of Phex
transcriptional activity (Fig. 2) that mirrors our previously reported
increase of Phex transcripts in mature osteoblasts (3, 43). Thus, the differential expression of the Phex
promoter in chondrocytes and MC3T3-E1 osteoblasts and to a lesser
extent in the ROS 17/2.8 osteoblasts, indicate that
cis-acting elements are present in the Phex
promoter necessary for its expression in skeletal cells. The finding of
Phex in cartilage-derived cells, similar to its expression
in osteoblasts, also further strengthens the association of
Phex expression and the process of mineralization of
extracellular matrix.
The high expression in skeletal cells lead us to investigate whether
transcription factors that regulate chondrogenesis and
osteoblastogenesis also regulate the Phex promoter. We
examined the effects on Phex promoter activity of SOX9, a
member of the family of SOX (SRY-type high mobility group
box) genes that plays central role in chondrogenesis (41),
and Cbfa1 (core-binding factor) gene (also known as Runx2),
a transcription factor that has a critical role in osteoblastic
differentiation (44). Consistent with the presence of
several putative SRY sites in the Phex promoter, we found
that cotransfection of SOX9 expression plasmid with the p2736
Phex-luc Phex promoter, but not the
p946Phex-luc promoter, resulted in an increase in
Phex promoter activity in all cells, indicating that the
chondrocyte and osteoblast cells as well as the kidney-derived cell
line COS-7 provide an environment to assess SOX9 effects. The response
was greater in C5.18 chondroctyes (Fig. 6). The fact that SOX9
collaborates with other transcription factors potentially explains its
greater effect in C5/18 chondrocytes (45, 46). Additional
studies will be needed to determine which of the several potential SRY
sites or other sites are important in mediating SOX9 effects and the
factors that cooperatively activate the Phex gene.
Unexpectedly, and despite the presence of a putative AML-1-binding site
at position -276 of the mouse (but not the human) promoter,
cotransfection of a Cbfa1 expression plasmid with the
-1606/+54 Phex promoter had no effect on Phex
promoter activity in ROS17/2.8. It is possible that other factors or
unique combinations of known factors direct the restricted expression
of Phex in osteoblasts.
Deletional analysis identified both positive and negative regulatory
elements in the murine Phex promoter (Fig. 4). Promoter
activity was altered in ROS17/2.8 osteosarcoma cells by progressive
5'-deletion mutations and was characterized by a bimodal pattern of
activity. The highest activity was observed with the -946/+54 promoter
construct. We found that deletions from -2736 to -1606 bp resulted in
a decrease in promoter activity, but further deletion from to -946 bp
restored promoter activity to their highest levels, consistent with the
presence of repressor elements between -2736 and -946. In this
region, we identified conserved sequences similar to the EF1 repressor
TGCCACCTGAGG at position -1643/-1632 (30) and the
osteocalcin gene silencer CCCCTNTCT at position -1985/-1977
(47). Further deletions from 946 to 22 bp resulted in
progressive loss of promoter activity. Significant promoter activity
was lost between 178 and 130 bp, suggesting that the region from 946 to
130 contains important positive cis-acting elements that
regulate Phex transcription. This region contained the
highest density of possible cis-acting elements conserved
between the mouse and human sequences. These included two C/EBP sites,
one C-Rel site, four SRY sites, two Nkx-2.5 sites, one AP-1 site, and
one GATA-1 site. Whether these sites bind transcription factors and
control Phex transcription will require further studies.
Finally, because of its role in the maintenance of normal serum
phosphate levels and skeletal mineralization, our a priori
hypothesis was that Phex gene transcription might be
modulated by factors controlling calcium and phosphate homeostasis. We
have been unable to demonstrate such regulation. PTH and
1,25(OH)2D3, two factors
important in regulating systemic phosphate homeostasis, failed to
affect the Phex promoter activity in ROS17/2.8 cells (Fig. 7) that have PTH receptors and respond to
1,25(OH)2D3 at the
concentrations used in this study. Despite potential AP-2 and c-REL
sites, neither TPA or forskolin increased the activity of the
Phex luciferase reporter gene in osteoblasts. These data
suggest that any effect of PTH and/or vitamin D to modulate
Phex expression may be indirect or involve elements outside
the 2.7-kb region.
In conclusion, we have confirmed the presence of a functional promoter in the 5'-flanking region of the murine Phex gene and have identified a corresponding homologous sequence in humans. Our initial characterizations of the murine Phex promoter are consistent with cell-type and maturational stage-specific transcriptional control but not control by hormones and other factors known to control phosphate homeostasis. The induction of promoter activity by SOX9 is consistent with the expression of Phex in chondrocytes. Our cell culture data, however, may not accurately reflect the physiological and in vivo regulation of Phex, and additional studies are needed to clarify the regulation of the promoter in a more physiologically relevant setting. Indeed, understanding the transcriptional regulation of Phex in osteoblasts as well as the location of particular cis-acting elements controlling Phex expression await further analysis that include assessment of protein/DNA interactions and testing Phex promoter function in the context of transgenic mice.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
Abbreviations: G3PDH, Glyceraldehyde-3-phosphate dehydrogenase; RT, reverse transcriptase; TPA, 12-O-tetradecanoylphorbol-13- acetate; UTR, untranslated region.
Received January 23, 2001.
Accepted for publication June 1, 2001.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
1(II) collagen gene. Mol Cell
Biol 17:2336–2346[Abstract]
B/Rel DNA-binding motifs: interaction of both subunits of
NF-B with DNA is required for transcriptional activation. Mol Cell
Biol 12:4412–4421This article has been cited by other articles:
 |
|
 |
|
  S. Liu, W. Tang, J. Zhou, J. R. Stubbs, Q. Luo, M. Pi, and L. D. Quarles Fibroblast Growth Factor 23 Is a Counter-Regulatory Phosphaturic Hormone for Vitamin D J. Am. Soc. Nephrol., May 1, 2006; 17(5): 1305 - 1315. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Wang, S. Liu, L. D. Quarles, and R. F. Spurney Targeted overexpression of G protein-coupled receptor kinase-2 in osteoblasts promotes bone loss Am J Physiol Endocrinol Metab, April 1, 2005; 288(4): E826 - E834. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. R. Hines, O. I. Kolek, M. D. Jones, S. H. Serey, N. B. Sirjani, P. R. Kiela, P. W. Jurutka, M. R. Haussler, J. F. Collins, and F. K. Ghishan 1,25-Dihydroxyvitamin D3 Down-regulation of PHEX Gene Expression Is Mediated by Apparent Repression of a 110 kDa Transfactor That Binds to a Polyadenine Element in the Promoter J. Biol. Chem., November 5, 2004; 279(45): 46406 - 46414. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. S.N. Rowe THE WRICKKENED PATHWAYS OF FGF23, MEPE AND PHEX Critical Reviews in Oral Biology & Medicine, September 1, 2004; 15(5): 264 - 281. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Blache, M. van de Wetering, I. Duluc, C. Domon, P. Berta, J.-N. Freund, H. Clevers, and P. Jay SOX9 is an intestine crypt transcription factor, is regulated by the Wnt pathway, and represses the CDX2 and MUC2 genes J. Cell Biol., July 5, 2004; 166(1): 37 - 47. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. J. Brewer, L. Canaff, G. N. Hendy, and H. S. Tenenhouse Differential regulation of PHEX expression in bone and parathyroid gland by chronic renal insufficiency and 1,25-dihydroxyvitamin D3 Am J Physiol Renal Physiol, April 1, 2004; 286(4): F739 - F748. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. R. Hines, J. F. Collins, M. D. Jones, S. H. Serey, and F. K. Ghishan Glucocorticoid regulation of the murine PHEX gene Am J Physiol Renal Physiol, August 1, 2002; 283(2): F356 - F363. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
