help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lazennec, G.
Right arrow Articles by Vignon, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lazennec, G.
Right arrow Articles by Vignon, F.
Endocrinology Vol. 142, No. 9 4120-4130
Copyright © 2001 by The Endocrine Society


ARTICLES

ERß Inhibits Proliferation and Invasion of Breast Cancer Cells

Gwendal Lazennec, Damien Bresson, Annick Lucas, Corine Chauveau and Françoise Vignon

INSERM U540 "Molecular and Cellular Endocrinology of Cancers," 34090 Montpellier, France

Address all correspondence and requests for reprints to: Dr Françoise Vignon or Dr. Gwendal Lazennec, INSERM U540 "Molecular and Cellular Endocrinology of Cancers," 60 rue de Navacelles, 34090 Montpellier, France. u540.montp.inserm.fr or lazennec{at}u540.montp.inserm.fr


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Recent studies indicate that the expression of ERß in breast cancer is lower than in the normal breast, suggesting that ERß could play an important role in carcinogenesis. To investigate this hypothesis, we engineered ER-negative MDA-MB-231 (human breast cancer cells) to reintroduce either ER{alpha} or ERß protein with an adenoviral vector. In these cells, ERß (as ER{alpha}) expression was monitored using RT-PCR and Western blot. ERß protein was localized in the nucleus (immunocytochemistry) and able to transactivate estrogen-responsive reporter constructs in the presence of E2. ERß and ER{alpha} induced the expression of several endogenous genes such as pS2, TGF{alpha}, or the cyclin kinase inhibitor p21 but, in contrast to ER{alpha}, ERß was unable to regulate c-myc proto-oncogene expression. The pure antiestrogen ICI 164, 384 completely blocked ER{alpha} and ERß estrogen-induced activities. ERß inhibited MDA-MB-231 cell proliferation in a ligand-independent manner, whereas ER{alpha} inhibition of proliferation is hormone dependent. Moreover, ERß and ER{alpha} decreased cell motility and invasion. Our data bring the first evidence that ERß is an important modulator of proliferation and invasion of breast cancer cells and support the hypothesis that the loss of ERß expression could be one of the events leading to the development of breast cancer.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
ESTROGENS MODULATE SEXUAL gland development and reproductive functions but have also beneficial effects on cardiovascular and nervous systems or bone integrity (1). Besides, estrogens are potent mitogens in the mammary gland in which they regulate the growth, development, and functioning of normal as well as cancerous breast (2, 3). Epidemiological evidences and numerous animal studies have indicated that estrogens play a role in the proliferation and progression of breast cancer; the removal of the ovaries or the treatment with antiestrogens opposes their deleterious effects (4, 5). Although there is growing evidence that estrogens can operate through nongenomic pathways (6, 7, 8), ERs, ER{alpha} (NR3A1), and ERß (NR3A2), which belong to a large family of nuclear receptors, are mediating the genomic action of estrogens by acting as ligand- dependent transcription factors (9, 10). Most human breast cancers, at least initially, express ER{alpha}, and the presence of ER{alpha} is generally considered as an indication of hormone dependence, even though only 60% of ER-positive tumors will respond to adjuvant therapy with tamoxifen (11).

Although ER{alpha} has been cloned over 10 yr ago (12), the presence of ERß has been unrecognized until recently (13, 14). ER{alpha} and ERß have diverged early during evolution (15) and differ mostly in the N-terminal A/B domain and to a lesser extent in the ligand-binding domain (E domain). These differences suggest that the two receptors could serve distinct actions. Indeed, the activation functions (AF)-1 and AF-2 located, respectively, in the A/B and ligand-binding domains display activities that are promoter and cell specific (16, 17, 18). Cowley and Parker (17) have shown that the AF-1 activity of ERß is weak, compared with that of ER{alpha} on estrogen-responsive reporters, whereas their AF-2 activities are similar. In turn, when both AF-1 and AF-2 functions are active in a particular cell and/or on a particular promoter, the activity of ER{alpha} greatly exceeds that of ERß, whereas ER{alpha} and ERß activities are similar when only AF-2 is required. The weaker activity of ERß in many promoter and cell contexts has also been reported by several groups (18, 19, 20).

Moreover, ER{alpha} and ERß knockout mice have generated and demonstrated striking different patterns (21, 22). ERß knockout mice show significantly reduced fertility in females, with ovaries exhibiting follicular arrest and anovulation. However, these mutant mice have a normal mammary gland development and lactation (21). On the contrary, ER{alpha} knock-out mice have an impaired fertility for both sexes and exhibit an estrogen-insensitive mammary gland and genital tract (22), suggesting possible overlapping and distinct action on the expression of genes regulating the important biological functions. Concerning the rodent mammary gland, both ERs are expressed in the rat mammary gland, but the presence and cellular distribution of the two receptors are distinct (23). In prepubertal rats, ER{alpha} is detected in 40% of the epithelial cell nuclei. During puberty and pregnancy, ER{alpha} expression is strongly decreased, whereas ER{alpha} is present in 70% of epithelial cells during lactation. About 60–70% of epithelial cells express ERß at all stages of breast development. Cells coexpressing both receptors represent up to 60% of the epithelial cells during lactation but are rare during pregnancy. Moreover, more than 90% of ERß-expressing cells do not proliferate (23).

In agreement with these observations, recent studies in humans indicate that the ERß expression is decreased between normal and neoplastic breast, colon, and ovarian cancer (24, 25, 26, 27, 28, 29, 30), suggesting that ERß could be an inhibitor of tumorigenesis. To test this hypothesis, we have engineered a receptor-negative breast cancer cell line to express functional ERß. In this cell line, ERß was able to activate the transcription of synthetic promoters in transient transfection experiments as well as natural endogenous promoters. Interestingly, ERß had major effects both on the proliferation, motility, and morphology of the cells, suggesting that ERß could effectively act as an inhibitor of breast cancer development.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Plasmids
The reporter plasmid ERE2-TK-CAT contains two copies of the consensus estrogen-responsive element (ERE) cloned upstream of the minimal herpes simplex virus thymidine kinase promoter. CMV-hER{alpha} and CMV-hERß correspond to the wild-type ER{alpha} and ERß cDNAs cloned into CMV5. A CMV-GAL reporter was used as an internal control and corresponds to the ß-galactosidase gene under the control of the cytomegalovirus (CMV) promoter.

Recombinant adenovirus construction and propagation
The complete coding sequence of wild-type human ER (hER) ß or hER{alpha} cDNAs were subcloned in BamHI site of the pACsk12CMV5 shuttle vector. To obtain recombinant viruses, permissive HEK-293 cells (human embryonic kidney cells) were cotransfected with the recombinant pACsk12CMV5-hER plasmid and with pJM17, which contains the remainder of the adenoviral genome as previously described (31, 32, 33). In vivo recombination of the plasmids generates infectious viral particles (adenovirus or recombinant adenovirus with hER{alpha} or ß [Ad-hER{alpha} or Ad-hERß]). DNA from these viruses was screened for the presence of the hER cDNA by PCR with hER primers, and titered virus stocks were used to infect MDA-MB-231 cells (human breast cancer cells).

Cell culture and transient transfection
HEK-293 cells were cultured in DMEM-F12 supplemented with 10% FCS in the presence of 5% CO2. MDA-MB-231 cells were cultured in Leibovitz L-15 medium containing 10% FCS, and 3.105 cells were plated in 6-well plates in phenol red-free DMEM-F12 supplemented with 10% CDFCS (charcoal dextran-treated FCS) 24 h before transfection. Transfections were performed by lipofection (lipofectamine, Life Technologies, Inc., Rockville, MD) using 4 µg of chloramphenicol acetyl transferase (CAT) reporter construct, 1 µg of the internal reference ß-galactosidase reporter plasmid (CMV-GAL), and CMV-hER expression vectors or recombinant viruses per well. Transactivation ability was determined by CAT activity on the whole-cell extract as previously described (34).

Whole-cell extract preparation and Western blot
MDA-MB-231 cells were lysed in 10 mM Tris-HCl, pH 7.4, 1.5 mM EDTA, and 10% glycerol containing protease inhibitors (5 µg/ml aprotinin, leupeptin and pepstatin A, and 0.1 mM phenylmethylsulfonyl fluoride). Then cells were sonicated and the cellular debris was pelleted by centrifugation at 13,000 x g for 20 min in Microfuge tubes. Forty-five micrograms whole-cell extract proteins were subjected to SDS-PAGE followed by electrotransfer onto a nitrocellulose membrane. The blot was probed with anti-hER{alpha} (SRA-1000) or hERß antibody (1:1000) (CWK-F12) (35) and then incubated with goat antimouse IgG horseradish peroxidase conjugated antibody (1 µg/ml). An ECL kit (Amersham Pharmacia Biotech, Arlington, IL) was used for detection.

Gel mobility shift assays
Briefly, 30,000 cpm of the [32P]-labeled (AGCTCTTTGATCAGGTCACTGTGACCTGACTTT) ERE double-strand oligonucleotide was combined with 1 µg poly (dI-dC) and 5 µg of MDA-MB-231 whole-cell extract. When indicated, anti-hER{alpha} (Stressgen, SRA-1000) or anti-hERß antibodies (CWK-F12), a kind gift of Professor B. S. Katzenellenbogen (35), were added. The reaction buffer contained 20 mM HEPES, pH 7.9; 1 mM DTT; 50 mM KCl; 10% glycerol; and 2.5 mM MgCl2. Protein-DNA complexes were separated from the free probe by nondenaturating gel electrophoresis with 4% polyacrylamide gels in 0.5x Tris/borate/EDTA.

Detection of ER{alpha} and ERß protein by immunocytochemistry
MDA-MB-231 cells were seeded in 10% CDFCS DMEM-F12 on sterile coverslips in 6-well plates and infected with the different adenoviruses. Forty-eight hours after infection, the cells were fixed (formaldehyde 3.7% 12 min/methanol 5 min/acetone 2 min) and washed with PBS. The coverslips were incubated for 30 min with PBS containing nonimmune rabbit serum (1:40). Then the cells were incubated with the primary antibody [ER{alpha}: SRA-1000 1:2000 (Stressgen); ERß: CWK-F12 1:3000] in PBS for 60 min at room temperature. The cells were then incubated with the secondary antibody (rabbit antimouse peroxidase conjugate, 13000, Sigma, St. Louis, MO) in PBS-bovine {gamma} globulin for 30 min at room temperature. Finally, the cells were incubated with a diaminobenzidine chromogen solution (0.66 mg/ml in PBS + 0.08% H2O2 [30 vol]) for 10 min at room temperature. The cells were counterstained with hematoxylin.

RNA isolation, Northern blot, and RT-PCR
Total RNA was isolated from MDA-MB-231 cells using the TRIzol reagent (Life Technologies, Inc.) as described by the manufacturer. Probes were amplified by RT-PCR using specific primers:

ER{alpha}: AAAAGACCGAAGAGGAGGGAGAAT/ATCCGGAACCGA GATGATGTAG,

ERß: GCCGCCCCATGTGCTGAT/GGACCCCGTGATGGAGGACTT,

c-myc: TACCCTCTCAACGACAGCAGCTCGCCCAAC/TCTTGACATTCTCCTCG GTGTCCGAGGACC

p21: CGAGTGGGGGCATCATCAAAAAC/TGTTACAGGAGCTG GAAGGTGTTTG,

pS2: TGACTCGGGGTCGCCTTTGGAG/GTGAGCCGAGGCACA GCTGCAG,

TGF{alpha}: CCTGTTCGCTCTGGGTATTGTGTTG/CGTGGTCCGCTGA TTTCTTCTCTAG).

Reverse transcription was performed using random primers and a GenAmp (Roche, Basel, Switzerland) RT-PCR kit. The amplifying primers are described above. The PCR was performed with Platinium Taq polymerase (Life Technologies, Inc.) and 1:40 of reverse transcription reaction. Cycles of 30 sec at 94 C, 1 min at 60 C, and 1.30 min at 72 C were done 29 times. A tenth of each PCR was electrophoresed on agarose gel. For Northern blot analysis, 20 µg total RNA were electrophoresed and then hybridized with the different probes.

Cell proliferation studies
Cells were maintained for 24 h in 10% CDFCS DMEM-F12 and then seeded at 30,000 cells/well in 24-well dishes in 10% CDFCS DMEM-F12. Cells were infected overnight with the different viruses. The next morning, the medium was removed and replaced with fresh 10% CDFCS DMEM-F12 medium. Treatment with E2 or ICI 164, 384 began at the same time. After 2, 4, or 6 d of E2, ICI 164, 384 or both compound treatments, the cells were trypsinized and counted using a Coultronics Coulter counter (DI model).

Wound-healing assay
Cells were plated in 6-well dishes in DMEM-F12 containing 5% CDFCS. Twenty-four hours after plating, the cells were infected with the different viruses overnight. The next morning, ethanol or E2 treatment started. After 20 h of treatment, wound-induced migration was triggered by scraping the cells at day 1 with a blue tip, and the wound was pictured immediately. Eighteen hours after the wound (d 2), the cells were pictured again. The percent of wound filling was calculated by measuring on the pictures the remaining gap space. The ratio of the gap space at d 2 over the gap space at d 1 gives the percentage of wound filling.

Invasion assay
MDA-MB-231 cells infected with nonrecombinant adenovirus (Ad5), Ad-hER{alpha}, or Ad-hERß (multiplicity of infection [MOI] 100) were plated 24 h after infection in the upper compartment of a 24-well Transwell (Corning-Costar, Corning, NY) on a polycarbonate filter (8 µm pore size) which was first coated with 30 µg of matrigel (Becton Dickinson and Co., Franklin Lakes, NJ). The lower compartment of the well was filled with DMEM-F12 supplemented with 10% CDFCS and 30 µg/ml fibronectin (Sigma). As a control, the same cells were layered on 24-well plates. Cells were treated with ethanol vehicle or E2 (10-8 M). After 36 h of migration, cells that had migrated to the lower side of the filter and cells present in the control plates were trypsinized and counted using a Coulter counter.

Morphology analysis
MDA-MB-231 cells were cultured in DMEM-F12 supplemented with 10% CDFCS. After infection with Ad5, Ad-hER{alpha}, or Ad-hERß (MOI 100), cells were treated with control vehicle ethanol or E2 (10-8 M) for 48 h and then pictured using a phase contrast microscope (Carl Zeiss, Le Pecq, France).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Adenoviruses elicit a high infection of MDA-MB-231 cells
Replication-deficient adenoviruses encoding hER{alpha} or hERß cDNA sequences were constructed and used to infect ER{alpha}-negative MDA-MB-231 cells (Fig. 1AGo). To control the efficiency of infection of MDA-MB-231 cells, we first treated the cells with an adenovirus coding for the ß-galactosidase protein (Fig. 1BGo). We observed a very efficient infection of the cells when increasing the MOI from 1 to 100, leading to an infection of about 80% of the cells at the highest MOI.



View larger version (36K):
[in this window]
[in a new window]
 
Figure 1. Schematic representation of adenovirus construction and high infection efficiency of MDA-MB-231 cells. A, Ad-hER{alpha} and Ad-hERß viruses were constructed as described in Materials and Methods using in vivo recombination in HEK-293 cells. The recombination occurs between the shuttle vector pACSK12-CMV5 carrying hER{alpha} or hERß cDNAs and pJM17 adenoviral sequences. B, MDA-MB 231 cells were grown in 6-well plates and infected overnight with no virus (A) or Ad-GAL virus at MOI 1 (B), 10 (C), or 25 (D), 50 (E), 100 (F). ß-Galactosidase activity was monitored after 48 h of expression. The upper panel corresponds to a picture of the entire plate and the lower panel to a 200-fold magnification of each well.

 
Adenoviral mediated expression of ER{alpha} and ERß
ER{alpha} and ERß expression was examined following infection of MDA-MB-231 cells (Fig. 2Go, A, B, and D). We could not detect any expression of ER{alpha} or ERß in MDA-MB-231 cells infected with the nonrecombinant virus Ad5 or in noninfected cells (data not shown). On the contrary, after infection with Ad-hERß virus, a high expression of ERß could be seen at RNA (Fig. 2AGo) and protein (Fig. 2BGo) levels. Similarly, expression of an equivalent amount of ER{alpha} was detected in Ad-hER{alpha}-infected cells (Fig. 2Go, A and B). To further check the functionality of the expressed ERß protein, we analyzed its ability to bind to an ERE DNA sequence by performing gel shift experiments (Fig. 2CGo). A specific binding could be seen only when ER{alpha} or ERß extracts were used (lanes 3 and 5). Moreover, the ERß-shifted complex had a faster migration rate than the ER{alpha} complex. The specificity of the shifted complex could be further demonstrated by using ER{alpha}- and ERß-specific antibodies (lanes 4 and 6). We then determined the cellular localization of ER{alpha}- and ERß-expressed proteins by immunocytochemistry (Fig. 2DGo). ER{alpha}- and ERß-infected cells displayed a clear and exclusive nuclear staining when using ER{alpha} and ERß antibodies, respectively. These data confirm our previous findings with ER{alpha} (31) and suggest that ERß protein is correctly expressed at RNA and protein levels in MDA-MB-231 cells, addressed to the nucleus, and able to bind to DNA.



View larger version (61K):
[in this window]
[in a new window]
 
Figure 2. Adenoviral expression of ER{alpha} and ERß in MDA-MB-231 cells. A, MDA-MB-231 cells were infected with the Ad5, Ad-hER{alpha}, or Ad-hERß viruses at MOI 100. After 1–48 h of treatment with 10-8 M E2, hER{alpha} and hERß expression was monitored by RT-PCR using primers located in the ligand-binding domain. The PCR products have a size of 542 bp and 703 bp for ER{alpha} and ERß, respectively. B, hER{alpha} and hERß protein expression was analyzed by Western blot using hER{alpha} ({alpha}Ab) or hERß (ßAb) specific antibodies. C, WCE from noninfected cells (C, lane 1), Ad5 (lane 2), Ad-hER{alpha} (hER{alpha}) (lanes 3–4), or Ad-hERß (hERß) (lanes 5–6) infected MDA-MB 231 cells were used for gel shift assay using a consensus ERE as a probe. Supershifts were performed using specific anti-hER{alpha} ({alpha}Ab) (lane 4) or anti-hERß (ßAb) (lane 6) antibodies. D, MDA-MB-231 cells were infected with Ad5, Ad-hER{alpha}, or Ad-hERß (hERß) at MOI 25, and ER{alpha} and ERß expression was visualized by immunocytochemistry using ER{alpha} ({alpha}Ab) and ERß (ßAb) specific antibodies.

 
ERß is able to activate estrogen-sensitive reporter genes
To further assess the functionality of the receptors produced, we analyzed their ability to transactivate estrogen-sensitive reporter genes (Fig. 3Go). As a control, we transfected regular plasmids encoding hER{alpha} or hERß along with the ERE2-TK-CAT reporter (Fig. 3AGo). We observed a strong activation of the reporter by ER{alpha} in the presence of E2. ERß was also able to activate the transcription in the presence of E2, but the stimulation was half that obtained with ER{alpha} (Fig. 3AGo). We then tested the ability of our recombinant Ad-hERß virus to activate the ERE2-TK-CAT reporter (Fig. 3BGo). When increasing MOI of Ad-hERß were used, a strong ligand- dependent activation of the reporter occurred, demonstrating that the adenovirally produced ERß exhibits a classical pattern of activation. However, at low MOI, ERß was less active than ER{alpha}, whereas the use of higher MOI of Ad-hERß virus elicited a good activation of the reporter. We then checked the sensitivity of ERß to estrogen stimulation (Fig. 3CGo). We observed a characteristic dose-response curve for ERß, similar to that obtained for ER{alpha}. A slight shift in the sensitivity to E2 was observed for ERß, which reached its maximal activity at 10-8 M, whereas ER{alpha} activity was maximal at 10-9 M. Similar results have been obtained by others showing that ERß has a weaker activity than ER{alpha} at low concentrations of E2 (36). To demonstrate that the expressed receptors were triggering estrogen effect, we analyzed their transactivation ability in the presence of the pure antiestrogen ICI 164, 384 (Fig. 3DGo). As expected, ICI 164, 384 could not stimulate ER{alpha} or ERß activity but completely shut down both the basal and E2-induced activities of both receptors, suggesting that the basal activity of both receptors was most probably owing to remaining traces of E2 in the stripped serum.



View larger version (20K):
[in this window]
[in a new window]
 
Figure 3. hER{alpha} and hERß can activate the transcription of estrogen-sensitive reporter genes. A, Empty CMV5 vector (CMV), CMV-hER{alpha} (hER{alpha}), or CMV-hERß (hERß) vectors were cotransfected in MDA-MB-231 cells with ERE2-TK-CAT reporter constructs and CMV-GAL internal reporter plasmid. Cells were grown for 36 h in the presence of control vehicle ethanol (C) or 10-8 M E2. Results are expressed as the percentage of CAT activity in noninfected cells (NI) and represent the mean ± SD (n = 5) of CAT activity after normalization for ß-galactosidase activity. B, NI cells or Ad5-, Ad-hER{alpha}-, or Ad-hERß-infected MDA-MB-231 cells were transfected with ERE2-TK-CAT and CMV-GAL reporter constructs. Increasing MOI of Ad-hER{alpha} and Ad-hERß viruses (0.1/1/10/100) were used. Cells were grown for 36 h in the presence of control vehicle ethanol (C) or 10-8 M E2. Results are expressed as the percentage of CAT activity in NI cells and represent the mean ± SD (n = 6) of CAT activity after normalization for ß-galactosidase activity. C, MDA-MB-231 cells were infected with Ad-hER{alpha} and Ad-hERß at MOI 100 and treated with increasing concentrations of E2. Results are expressed as the percentage of CAT activity in NI cells and represent the mean ± SD (n = 6) of CAT activity after normalization for ß-galactosidase activity. D, MDA-MB-231 cells were either transfected with empty CMV5 vector (CMV), CMV-hER{alpha} (hER{alpha}), or CMV-hERß (hERß) vectors or infected with Ad5, Ad-hER{alpha}, or Ad-hERß viruses along with ERE2-TK-CAT and CMV-GAL reporter constructs. Cells were grown for 36 h in the presence of control vehicle ethanol (C), 10-8 M E2, ICI 164, 384 (10-6 M), or the combination of E2 and ICI 164, 384 (10-8 M and 10-6 M, respectively). Results are expressed as the percentage of CAT activity in NI cells and represent the mean ± SD (n = 6) of CAT activity after normalization for ß-galactosidase activity.

 
ER{alpha} and ERß have common but also distinct target genes
Very little is known about the specific target genes of ERß. Therefore, we examined in these ERß-positive cells the expression of four genes, TGF{alpha}, p21, c-myc proto-oncogene, and pS2 genes, which are also regulated in ER{alpha}-infected cells in the presence of E2 (Fig. 4Go, A and B). ER{alpha} and ERß were able to activate the expression of pS2, p21, and TGF{alpha} genes in an estrogen-dependent manner. ERß was 2- to 3-fold less potent than ER{alpha} to stimulate pS2, p21, and TGF{alpha} expression than ER{alpha}. The pS2 activation was maximum at 48 h of E2 treatment for both receptors. For TGF{alpha} and p21 genes, the maximal activation was reached at 24 h for both receptors, suggesting that these genes exhibit an earlier response than pS2. Very interestingly, ER{alpha} almost completely abolished the expression of c-myc in the presence of E2, whereas ERß had no significant effect. These data suggest that ER{alpha} and ERß effects on target genes differ both in the amplitude of regulation and in the nature of the genes regulated. To evaluate whether antiestrogens could also modulate the expression of these genes, we performed the same experiments in the presence of ICI 164, 384, alone or in combination with E2 (Fig. 4CGo). ICI 164, 384 was able to decrease the basal level of expression of pS2, p21, and TGF{alpha} and, interestingly, completely reverse the induction of pS2, p21, and TGF{alpha} genes by E2 in ER{alpha}- and ERß-infected cells.



View larger version (41K):
[in this window]
[in a new window]
 
Figure 4. Modulation of endogenous gene expression by hER{alpha} and hERß. A, MDA-MB-231 cells were infected at MOI 100 with the different viruses. The E2 treatment began sequentially 24 h after infection. All cells were harvested at the same moment following different times of E2 exposure and RNA extracted. Twenty micrograms total RNA were used for Northern blot and hybridized with TGF{alpha}, p21, c-myc, or pS2 probes. Equal loading was checked with an RNA 28S probe. Data of a representative experiment are shown here. B, Quantification of Northern experiments after normalization by 28S RNA levels. Results are the mean ± SD (n = 3) of three experiments. C, The same experiments were performed in the presence of control vehicle ethanol (C), E2 (10-8 M) (E), ICI 164, 384 (10-6 M) alone (I), or in combination (EI). Data of a representative experiment are shown here, and the quantification after normalization with 28S RNA is indicated below. Results are expressed in arbitrary units of scan.

 
ER{alpha} and ERß are potent inhibitors of the proliferation
The main question was to determine whether ERß expression could modulate the proliferation rate of MDA-MB-231 cells. Control cells (noninfected or Ad5 infected) had a similar growth pattern in the absence or in the presence of estrogens (Fig. 5AGo, left panel). When MDA-MB-231 cells were infected with Ad-hER{alpha} virus (Fig. 5AGo, middle panel), they proliferated at the same rate as naive cells in the absence of estrogens. But when E2 was added, a strong inhibition (50%) of the proliferation occurred, which is in agreement with our previous work (31). Very interestingly, ERß was also able to inhibit the proliferation of MDA-MB-231 cells, but this effect was totally ligand independent: a 40% inhibition occurred whether or not estrogens were present (Fig. 5AGo, right panel). This is, to our knowledge, the first direct evidence that ERß can be involved in the proliferation control of breast cancer cells. To determine the effects of pure antiestrogens on cell proliferation, we performed experiments in the presence of ICI 164, 384 (Fig. 5BGo). ICI 164, 384 had no effect by itself on the proliferation of naive, ER{alpha}-, or ERß-expressing cells. However, ICI 164, 384 completely reversed E2-triggered inhibition in Ad-hER{alpha} infected cells. Moreover, ICI 164, 384 or in combination with E2 could not modulate proliferation rate of ERß-expressing cells. These data confirm that inhibition of the proliferation by ER{alpha} is ligand dependent, whereas the inhibition by ERß was ligand independent.



View larger version (30K):
[in this window]
[in a new window]
 
Figure 5. hER{alpha} and hERß are able to repress the proliferation of MDA-MB-231 cells. MDA-MB-231 cells were either NI or infected with Ad5, Ad-hER{alpha}, or Ad-hERß viruses at MOI 100. A, The cells were treated with ethanol vehicle or E2 (10-8 M) 24 h after the beginning of the infection. Proliferation rate was determined by counting the cells at days 2, 4, and 6. Results represent the mean ± SD of four determinations. B, The effect of the pure antiestrogen ICI 164, 384 was evaluated by treating the cells either with ICI 164,384 (10-6 M) alone or in combination with E2 (10-8 M). On day 4, cells were counted and results represent the mean ± SD of three determinations.

 
ER expression has profound effects on invasion, motility, and morphology of the cells
It was of interest to determine whether ERß expression might affect cell motility and therefore modulate the invasiveness of the cells. To address this issue, we performed wound healing-induced migration experiments (Fig. 6Go, A and B). Infected cells were forced to migrate through the space created by scraping the monolayer with a tip. After 18 h of migration, Ad5-infected MDA-MB-231 cells had filled 85% of the wound (Fig. 6BGo). On the contrary, ER{alpha}-infected cells had only partially (50%) filled the wound. This lack of migration was not significantly affected when E2 was added. ERß was also able to inhibit the cell motility. This inhibition occurred in the absence or in the presence of E2 (filling of only 30–40% of the space), suggesting that ERß was a more potent inhibitor of motility than ER{alpha}. We then evaluated the migration ability of these cells using the classic Transwell in vitro assay. In this assay, cells are encouraged to migrate from the upper compartment coated with matrigel to the lower compartment coated with fibronectin, which serves as a chemoattractant. After 36 h of migration, we observed that Ad-hER{alpha}- and Ad-hERß-migrating cells represent, respectively, 70% and 50% of the control migrating cells (Fig. 6CGo). Addition of E2 did not change the migration rate of any kind of cells. In conclusion, motility and invasion assays are in close agreement, suggesting that ERß is a more potent inhibitor of cell migration than ER{alpha}.



View larger version (54K):
[in this window]
[in a new window]
 
Figure 6. hERß is a strong inhibitor of motility and invasion. A, MDA-MB-231 cells were infected with Ad5, Ad-hER{alpha}, or Ad-hERß viruses at MOI 100. Then 24 h after the beginning of the infection, the cells were treated with ethanol (control) or E2 (10-8 M). After 48 h of ligand treatment, cells were scratched with a blue tip and pictured (t = 0). The wound was pictured again 18 h after the scratch (t = 18 h). Pictures of a representative assay are shown here. B, Results are shown as the percent of wound filling after 18 h of migration and represent the mean ± SD of three experiments. C, MDA-MB-231 cells were infected with Ad5, Ad-hER{alpha}, or Ad-hERß (MOI 100). Cells were plated on transwell or on control plates and treated with ethanol vehicle or E2 (10-8 M) 24 h after infection. Cells that had migrated to the lower side of the filter and cells present in the control plates were counted after 36 h of migration. The percentage of control migrating cells was set up to 100. Results are expressed as the percentage of control migrating cells and represent the mean ± SD of four experiments.

 
In correlation with these observations on the reduction of cell motility and invasion following ER expression, we have tested whether cell morphology was affected. Strikingly, ERß led to a change in the morphology of the cells (Fig. 7Go). Infected cells lose their fibroblastic appearance and acquired an epithelioid-like shape. The cells were enlarged and more rounded. ER{alpha} expression also modified the morphology of the cells and led to a more flattened shape of the cells. This change was even more pronounced in the presence of estradiol creating a characteristic structure of branching cells.



View larger version (66K):
[in this window]
[in a new window]
 
Figure 7. hER{alpha} and hERß alter the morphology of MDA-MB-231 cells. MDA-MB-231 cells were infected with Ad5, Ad-hER{alpha}, or Ad-hERß viruses at MOI 100. Then 24 h after the beginning of the infection, the cells were treated with ethanol (control) or E2 (10-8 M). After 48 h of ligand treatment, cells were pictured under a phase contrast microscope.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The use of recombinant adenoviruses has enabled us to express ERß in breast cancer cells devoid of detectable endogenous ERs. ERß protein appears to be fully functional as shown by DNA binding, cellular localization, transient transfection experiments, and regulation of estrogen-regulated endogenous genes. Thus, our data suggest that this novel model exhibits all the interesting features required for the study of ERß action in breast cancer cells and could thus be predictive of its role in human tumors.

In MDA-MB-231 cells, expressed ERß regulated the activity of reporter constructs and endogenous genes. The weaker activity of ERß on reporter genes, compared with ER{alpha}, is likely owing to a lack of ERß AF-1 activity as suggested by several studies (17, 19, 20, 36). Indeed, depending on the cellular and promoter context, AF-1 function has a negligible or high activity, which in turn leads to a greatly enhanced activity of ER{alpha} when gene regulation requires both AF-1 and AF-2. On the contrary, when only AF-2 is active, both receptors exhibit similar activities.

Interestingly, we show here that ERß can induce the expression of pS2, p21, and TGF{alpha}, whereas it has no effect on c-myc expression. We and others have previously shown that in cellular models in which ER{alpha} was exogenously expressed, ER{alpha} could induce cathepsin D, pS2, p21, and TGF{alpha} expression in the presence of E2 (31, 37, 38, 39), whereas it was able to down-regulate c-myc, TGFß2, BRCA-1, BRCA-2, and c-fos/c-jun expression (31, 37, 40). This suggests that ER{alpha} and ERß target genes are partially overlapping but that there are also target genes regulated by only one type of receptor.

To date, only a limited number of promoters regulated specifically by one E2 liganded-ER isotype have been identified. This is the case of the osteopontin (41) and hTERT (catalytic subunit of human telomerase) (42) promoters, which are up-regulated by ER{alpha} and not by ERß. There is only one demonstration of a gene exclusively regulated by ERß and not by ER{alpha} in the presence of estrogens. This is the case of methallothionein II gene, which is specifically up-regulated by ERß in SAOS-2 cells but is regulated by ER{alpha} and ERß in LNCaPLN3 cells (43). Interestingly, c-myc RNA levels (whose expression is generally correlated with the proliferation rate) were not affected by ERß in the presence of E2 in contrast to what is observed in ER{alpha}-MDA-MB-231 cells. The p21 RNA levels were increased by ERß in the presence of E2. The p21 expression is definitely induced in numerous growth-arrested cells (44), even if there are no growth abnormalities in p21-null mice (45). Moreover, p21 is also involved in some cases in the differentiation process, without affecting proliferation (46). Therefore, p21 up-regulation observed in E2-treated ERß-expressing cells might be related to differentiation, as suggested by the morphological changes observed. The change in morphology from a fibroblastic to an epithelioid-like shape of MDA-MB-231 cells infected with ERß has been reported for other engineered cell lines, such as MDA-MB-231 cells stably expressing PR (47). Interestingly, the proliferation of these cells was inhibited by the addition of progesterone, the corresponding receptor ligand. It will be of interest to evaluate whether ERß expression leads to changes in adhesion properties of the cells and in particular to determine whether adhesion molecule expression is altered.

Our work represents the first direct evidence that ERß is involved in the control of the proliferation of breast cancer cells. Surprisingly, ERß inhibition of the proliferation was ligand independent, whereas ERß was able to regulate reporter genes and endogenous gene expression in a ligand-dependent manner. Exogenous ER{alpha} expression using stable or retroviral infected cell lines has already been reported (31, 48, 49, 50, 51). All these studies have shown an E2-dependent decreased proliferation of ER{alpha} expressing cells, ranging from a modest to a high level of inhibition. Therefore, our data suggest that ER{alpha} and ERß inhibit the proliferation through distinct mechanisms. To date, only one study has reported the stable expression of ERß (52). These authors used rat-1 cells and compared ER{alpha} and ERß transfectants. ERß did not affect the proliferation, but in this model, in disagreement with all other studies, ER{alpha} also had no ability to repress proliferation in the presence of E2.

More interestingly, in contrast to ER{alpha}, the effect of exogenous expression of ERß on proliferation seems to be relevant to the clinical situation. Indeed, numerous studies have shown that the ERß/ER{alpha} ratio was decreased between normal to cancerous tissues, as in breast, colon, and ovarian cancers (24, 25, 26, 27, 28, 29, 30), suggesting that ERß could play a negative role on tumorigenesis. Roger et al. (27) have shown that ERß protein was expressed in 85% of epithelial cells of normal mammary gland, and this expression was not significantly altered in nonproliferative breast benign disease. On the contrary, ERß expression was decreased in proliferative breast benign disease and was nearly completely shut down in high-grade ductal carcinoma in situ, suggesting that the presence of ERß is associated with nonproliferative states of the disease. What is still under question is whether ERß expression in breast cancers could be considered a good prognostic indicator. In invasive breast cancer, other studies have shown that ERß protein expression was associated with less invasive and proliferative tumors (negative axillary node status, low grade, low S-phase fraction) suggesting that ERß might be a good prognostic indicator (53). This conclusion was also supported by Omoto et al. (54), even though they could not see a significant correlation between ERß expression and other known clinical parameters. Finally, in terms of adjuvant hormonal therapy, the conclusions are rather contradictory at present because some studies suggest that ERß-expressing tumors are associated with a better survival of patients under adjuvant hormonal therapy (55) whereas other results suggest that ERß is up-regulated in tamoxifen-resistant tumors and could be involved in tamoxifen resistance (56, 57).

In agreement with previous work (58), our data show that ER{alpha} and ERß activities on an ERE-containing reporter and on estrogen regulated genes can be inhibited by the pure antiestrogen ICI 164,384. Moreover, several studies have underlined the differences between ER{alpha} and ERß in terms of response to estrogens or anti-estrogens on AP-1 sites. Indeed, ERß is able to potentiate AP-1 containing reporters in the presence of antiestrogens but not in the presence of estrogens. ER{alpha} stimulates AP-1 activity in the presence of estrogens and antiestrogens in endometrial cells (58, 59, 60), but antiestrogens have no effect on AP-1 activity in breast cancer cells (60, 61). Of particular note, ERß is overall more potent than ER{alpha} on AP-1 sites, whereas the contrary occurs on EREs (17, 19, 20, 36, 58).

We also show that ER{alpha} and ERß inhibit migration and invasion in a ligand-independent manner. These effects of ERß are in close agreement with a previous report showing that ER{alpha} inhibits the migration of ER{alpha}-negative breast cancer cells (48, 62). In the context of breast cancer, such a reduction of invasion and motility would certainly lead to less aggressive cancers with a lower rate of metastasis. These results also fit well with numerous reports describing that ER-positive breast cancer cells are generally less invasive than ER- negative breast cancer cells (63, 64, 65, 66) and that ERß expressing tumors are less metastatic (53). Moreover, reintroduction of ER{alpha} in ER-negative breast cancer cells decreases their invasion and metastatic potential (48). Thus, both ER{alpha} and ERß are able to reverse the invasive phenotype of MDA-MB-231 cells into less invasive cells, mimicking the situation of ER-positive breast cancer cells.

In conclusion, our results strongly support the idea that ERß could be a potent proliferation gatekeeper as well as an inhibitor of cell motility and invasion. The decreased expression of ERß observed between normal and cancerous breast could be one of the events leading to an uncontrolled proliferation of the cells. Our data suggest that the use of ERß itself or of some of its target genes could be of interest to design a gene therapy approach against hormone-unresponsive breast cancer.


    Acknowledgments
 
We thank Professor B. S. Katzenellenbogen for the gift of ERß antibody, ER{alpha} and ERß cDNAs, and ERE2-TK-CAT construct. We are also grateful to Dr. P. Moullier and AFM (Association Française contre les Myopathies) for their support to produce the viruses. We acknowledge the participation of A. Licznar and M. Lacroix to some experiments during their graduate courses. We thank Dr. P. Roger for critically reviewing this manuscript and J. Y. Cance for the photographic work.


    Footnotes
 
This work was supported by grants from ARC (Association pour la Recherche contre le Cancer, Grant No. 5405), la Ligue Nationale contre le Cancer (Comité du Gard), INSERM, and CNRS.

G.L. and D.B. contributed equally to this work.

Abbreviations: Ad, Adenovirus; Ad5, nonrecombinant adenovirus; Ad hER{alpha} or ß, recombinant adenovirus with hER{alpha} or ß; AF, activation function; CAT, chloramphenicol acetyl transferase; CDFCS, charcoal dextran-treated FCS; ERE, estrogen-responsive element; HEK-293 cells, human embryonic kidney cells; hER{alpha} or ß, human estrogen receptor {alpha} or ß; MOI, multiplicity of infection.

Received January 31, 2001.

Accepted for publication May 24, 2001.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Gustafsson JA 1999 Estrogen receptor ß—a new dimension in estrogen mechanism of action. J Endocrinol 163:379–383[CrossRef][Medline]
  2. Russo J, Russo IH 1997 Differentiation and breast cancer. Medicina (B Aires) 57:81–91
  3. Haslam SZ, Counterman LJ, Nummy KA 1993 Effects of epidermal growth factor, estrogen, and progestin on DNA synthesis in mammary cells in vivo are determined by the developmental state of the gland. J Cell Physiol 155:72–78[CrossRef][Medline]
  4. Hilakivi-Clarke L, Clarke R, Lippman M 1999 The influence of maternal diet on breast cancer risk among female offspring. Nutrition 15:392–401[CrossRef][Medline]
  5. Liao DZ, Pantazis CG, Hou X, Li SA 1998 Promotion of estrogen-induced mammary gland carcinogenesis by androgen in the male Noble rat: probable mediation by steroid receptors. Carcinogenesis 19:2173–2180[Abstract/Free Full Text]
  6. Pietras RJ, Szego CM 1999 Cell membrane estrogen receptors resurface. Nat Med 5:1330[Medline]
  7. Collins P, Webb C 1999 Estrogen hits the surface. Nat Med 5:1130–1131[CrossRef][Medline]
  8. Ruehlmann DO, Mann GE 2000 Rapid non-genomic vasodilator actions of oestrogens and sex steroids. Curr Med Chem 7:533–541[Medline]
  9. Nuclear Receptors Nomenclature C 1999 A unified nomenclature system for the nuclear receptor superfamily [letter]. Cell 97:161–163[CrossRef][Medline]
  10. Beato M, Herrlich P, Schutz G 1995 Steroid hormone receptors: many actors in search of a plot. Cell 83:851–857[CrossRef][Medline]
  11. McGuire WL 1975 Endocrine therapy of breast cancer. Annu Rev Med 26:353–363[CrossRef][Medline]
  12. Green S, Walter P, Kumar V, et al. 1986 Human oestrogen receptor cDNA: sequence, expression and homology to v-erbA. Nature 320:134–139[CrossRef][Medline]
  13. Kuiper G, Enmark E, Peltohuikko M, Nilsson S, Gustafsson JA 1996 Cloning of a novel estrogen receptor expressed in rat prostate and ovary. Proc Natl Acad Sci USA 93:5925–5930[Abstract/Free Full Text]
  14. Mosselman S, Polman J, Dijkema R 1996 ER-ß identification and characterization of a novel human estrogen receptor. FEBS Lett 392:49–53[CrossRef][Medline]
  15. Kelley ST, Thackray VG 1999 Phylogenetic analyses reveal ancient duplication of estrogen receptor isoforms. J Mol Evol 49:609–614[CrossRef][Medline]
  16. Tora L, White J, Brou C, et al. 1989 The human estrogen receptor has two independent nonacidic transcriptional activation functions. Cell 59:477–487[CrossRef][Medline]
  17. Cowley SM, Parker MG 1999 A comparison of transcriptional activation by ER {alpha} and ER ß. J Steroid Biochem Mol Biol 69:165–175[CrossRef][Medline]
  18. McInerney EM, Weis KE, Sun J, Mosselman S, Katzenellenbogen BS 1998 Transcription activation by the human estrogen receptor subtype ß (ER-ß) studied with ER-ß and ER-{alpha} receptor chimeras. Endocrinology 139:4513–4522[Abstract/Free Full Text]
  19. Hall JM, McDonnell DP 1999 The estrogen receptor ß-isoform (ERß) of the human estrogen receptor modulates ER{alpha} transcriptional activity and is a key regulator of the cellular response to estrogens and antiestrogens. Endocrinology 140:5566–5578[Abstract/Free Full Text]
  20. Delaunay F, Pettersson K, Tujague M, Gustafsson JA 2000 Functional differences between the amino-terminal domains of estrogen receptors {alpha} and ß. Mol Pharmacol 58:584–590[Abstract/Free Full Text]
  21. Krege JH, Hodgin JB, Couse JF, et al. 1998 Generation and reproductive phenotypes of mice lacking estrogen receptor ß. Proc Natl Acad Sci USA 95:15677–15682[Abstract/Free Full Text]
  22. Couse JF, Korach KS 1999 Estrogen receptor null mice: what have we learned and where will they lead us? Endocr Rev 20:358–417[Abstract/Free Full Text]
  23. Saji S, Jensen EV, Nilsson S, Rylander T, Warner M, Gustafsson J 2000 Estrogen receptors {alpha} and ß in the rodent mammary gland. Proc Natl Acad Sci USA 97:337–342[Abstract/Free Full Text]
  24. Foley EF, Jazaeri AA, Shupnik MA, Jazaeri O, Rice LW 2000 Selective loss of estrogen receptor ß in malignant human colon. Cancer Res 60:245–248[Abstract/Free Full Text]
  25. Campbell-Thompson M, Lynch IJ, Bhardwaj B 2001 Expression of estrogen receptor (ER) subtypes and ERß isoforms in colon cancer. Cancer Res 61: 632–640
  26. Iwao K, Miyoshi Y, Egawa C, Ikeda N, Noguchi S 2000 Quantitative analysis of estrogen receptor-ß mRNA and its variants in human breast cancers. Int J Cancer 88:733–736[CrossRef][Medline]
  27. Roger P, Sahla ME, Makela S, Gustafsson JA, Baldet P, Rochefort H 2001 Decreased expression of estrogen receptor ß protein in proliferative preinvasive mammary tumors. Cancer Res 61:2537–2541[Abstract/Free Full Text]
  28. Rutherford T, Brown WD, Sapi E, Aschkenazi S, Munoz A, Mor G 2000 Absence of estrogen receptor-ß expression in metastatic ovarian cancer. Obstet Gynecol 96:417–421[CrossRef][Medline]
  29. Leygue E, Dotzlaw H, Watson PH, Murphy LC 1998 Altered estrogen receptor {alpha} and ß messenger RNA expression during human breast tumorigenesis. Cancer Res 58:3197–3201[Abstract/Free Full Text]
  30. Pujol P, Rey JM, Nirde P, et al. 1998 Differential expression of estrogen receptor{alpha} and -ß messenger RNAs as a potential marker of ovarian carcinogenesis. Cancer Res 58:5367–5373[Abstract/Free Full Text]
  31. Lazennec G, Katzenellenbogen BS 1999 Expression of human estrogen receptor using an efficient adenoviral gene delivery system is able to restore hormone-dependent features to estrogen receptor-negative breast carcinoma cells. Mol Cell Endocrinol 149:93–105[CrossRef][Medline]
  32. Graham FL, Smilet J, Russel WC, Nairn R 1977 Characteristics of a human cell line transformed by DNA from adenovirus type 5. J Gen Virol 36:59–72[Abstract/Free Full Text]
  33. McGregory WJ, Bautista DS, Graham FL 1988 A simple technique for the rescue of early region 1 mutations into infectious human adenovirus type 5. Virology 163:614–617[CrossRef][Medline]
  34. Lazennec G, Alcorn JL, Katzenellenbogen BS 1999 Adenovirus-mediated delivery of a dominant negative estrogen receptor gene abrogates estrogen-stimulated gene expression and breast cancer cell proliferation. Mol Endocrinol 13:969–980[Abstract/Free Full Text]
  35. Choi I, Ko C, Park-Sarge O-K, et al. Human estrogen receptor ß-specific monoclonal antibodies: characterization and use in studies of estrogen receptor ß protein expression in reproductive tissues. Mol Cell Endocrinol, in press
  36. Pettersson K, Delaunay F, Gustafsson JA 2000 Estrogen receptor ß acts as a dominant regulator of estrogen signaling. Oncogene 19:4970–4978[CrossRef][Medline]
  37. Jeng MH, Jiang SY, Jordan VC 1994 Paradoxical regulation of estrogen-dependent growth factor gene expression in estrogen receptor (ER)-negative human breast cancer cells stably expressing ER. Cancer Lett 82:123–128[CrossRef][Medline]
  38. Thomas TJ, Faaland CA, Adhikarakunnathu S, Watkins LF, Thomas T 1998 Induction of p21 (CIP1/WAF1/SID1) by estradiol in a breast epithelial cell line transfected with the recombinant estrogen receptor gene: a possible mechanism for a negative regulatory role of estradiol. Breast Cancer Res Treat 47:181–193[CrossRef][Medline]
  39. Touitou I, Vignon F, Cavailles V, Rochefort H 1991 Hormonal regulation of cathepsin D following transfection of the estrogen or progesterone receptor into three sex steroid hormone resistant cancer cell lines. J Steroid Biochem Mol Biol 40:231–237[CrossRef][Medline]
  40. Wang W, Smith RR, Burghardt R, Safe SH 1997 17ß-Estradiol-mediated growth inhibition of MDA-MB-468 cells stably transfected with the estrogen receptor: cell cycle effects. Mol Cell Endocrinol 133:49–62[CrossRef][Medline]
  41. Vanacker JM, Pettersson K, Gustafsson J, Laudet V 1999 Transcriptional targets shared by estrogen receptor-related receptors (ERRs) and estrogen receptor (ER) {alpha}, but not by ERß. EMBO J 18:4270–4279[CrossRef][Medline]
  42. Misiti S, Nanni S, Fontemaggi G, et al. 2000 Induction of hTERT expression and telomerase activity by estrogens in human ovary epithelium cells. Mol Cell Biol 20:3764–3771[Abstract/Free Full Text]
  43. Harris HA, Henderson RA, Bhat RA, Komm BS 2001 Regulation of metallothionein II messenger ribonucleic acid measures exogenous estrogen receptor-ß activity in SAOS-2 and LNCaPLN3 cells. Endocrinology 142:645–652[Abstract/Free Full Text]
  44. Cariou S, Donovan JC, Flanagan WM, Milic A, Bhattacharya N, Slingerland JM 2000 Down-regulation of p21WAF1/CIP1 or p27Kip1 abrogates antiestrogen-mediated cell cycle arrest in human breast cancer cells. Proc Natl Acad Sci USA 97:9042–9046[Abstract/Free Full Text]
  45. Weiss RH, Joo A, Randour C 2000 p21Waf1/Cip1 is an assembly factor required for platelet-derived growth factor-induced vascular smooth muscle cell proliferation. J Biol Chem 275:10285–10290[Abstract/Free Full Text]
  46. Di Cunto F, Topley G, Calautti E, et al. 1998 Inhibitory function of p21Cip1/WAF1 in differentiation of primary mouse keratinocytes independent of cell cycle control. Science 280:1069–1072[Abstract/Free Full Text]
  47. Lin VC, Ng EH, Aw SE, Tan MG, Bay BH 2000 Progesterone induces focal adhesion in breast cancer cells MDA-MB-231 transfected with progesterone receptor complementary DNA. Mol Endocrinol 14:348–358[Abstract/Free Full Text]
  48. Garcia M, Derocq D, Freiss G, Rochefort H 1992 Activation of estrogen receptor transfected into a receptor-negative breast cancer cell line decreases the metastatic and invasive potential of the cells. Proc Natl Acad Sci USA 89:11538–11542[Abstract/Free Full Text]
  49. Jiang SY, Jordan VC 1992 Growth regulation of estrogen receptor-negative breast cancer cells transfected with complementary DNAs for estrogen receptor. J Natl Cancer Inst 84:580–591[Abstract/Free Full Text]
  50. Kushner PJ, Hort E, Shine J, Baxter JD, Greene GL 1990 Construction of cell lines that express high levels of the human estrogen receptor and are killed by estrogens. Mol Endocrinol 4:1465–1473[Abstract/Free Full Text]
  51. Zajchowski DA, Sager R 1991 Induction of estrogen-regulated genes differs in immortal and tumorigenic human mammary epithelial cells expressing a recombinant estrogen receptor. Mol Endocrinol 5:1613–1623[Abstract/Free Full Text]
  52. Cheng J, Malayer JR 1999 Responses to stable ectopic estrogen receptor-ß expression in a rat fibroblast cell line. Mol Cell Endocrinol 156:95–105[CrossRef][Medline]
  53. Jarvinen TA, Pelto-Huikko M, Holli K, Isola J 2000 Estrogen receptor ß is coexpressed with ER{alpha} and PR and associated with nodal status, grade, and proliferation rate in breast cancer. Am J Pathol 156:29–35[Abstract/Free Full Text]
  54. Omoto Y, Inoue S, Ogawa S, et al. 2001 Clinical value of the wild-type estrogen receptor ß expression in breast cancer. Cancer Lett 163:207–212[CrossRef][Medline]
  55. Mann S, Laucirica R, Carlson N, et al. 2001 Estrogen receptor ß expression in invasive breast cancer. Hum Pathol 32:113–118[CrossRef][Medline]
  56. Speirs V, Malone C, Walton DS, Kerin MJ, Atkin SL 1999 Increased expression of estrogen receptor ß mRNA in tamoxifen-resistant breast cancer patients. Cancer Res 59:5421–5424[Abstract/Free Full Text]
  57. Speirs V, Kerin MJ 2000 Prognostic significance of oestrogen receptor ß in breast cancer. Br J Surg 87:405–409[CrossRef][Medline]
  58. Paech K, Webb P, Kuiper G, et al. 1997 Differential ligand activation of estrogen receptors ER-{alpha} and ER-ß at AP1 sites. Science 277:1508–1510[Abstract/Free Full Text]
  59. Webb P, Nguyen P, Valentine C, et al. 1999 The estrogen receptor enhances AP-1 activity by two distinct mechanisms with different requirements for receptor transactivation functions. Mol Endocrinol 13:1672–1685[Abstract/Free Full Text]
  60. Webb P, Lopez GN, Uht RM, Kushner PJ 1995 Tamoxifen activation of the estrogen receptor/AP-1 pathway: potential origin for the cell-specific estrogen-like effects of antiestrogens. Mol Endocrinol 9:443–456[Abstract/Free Full Text]
  61. Philips A, Chalbos D, Rochefort H 1993 Estradiol increases and anti-estrogens antagonize the growth factor-induced activator protein-1 activity in MCF7 breast cancer cells without affecting c-fos and c-jun synthesis. J Biol Chem 268:14103–14108[Abstract/Free Full Text]
  62. Platet N, Cunat S, Chalbos D, Rochefort H, Garcia M 2000 Unliganded and liganded estrogen receptors protect against cancer invasion via different mechanisms [in process citation]. Mol Endocrinol 14:999–1009[Abstract/Free Full Text]
  63. Tong D, Czerwenka K, Sedlak J, et al. 1999 Association of in vitro invasiveness and gene expression of estrogen receptor, progesterone receptor, pS2 and plasminogen activator inhibitor-1 in human breast cancer cell lines. Breast Cancer Res Treat 56:91–97[CrossRef][Medline]
  64. Thompson EW, Paik S, Brunner N, et al. 1992 Association of increased basement membrane invasiveness with absence of estrogen receptor and expression of vimentin in human breast cancer cell lines. J Cell Physiol 150:534–544[CrossRef][Medline]
  65. Sommers CL, Byers SW, Thompson EW, Torri JA, Gelmann EP 1994 Differentiation state and invasiveness of human breast cancer cell lines. Breast Cancer Res Treat 31:325–335[CrossRef][Medline]
  66. Madsen MW, Briand P 1990 Relationship between tumorigenicity, in vitro invasiveness, and plasminogen activator production of human breast cell lines. Eur J Cancer 26:793–797



This article has been cited by other articles:


Home page
Clin. Cancer Res.Home page
A. M. Egloff, M. E. Rothstein, R. Seethala, J. M. Siegfried, J. R. Grandis, and L. P. Stabile
Cross-Talk between Estrogen Receptor and Epidermal Growth Factor Receptor in Head and Neck Squamous Cell Carcinoma
Clin. Cancer Res., November 1, 2009; 15(21): 6529 - 6540.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
J.-R. Weng, C.-H. Tsai, H. A. Omar, A. M. Sargeant, D. Wang, S. K. Kulp, C. L. Shapiro, and C.-S. Chen
OSU-A9, a potent indole-3-carbinol derivative, suppresses breast tumor growth by targeting the Akt-NF-{kappa}B pathway and stress response signaling
Carcinogenesis, October 1, 2009; 30(10): 1702 - 1709.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S.-H. Yang, S. N. Sarkar, R. Liu, E. J. Perez, X. Wang, Y. Wen, L.-J. Yan, and J. W. Simpkins
Estrogen Receptor {beta} as a Mitochondrial Vulnerability Factor
J. Biol. Chem., April 3, 2009; 284(14): 9540 - 9548.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
G. Zhang, X. Liu, A. M. Farkas, A. V. Parwani, K. L. Lathrop, D. Lenzner, S. R. Land, and H. Srinivas
Estrogen Receptor {beta} Functions through Nongenomic Mechanisms in Lung Cancer Cells
Mol. Endocrinol., February 1, 2009; 23(2): 146 - 156.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
M. Chen, I. Hsu, A. Wolfe, S. Radovick, K. Huang, S. Yu, C. Chang, E. M. Messing, and S. Yeh
Defects of Prostate Development and Reproductive System in the Estrogen Receptor-{alpha} Null Male Mice
Endocrinology, January 1, 2009; 150(1): 251 - 259.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
S. N. Sundar, C. N. Marconett, V. B. Doan, J. A. Willoughby Sr, and G. L. Firestone
Artemisinin selectively decreases functional levels of estrogen receptor-alpha and ablates estrogen-induced proliferation in human breast cancer cells
Carcinogenesis, December 1, 2008; 29(12): 2252 - 2258.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
C. Chavey, M. Muhlbauer, C. Bossard, A. Freund, S. Durand, C. Jorgensen, C. Jobin, and G. Lazennec
Interleukin-8 Expression Is Regulated by Histone Deacetylases through the Nuclear Factor-{kappa}B Pathway in Breast Cancer
Mol. Pharmacol., November 1, 2008; 74(5): 1359 - 1366.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
B. R. Bhavnani, S.-P. Tam, and X. Lu
Structure Activity Relationships and Differential Interactions and Functional Activity of Various Equine Estrogens Mediated via Estrogen Receptors (ERs) ER{alpha} and ER{beta}
Endocrinology, October 1, 2008; 149(10): 4857 - 4870.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
A. M. Sotoca Covaleda, H. van den Berg, J. Vervoort, P. van der Saag, A. Strom, J.-A. Gustafsson, I. Rietjens, and A. J. Murk
Influence of Cellular ER{alpha}/ER{beta} Ratio on the ER{alpha}-Agonist Induced Proliferation of Human T47D Breast Cancer Cells
Toxicol. Sci., October 1, 2008; 105(2): 303 - 311.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
S.-H. Park, L. W. T. Cheung, A. S. T. Wong, and P. C. K. Leung
Estrogen Regulates Snail and Slug in the Down-Regulation of E-Cadherin and Induces Metastatic Potential of Ovarian Cancer Cells through Estrogen Receptor {alpha}
Mol. Endocrinol., September 1, 2008; 22(9): 2085 - 2098.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
A. M. Shaaban, A. R. Green, S. Karthik, Y. Alizadeh, T. A. Hughes, L. Harkins, I. O. Ellis, J. F. Robertson, E. C. Paish, P. T.K. Saunders, et al.
Nuclear and Cytoplasmic Expression of ER{beta}1, ER{beta}2, and ER{beta}5 Identifies Distinct Prognostic Outcome for Breast Cancer Patients
Clin. Cancer Res., August 15, 2008; 14(16): 5228 - 5235.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
C. W. Xiao
Health Effects of Soy Protein and Isoflavones in Humans
J. Nutr., June 1, 2008; 138(6): 1244S - 1249S.
[Abstract] [Full Text] [PDF]


Home page
J Mol EndocrinolHome page
X. Li, S. L Nott, Y. Huang, R. Hilf, R. A Bambara, X. Qiu, A. Yakovlev, S. Welle, and M. Muyan
Gene expression profiling reveals that the regulation of estrogen-responsive element-independent genes by 17{beta}-estradiol-estrogen receptor {beta} is uncoupled from the induction of phenotypic changes in cell models
J. Mol. Endocrinol., May 1, 2008; 40(5): 211 - 229.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
N. Picard, C. Charbonneau, M. Sanchez, A. Licznar, M. Busson, G. Lazennec, and A. Tremblay
Phosphorylation of Activation Function-1 Regulates Proteasome-Dependent Nuclear Mobility and E6-Associated Protein Ubiquitin Ligase Recruitment to the Estrogen Receptor {beta}
Mol. Endocrinol., February 1, 2008; 22(2): 317 - 330.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Cvoro, D. Tatomer, M.-K. Tee, T. Zogovic, H. A. Harris, and D. C. Leitman
Selective Estrogen Receptor- Agonists Repress Transcription of Proinflammatory Genes
J. Immunol., January 1, 2008; 180(1): 630 - 636.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
I. Bieche, C. Chavey, C. Andrieu, M. Busson, S. Vacher, L. Le Corre, J.-M. Guinebretiere, S. Burlinchon, R. Lidereau, and G. Lazennec
CXC chemokines located in the 4q21 region are up-regulated in breast cancer
Endocr. Relat. Cancer, December 1, 2007; 14(4): 1039 - 1052.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
M. A. Cho, M. K. Lee, K.-H. Nam, W. Y. Chung, C. S. Park, J. H. Lee, T. Noh, W. I. Yang, Y. Rhee, S.-K. Lim, et al.
Expression and role of estrogen receptor {alpha} and {beta} in medullary thyroid carcinoma: different roles in cancer growth and apoptosis
J. Endocrinol., November 1, 2007; 195(2): 255 - 263.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
D. Marot, I. Bieche, C. Aumas, S. Esselin, C. Bouquet, S. Vacher, G. Lazennec, M. Perricaudet, F. Kuttenn, R. Lidereau, et al.
High tumoral levels of Kiss1 and G-protein-coupled receptor 54 expression are correlated with poor prognosis of estrogen receptor-positive breast tumors
Endocr. Relat. Cancer, September 1, 2007; 14(3): 691 - 702.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
C. M. Silva and M. A. Shupnik
Integration of Steroid and Growth Factor Pathways in Breast Cancer: Focus on Signal Transducers and Activators of Transcription and Their Potential Role in Resistance
Mol. Endocrinol., July 1, 2007; 21(7): 1499 - 1512.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
O. Treeck, G. Pfeiler, D. Mitter, C. Lattrich, G. Piendl, and O. Ortmann
Estrogen receptor {beta}1 exerts antitumoral effects on SK-OV-3 ovarian cancer cells
J. Endocrinol., June 1, 2007; 193(3): 421 - 433.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
M. Bionaz and J. J. Loor
Identification of reference genes for quantitative real-time PCR in the bovine mammary gland during the lactation cycle
Physiol Genomics, May 11, 2007; 29(3): 312 - 319.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
H. A. Harris
Estrogen Receptor-{beta}: Recent Lessons from in Vivo Studies
Mol. Endocrinol., January 1, 2007; 21(1): 1 - 13.
[Abstract] [Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
K. Dahlman-Wright, V. Cavailles, S. A. Fuqua, V. C. Jordan, J. A. Katzenellenbogen, K. S. Korach, A. Maggi, M. Muramatsu, M. G. Parker, and J.-A. Gustafsson
International Union of Pharmacology. LXIV. Estrogen Receptors
Pharmacol. Rev., December 1, 2006; 58(4): 773 - 781.
[Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. M. Garcia-Pedrero, E. Kiskinis, M. G. Parker, and B. Belandia
The SWI/SNF Chromatin Remodeling Subunit BAF57 Is a Critical Regulator of Estrogen Receptor Function in Breast Cancer Cells
J. Biol. Chem., August 11, 2006; 281(32): 22656 - 22664.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
A. Castet, A. Herledan, S. Bonnet, S. Jalaguier, J.-M. Vanacker, and V. Cavailles
Receptor-Interacting Protein 140 Differentially Regulates Estrogen Receptor-Related Receptor Transactivation Depending on Target Genes
Mol. Endocrinol., May 1, 2006; 20(5): 1035 - 1047.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
M A J Herve, G Meduri, F G Petit, T S Domet, G Lazennec, S Mourah, and M Perrot-Applanat
Regulation of the vascular endothelial growth factor (VEGF) receptor Flk-1/KDR by estradiol through VEGF in uterus
J. Endocrinol., January 1, 2006; 188(1): 91 - 99.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Zhang, X. Xie, X. Zhu, J. Zhu, C. Hao, Q. Lu, L. Ding, Y. Liu, L. Zhou, Y. Liu, et al.
Stimulatory Cross-talk between NFAT3 and Estrogen Receptor in Breast Cancer Cells
J. Biol. Chem., December 30, 2005; 280(52): 43188 - 43197.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
J. L. Boerner, M. A. Gibson, E. M. Fox, E. D. Posner, S. J. Parsons, C. M. Silva, and M. A. Shupnik
Estrogen Negatively Regulates Epidermal Growth Factor (EGF)-Mediated Signal Transducer and Activator of Transcription 5 Signaling in Human EGF Family Receptor-Overexpressing Breast Cancer Cells
Mol. Endocrinol., November 1, 2005; 19(11): 2660 - 2670.
[Abstract] [Full Text] [PDF]


Home page
J Mol EndocrinolHome page
C Roger, S Lambard, A Bouskine, B Mograbi, D Chevallier, M Nebout, G Pointis, S Carreau, and P Fenichel
Estrogen-induced growth inhibition of human seminoma cells expressing estrogen receptor {beta} and aromatase
J. Mol. Endocrinol., August 1, 2005; 35(1): 191 - 199.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
V. Martineti, L. Picariello, I. Tognarini, S. C. Sala, A. Gozzini, C. Azzari, C. Mavilia, A. Tanini, A. Falchetti, G. Fiorelli, et al.
ER{beta} is a potent inhibitor of cell proliferation in the HCT8 human colon cancer cell line through regulation of cell cycle components
Endocr. Relat. Cancer, June 1, 2005; 12(2): 455 - 469.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
M. Esslimani-Sahla, A. Kramar, J. Simony-Lafontaine, M. Warner, J.-A. Gustafsson, and H. Rochefort
Increased Estrogen Receptor {beta}cx Expression during Mammary Carcinogenesis
Clin. Cancer Res., May 1, 2005; 11(9): 3170 - 3174.
[Abstract] [Full Text] [PDF]


Home page
J Mol EndocrinolHome page
L C Murphy, B Peng, A Lewis, J R Davie, E Leygue, A Kemp, K Ung, M Vendetti, and R Shiu
Inducible upregulation of oestrogen receptor-{beta}1 affects oestrogen and tamoxifen responsiveness in MCF7 human breast cancer cells
J. Mol. Endocrinol., April 1, 2005; 34(2): 553 - 566.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
M. H. Herynk and S. A. W. Fuqua
Estrogen Receptor Mutations in Human Disease
Endocr. Rev., December 1, 2004; 25(6): 869 - 898.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
M. Razandi, A. Pedram, I. Merchenthaler, G. L. Greene, and E. R. Levin
Plasma Membrane Estrogen Receptors Exist and Functions as Dimers
Mol. Endocrinol., December 1, 2004; 18(12): 2854 - 2865.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
A Bardin, N Boulle, G Lazennec, F Vignon, and P Pujol
Loss of ER{beta} expression as a common step in estrogen-dependent tumor progression
Endocr. Relat. Cancer, September 1, 2004; 11(3): 537 - 551.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
C. Rousseau, J. N. Nichol, F. Pettersson, M.-C. Couture, and W. H. Miller Jr.
ER{beta} Sensitizes Breast Cancer Cells to Retinoic Acid: Evidence of Transcriptional Crosstalk
Mol. Cancer Res., September 1, 2004; 2(9): 523 - 531.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
A. Bardin, P. Hoffmann, N. Boulle, D. Katsaros, F. Vignon, P. Pujol, and G. Lazennec
Involvement of Estrogen Receptor {beta} in Ovarian Carcinogenesis
Cancer Res., August 15, 2004; 64(16): 5861 - 5869.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Pathol.Home page
L Nakopoulou, A C Lazaris, E G Panayotopoulou, I Giannopoulou, N Givalos, S Markaki, and A Keramopoulos
The favourable prognostic value of oestrogen receptor {beta} immunohistochemical expression in breast cancer
J. Clin. Pathol., May 1, 2004; 57(5): 523 - 528.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
A. Cabanes, M. Wang, S. Olivo, S. DeAssis, J.-A. Gustafsson, G. Khan, and L. Hilakivi-Clarke
Prepubertal estradiol and genistein exposures up-regulate BRCA1 mRNA and reduce mammary tumorigenesis
Carcinogenesis, May 1, 2004; 25(5): 741 - 748.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
H. S. Cross, E. Kallay, D. Lechner, W. Gerdenitsch, H. Adlercreutz, and H. J. Armbrecht
Phytoestrogens and Vitamin D Metabolism: A New Concept for the Prevention and Therapy of Colorectal, Prostate, and Mammary Carcinomas
J. Nutr., May 1, 2004; 134(5): 1207S - 1212S.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. Paruthiyil, H. Parmar, V. Kerekatte, G. R. Cunha, G. L. Firestone, and D. C. Leitman
Estrogen Receptor {beta} Inhibits Human Breast Cancer Cell Proliferation and Tumor Formation by Causing a G2 Cell Cycle Arrest
Cancer Res., January 1, 2004; 64(1): 423 - 428.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
L. Ding, J. Yan, J. Zhu, H. Zhong, Q. Lu, Z. Wang, C. Huang, and Q. Ye
Ligand-independent activation of estrogen receptor {alpha} by XBP-1
Nucleic Acids Res., September 15, 2003; 31(18): 5266 - 5274.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
T. Watanabe, M. Akishita, T. Nakaoka, K. Kozaki, Y. Miyahara, H. He, Y. Ohike, T. Ogita, S. Inoue, M. Muramatsu, et al.
Estrogen receptor {beta} mediates the inhibitory effect of estradiol on vascular smooth muscle cell proliferation
Cardiovasc Res, September 1, 2003; 59(3): 734 - 744.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
E. Baldi, L. Bonaccorsi, and G. Forti
Androgen Receptor: Good Guy or Bad Guy in Prostate Cancer Invasion?
Endocrinology, May 1, 2003; 144(5): 1653 - 1655.
[Full Text] [PDF]


Home page
Biol. Reprod.Home page
S. B. Pillai, J. M. Jones, and R. D. Koos
Treatment of Rats with 17{beta}-Estradiol or Relaxin Rapidly Inhibits Uterine Estrogen Receptor {beta}1 and {beta}2 Messenger Ribonucleic Acid Levels
Biol Reprod, December 1, 2002; 67(6): 1919 - 1926.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
H. Buteau-Lozano, M. Ancelin, B. Lardeux, J. Milanini, and M. Perrot-Applanat
Transcriptional Regulation of Vascular Endothelial Growth Factor by Estradiol and Tamoxifen in Breast Cancer Cells: A Complex Interplay between Estrogen Receptors {alpha} and {beta}
Cancer Res., September 1, 2002; 62(17): 4977 - 4984.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Liu, W.-C. Park, D. J. Bentrem, K. P. McKian, A. D. L. Reyes, J. A. Loweth, J. M. Schafer, J. W. Zapf, and V. C. Jordan
Structure-Function Relationships of the Raloxifene-Estrogen Receptor-alpha Complex for Regulating Transforming Growth Factor-alpha Expression in Breast Cancer Cells
J. Biol. Chem., March 8, 2002; 277(11): 9189 - 9198.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lazennec, G.
Right arrow Articles by Vignon, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lazennec, G.
Right arrow Articles by Vignon, F.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals