| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
TRH-TSH-THYROID |
Division of Endocrinology and Metabolism, Departments of Medicine and Pathology (P.U.), Mount Sinai School of Medicine, New York, New York 10128
Address all correspondence and requests for reprints to: Terry F. Davies, M.D., Mount Sinai School of Medicine, Box 1055, 1 Gustave L. Levy Place, New York, New York 10128. E-mail: terry.davies{at}mssm.edu
| Abstract |
|---|
|
|
|---|
Within the thyroid glands, 12 of 26 (46%) Tg-immunized pregnant mice were SRY positive (range, 11700 cells), whereas, in contrast, few SRY transcripts were detected in control thyroids from nonimmunized pregnant mice (P < 0.05). At 5 wk postpartum, although SRY was still detected in the thyroids of 12 of 40 (30%) Tg-immunized mice, the number of male cells was markedly decreased (range, 130), and by 10 wk postpartum SRY had disappeared. Using allogeneic male mice heterozygous for green fluorescent protein expression, green fluorescent fetal cells were detected in the blood and bone marrow of pregnant mice. However, green cells were only found in thyroid glands from Tg-immunized pregnant mice that had green fluorescent protein-transgenic green fetuses and not in control nonimmunized pregnant mice. Cytologically, the fetal cells appeared to be of variable origin. Using antibody-mediated affinity purification of thyroid digests we showed this cell population to include fetal cells of T cell and dendritic cell lineage.
Hence, fetal cells of immune origin were shown to accumulate within the thyroid glands of mice with EAT during pregnancy and the early postpartum. These data indicated that the inflamed thyroid gland was capable of accumulating fetal cells, including T cells and dendritic cells. Such active immune cells may have a profound regulatory influence on autoimmune thyroiditis in pregnancy and the postpartum period.
| Introduction |
|---|
|
|
|---|
The phenomenon of fetal microchimerism has been found in the peripheral blood of pregnant women and may persist for as long as 27 yr (10, 11). Fetal microchimerism has also been found to be associated with several autoimmune diseases. In systemic sclerosis patients who had previously given birth to a son, it was found that the prevalence of male DNA was higher in patients than in matched controls (12). Furthermore, fetal cells were found in the skin lesions of such systemic sclerosis patients (13). Polymorphic eruption of pregnancy has also been shown to be associated with fetal microchimerism (14). These data, therefore, suggested that fetal microchimerism may modulate the maternal immune system in autoimmune disease. However, the mechanisms of this influence have not been fully explored. It should also be noted that fetal microchimerism was not found in patients with primary biliary cirrhosis (15), systemic lupus erythematosus, or Sjögrens syndrome patients (16).
We recently described a murine model for studying the influence of pregnancy and the postpartum on experimental autoimmune thyroiditis (EAT) (17). We found that the severity of EAT was affected in a manner similar to that in humans with postpartum exacerbation. Therefore, we studied fetal microchimerism in this model using a sensitive quantitative PCR-ELISA for the SRY male antigen during pregnancy and the postpartum period. To confirm the presence of fetal cells in maternal tissues, we also used male mice transgenic for green fluorescent protein (GFP). These mice have actin promoter-generated green fluorescent cells, except for their erythrocytes and hair (18). We mated Tg- immunized CBA/J females with green males and observed green fetal cells in maternal tissues.
| Materials and Methods |
|---|
|
|
|---|
Thyroid histology. Thyroids were removed, and half-thyroids were fixed in 10% formalin in PBS and stained by hematoxylin and eosin. The rest of the half-thyroids were used for PCR assay. Histological examination was performed by the pathologist in a manner that was blinded as to the experimental group from which the tissue came. Thyroids that had inflammatory cell infiltration were counted as thyroiditis. A thyroiditis grade was assigned to each sample as described previously (17). The severity of thyroiditis was graded as follows: 0.5, small focal areas of inflammatory cells; 1.0, focal collections of mononuclear cells with some follicular destruction; 2.0, diffuse infiltration of thyroid follicles involving approximately 40% or less of thyroid tissue examined; and 3.0, destruction of more than 40% of thyroid tissue. A thyroiditis index (TI) for each group was calculated as the percentage of mice with lymphocytic infiltration multiplied by the mean grade of thyroiditis.
PCR-ELISA for Y-chromosome-specific DNA (SRY)
Primers and probes. Primers and probes were obtained from
Integrated DNA Technologies, Inc. (Coralville, IA). For the mouse Y
chromosome we chose primers specific for an area of the SRY locus
(5'-CTGCTGTGAACAGACACTACGAC-3' and 3'-AACTCCCAGGACCAGGCAA-5'), and for
controls we used murine actin (5'-GACGAGGCCCAGAGCAAGAGAG-3' and
5'-ACGTACATGGCTGGGGTGTTG-3'). The probes used for quantitation of the
PCR product were GCACGCATTTTCCCAGCTTG for SRY and CAGCACGGGGTGCTCCTCGGG
for actin. Probes were digoxigenin labeled using a digoxigenin 3'-end
labeling kit as indicated by the manufacturer (Roche Molecular Biochemicals, Indianapolis, IN).
Quantitative PCR. The genomic DNA was isolated using DNA Mini Kits (QIAGEN, Valencia. CA). A quantitative ELISA-PCR assay was established as previously described (20). Ten microliters of genomic DNA solution were added to a 96-well PCR plate (M-J Research, Watertown, MA) containing 40 µl PCR mixture [20 mM Tris-HCl (pH 8.4), 50 mM KCl, 0.2 mM dNTP mixture, 1.0 mM MgCl2, 200 nM of each primer, and 2.5 U Taq DNA polymerase (Roche Molecular Biochemicals)]. The PCR reaction was initiated at 95 C for 2 min, followed by 2442 cycles at 95 C for 1 min, 60 C for 1 min, and 72 C for 30 sec in a thermal cycler (PTC-100, MJ Research, Inc., Watertown, MA). An avidin (Sigma)-coated (100 µg/ml) microplate (Immulon 4, Dynatec Corp., Chantilly, VA) was incubated with 2.5% BSA/PBS. Ten microliters of PCR product were placed in the microplates and incubated at room temperature for 1 h. The DNA was denatured by adding 0.25 M NaOH at room temperature for 10 min. After three washes, a digoxigenin-labeled probe (0.2 pmol/well) was added in 100 µg 5x sodium chloride sodium phosphate-EDTA and incubated for 2 h at 42 C. After three washes, antidigoxigenin, alkaline phosphatase-coupled antibody (Sigma; 1:5000) was added and incubated for 1 h at room temperature. After four washes, 1 mg/ml paranitrophenyl substrate (Sigma) was added in 1 M diethanolamine buffer. The OD at 405 nm was measured after color development. To normalize the variation, the ratio of SRY and actin was calculated in each sample, and the number of male cells was determined by comparison to a standard titration of male cells mixed with female cells. To maintain the relationship between the number of male cells and the amount of PCR products, several doses of DNA and various numbers of cycles of PCR were performed in preliminary experiments. All presented data were obtained with 200 ng DNA, 42 cycles for SRY, and 24 cycles for actin, because these conditions maintained a quantitative relationship. One male cell could be detected in a background of 1 x 105 female cells.
Green mouse protocol
Enhanced green fluorescent protein (EGFP)-transgenic
mice. Heterozygous EGFP-transgenic mice [C57BL/6 Transgenic-15
(act-EGFP)Osb1] were provided by Dr. Masaru Okabe (Osaka University,
Osaka, Japan) (18). CBA/J female mice were immunized with
mTg and LPS as described above. One week later, they were mated with
EGFP-transgenic males and killed after 2 wk of pregnancy. Maternal
blood was collected by heart puncture, and red cells were removed with
a lysis buffer (155 mM NH4Cl, 10
mM KHCO3, and 0.1 mM
EDTA). Bone marrow cells were collected by washing out the inside of
the femoral bones with PBS. The cells were attached to slides by using
a cytocentrifuge (Cytofuge 2, StatSpin, Inc., Norwood, MA). Thyroids
were fixed in 4% paraformaldehyde overnight or embedded in Tissue-Tek
OCT compound (Sakura Finetek U.S.A., Inc., Torrance, CA), quickly
frozen with dry ice, and sectioned on a cryostat at 510 µm
thickness. Slides were examined by fluorescence microscopy (AX70,
Olympus Corp., Tokyo, Japan) and confocal microscopy in an
inverted configuration (TCS-SP-UV laser scanning microscope,
Leica Corp., Northwale, NJ).
Characterization of intrathyroidal fetal cells. Thyroid glands were removed from Tg-immunized mice at 2 wk of pregnancy. Thyroid lobes from eight mice were minced with fine scissors in 5 ml HBSS that contained 1.5 mg/ml collagenase (Worthington Biochemical Corp., Lakewood, NJ) three times, and leukocytes were obtained according to the method of Creemers et al. (21). Magnetic cell sorting was performed using a MidiMACS magnetic separator with LS+VS+ separation columns (Miltenyi Biotec, Inc., Auburn, CA). Anti-CD4, B220/CD45R, CD11c, CD11b antibodies with microbeads were purchased from Miltenyi Biotec, Inc. (Auburn, CA), for direct cell sorting. Anti-CD8 and Sca-1 antibodies were purchased from PharMingen (San Diego, CA), and goat antirat IgG-coated microbeads were purchased from Miltenyi Biotec, Inc. (Auburn, CA), for indirect cell sorting. Actual cell sorting was performed in sequence using anti-CD4, CD8, B220/CD45R, CD11c, CD11b, and Sca-1 with the recommended concentrations of each bead or antibody. DNA was then extracted from 0.1 x 105 or more sorted cells and the negative cells by incubating in 20 µl 50 mM Tris-HCl (pH 8.0), 20 mM NaCl, 1 mM EDTA, 0.2% SDS, and 100 µg/ml proteinase K at 56 C for 1 h. SRY-specific PCR was performed as described above. A total of 10 µl PCR product was electrophoresed on a 2% agarose gel (Sigma) containing ethidium bromide using Tris-borate EDTA buffer and photographed under UV light.
Data analysis
Data were analyzed by t tests or
2 tests. P < 0.05 was
considered significant.
| Results |
|---|
|
|
|---|
|
|
These data indicate that fetal cells accumulate in the thyroid glands
of Tg-immunized mice during pregnancy and through 5 wk postpartum. The
actual number of mice with intrathyroidal SRY transcripts also
correlated directly with the quantity of transcripts measured. In the
Tg-immunized mice mated with syngeneic males, the percentage of thyroid
SRY-positive mothers was greater in mothers with histological
thyroiditis compared with mothers who did not show thyroiditis. This
was true at 2 wk of pregnancy and at 5 wk postpartum (Fig. 3A
). These data also supported the
concept of fetal cells accumulating preferentially in thyroid glands
with thyroiditis. However, there was no trend for the degree of fetal
cell accumulations to correlate with the thyroiditis grade, although
the numbers of animals examined in this way was small (Fig. 3B
).
|
|
|
| Discussion |
|---|
|
|
|---|
In this report we showed that fetal murine cells were detectable in maternal peripheral blood not only during pregnancy, but also in the postpartum period, as previously described in humans (23). Most fetal cells were found in the blood, and only a few in spleen and bone marrow. These data indicated that most fetal cells were destroyed and cleared from the circulation under normal conditions. In keeping with these observations we found an accumulation of fetal cells in mouse thyroids only after Tg immunization, indicating that the induction of some degree of immune attack on the thyroid induced the accumulation of fetal cells in these maternal thyroid glands. This phenomenon was seen during pregnancy and the postpartum period, and we found that the thyroid glands with the most marked thyroiditis had fetal cells more frequently than those without thyroiditis. We were also able to make unique use of GFP-transgenic male mice to generate green fetuses in normal and Tg-immunized mothers. The green fetal cells were easily detected in recipient mothers and clarified the migration of fetal cells by allowing us to directly visualize green fetal cells in the maternal thyroid glands. Such green fluorescent cells were only observed in thyroids from Tg-immunized mice, providing direct evidence that fetal cells migrated to the inflamed thyroid glands. However, these data also suggested that the accumulated intrathyroidal fetal cells had the potential to modulate autoimmune thyroiditis during pregnancy and the postpartum period.
In humans, autoimmune thyroid diseases are well known to be affected by pregnancy and the postpartum. Although thyroid autoantibodies and Graves disease itself tend to be suppressed during pregnancy, a high percentage (810%) of women develop autoimmune (Hashimotos) thyroiditis or Graves disease 312 months after delivery (3, 4). Studies to determine the immunological mechanisms for these changes have focused on variations in subsets of peripheral blood cell T cell markers such as CD4 and CD8 (3), and Th1 and Th2 subsets examined by cytokine secretion (6, 7). However, our data raise the possibility that fetal cells themselves may be inhibiting maternal immune reactivity. Much of this hypothesis must depend upon the cell types involved in fetal microchimerism and their potential immunological role. Such cells have been examined in previous studies. In maternal blood, several types of fetal cells have been described: trophoblasts (23), CD34+ and CD34+CD38+ hemopoietic progenitor cells (11), nucleated erythroblasts (24), and leukocytes (12). Fetal cells were also found in sorted lymphocyte subsets, such as CD3+CD19+, CD14+, and CD56/16+ subsets in healthy women and women with scleroderma (25). In addition, cell-free chimerism has been shown in pregnant women, where male DNA was found in the serum and plasma of women pregnant with boys (26). Our studies in mice found intrathyroidal fetal cells of CD4+ and CD8+ T cell lineage and also of dendritic cell lineage. These data indicated that fetal T cells and dendritic cells migrated to the maternal thyroids and clearly had the potential to influence the immune response.
How these fetal cells actually migrated to the thyroid glands remains
to be determined. As autoimmune thyroid disease is associated with the
expression of a variety of adhesion molecules (27, 28), it
is likely that this was a nonspecific accumulation and dependent on
cell adhesion. However, we recently reported that the chemokine
receptor 5 (CCR5), which is expressed on monocyte/macrophages,
dendritic cells, and activated lymphocytes, especially Th1-type cells
(29), was strongly expressed in intrathyroidal immune
cells in Tg-immunized mice. In humans, chemokines such as macrophage
inflammatory proteins-1
and -1ß, which are ligands for CCR5, were
detected in the thyroids of patients with Graves disease
(30). Because chemokines and their receptors have been
shown to be associated with selective migration of leukocytes to
inflammatory sites (31), these data indicated that Tg
immunization might lead to the migration of CCR5+
fetal cells to the thyroid. In addition, major histocompatibility
complex (MHC) antigens have been implicated in such a phenomenon. In
humans, the persistence of fetal microchimerism among T lymphocytes was
found to be strongly associated with a specific human leukocyte class
II antigen (DQA1*0501) in the son and the mother (32). As
the inflamed thyroid gland has an abundance of MHC antigens expressed
by the thyroid epithelial cells, fetal and maternal MHC might also
affect susceptibility to intrathyroidal fetal microchimerism via graft
vs. host reactions.
In conclusion, intrathyroidal fetal microchimerism was found in pregnant mice with EAT. These findings raise new questions concerning the normal immune changes of pregnancy and the influence of pregnancy on autoimmune disease both during pregnancy and into the postpartum period.
| Note Added in Proof |
|---|
|
|
|---|
| Acknowledgments |
|---|
| Footnotes |
|---|
Abbreviations: EAT, Experimental autoimmune thyroiditis; EGFP, enhanced green fluorescent protein; GFP, green fluorescent protein; LPS, lipopolysaccharide; MHC, major histocompatibility complex; mTg, murine Tg; TI, thyroiditis index.
Received July 11, 2001.
Accepted for publication September 12, 2001.
| References |
|---|
|
|
|---|
- and
interleukin-4-secreting cells during normal pregnancy. Am J Reprod
Immunol 39:362367
This article has been cited by other articles:
![]() |
D. W. Bianchi and N. M. Fisk Fetomaternal Cell Trafficking and the Stem Cell Debate: Gender Matters JAMA, April 4, 2007; 297(13): 1489 - 1491. [Full Text] [PDF] |
||||
![]() |
K. Khosrotehrani, R.R. Reyes, K.L. Johnson, R.B. Freeman, R.N. Salomon, I. Peter, H. Stroh, S. Guegan, and D.W. Bianchi Fetal cells participate over time in the response to specific types of murine maternal hepatic injury Hum. Reprod., March 1, 2007; 22(3): 654 - 661. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Nguyen Huu, M. Oster, S. Uzan, F. Chareyre, S. Aractingi, and K. Khosrotehrani Maternal neoangiogenesis during pregnancy partly derives from fetal endothelial progenitor cells PNAS, February 6, 2007; 104(6): 1871 - 1876. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. P. Walsh, A. P. Bremner, M. K. Bulsara, P. O'Leary, P. J. Leedman, P. Feddema, and V. Michelangeli Parity and the Risk of Autoimmune Thyroid Disease: A Community-Based Study J. Clin. Endocrinol. Metab., September 1, 2005; 90(9): 5309 - 5312. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Poppe, D. Glinoer, H. Tournaye, P. Devroey, A. van Steirteghem, L. Kaufman, and B. Velkeniers Assisted Reproduction and Thyroid Autoimmunity: An Unfortunate Combination? J. Clin. Endocrinol. Metab., September 1, 2003; 88(9): 4149 - 4152. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Ando and T. F. Davies Postpartum Autoimmune Thyroid Disease: The Potential Role of Fetal Microchimerism J. Clin. Endocrinol. Metab., July 1, 2003; 88(7): 2965 - 2971. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. N. Pearce, A. P. Farwell, and L. E. Braverman Thyroiditis N. Engl. J. Med., June 26, 2003; 348(26): 2646 - 2655. [Full Text] [PDF] |
||||
![]() |
A. A. Kokandi, A. B. Parkes, L. D. K. E. Premawardhana, R. John, and J. H. Lazarus Association of Postpartum Thyroid Dysfunction with Antepartum Hormonal and Immunological Changes J. Clin. Endocrinol. Metab., March 1, 2003; 88(3): 1126 - 1132. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Ando, M. Imaizumi, P. Graves, P. Unger, and T. F. Davies Induction of Thyroid-Stimulating Hormone Receptor Autoimmunity in Hamsters Endocrinology, February 1, 2003; 144(2): 671 - 680. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Ando, M. Imaizumi, P. N. Graves, P. Unger, and T. F. Davies Intrathyroidal Fetal Microchimerism in Graves' Disease J. Clin. Endocrinol. Metab., July 1, 2002; 87(7): 3315 - 3320. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |