help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Imaizumi, M.
Right arrow Articles by Davies, T. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Imaizumi, M.
Right arrow Articles by Davies, T. F.
Right arrowPubmed/NCBI databases
*Substance via MeSH
Hazardous Substances DB
*THYROGLOBULIN
Endocrinology Vol. 143, No. 1 247-253
Copyright © 2002 by The Endocrine Society


TRH-TSH-THYROID

Intrathyroidal Fetal Microchimerism in Pregnancy and Postpartum

M. Imaizumi, A. Pritsker, P. Unger and T. F. Davies

Division of Endocrinology and Metabolism, Departments of Medicine and Pathology (P.U.), Mount Sinai School of Medicine, New York, New York 10128

Address all correspondence and requests for reprints to: Terry F. Davies, M.D., Mount Sinai School of Medicine, Box 1055, 1 Gustave L. Levy Place, New York, New York 10128. E-mail: terry.davies{at}mssm.edu


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Note Added in Proof
 References
 
To investigate a possible relationship between fetal microchimerism and autoimmune thyroiditis, we looked for the presence of fetal cells in the maternal blood and thyroid gland in murine experimental autoimmune thyroiditis (EAT). We used a quantitative PCR-ELISA for products of the SRY locus on the Y chromosome to detect fetal male cells during pregnancy and the postpartum period with a sensitivity of approximately 1 male cell/105 female cells.

Within the thyroid glands, 12 of 26 (46%) Tg-immunized pregnant mice were SRY positive (range, 1–1700 cells), whereas, in contrast, few SRY transcripts were detected in control thyroids from nonimmunized pregnant mice (P < 0.05). At 5 wk postpartum, although SRY was still detected in the thyroids of 12 of 40 (30%) Tg-immunized mice, the number of male cells was markedly decreased (range, 1–30), and by 10 wk postpartum SRY had disappeared. Using allogeneic male mice heterozygous for green fluorescent protein expression, green fluorescent fetal cells were detected in the blood and bone marrow of pregnant mice. However, green cells were only found in thyroid glands from Tg-immunized pregnant mice that had green fluorescent protein-transgenic green fetuses and not in control nonimmunized pregnant mice. Cytologically, the fetal cells appeared to be of variable origin. Using antibody-mediated affinity purification of thyroid digests we showed this cell population to include fetal cells of T cell and dendritic cell lineage.

Hence, fetal cells of immune origin were shown to accumulate within the thyroid glands of mice with EAT during pregnancy and the early postpartum. These data indicated that the inflamed thyroid gland was capable of accumulating fetal cells, including T cells and dendritic cells. Such active immune cells may have a profound regulatory influence on autoimmune thyroiditis in pregnancy and the postpartum period.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Note Added in Proof
 References
 
MANY AUTOIMMUNE diseases, such as rheumatoid arthritis and multiple sclerosis, are ameliorated by pregnancy. In addition, during the postpartum they may also present for the first time or exhibit deterioration (1, 2). In the same way, both Hashimoto’s autoimmune thyroiditis and hyperthyroid Graves’ disease occur commonly (8–10%) in women during the postpartum period and may be transient or chronic (3, 4). The mechanisms by which pregnancy affects maternal immunity are still unclear, although a wide spectrum of immunological changes has been reported (5, 6, 7, 8, 9). Many of these factors influence the pathogenesis of autoimmune diseases during and after pregnancy.

The phenomenon of fetal microchimerism has been found in the peripheral blood of pregnant women and may persist for as long as 27 yr (10, 11). Fetal microchimerism has also been found to be associated with several autoimmune diseases. In systemic sclerosis patients who had previously given birth to a son, it was found that the prevalence of male DNA was higher in patients than in matched controls (12). Furthermore, fetal cells were found in the skin lesions of such systemic sclerosis patients (13). Polymorphic eruption of pregnancy has also been shown to be associated with fetal microchimerism (14). These data, therefore, suggested that fetal microchimerism may modulate the maternal immune system in autoimmune disease. However, the mechanisms of this influence have not been fully explored. It should also be noted that fetal microchimerism was not found in patients with primary biliary cirrhosis (15), systemic lupus erythematosus, or Sjögren’s syndrome patients (16).

We recently described a murine model for studying the influence of pregnancy and the postpartum on experimental autoimmune thyroiditis (EAT) (17). We found that the severity of EAT was affected in a manner similar to that in humans with postpartum exacerbation. Therefore, we studied fetal microchimerism in this model using a sensitive quantitative PCR-ELISA for the SRY male antigen during pregnancy and the postpartum period. To confirm the presence of fetal cells in maternal tissues, we also used male mice transgenic for green fluorescent protein (GFP). These mice have actin promoter-generated green fluorescent cells, except for their erythrocytes and hair (18). We mated Tg- immunized CBA/J females with green males and observed green fetal cells in maternal tissues.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Note Added in Proof
 References
 
Initial animal protocols
Immunization and mating. Murine Tg (mTg) was prepared from frozen mouse thyroids (Pel-Freez Biologicals, Rogers, AK) as previously described (19). CBA/J (H2k) and BALB/c(H2d) (8 wk old unless stated otherwise) were purchased from The Jackson Laboratory (Bar Harbor, ME). All experiments were conducted in accordance with the NIH Guide for the Care and Use of Laboratory Animals. CBA/J female mice were immunized iv with mTg (50 µg), followed by lipopolysaccharide (LPS) from Salmonella enteritidis (Sigma, St. Louis, MO; 20 µg, iv) 3 h later. As controls, CBA/J female mice were immunized with LPS (20 µg, iv) only. The same immunization schedule was repeated 1 wk later. One week after the last immunization, immunized CBA/J female mice were mated for 1 wk. Mice with vaginal plugs were counted as originally pregnant. Pregnancies were then allowed to proceed, and mice were killed after 2 wk of pregnancy (4 wk after the last immunization), or 5 or 10 wk postpartum (9 or 14 wk after the last immunization), and their blood, thyroids, and spleens were examined.

Thyroid histology. Thyroids were removed, and half-thyroids were fixed in 10% formalin in PBS and stained by hematoxylin and eosin. The rest of the half-thyroids were used for PCR assay. Histological examination was performed by the pathologist in a manner that was blinded as to the experimental group from which the tissue came. Thyroids that had inflammatory cell infiltration were counted as thyroiditis. A thyroiditis grade was assigned to each sample as described previously (17). The severity of thyroiditis was graded as follows: 0.5, small focal areas of inflammatory cells; 1.0, focal collections of mononuclear cells with some follicular destruction; 2.0, diffuse infiltration of thyroid follicles involving approximately 40% or less of thyroid tissue examined; and 3.0, destruction of more than 40% of thyroid tissue. A thyroiditis index (TI) for each group was calculated as the percentage of mice with lymphocytic infiltration multiplied by the mean grade of thyroiditis.

PCR-ELISA for Y-chromosome-specific DNA (SRY)
Primers and probes. Primers and probes were obtained from Integrated DNA Technologies, Inc. (Coralville, IA). For the mouse Y chromosome we chose primers specific for an area of the SRY locus (5'-CTGCTGTGAACAGACACTACGAC-3' and 3'-AACTCCCAGGACCAGGCAA-5'), and for controls we used murine actin (5'-GACGAGGCCCAGAGCAAGAGAG-3' and 5'-ACGTACATGGCTGGGGTGTTG-3'). The probes used for quantitation of the PCR product were GCACGCATTTTCCCAGCTTG for SRY and CAGCACGGGGTGCTCCTCGGG for actin. Probes were digoxigenin labeled using a digoxigenin 3'-end labeling kit as indicated by the manufacturer (Roche Molecular Biochemicals, Indianapolis, IN).

Quantitative PCR. The genomic DNA was isolated using DNA Mini Kits (QIAGEN, Valencia. CA). A quantitative ELISA-PCR assay was established as previously described (20). Ten microliters of genomic DNA solution were added to a 96-well PCR plate (M-J Research, Watertown, MA) containing 40 µl PCR mixture [20 mM Tris-HCl (pH 8.4), 50 mM KCl, 0.2 mM dNTP mixture, 1.0 mM MgCl2, 200 nM of each primer, and 2.5 U Taq DNA polymerase (Roche Molecular Biochemicals)]. The PCR reaction was initiated at 95 C for 2 min, followed by 24–42 cycles at 95 C for 1 min, 60 C for 1 min, and 72 C for 30 sec in a thermal cycler (PTC-100, MJ Research, Inc., Watertown, MA). An avidin (Sigma)-coated (100 µg/ml) microplate (Immulon 4, Dynatec Corp., Chantilly, VA) was incubated with 2.5% BSA/PBS. Ten microliters of PCR product were placed in the microplates and incubated at room temperature for 1 h. The DNA was denatured by adding 0.25 M NaOH at room temperature for 10 min. After three washes, a digoxigenin-labeled probe (0.2 pmol/well) was added in 100 µg 5x sodium chloride sodium phosphate-EDTA and incubated for 2 h at 42 C. After three washes, antidigoxigenin, alkaline phosphatase-coupled antibody (Sigma; 1:5000) was added and incubated for 1 h at room temperature. After four washes, 1 mg/ml paranitrophenyl substrate (Sigma) was added in 1 M diethanolamine buffer. The OD at 405 nm was measured after color development. To normalize the variation, the ratio of SRY and actin was calculated in each sample, and the number of male cells was determined by comparison to a standard titration of male cells mixed with female cells. To maintain the relationship between the number of male cells and the amount of PCR products, several doses of DNA and various numbers of cycles of PCR were performed in preliminary experiments. All presented data were obtained with 200 ng DNA, 42 cycles for SRY, and 24 cycles for actin, because these conditions maintained a quantitative relationship. One male cell could be detected in a background of 1 x 105 female cells.

Green mouse protocol
Enhanced green fluorescent protein (EGFP)-transgenic mice. Heterozygous EGFP-transgenic mice [C57BL/6 Transgenic-15 (act-EGFP)Osb1] were provided by Dr. Masaru Okabe (Osaka University, Osaka, Japan) (18). CBA/J female mice were immunized with mTg and LPS as described above. One week later, they were mated with EGFP-transgenic males and killed after 2 wk of pregnancy. Maternal blood was collected by heart puncture, and red cells were removed with a lysis buffer (155 mM NH4Cl, 10 mM KHCO3, and 0.1 mM EDTA). Bone marrow cells were collected by washing out the inside of the femoral bones with PBS. The cells were attached to slides by using a cytocentrifuge (Cytofuge 2, StatSpin, Inc., Norwood, MA). Thyroids were fixed in 4% paraformaldehyde overnight or embedded in Tissue-Tek OCT compound (Sakura Finetek U.S.A., Inc., Torrance, CA), quickly frozen with dry ice, and sectioned on a cryostat at 5–10 µm thickness. Slides were examined by fluorescence microscopy (AX70, Olympus Corp., Tokyo, Japan) and confocal microscopy in an inverted configuration (TCS-SP-UV laser scanning microscope, Leica Corp., Northwale, NJ).

Characterization of intrathyroidal fetal cells. Thyroid glands were removed from Tg-immunized mice at 2 wk of pregnancy. Thyroid lobes from eight mice were minced with fine scissors in 5 ml HBSS that contained 1.5 mg/ml collagenase (Worthington Biochemical Corp., Lakewood, NJ) three times, and leukocytes were obtained according to the method of Creemers et al. (21). Magnetic cell sorting was performed using a MidiMACS magnetic separator with LS+VS+ separation columns (Miltenyi Biotec, Inc., Auburn, CA). Anti-CD4, B220/CD45R, CD11c, CD11b antibodies with microbeads were purchased from Miltenyi Biotec, Inc. (Auburn, CA), for direct cell sorting. Anti-CD8 and Sca-1 antibodies were purchased from PharMingen (San Diego, CA), and goat antirat IgG-coated microbeads were purchased from Miltenyi Biotec, Inc. (Auburn, CA), for indirect cell sorting. Actual cell sorting was performed in sequence using anti-CD4, CD8, B220/CD45R, CD11c, CD11b, and Sca-1 with the recommended concentrations of each bead or antibody. DNA was then extracted from 0.1 x 105 or more sorted cells and the negative cells by incubating in 20 µl 50 mM Tris-HCl (pH 8.0), 20 mM NaCl, 1 mM EDTA, 0.2% SDS, and 100 µg/ml proteinase K at 56 C for 1 h. SRY-specific PCR was performed as described above. A total of 10 µl PCR product was electrophoresed on a 2% agarose gel (Sigma) containing ethidium bromide using Tris-borate EDTA buffer and photographed under UV light.

Data analysis
Data were analyzed by t tests or {chi}2 tests. P < 0.05 was considered significant.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Note Added in Proof
 References
 
Induction of thyroiditis
Thyroid histology was examined in the Tg-immunized pregnant mice and at 5 wk postpartum after mating with syngeneic males. Thyroid histology was also examined in a nonpregnant Tg-immunized control group. We found that a similar percentage of Tg-immunized mice developed thyroiditis after 2 wk of pregnancy as in the nonpregnant group (Fig. 1AGo), and the degree of thyroiditis was also similar, as shown by the TI (Fig. 1BGo). However, the percentage of mice with thyroiditis was significantly increased at 5 wk postpartum compared with the controls (Fig. 1AGo) along with the TI (Fig. 1BGo). These data suggested that thyroiditis was increased postpartum in this syngeneic model as we have previously reported (17).



View larger version (26K):
[in this window]
[in a new window]
 
Figure 1. Thyroiditis in pregnancy and postpartum. Data were derived from Tg-immunized mice mated with syngeneic males. P, During pregnancy; PP, postpartum. The controls were normal nonpregnant mice. A, The percentage of mice with thyroiditis showed no difference during pregnancy, but was significantly increased in the postpartum period (*, P = 0.031). B, The degree of thyroiditis expressed as a TI in the same groups showing a marked increase in the postpartum period.

 
Detection of SRY-fetal DNA in peripheral blood and spleen
In the peripheral blood, SRY containing DNA was detected in 6 of 18 (33%) nonimmunized pregnant mice and in 5 of 18 (28%) Tg-immunized pregnant mice at 2 wk of pregnancy (Fig. 2AGo). There was no significant difference in the amount of SRY DNA detected (range, 1–300 cells). At 5 wk postpartum, SRY was still detected in 2 of 14 (14%) nonimmunized mice and in 5 of 18 (28%) Tg-immunized mice, although the amount of SRY DNA was much decreased compared with that found at 2 wk of pregnancy in both nonimmunized and Tg-immunized mice (range, 1–10; P < 0.05; Fig. 2AGo). At 10 wk postpartum, SRY was undetectable in most mice (Fig. 2AGo). In the spleens, 4 of 11 nonimmunized mice and 1 of 10 Tg-immunized mice had detectable SRY DNA at 2 wk of pregnancy. However, the amount of SRY was much lower than that seen in the blood, ranging from 1 to 6 male cells/105 female cells (Fig. 2AGo). These data indicated that fetal microchimerism in murine peripheral blood and spleen was a normal event during pregnancy and the postpartum. Presumably, negative mice were a reflection of the sensitivity of the SRY testing.



View larger version (23K):
[in this window]
[in a new window]
 
Figure 2. Microchimerism in mouse blood and thyroids during pregnancy and postpartum. The number of male cells (derived from SRY-PCR transcripts) in each positive sample is illustrated. A, Microchimerism in blood and spleen. B, Microchimerism in thyroid. *, P = 0.047 between controls and EAT in pregnancy; *, P = 0.049 between EAT in pregnancy and EAT at 5 wk PP; *, P = 0.024 between controls and EAT at 5 wk PP.

 
Detection of SRY-fetal DNA in murine thyroids
Within the thyroid glands, SRY DNA was detected in 12 of 26 (46%) Tg-immunized pregnant mice, whereas only small amounts of SRY were detected in 2 of 10 (20%) nonimmunized pregnant mice at 2 wk of pregnancy (P < 0.05; Fig. 2BGo). At 5 wk postpartum, SRY DNA was still detected in 12 of 40 (30%) Tg-immunized mice (range, 1–30), whereas it was not present in nonimmunized mice, although the amount of SRY DNA was significantly decreased compared with that during pregnancy (P < 0.05; Fig. 2BGo). At 10 wk postpartum, SRY was negative in all but 1 thyroid in both nonimmunized and Tg-immunized mice (Fig. 2BGo). No SRY-positive PCR-ELISA samples were found in DNA preparations from 15 thyroids of Tg-immunized virgin mice (data not illustrated).

These data indicate that fetal cells accumulate in the thyroid glands of Tg-immunized mice during pregnancy and through 5 wk postpartum. The actual number of mice with intrathyroidal SRY transcripts also correlated directly with the quantity of transcripts measured. In the Tg-immunized mice mated with syngeneic males, the percentage of thyroid SRY-positive mothers was greater in mothers with histological thyroiditis compared with mothers who did not show thyroiditis. This was true at 2 wk of pregnancy and at 5 wk postpartum (Fig. 3AGo). These data also supported the concept of fetal cells accumulating preferentially in thyroid glands with thyroiditis. However, there was no trend for the degree of fetal cell accumulations to correlate with the thyroiditis grade, although the numbers of animals examined in this way was small (Fig. 3BGo).



View larger version (20K):
[in this window]
[in a new window]
 
Figure 3. A, Percentage of thyroid SRY-positive mothers in Tg-immunized mice without thyroiditis and in those with thyroiditis. Data were combined from those during pregnancy and 5 wk postpartum (*, P = 0.045). B, Intrathyroidal fetal cell accumulation in relation to the TI.

 
Green fluorescent cells in maternal blood and thyroids
To confirm the presence of fetal cells in maternal blood and thyroids, Tg-immunized females were mated with EGFP-transgenic green male mice, and their blood and thyroids were observed after 2 wk of pregnancy. Tg-immunized females had approximately 50% green fetuses and approximately 50% normal fetuses. Green cells were detected in maternal blood (Fig. 4AGo) and maternal bone marrow (Fig. 4BGo). Green cells were also detected in the thyroid gland (Fig. 4CGo), and SRY-positive DNA was detected in the same thyroids by PCR-ELISA (data not shown). These observations confirmed the migration of fetal cells and their accumulation in Tg-immunized maternal thyroids.



View larger version (56K):
[in this window]
[in a new window]
 
Figure 4. Green fluorescent fetal cells in blood (upper panel), bone marrow (middle panel), and thyroid (lower panel) in Tg-immunized pregnant mice mated with EGFP-transgenic males (magnification, x100).

 
Characterization of intrathyroidal fetal cells
The green fetal cells observed in maternal tissues varied in size from small to large and single to multinucleated, suggesting a diverse population of fetal progenitor cells. To examine the characteristics of the intrathyroidal fetal cells in more detail we used antibody-mediated cell separation. By magnetic bead cell sorting for intrathyroidal leukocytes in Tg-immunized pregnant mice, 2.8 x 105 CD4+ cells, 3.8 x 105 CD8+ cells, 2.2 x 105 B220/CD45R+ cells, 0.1 x 105 CD11c+ cells, 0.1 x 105 CD11b+, 0.2 x 105 Sca-1+ cells, and 0.2 x 105 negative cells were obtained from eight mice. Less than 0.1 x 105 CD4+ cells were obtained from five nonimmunized mice, indicating their lack of lymphocytic infiltration. SRY-specific PCRs showed positive bands in the CD4+, CD8+, and CD11b+ cell preparations and was negative in B220/CD45R+, CD11b+, Sca-1+, and control cells (Fig. 5Go). These data indicated that fetal CD4+ and CD8+ cells, probably of T cell lineage, and dendritic cell lineage, migrated to the maternal thyroid glands.



View larger version (20K):
[in this window]
[in a new window]
 
Figure 5. SRY-specific PCR-generated DNA products in sorted intrathyroidal leukocytes. SRY bands were present in CD4- and CD11c-positive cells, and a faint SRY band was also seen in CD8-positive cells. Male blood and female blood were positive and negative controls, respectively.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Note Added in Proof
 References
 
Compared with transplantation and fetal life itself, pregnancy is the major source of microchimerism. After the 34th week of pregnancy, more than 90% of women bearing male fetuses have male cells in their blood. Although the level of circulating fetal cells has been reported to be very low (1:500,000 male:female cells) (13), such fetal cells can persist after delivery for more than 20 yr (11). However, microchimerism in mice related to pregnancy has been reported not to persist after syngeneic pregnancies (22).

In this report we showed that fetal murine cells were detectable in maternal peripheral blood not only during pregnancy, but also in the postpartum period, as previously described in humans (23). Most fetal cells were found in the blood, and only a few in spleen and bone marrow. These data indicated that most fetal cells were destroyed and cleared from the circulation under normal conditions. In keeping with these observations we found an accumulation of fetal cells in mouse thyroids only after Tg immunization, indicating that the induction of some degree of immune attack on the thyroid induced the accumulation of fetal cells in these maternal thyroid glands. This phenomenon was seen during pregnancy and the postpartum period, and we found that the thyroid glands with the most marked thyroiditis had fetal cells more frequently than those without thyroiditis. We were also able to make unique use of GFP-transgenic male mice to generate green fetuses in normal and Tg-immunized mothers. The green fetal cells were easily detected in recipient mothers and clarified the migration of fetal cells by allowing us to directly visualize green fetal cells in the maternal thyroid glands. Such green fluorescent cells were only observed in thyroids from Tg-immunized mice, providing direct evidence that fetal cells migrated to the inflamed thyroid glands. However, these data also suggested that the accumulated intrathyroidal fetal cells had the potential to modulate autoimmune thyroiditis during pregnancy and the postpartum period.

In humans, autoimmune thyroid diseases are well known to be affected by pregnancy and the postpartum. Although thyroid autoantibodies and Graves’ disease itself tend to be suppressed during pregnancy, a high percentage (8–10%) of women develop autoimmune (Hashimoto’s) thyroiditis or Graves’ disease 3–12 months after delivery (3, 4). Studies to determine the immunological mechanisms for these changes have focused on variations in subsets of peripheral blood cell T cell markers such as CD4 and CD8 (3), and Th1 and Th2 subsets examined by cytokine secretion (6, 7). However, our data raise the possibility that fetal cells themselves may be inhibiting maternal immune reactivity. Much of this hypothesis must depend upon the cell types involved in fetal microchimerism and their potential immunological role. Such cells have been examined in previous studies. In maternal blood, several types of fetal cells have been described: trophoblasts (23), CD34+ and CD34+CD38+ hemopoietic progenitor cells (11), nucleated erythroblasts (24), and leukocytes (12). Fetal cells were also found in sorted lymphocyte subsets, such as CD3+CD19+, CD14+, and CD56/16+ subsets in healthy women and women with scleroderma (25). In addition, cell-free chimerism has been shown in pregnant women, where male DNA was found in the serum and plasma of women pregnant with boys (26). Our studies in mice found intrathyroidal fetal cells of CD4+ and CD8+ T cell lineage and also of dendritic cell lineage. These data indicated that fetal T cells and dendritic cells migrated to the maternal thyroids and clearly had the potential to influence the immune response.

How these fetal cells actually migrated to the thyroid glands remains to be determined. As autoimmune thyroid disease is associated with the expression of a variety of adhesion molecules (27, 28), it is likely that this was a nonspecific accumulation and dependent on cell adhesion. However, we recently reported that the chemokine receptor 5 (CCR5), which is expressed on monocyte/macrophages, dendritic cells, and activated lymphocytes, especially Th1-type cells (29), was strongly expressed in intrathyroidal immune cells in Tg-immunized mice. In humans, chemokines such as macrophage inflammatory proteins-1{alpha} and -1ß, which are ligands for CCR5, were detected in the thyroids of patients with Graves’ disease (30). Because chemokines and their receptors have been shown to be associated with selective migration of leukocytes to inflammatory sites (31), these data indicated that Tg immunization might lead to the migration of CCR5+ fetal cells to the thyroid. In addition, major histocompatibility complex (MHC) antigens have been implicated in such a phenomenon. In humans, the persistence of fetal microchimerism among T lymphocytes was found to be strongly associated with a specific human leukocyte class II antigen (DQA1*0501) in the son and the mother (32). As the inflamed thyroid gland has an abundance of MHC antigens expressed by the thyroid epithelial cells, fetal and maternal MHC might also affect susceptibility to intrathyroidal fetal microchimerism via graft vs. host reactions.

In conclusion, intrathyroidal fetal microchimerism was found in pregnant mice with EAT. These findings raise new questions concerning the normal immune changes of pregnancy and the influence of pregnancy on autoimmune disease both during pregnancy and into the postpartum period.


    Note Added in Proof
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Note Added in Proof
 References
 
The presence of human fetal cells in female thyroid glands, particularly those from patients with autoimmune thyroid disease, has now been reported in two abstracts and a full paper (33, 34, 35).


    Acknowledgments
 
Special thanks to Peter Graves, Ph.D., for help in characterizing the SRY-PCR, to Dr. T. Ando for technical assistance, and to Drs. A. Martin and N. Kerlero de Rosbo for review of the manuscript.


    Footnotes
 
This work was supported in part by NIH Grants DK-52464, DK-35764, and DK-45011 (to T.F.D.) and the David Owen Segal Endowment (to M.I.). Confocal microscopy was supported by NIH Shared Instrumentation Grant RRO-9145 and NSF Major Research Instrumentation Grant DBI-9724504.

Abbreviations: EAT, Experimental autoimmune thyroiditis; EGFP, enhanced green fluorescent protein; GFP, green fluorescent protein; LPS, lipopolysaccharide; MHC, major histocompatibility complex; mTg, murine Tg; TI, thyroiditis index.

Received July 11, 2001.

Accepted for publication September 12, 2001.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Note Added in Proof
 References
 

  1. Confavreux C, Hutchinson M, Hours MM, Cortinovis-Tourniaire P, Moreau T 1998 Rate of pregnancy-related relapse in multiple sclerosis. Pregnancy in Multiple Sclerosis Group. N Engl J Med 339:285–291[Abstract/Free Full Text]
  2. Nelson JL, Hughes KA, Smith AG, Nisperos BB, Branchaud AM, Hansen JA 1993 Maternal-fetal disparity in HLA class II alloantigens and the pregnancy-induced amelioration of rheumatoid arthritis. N Engl J Med 329:466–471[Abstract/Free Full Text]
  3. Stagnaro-Green A 1994 Pregnancy and thyroid disease. Immunol Allergy Clin North Am 14:865–878
  4. Amino N, Miyai K 1983 Postpartum autoimmune endocrine syndromes. In: Davies TF, ed. Autoimmune endocrine disease. New York: Wiley & Sons; 247–272
  5. Stagnaro-Green A, Roman SH, Cobin RH, El-Harazy E, Wallenstein S, Davies TF 1992 A prospective study of lymphocyte-initiated immunosuppression in normal pregnancy: evidence of a T-cell etiology for postpartum thyroid dysfunction. J Clin Endocrinol Metab 74:645–653[Abstract]
  6. Watanabe M, Iwatani Y, Kaneda T, Hidaka Y, Mitsuda N, Morimoto Y, Amino N 1997 Changes in T, B, and NK lymphocyte subsets during and after normal pregnancy. Am J Reprod Immunol 37:368–377
  7. Matthiesen L, Ekerfelt C, Berg G, Ernerudh J 1998 Increased numbers of circulating interferon-{gamma}- and interleukin-4-secreting cells during normal pregnancy. Am J Reprod Immunol 39:362–367
  8. Shafer-Weaver KA, Corl CM, Sordillo LM 1999 Shifts in bovine CD4+ subpopulations increase T-helper-2 compared with T-helper-1 effector cells during the postpartum period. J Dairy Sci 82:1696–1706[Abstract]
  9. Raghupathy R 1997 Th1-type immunity is incompatible with successful pregnancy. Immunol Today 10:478–482
  10. Geifman-Holtzman O, Blatman RN, Bianchi DW 1994 Prenatal genetic diagnosis by isolation and analysis of fetal cells circulating in maternal blood. Semin Perinatol 18:366–375[Medline]
  11. Bianchi DW, Zickwolf GK, Weil GJ, Sylvester S, DeMaria MA 1996 Male fetal progenitor cells persist in maternal blood for as long as 27 years postpartum. Proc Natl Acad Sci USA 93:705–708[Abstract/Free Full Text]
  12. Artlett CM, Smith JB, Jimenez SA 1998 Identification of fetal DNA and cells in skin lesions from women with systemic sclerosis. N Engl J Med 338:1186–1191[Abstract/Free Full Text]
  13. Aractingi S, Berkane N, Bertheau P, Le Goue C, Dausset J, Uzan S, Carosella ED 1998 Fetal DNA in skin of polymorphic eruptions of pregnancy. Lancet 352:1898–1901[CrossRef][Medline]
  14. Tanaka A, Lindor K, Gish R, Batts K, Shiratori Y, Omata M, Nelson JL, Ansari A, Coppel R, Newsome M, Gershwin ME 1999 Fetal microchimerism alone does not contribute to the induction of primary biliary cirrhosis. Hepatology 30:833–838[CrossRef][Medline]
  15. Miyashita Y, Ono M, Ono M, Ueki H, Kurasawa K 2000 Y chromosome microchimerism in rheumatic autoimmune disease. Ann Rheum Dis 59: 655–656
  16. Imaizumi M, Pritsker A, Kita M, Ahmad M, Unger P, Davies TF Non-MHC driven exacerbation of experimental thyroiditis in the postpartum period. Autoimmunity, in press
  17. Imaizumi M, Pritsker A, Kita M, Ahmad M, Unger P, Davies TF 2001 Pregnancy and murine thyroiditis: thyroglobulin immunization leads to fetal loss in specific allogeneic pregnancies. Endocrinology 142:823–829[Abstract/Free Full Text]
  18. Okabe M, Ikawa M, Kominami K, Nakanishi T, Nishimune Y 1997 ‘Green mice’ as a source of ubiquitous green cells. FEBS Lett 407:313–319[CrossRef][Medline]
  19. Simon LL, Krco CJ, David CS, Kong YM 1985 Characterization of the in vitro murine T-cell proliferative responses to murine and human thyroglobulins in thyroiditis-susceptible and -resistant mice. Cell Immunol 94:243–253[CrossRef][Medline]
  20. Alard P, Lantz O, Sebagh M, Calvo CF, Weill D, Chavanel G, Senik A, Charpentier B 1993 A versatile ELISA-PCR assay for mRNA quantitation from a few cells. BioTechniques 15:730–737[Medline]
  21. Creemers PAA, Giraldo AA, Rose NR, Kong YM 1984 T-cell subsets in the thyroids of mice developing autoimmune thyroiditis. Cell Immunol 87:692–687[CrossRef][Medline]
  22. Bonney EA, Matzinger P 1997 The maternal immune system’s interaction with circulating fetal cells. J Immunol 158:40–47[Abstract]
  23. Mueller UW, Hawes CS, Wright AE, Petropoulos A, DeBoni E, Firgaira FA, Morley AA, Turner DR, Jones WR 1990 Isolation of fetal trophoblast cells from peripheral blood of pregnant women. Lancet 336:197–200[CrossRef][Medline]
  24. Bianchi DW, Flint AF, Pizzimenti MF, Knoll JH, Latt SA 1990 Isolation of fetal DNA from nucleated erythrocytes in maternal blood. Proc Natl Acad Sci USA 87:3279–3283[Abstract/Free Full Text]
  25. Evans PC, Lambert N, Maloney S, Furst DE, Moore JM, Nelson JL 1999 Long-term fetal microchimerism in peripheral blood mononuclear cell subsets in healthy women and women with scleroderma. Blood 93:2033–2037[Abstract/Free Full Text]
  26. Lo YM, Tein MS, Lau TK, Haines CJ, Leung TN, Poon PM, Wainscoat JS, Johnson PJ, Chang AM, Hjelm NM 1998 Quantitative analysis of fetal DNA in maternal plasma and serum: implications for noninvasive prenatal diagnosis. Am J Hum Genet 62:768–775[CrossRef][Medline]
  27. Ishikawa N, Eguchi K, Ueki Y, Nakashima M, Shimada H, Ito K, Nagataki S 1993 Expression of adhesion molecules on infiltrating T cells in thyroid glands from patients with Graves’ disease. Clin Exp Immunol 94:363–370[Medline]
  28. Marazuela M, Postigo AA, Acevedo A, Diaz-Gonzalez F, Sanchez-Madrid F, de Landazuri MO 1994 Adhesion molecules from the LFA-1/ICAM-1,3 and VLA-4/VCAM-1 pathways on T lymphocytes and vascular endothelium in Graves’ and Hashimoto’s thyroid glands. Eur J Immunol 24:2483–2490[Medline]
  29. Loetscher P, Uguccioni M, Bordoli L, Baggiolini M, Moser B, Chizzolini C, Dayer JM 1998 CCR5 is characteristic of Th1 lymphocytes [Letter]. Nature 391:344–345[Medline]
  30. Ashhab Y, Dominguez O, Sospedra M, Roura-Mir C, Lucas-Martin A, Pujol-Borrell R 1999 A one-tube polymerase chain reaction protocol demonstrates CC chemokine overexpression in Graves’ disease glands [published erratum appears in J Clin Endocrinol Metab 1999 Dec;84(12):4361]. J Clin Endocrinol Metab 84:2873–2882[Abstract/Free Full Text]
  31. Luster AD 1998 Chemokines-chemotactic cytokines that mediate inflammation. N Engl J Med 338:436–445[Free Full Text]
  32. Lambert NC, Evans PC, Hashizumi TL, Maloney S, Gooley T, Furst DE, Nelson JL 2000 Cutting edge: persistent fetal microchimerism in T lymphocytes is associated with HLA-DQA1*0501: implications in autoimmunity. J Immunol 164:5545–5548[Abstract/Free Full Text]
  33. Srivatsa S, Srivatsa B, Johnson K, Lee SL, Bianchi DW Evidence of fetal cell microchimerism in the thyroid. Proc of the 82nd Annual Meeting of The Endocrine Society, Toronto, Canada, 2000 (Abstract 2407)
  34. Ando T, Imaizumi M, Pritsker A, Davies TF Identification of fetal microchimerism in the human thyroid. Proc of the 83rd Annual Meeting of the Endocrine Society, Denver, CO, 2001 (Abstract OR23-1)
  35. Klintschar M, Schwaiger P, Mannweiler S, Regauer S, Kleiber M 2001 Evidence of fetal microchimerism in Hashimoto’s thyroiditis. J Clin Endocrinol Metab 86:2494–2498[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
JAMAHome page
D. W. Bianchi and N. M. Fisk
Fetomaternal Cell Trafficking and the Stem Cell Debate: Gender Matters
JAMA, April 4, 2007; 297(13): 1489 - 1491.
[Full Text] [PDF]


Home page
Hum ReprodHome page
K. Khosrotehrani, R.R. Reyes, K.L. Johnson, R.B. Freeman, R.N. Salomon, I. Peter, H. Stroh, S. Guegan, and D.W. Bianchi
Fetal cells participate over time in the response to specific types of murine maternal hepatic injury
Hum. Reprod., March 1, 2007; 22(3): 654 - 661.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. Nguyen Huu, M. Oster, S. Uzan, F. Chareyre, S. Aractingi, and K. Khosrotehrani
Maternal neoangiogenesis during pregnancy partly derives from fetal endothelial progenitor cells
PNAS, February 6, 2007; 104(6): 1871 - 1876.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
J. P. Walsh, A. P. Bremner, M. K. Bulsara, P. O'Leary, P. J. Leedman, P. Feddema, and V. Michelangeli
Parity and the Risk of Autoimmune Thyroid Disease: A Community-Based Study
J. Clin. Endocrinol. Metab., September 1, 2005; 90(9): 5309 - 5312.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
K. Poppe, D. Glinoer, H. Tournaye, P. Devroey, A. van Steirteghem, L. Kaufman, and B. Velkeniers
Assisted Reproduction and Thyroid Autoimmunity: An Unfortunate Combination?
J. Clin. Endocrinol. Metab., September 1, 2003; 88(9): 4149 - 4152.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
T. Ando and T. F. Davies
Postpartum Autoimmune Thyroid Disease: The Potential Role of Fetal Microchimerism
J. Clin. Endocrinol. Metab., July 1, 2003; 88(7): 2965 - 2971.
[Abstract] [Full Text] [PDF]


Home page
NEJMHome page
E. N. Pearce, A. P. Farwell, and L. E. Braverman
Thyroiditis
N. Engl. J. Med., June 26, 2003; 348(26): 2646 - 2655.
[Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
A. A. Kokandi, A. B. Parkes, L. D. K. E. Premawardhana, R. John, and J. H. Lazarus
Association of Postpartum Thyroid Dysfunction with Antepartum Hormonal and Immunological Changes
J. Clin. Endocrinol. Metab., March 1, 2003; 88(3): 1126 - 1132.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
T. Ando, M. Imaizumi, P. Graves, P. Unger, and T. F. Davies
Induction of Thyroid-Stimulating Hormone Receptor Autoimmunity in Hamsters
Endocrinology, February 1, 2003; 144(2): 671 - 680.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
T. Ando, M. Imaizumi, P. N. Graves, P. Unger, and T. F. Davies
Intrathyroidal Fetal Microchimerism in Graves' Disease
J. Clin. Endocrinol. Metab., July 1, 2002; 87(7): 3315 - 3320.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Imaizumi, M.
Right arrow Articles by Davies, T. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Imaizumi, M.
Right arrow Articles by Davies, T. F.
Right arrowPubmed/NCBI databases
*Substance via MeSH
Hazardous Substances DB
*THYROGLOBULIN


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals