| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLE |
Department of Biology (S.L.G., P.V., N.M.S.), University of Victoria, Victoria, British Columbia, Canada V8W 3N5; and Faculty of Pharmacy (N.Y.), University of Montreal, Montréal, Québec, Canada, H3C 3J7
Address all correspondence and requests for reprints to: Dr. N. M. Sherwood, Department of Biology, University of Victoria, Victoria, British Columbia, V8W 3N5. E-mail: nsherwoo{at}uvic.ca.
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Brown adipose tissue is the major site of adaptive thermogenesis in neonates and rodents. We show that PACAP null mice have brown adipocytes that differentiate normally and express two enzymes involved in thermogenesis, hormone-sensitive lipase and uncoupling protein 1. Likewise, levels of catecholamines in the adrenal medulla and plasma are normal in PACAP null mice raised at a lower temperature. In contrast, norepinephrine and its precursor dopamine extracted from brown adipose tissue are present at significantly lower levels in the PACAP null mice compared with controls. Also, PACAP null mice showed a greater loss of core body temperature compared with wild-type controls at 21 C. We conclude that under prolonged but mild cold stress, lack of PACAP results in inadequate heat production due to insufficient norepinephrine stimulation of brown adipose tissue.
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
We created a mouse line in which the PACAP gene was disrupted and have revealed a novel function for PACAP in lipid metabolism (5). Most of the PACAP null mice died before 2 wk of age in a wasted state with lipid droplets in liver, heart, and skeletal muscle cells. Although it is known that PACAP regulates hormones involved in lipid metabolism, including insulin and catecholamines, the cause of the lipid accumulation and wasting death in PACAP null mice has yet to be elucidated. Two other PACAP null mouse lines have been generated. One paper (6) reports a higher mortality (about 50%) of PACAP null pups before weaning, whereas the other paper (7) does not discuss mortality. In addition two PAC1 receptor knockout mouse lines report increased mortality with 60% loss (8) or 24% loss (9) in the PAC1 receptor knockout mice before weaning when compared with wild-type controls.
The mechanism of action of PACAP in thermoregulation could depend on norepinephrine and epinephrine that are released from the adrenal medulla or on norepinephrine released from nerve endings in brown adipose tissue. PACAP is present in preganglionic nerve terminals that innervate the adrenal gland (7, 10). PACAP regulates activity and mRNA expression of the catecholamine synthesizing enzymes tyrosine hydroxylase, dopamine ß-hydroxylase, and phenylethanolamine N-methyltransferase (11, 12, 13) and is a potent secretogogue of catecholamines from the adrenal medulla (14).
Within the sympathetic nervous system, PACAP is present with acetylcholine in preganglionic neurons that synapse in the sympathetic ganglia (15) or synapse onto adrenal medullary cells (7). In addition, PACAP is produced in postganglionic nerves of the superior cervical ganglia (16). The PACAP-specific (PAC1) receptor is expressed on postganglionic nerves of the superior cervical ganglion (15) and cells of the adrenal medulla (17). Multiple signaling pathways through the PAC1 receptor (18, 19) are implicated in PACAP-induced catecholamine secretion.
Norepinephrine is the major regulator of adaptive thermogenesis, although thyroid hormones are known to regulate obligatory thermogenesis (20). The importance of norepinephrine in adaptive thermogenesis was reiterated when mice unable to produce norepinephrine and epinephrine (dopamine ß-hydroxylase null mice) were severely cold sensitive (21). Leptin is also involved in adaptive thermogenesis, but its effects are mediated by norepinephrine (22, 23).
The effect of norepinephrine in thermogenesis occurs in brown adipose tissue. In adult humans and other large mammals, the major site of thermoregulation is skeletal muscle (20). In neonates and rodents, brown adipose tissue is the major source of heat production through nonshivering or adaptive thermogenesis (20). Cold is detected and adaptive thermogenesis is activated by the brain, likely in the hypothalamus. Neurons in the hindbrain (raphe pallidus) are activated to stimulate preganglionic sympathetic nerves in the spinal cord (24). Preganglionic sympathetic nerves synapse onto postganglionic neurons in the middle and inferior cervical ganglia and in the first five thoracic ganglia (25). These postganglionic nerves innervate brown adipocytes and the blood vessels within brown adipose tissue to activate heat production and distribution, respectively (26). Norepinephrine is released from sympathetic nerve endings and binds to ß3-adrenergic receptors on brown adipocytes activating hormone sensitive (HS) lipase and uncoupling protein (UCP) 1 (27). HS lipase is activated by cAMP and causes the breakdown of stored triglycerides into free fatty acids (28). The free fatty acids then enter the mitochondria. Brown adipose tissue produces heat by expressing UCP 1, a specialized protein that uncouples mitochondrial respiration from ATP production such that energy is released in the form of heat (20).
Two structurally homologous uncoupling proteins, UCP 2 and UCP 3, have been identified, but their role in nonshivering thermogenesis remains unclear (27). UCP 2 is expressed throughout the body in both white and brown adipose tissue, skeletal muscle, heart, placenta, brain, stomach, kidney, lung, liver, spleen, and thymus (29). UCP 3 is expressed in brown fat, skeletal muscle, and heart (30, 31). When expressed in yeast cells, UCP 2 and UCP 3 have uncoupling properties (29, 31). However, it is argued that UCP 1 is the only protein able to mediate uncoupling of ATP formation and that UCP 2 and 3 share homology in structure with UCP 1, but do not contribute directly to nonshivering thermogenesis (32, 33). In UCP 1 null mice, UCP 2 mRNA was up-regulated in brown adipose tissue suggesting a compensatory mechanism (34). However, UCP 1 null mice were cold sensitive, supporting the conclusion that UCP 2 does not contribute to uncoupling of oxidative phosphorylation (32). UCP 3 has been shown to be regulated by thermogenic signals (31), but knockout and overexpression studies suggest that the primary role of UCP 3 is in the regulation of fatty acid metabolism (35).
This study identifies the phenotype of PACAP null mice as temperature sensitive. To determine the mechanism by which PACAP is regulating thermogenesis, brown adipose tissue and hormones regulating brown adipose tissue within the PACAP null mice are compared with PACAP+/-and PACAP+/+ mice. The paper examines the histology of brown adipose tissue and expression of HS lipase and UCP 1. Tyrosine hydroxylase (TH) expression was assessed in adrenal tissue. Levels of catecholamines in plasma, interscapular brown adipose tissue, and adrenal tissue were measured. We hypothesize that in times of stress, such as cold stress, lack of PACAP prevents sufficient production of catecholamines from the sympathetic nerves innervating brown adipose tissue, resulting in insufficient levels of norepinephrine to activate brown adipocyte nonshivering thermogenesis.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The genotypes of pups born to heterozygous breeding pairs were determined at postnatal d 5. The pups were ear-clipped, creating identification for the individual pups and providing a tissue sample from which DNA was extracted. Genomic DNA was extracted from the small tissue sample using a solution of 5% Chelex (Bio-Rad Laboratories, Inc., Hercules, CA) with 2 mM proteinase K and 0.1% Tween 20. The reaction was incubated at 50 C for 45 min, followed by a 15-min incubation at 94 C to inactivate the proteinase K. The solution was shaken, and the Chelex was allowed to settle to the bottom of the tube. Genomic DNA (1 µl) was then added to a 50-µl PCR containing 2.5 U Taq polymerase (Invitrogen, Carlsbad, CA), 1x Taq buffer, 2.5 mM MgCl2, 0.2 mM deoxynucleoside triphosphates (dNTPs), and 20 pmol of three primers: 5'MP1 (5' ATGTGTAGCGGAGCAAGGCTGG 3'), PA1 (5'CACTCGGACGGCA-TCTTCACAGATAG 3'), and 3'UTR-1 (5'GGCCATTATTGGTATCTTCAAGACGG 3') (Fig. 1A
). The reaction conditions were: denaturation at 94 C for 5 min, then 94 C for 30 sec; annealing at 67 C for 30 sec; extension at 72 C for 30 sec for 32 cycles and a long extension at 72 C for 7 min. Products were run on a 1.5% agarose gel, stained with ethidium bromide, and visualized under UV light. The wild-type allele produced a band of approximately 550 bp, whereas the knockout allele produced a band of approximately 950 bp (Fig. 1B). Thus, the three genotypes produce distinct banding patterns. A PCR that contained 1 µl of H2O instead of genomic DNA served as a negative control for each litter. Initially, a Southern blot was used to confirm the genotyping results obtained from the PCR strategy described above (5). An additional tissue sample was taken from animals at sampling or from knockout pups that died in their second postnatal week to confirm genotypes determined at d 5. Because cages were checked daily for deceased pups in the mortality study, degradation of genomic DNA was not a problem.
|
Temperature challenge
Seven-day-old PACAP+/+ and PACAP-/- mice were removed individually from their mothers, and the first temperature recording (time 0) was taken immediately. After the first recording, the pups were placed alone in a cage with corn cob bedding. The body temperature of the mice was measured using a chromel-alumel thermocouple (diameter, 0.006 mm) as a rectal probe (Omega, Stamford, CT) and recorded by a CR10 data logger (Campbell Scientific, Inc., Logan, UT). Body temperature was recorded at the start of the experiment and at 5, 10, 15, 20, 30, 40, and 50 min after removal from the mother. The animals were euthanized when their body temperature had dropped 10 C. Temperature readings at each time point were averaged for each group of mice: mixed strain PACAP+/+ (n = 7) and PACAP-/- (n = 9) mice and seventh backcrossed PACAP+/+ (n = 5) and PACAP-/-(n = 7) mice. The SE was calculated, and significance (P < 0.05) of the values at each time point was determined using an unpaired t test (two-tailed). Temperature within the room was monitored throughout the procedure with the temperature sensing equipment described above and remained at 21.5 ± 0.5 C. Temperature fluctuations within the cage were minimized by using corn cob bedding without nesting material and by the absence of the mother and siblings. The experimental conditions were identical for both wild-type and PACAP null pups.
Histology and mass of brown adipose tissue
Seven-day-old PACAP+/+ (n = 9), PACAP+/- (n = 20), and PACAP-/- (n = 13) mice were weighed and then euthanized using isoflurane. The interscapular brown fat was dissected from the mice, weighed, and then fixed in 4% paraformaldehyde in PBS overnight or frozen rapidly using liquid nitrogen. Interscapular brown fat mass to body mass ratio was calculated for each brown fat sample. The masses for each genotype were averaged, and the SE was calculated. Significance (P < 0.05) was determined using the Tukey-Kramer multiple comparison test.
Interscapular brown fat that had been fixed was trimmed to a cube approximately 2 mm3. It was washed two times in sterile double-distilled H2O for 20 min and dehydrated through a graded ethanol series. The tissue was embedded in glycol methacrylate (Technovit 700) as described by the manufacturer (Heraeus Kulzer GmbH & Co., Wehrheim, Germany). Once tissue was embedded in the plastic, 7-µm sections were cut using a glass knife and a JB-4 microtome (Sorvall, Newtown, CT). Sections were stained with Delafield’s Hemotoxylin and Eosin Y and viewed on a Universal microscope (Zeiss, Oberkochen, Germany).
Preparation of probes for UCP 1 and HS lipase
Interscapular brown adipose tissue was collected from 7-d-old PACAP+/+, PACAP+/-, and PACAP-/- littermates, frozen immediately in liquid nitrogen, and stored at -80 C. Tissue was ground into a fine powder using a chilled mortar and pestle. mRNA was isolated using the Ambion MicroPoly (A) Pure kit (Ambion, Inc., Austin, TX).
cDNAs for UCP 1 and HS lipase were isolated by RT-PCR to act as template to generate probes for Northern analysis. The mRNA (1 µg) was reverse transcribed in a 50-µl reaction that contained 2 mM oligo dT, 2 mM dNTPs, 1x first strand buffer, 0.01 M dithiothreitol, 5 U RNase inhibitor, and 100 U SuperScript II reverse transcriptase (Life Technologies, Inc., Burlington, Ontario, Canada). The reaction was incubated at 42 C for 90 min, and the enzyme was heat-inactivated at 90 C for 10 min.
cDNA (1 µl) generated from the above reaction was added to two 50-µl PCRs containing 2.5 U Taq polymerase (Life Technologies, Inc.), 1x Taq buffer (Life Technologies, Inc.), 2.5 mM MgCl2, 0.2 mM dNTPs (Life Technologies, Inc.), and 20 pmol sense primer and antisense primer. To isolate a fragment of the UCP 1 cDNA (318 bp) a sense primer (5'AAGGCCAGGCTTCCAGTACTATTAGGT3') and an antisense primer (5'GGTTTGATCCCATGCAGATGGCTCTG3') were used (36). For HS lipase, a 477-bp fragment was amplified using a sense primer (5'ATGGATTTACGCACGATGACACAG3') and an antisense primer (5'TAGCGTGACATACTCTTGCAGGAA3'; Ref. 37). PCR was carried out under the following conditions: denaturation at 94 C for 45 sec;annealing at 60 C for 45 sec; extension at 72 C for 1 min for 32 cycles and a long extension of 5 min. PCR products were separated on a 1.5% agarose gel and visualized under UV light using a still video system (Eagle Eye, Stratagene, San Diego, CA). The UCP 1 and HS lipase PCR products were cloned into the pGEM-T vector system (Promega Corp., Madison, WI) and transfected into XL-2 blue competent cells (Stratagene). Plasmids were purified using a miniprep kit (QIAGEN, Mississauga, Ontario, Canada) and sequenced. cDNA probes for UCP 1 and HS lipase were labeled with 32P using a random priming DNA labeling system according to the manufacturer (Life Technologies, Inc.). The labeled probes were purified on a NAP 5 Sephadex column (Amersham Pharmacia Biotech, Uppsala, Sweden), boiled for 7 min, and iced immediately.
Northern blot of HS lipase and UCP 1
Interscapular brown adipose tissue collected from 7-d-old PACAP+/+, PACAP+/-, and PACAP-/- littermates was frozen immediately in liquid nitrogen and stored at -80 C. Each tissue was ground into a fine powder using a chilled mortar and pestle. Total RNA was isolated using TRIzol as described by the manufacturer (Life Technologies, Inc.). Total RNA from each genotype was pooled to obtain enough RNA for Northern analysis.
A formaldehyde agarose gel was prepared consisting of 210 ml 2% agarose in diethylpyrocarbonate-treated H2O, 60 ml 12.3 M formaldehyde and 66 ml 5x formaldehyde gel running buffer (0.1 M 3[N-morholino]propanesulfonic acid, pH 7.0; 40 mM sodium acetate; 5 mM EDTA). The gel was prerun at 50 V for 5 min. For each genotype, 15 µg total RNA, 3.5 µl formaldehyde, 10 µl formamide, and 2 µl 10xformaldehyde gel loading buffer (50% glycerol; 1 mM EDTA, pH 8.0; 0.25% bromophenol blue; 0.25% xylene cyanol) was loaded onto the gel and run at 60 V for 5 h. When the dye front had migrated 8 cm, the gel was stopped; marker lanes were cut off and stained with ethidium bromide, then visualized under UV light using a still video system (Eagle Eye, Stratagene). The remaining part of the gel was soaked in diethylpyrocarbonate-treated H2O for 15 min, and the RNA was transferred to a positively charged nylon membrane (Ambion, Inc.) via capillary transfer overnight in 10 mM NaOH. The membrane was soaked in 2x SSC and 0.1% SDS for 5 min at room temperature, dried, and baked at 65 C for 30 min. The membrane was prehybridized in ULTRAhyb hybridization buffer (Ambion, Inc.) for 2 h at 55 C.
Both the UCP 1 and HS lipase probes and 50 µl of sea urchin sperm DNA (300 mg/ml) were added to the hybridization buffer and incubated at 55 C with shaking overnight. The membrane was washed with 2x SSC and 0.2% SDS at 55 C for 15 min two times and with 0.2x SSC and 0.2% SDS at 55 C for 30 min two times, wrapped, and exposed to a Phosphor screen (Molecular Dynamics, Inc., Sunnyvale, CA) overnight. The image was developed on the STORM PhosphoImager, and data were analyzed using ImageQuant software (Molecular Dynamics, Inc.). The membrane was reprobed with a 32P-labeled cDNA made against mouse ß-actin under the same conditions as above to standardize the amount of RNA present.
Preparation of TH probe
Seven-day-old PACAP +/+, PACAP+/-, and PACAP-/- mice were euthanized using isoflurane, and adrenal glands were collected. mRNA from pooled adrenal glands was isolated using the MicroPoly (A) Pure mRNA isolation kit (Ambion, Inc.). mRNA (1 µg) was used as template in a RT reaction as above. cDNA (1 µl) generated from the RT reaction was used in a 50-µl PCR containing reagents as above, except for a different sense primer (5'GGTATTCGAGGAGAGGGATGGA3') and antisense primer (5'ACCCGACGCACAGAACTGAG3'; Ref. 38). The primers were used to generate a 240-bp fragment of the tyrosine hydroxylase cDNA. The products generated from the PCR were separated on a 1.5% agarose gel, stained with ethidium bromide, and visualized under UV light using a still video system (Eagle Eye, Stratagene). PCR products were cloned into the pGEM-T vector system (Promega Corp.) and sequenced to confirm their identity. The TH cDNA generated by the above RT-PCR was used as a probe in a Northern blot analysis. The TH cDNA was labeled and purified as above.
Northern blot for TH in adrenal gland
Adrenal glands were collected from 7-d-old PACAP+/+, PACAP+/-, and PACAP-/- littermates, frozen immediately in liquid nitrogen, and stored at -80 C. Each tissue was ground into a fine powder using a chilled mortar and pestle. Total RNA from 12 adrenal glands for each genotype was isolated using TRIzol as described by the manufacturer (Life Technologies, Inc.). Total RNA from each genotype was pooled to obtain enough RNA for Northern analysis.
A formaldehyde agarose gel was prepared and prerun as above but in a total volume of 50 ml. For each genotype, 12 µg adrenal gland RNA, 3.5 µl formaldehyde, 10 µl formamide, and 2 µl 10x formaldehyde gel loading buffer was loaded onto the gel and run at 40 V for 4 h. When the dye front had migrated 6.5 cm, the gel was stopped, and the RNA was transferred and fixed to a positively charged nylon membrane (Ambion, Inc.) as above. The prehybridization and hybridization reactions were run under the same conditions as above, except the hybridization solution contained a probe specific to TH. The membrane was washed twice with 2x SSC and 0.2% SDS at 55 C for 10 min, wrapped, and exposed to a Phosphor screen (Molecular Dynamics, Inc.) overnight. The image was developed, analyzed, and standardized as above.
Plasma catecholamines
Plasma catecholamine concentrations were determined in blood obtained by cardiac puncture with a heparinized needle-syringe from mice anesthetized with isoflurane. Blood (200 µl) was transferred to a centrifuge tube containing 4 µl of preservative solution (pH 6.5) consisting of ethylene glycol-bis (ß-amino-ethyl ether)-N,N,N',N'-tetraacetic acid (95 mg/ml) and glutathione (60 mg/ml). Blood samples were immediately centrifuged for 5 min at 12,000 revolutions/min. Plasma was then transferred to another tube and stored at -80 C until assayed. Plasma concentrations of epinephrine, norepinephrine, and dopamine were quantified by means of an isocratic high-performance liquid chromatographic system (HPLC, Gilson, Villiers-Le-Bel, France) coupled with an electrochemical detector Coulochem II (model 5200; ESA, Inc., Bedford, MA) according to the methods previously published in detail (39).
Tissue catecholamines
Tissue catecholamine contents were determined in the adrenal glands and interscapular brown adipose tissue obtained from anesthetized mice. The tissue was excised and immediately frozen in liquid nitrogen. Frozen tissue was ground into a fine powder using a chilled mortar and pestle and weighed. The powdered tissue was then added to 500 µl of 0.2 N acetic acid containing 3 mM sodium metabisulfite and 5 mM EDTA and mixed vigorously (modified from Ref. 40). The homogenate was centrifuged at 12,000 x g for 15 min. The supernatant was transferred to a new tube and stored at -80 C until assayed. Catecholamines were extracted from the supernatant according to the methods described for plasma catecholamine extraction (39) with slight modifications as follows. To 300 µl of the supernatant in a 15-ml glass tube with a screw cap, 20 µl of an aqueous solution containing dihydroxybenzylamine (10 ng/ml prepared with 0.08 M acetic acid) served as internal standard and 1 ml of 2 M NH4OH-NH4Cl buffer (pH 8.7) containing 0.1% diphenylborate-ethanolamine and 0.5% EDTA were added. After the addition of 5 ml of n-heptane containing 1% n-octanol and 0.25% tetraoctylammonium bromide, the sample solution was mixed with a rotating mixer (Reax 2, Caframo, Wiarton, Ontario, Canada) for 5 min and centrifuged at 2500 revolutions/min for 5 min. Then, 4 ml of the organic phase were transferred to a conic tube, mixed with 2 ml of n-octanol and 600 µl of 0.08 M acetic acid for 5 min, and centrifuged at 2500 revolutions/min for 5 min. The organic phase was discarded, and the aqueous phase was transferred to an amber microtube for the HPLC coupled with the electrochemical detector Coulochem II (ESA, Inc.). The supernatant extracts were analyzed by injecting 20 µl of the aqueous phase into the HPLC column (CSC-Vitess, 3 µm, 5 x 0.46 cm, CSC Sciences, Montréal, Québec, Canada) through a complete filling with an aliquot of 100 µl by means of an autosampling injector (model 231–401, Gilson). Pump flow of the mobile phase was 0.8 ml/min. The effluent was monitored at the following potentials: +300 mV for the first electrode, +60 mV for the second and screen electrode, and -300 mV for the third and quantifying electrode. Full-scale sensitivity was 50 nA and 1 µA for brown adipose tissue and adrenals, respectively.
Significance (P < 0.05) of catecholamine levels in the three genotypes in plasma, brown adipose tissue, and adrenal tissue was determined by a one-way ANOVA, and significance between genotypes was determined using the Tukey-Kramer multiple comparison test.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
).
|
). The mean values for body temperature were tightly grouped for each genotype with little variation. After a 10-min separation from the mother, the knockout mice had a significantly (P < 0.05) lower body temperature than the wild-type controls in both groups of mice. The lower body temperature of the PACAP null mice compared with wild-type controls persisted for the remainder of the experiment (Fig. 3, A and B).
|
). Histological examination of brown adipose tissue from PACAP+/+, PACAP+/-, and PACAP-/- mice shows no difference in the appearance of brown adipose tissue among the three genotypes (Fig. 4B). Brown adipocytes of PACAP null mice contain multiple, lipid-filled droplets within the cytoplasm, a feature representative of differentiated brown adipose tissue.
|
). In PACAP-/- mice, UCP 1 mRNA levels in brown adipocytes were 1.6 times higher than PACAP+/+ and PACAP+/- controls (Fig. 5). Northern blots were repeated to confirm quantitative results. Because pooled tissue had to be used due to small sample size, statistical analysis of the data could not be performed.
|
). Because of the small size of the adrenal glands in the 7-d-old mice pups, pooled tissue was used, which prevents statistical analysis of the data. The Northern blot was repeated three times to confirm quantitative results.
|
). Norepinephrine levels in plasma and adrenal tissue of 7-d-old PACAP+/+, PACAP+/-, and PACAP-/- mice did not differ (P > 0.05) among the three genotypes (Fig. 7). Epinephrine levels in brown adipose tissue, plasma, and adrenal tissue did not differ among the genotypes (Fig. 7). In brown adipose tissue, PACAP null mice showed significantly lower levels of dopamine than wild-type mice, but were not different from heterozygotes (Fig. 7). Also, dopamine in the plasma of heterozygote and null mice was significantly lower (P < 0.05) than that seen in wild-type mice. Dopamine levels in adrenal tissue did not differ between genotypes (Fig. 7).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
). The temperature challenge study confirms the importance of PACAP in thermoregulation as both mixed strain and seventh backcrossed PACAP null mice lost core body temperature more readily than wild-type controls (Fig. 3). Therefore, normal mechanisms to increase body temperature in times of cold stress are not functioning correctly in PACAP null mice. Previous experiments have shown a role for PACAP in thermoregulation. Reserpine-induced hypothermia in mice was reversed by the administration of PACAP-38. Vasoactive intestinal polypeptide did not elicit the same response, which suggests that the PAC1 receptor mediates the hypothermia-reversing effects of PACAP (41). Pataki et al. (42, 43) showed that cerebroventricular administration of PACAP induced hyperthermia in rats. The pathway involved in PACAP-induced hyperthermia is unknown. However, PACAP is produced in the hypothalamus, a site of thermoregulatory control, and has been shown to regulate thermogenic hormones such as thyroid hormones and catecholamines (1).
The main mechanism for adaptive thermogenesis in neonatal rodents is activation of nonshivering thermogenesis in brown adipose tissue by UCP 1 (20). We found that brown adipose tissue of the PACAP-/- mice is present and fully differentiated, as is the brown adipose tissue of PACAP+/- and PACAP+/+ littermates. The calculated interscapular brown fat mass to body mass ratios for PACAP+/+, PACAP+/-, and PACAP-/- mice at postnatal d 7 were not significantly different from one another (Fig. 4A). Histological examination of brown adipose tissue shows the presence of multiple lipid-filled droplets in the cytoplasm of the brown adipocytes (Fig. 4B). In undifferentiated brown adipocytes, lipid droplets are absent or sparse (44). Therefore, we conclude that the thermoregulatory problems associated with the lack of PACAP are not due to a lack of brown adipose tissue or to an inability of brown adipose tissue to differentiate during embryogenesis in the PACAP null mice.
Brown adipocytes of PACAP-/- mice express two enzymes, HS lipase and UCP 1, that function in the breakdown of stored fats for the production of heat. In PACAP null mice, HS lipase and UCP 1 mRNAs are produced at levels at least as high as wild-type controls (Fig. 5). The ability of brown adipocytes from PACAP-/- mice to express both HS lipase and UCP 1 suggests the lack of PACAP is not affecting transcription of these enzymes. In fact, both HS lipase and UCP 1 mRNA are up-regulated in the PACAP null mice compared with wild-type controls. Brown adipose tissue of PACAP null mice is likely functional in nonshivering thermogenesis if a regulatory signal reaches the brown adipocytes.
Norepinephrine, which affects brown adipocyte function, is produced and secreted from two sources. The first source is in sympathetic nerve endings terminating on brown adipocytes, and the second is in the adrenal medulla where it is released into circulation. As the main hormone involved in adaptive thermogenesis, norepinephrine production in PACAP null pups that are unable to thermoregulate was assessed. Because the majority of norepinephrine supplied to brown adipocytes is released directly from the postganglionic nerve terminals innervating brown adipose tissue, we measured levels of catecholamines in extracted interscapular brown adipose tissue. The level of norepinephrine in interscapular brown adipose tissue (463 ng/g) was 171 times higher than levels of norepinephrine in plasma (2.7 ng/ml) and 2.4 times higher than levels in adrenal tissue (194 ng/g). PACAP null mice had significantly decreased levels of norepinephrine and its precursor dopamine in postganglionic nerve terminals innervating brown adipose tissue compared with wild-type and heterozygote controls, suggesting that in times of prolonged cold stress, lack of PACAP inhibits production of dopamine and norepinephrine. Another study showed abnormal catecholamine synthesis in adult PACAP null mice after an insulin challenge, where the lack of PACAP resulted in prolonged hypoglycemia and increased mortality from an inability to maintain sustained epinephrine release from the adrenal medulla (7).
Colocalization of PACAP and norepinephrine in sympathetic nerves that terminate in brown adipose tissue has not been studied, but the two hormones are colocalized in nerve terminals that synapse with arginine vasopressin neurons in the supraoptic nuclei of the hypothalamus. Together, PACAP and norepinephrine have a synergistic effect on vasopressin release (45). If PACAP and norepinephrine are colocalized in the terminals of postganglionic nerves innervating brown adipose tissue, the absence of PACAP in the null mice may prevent synergistic effects of PACAP and norepinephrine on brown adipocytes (Fig. 8).
|
). Because production of heat from brown adipose tissue is activated almost exclusively by norepinephrine, it is not surprising that there were normal levels of epinephrine in all tissues examined and of norepinephrine in the adrenal gland and plasma of cold-stressed PACAP null mice.
Catecholamines are produced in an enzymatic reaction involving three main enzymes (TH, dopamine ß-hydroxylase, and phenylethanolamine N-methyltransferase). PACAP has been shown to regulate transcription and/or activity of all three enzymes in adrenal medullary cells. As the rate-limiting enzyme of catecholamine synthesis, the TH mRNA expression level in adrenal medulla of PACAP null mice was assessed and compared with controls. Normally, PACAP activates transcription of the TH gene, so decreased transcription of the TH gene in PACAP null mice was expected. However, in adrenal tissue of PACAP-/- mice, TH was expressed at levels twice as high as controls (Fig. 6). The up-regulation of TH mRNA expression in the adrenal medulla of PACAP null mice suggests an increased need for TH in the adrenal medulla of cold-stressed PACAP null mice. Therefore, the thermoregulatory problems of the PACAP null mice are not associated with decreased transcription of the TH gene. PACAP can regulate TH activity by phosphorylating serine residues of the TH protein through the cAMP-protein kinase A pathway (10, 46). Decreased TH activity after an insulin challenge was shown in adult PACAP-/- mice that were unable to maintain prolonged epinephrine release (7).
The present study suggests a role for PACAP in sustained activation of the sympathetic nervous system in times of prolonged physiological stress, such as cold stress. When raised at 21 C, PACAP null mice cannot supply appropriate levels of norepinephrine to brown adipocytes, and therefore adaptive thermogenesis of PACAP null mice is decreased. If PACAP also regulates other stress responses in which norepinephrine and epinephrine are released, this could explain why the structure of the PACAP peptide has remained highly conserved (1).
|
Acknowledgments |
|---|
|
Footnotes |
|---|
Abbreviations: dNTP, Deoxynucleoside triphosphate; HS, hormone sensitive; PACAP, pituitary adenylate cyclase-activating polypeptide;PAC1, PACAP-specific; TH, tyrosine hydroxylase; UCP, uncoupling protein.
Received April 15, 2002.
Accepted for publication July 15, 2002.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  B. A. Adams, S. L. Gray, E. R. Isaac, A. C. Bianco, A. J. Vidal-Puig, and N. M. Sherwood Feeding and Metabolism in Mice Lacking Pituitary Adenylate Cyclase-Activating Polypeptide Endocrinology, April 1, 2008; 149(4): 1571 - 1580. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. J. Cummings, C. Willie, and R. J. A. Wilson Pituitary adenylate cyclase-activating polypeptide maintains neonatal breathing but not metabolism during mild reductions in ambient temperature Am J Physiol Regulatory Integrative Comp Physiol, March 1, 2008; 294(3): R956 - R965. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Lacombe, V. Lelievre, C. E. Roselli, W. Salameh, Y.-h. Lue, G. Lawson, J.-M. Muller, J. A. Waschek, and E. Vilain Delayed testicular aging in pituitary adenylate cyclase-activating peptide (PACAP) null mice PNAS, March 7, 2006; 103(10): 3793 - 3798. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. P. Segal, N. R. Stallings, C. E. Lee, L. Zhao, N. Socci, A. Viale, T. M. Harris, M. B. Soares, G. Childs, J. K. Elmquist, et al. Use of Laser-Capture Microdissection for the Identification of Marker Genes for the Ventromedial Hypothalamic Nucleus J. Neurosci., April 20, 2005; 25(16): 4181 - 4188. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. J. Harmar, W. J. Sheward, C. F. Morrison, B. Waser, M. Gugger, and J. C. Reubi Distribution of the VPAC2 Receptor in Peripheral Tissues of the Mouse Endocrinology, March 1, 2004; 145(3): 1203 - 1210. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. J. Cummings, J. D. Pendlebury, N. M. Sherwood, and R. J. A. Wilson Sudden neonatal death in PACAP-deficient mice is associated with reduced respiratory chemoresponse and susceptibility to apnoea J. Physiol., February 15, 2004; 555(1): 15 - 26. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Zhu, C. Tamvakopoulos, D. Xie, J. Dragovic, X. Shen, J. E. Fenyk-Melody, K. Schmidt, A. Bagchi, P. R. Griffin, N. A. Thornberry, et al. The Role of Dipeptidyl Peptidase IV in the Cleavage of Glucagon Family Peptides: IN VIVO METABOLISM OF PITUITARY ADENYLATE CYCLASE-ACTIVATING POLYPEPTIDE-(1-38) J. Biol. Chem., June 13, 2003; 278(25): 22418 - 22423. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
O. Skott Pituitary adenylate cyclase-activating polypeptide and adrenomedullary function Am J Physiol Regulatory Integrative Comp Physiol, February 1, 2003; 284(2): R586 - R587. [Full Text] [PDF]
|
|
|
|
|
|
A. Arimura Editorial: Impaired Adaptive Thermogenesis in Pituitary Adenylate Cyclase-Activating Polypeptide-Deficient Mice Endocrinology, October 1, 2002; 143(10): 3715 - 3716. [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||
