help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gray, S. L.
Right arrow Articles by Sherwood, N. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gray, S. L.
Right arrow Articles by Sherwood, N. M.
Endocrinology Vol. 143, No. 10 3946-3954
Copyright © 2002 by The Endocrine Society


ARTICLE

Temperature-Sensitive Phenotype in Mice Lacking Pituitary Adenylate Cyclase-Activating Polypeptide

Sarah L. Gray, Nobuharu Yamaguchi, Petra Vencová and Nancy M. Sherwood

Department of Biology (S.L.G., P.V., N.M.S.), University of Victoria, Victoria, British Columbia, Canada V8W 3N5; and Faculty of Pharmacy (N.Y.), University of Montreal, Montréal, Québec, Canada, H3C 3J7

Address all correspondence and requests for reprints to: Dr. N. M. Sherwood, Department of Biology, University of Victoria, Victoria, British Columbia, V8W 3N5. E-mail: nsherwoo{at}uvic.ca.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Pituitary adenylate cyclase-activating polypeptide (PACAP) is a highly conserved hormone. Targeted disruption of the PACAP gene has revealed a role for this peptide in lipid metabolism, carbohydrate metabolism, and the sympathetic response to insulin stress. We report here that PACAP null mice are temperature sensitive. When raised at 21 C, only 11% of the PACAP null mice survived past the first 2 wk after birth, but when raised at 24 C, most (76%) of the PACAP null mice survived. The question is the mechanism by which the absence of PACAP affects thermoregulation.

Brown adipose tissue is the major site of adaptive thermogenesis in neonates and rodents. We show that PACAP null mice have brown adipocytes that differentiate normally and express two enzymes involved in thermogenesis, hormone-sensitive lipase and uncoupling protein 1. Likewise, levels of catecholamines in the adrenal medulla and plasma are normal in PACAP null mice raised at a lower temperature. In contrast, norepinephrine and its precursor dopamine extracted from brown adipose tissue are present at significantly lower levels in the PACAP null mice compared with controls. Also, PACAP null mice showed a greater loss of core body temperature compared with wild-type controls at 21 C. We conclude that under prolonged but mild cold stress, lack of PACAP results in inadequate heat production due to insufficient norepinephrine stimulation of brown adipose tissue.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
PITUITARY ADENYLATE CYCLASE-ACTIVATING polypeptide (PACAP) is a member of the glucagon superfamily of hormones, a group of peptides involved in processes of growth and metabolism (1). In vitro, PACAP has been implicated in many functions. It is a releaser of hormones, including insulin in a glucose-dependent manner (2), catecholamines from the adrenal medulla (3), and several hormones from the anterior pituitary (4). In addition, PACAP has been shown to act as a vasorelaxant, a neuromodulator and a regulator of proliferation and differentiation of neuroblasts within the central nervous system and of chromaffin cells of the adrenal medulla during development (1).

We created a mouse line in which the PACAP gene was disrupted and have revealed a novel function for PACAP in lipid metabolism (5). Most of the PACAP null mice died before 2 wk of age in a wasted state with lipid droplets in liver, heart, and skeletal muscle cells. Although it is known that PACAP regulates hormones involved in lipid metabolism, including insulin and catecholamines, the cause of the lipid accumulation and wasting death in PACAP null mice has yet to be elucidated. Two other PACAP null mouse lines have been generated. One paper (6) reports a higher mortality (about 50%) of PACAP null pups before weaning, whereas the other paper (7) does not discuss mortality. In addition two PAC1 receptor knockout mouse lines report increased mortality with 60% loss (8) or 24% loss (9) in the PAC1 receptor knockout mice before weaning when compared with wild-type controls.

The mechanism of action of PACAP in thermoregulation could depend on norepinephrine and epinephrine that are released from the adrenal medulla or on norepinephrine released from nerve endings in brown adipose tissue. PACAP is present in preganglionic nerve terminals that innervate the adrenal gland (7, 10). PACAP regulates activity and mRNA expression of the catecholamine synthesizing enzymes tyrosine hydroxylase, dopamine ß-hydroxylase, and phenylethanolamine N-methyltransferase (11, 12, 13) and is a potent secretogogue of catecholamines from the adrenal medulla (14).

Within the sympathetic nervous system, PACAP is present with acetylcholine in preganglionic neurons that synapse in the sympathetic ganglia (15) or synapse onto adrenal medullary cells (7). In addition, PACAP is produced in postganglionic nerves of the superior cervical ganglia (16). The PACAP-specific (PAC1) receptor is expressed on postganglionic nerves of the superior cervical ganglion (15) and cells of the adrenal medulla (17). Multiple signaling pathways through the PAC1 receptor (18, 19) are implicated in PACAP-induced catecholamine secretion.

Norepinephrine is the major regulator of adaptive thermogenesis, although thyroid hormones are known to regulate obligatory thermogenesis (20). The importance of norepinephrine in adaptive thermogenesis was reiterated when mice unable to produce norepinephrine and epinephrine (dopamine ß-hydroxylase null mice) were severely cold sensitive (21). Leptin is also involved in adaptive thermogenesis, but its effects are mediated by norepinephrine (22, 23).

The effect of norepinephrine in thermogenesis occurs in brown adipose tissue. In adult humans and other large mammals, the major site of thermoregulation is skeletal muscle (20). In neonates and rodents, brown adipose tissue is the major source of heat production through nonshivering or adaptive thermogenesis (20). Cold is detected and adaptive thermogenesis is activated by the brain, likely in the hypothalamus. Neurons in the hindbrain (raphe pallidus) are activated to stimulate preganglionic sympathetic nerves in the spinal cord (24). Preganglionic sympathetic nerves synapse onto postganglionic neurons in the middle and inferior cervical ganglia and in the first five thoracic ganglia (25). These postganglionic nerves innervate brown adipocytes and the blood vessels within brown adipose tissue to activate heat production and distribution, respectively (26). Norepinephrine is released from sympathetic nerve endings and binds to ß3-adrenergic receptors on brown adipocytes activating hormone sensitive (HS) lipase and uncoupling protein (UCP) 1 (27). HS lipase is activated by cAMP and causes the breakdown of stored triglycerides into free fatty acids (28). The free fatty acids then enter the mitochondria. Brown adipose tissue produces heat by expressing UCP 1, a specialized protein that uncouples mitochondrial respiration from ATP production such that energy is released in the form of heat (20).

Two structurally homologous uncoupling proteins, UCP 2 and UCP 3, have been identified, but their role in nonshivering thermogenesis remains unclear (27). UCP 2 is expressed throughout the body in both white and brown adipose tissue, skeletal muscle, heart, placenta, brain, stomach, kidney, lung, liver, spleen, and thymus (29). UCP 3 is expressed in brown fat, skeletal muscle, and heart (30, 31). When expressed in yeast cells, UCP 2 and UCP 3 have uncoupling properties (29, 31). However, it is argued that UCP 1 is the only protein able to mediate uncoupling of ATP formation and that UCP 2 and 3 share homology in structure with UCP 1, but do not contribute directly to nonshivering thermogenesis (32, 33). In UCP 1 null mice, UCP 2 mRNA was up-regulated in brown adipose tissue suggesting a compensatory mechanism (34). However, UCP 1 null mice were cold sensitive, supporting the conclusion that UCP 2 does not contribute to uncoupling of oxidative phosphorylation (32). UCP 3 has been shown to be regulated by thermogenic signals (31), but knockout and overexpression studies suggest that the primary role of UCP 3 is in the regulation of fatty acid metabolism (35).

This study identifies the phenotype of PACAP null mice as temperature sensitive. To determine the mechanism by which PACAP is regulating thermogenesis, brown adipose tissue and hormones regulating brown adipose tissue within the PACAP null mice are compared with PACAP+/-and PACAP+/+ mice. The paper examines the histology of brown adipose tissue and expression of HS lipase and UCP 1. Tyrosine hydroxylase (TH) expression was assessed in adrenal tissue. Levels of catecholamines in plasma, interscapular brown adipose tissue, and adrenal tissue were measured. We hypothesize that in times of stress, such as cold stress, lack of PACAP prevents sufficient production of catecholamines from the sympathetic nerves innervating brown adipose tissue, resulting in insufficient levels of norepinephrine to activate brown adipocyte nonshivering thermogenesis.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Genotyping of pups born to heterozygous breeding pairs
Mixed strain (129SvJ/C57BL/6) mice were used for most of the experiments in this study. In addition, we generated mice backcrossed seven times to a C57BL/6 background, and they exhibited the same phenotype as mixed strain PACAP null mice. The temperature challenge experiment was performed on both mixed strain mice and mice backcrossed seven times.

The genotypes of pups born to heterozygous breeding pairs were determined at postnatal d 5. The pups were ear-clipped, creating identification for the individual pups and providing a tissue sample from which DNA was extracted. Genomic DNA was extracted from the small tissue sample using a solution of 5% Chelex (Bio-Rad Laboratories, Inc., Hercules, CA) with 2 mM proteinase K and 0.1% Tween 20. The reaction was incubated at 50 C for 45 min, followed by a 15-min incubation at 94 C to inactivate the proteinase K. The solution was shaken, and the Chelex was allowed to settle to the bottom of the tube. Genomic DNA (1 µl) was then added to a 50-µl PCR containing 2.5 U Taq polymerase (Invitrogen, Carlsbad, CA), 1x Taq buffer, 2.5 mM MgCl2, 0.2 mM deoxynucleoside triphosphates (dNTPs), and 20 pmol of three primers: 5'MP1 (5' ATGTGTAGCGGAGCAAGGCTGG 3'), PA1 (5'CACTCGGACGGCA-TCTTCACAGATAG 3'), and 3'UTR-1 (5'GGCCATTATTGGTATCTTCAAGACGG 3') (Fig. 1AGo). The reaction conditions were: denaturation at 94 C for 5 min, then 94 C for 30 sec; annealing at 67 C for 30 sec; extension at 72 C for 30 sec for 32 cycles and a long extension at 72 C for 7 min. Products were run on a 1.5% agarose gel, stained with ethidium bromide, and visualized under UV light. The wild-type allele produced a band of approximately 550 bp, whereas the knockout allele produced a band of approximately 950 bp (Fig. 1BGo). Thus, the three genotypes produce distinct banding patterns. A PCR that contained 1 µl of H2O instead of genomic DNA served as a negative control for each litter. Initially, a Southern blot was used to confirm the genotyping results obtained from the PCR strategy described above (5). An additional tissue sample was taken from animals at sampling or from knockout pups that died in their second postnatal week to confirm genotypes determined at d 5. Because cages were checked daily for deceased pups in the mortality study, degradation of genomic DNA was not a problem.



View larger version (28K):
[in this window]
[in a new window]
 
Figure 1. Strategy used to genotype pups born to heterozygous breeding pairs. A, Representation of the mouse PACAP wild-type and PACAP knockout alleles. Locations of primers used for PCR of genomic DNA are shown. B, PCR amplified genomic DNA from PACAP+/+, PACAP+/-, and PACAP-/- mice using the primers 5'MP1, PA-1, and 3'UTR 1 in a single reaction. The knockout allele produces a band of approximately 950 bp, and the wild-type allele produces a band of approximately 550 bp, providing distinct banding patterns for each of the three genotypes.

 
Temperature-sensitive mortality of PACAP-/- mice
Male and female PACAP+/- mice were bred and housed in rooms maintained at either 21 C or 24 C concurrently. The parents and offspring were always maintained at the same room temperature at which breeding occurred. Temperature and humidity in the rooms was recorded continuously. Pregnant females were monitored daily, and the number of pups born to females housed at the different temperatures was recorded on the day of birth. Pups born at the different temperatures were genotyped on postnatal d 5 as above so that individuals could be monitored daily and mortality recorded. The procedures used in this study were approved by the University of Victoria Animal Care Committee.

Temperature challenge
Seven-day-old PACAP+/+ and PACAP-/- mice were removed individually from their mothers, and the first temperature recording (time 0) was taken immediately. After the first recording, the pups were placed alone in a cage with corn cob bedding. The body temperature of the mice was measured using a chromel-alumel thermocouple (diameter, 0.006 mm) as a rectal probe (Omega, Stamford, CT) and recorded by a CR10 data logger (Campbell Scientific, Inc., Logan, UT). Body temperature was recorded at the start of the experiment and at 5, 10, 15, 20, 30, 40, and 50 min after removal from the mother. The animals were euthanized when their body temperature had dropped 10 C. Temperature readings at each time point were averaged for each group of mice: mixed strain PACAP+/+ (n = 7) and PACAP-/- (n = 9) mice and seventh backcrossed PACAP+/+ (n = 5) and PACAP-/-(n = 7) mice. The SE was calculated, and significance (P < 0.05) of the values at each time point was determined using an unpaired t test (two-tailed). Temperature within the room was monitored throughout the procedure with the temperature sensing equipment described above and remained at 21.5 ± 0.5 C. Temperature fluctuations within the cage were minimized by using corn cob bedding without nesting material and by the absence of the mother and siblings. The experimental conditions were identical for both wild-type and PACAP null pups.

Histology and mass of brown adipose tissue
Seven-day-old PACAP+/+ (n = 9), PACAP+/- (n = 20), and PACAP-/- (n = 13) mice were weighed and then euthanized using isoflurane. The interscapular brown fat was dissected from the mice, weighed, and then fixed in 4% paraformaldehyde in PBS overnight or frozen rapidly using liquid nitrogen. Interscapular brown fat mass to body mass ratio was calculated for each brown fat sample. The masses for each genotype were averaged, and the SE was calculated. Significance (P < 0.05) was determined using the Tukey-Kramer multiple comparison test.

Interscapular brown fat that had been fixed was trimmed to a cube approximately 2 mm3. It was washed two times in sterile double-distilled H2O for 20 min and dehydrated through a graded ethanol series. The tissue was embedded in glycol methacrylate (Technovit 700) as described by the manufacturer (Heraeus Kulzer GmbH & Co., Wehrheim, Germany). Once tissue was embedded in the plastic, 7-µm sections were cut using a glass knife and a JB-4 microtome (Sorvall, Newtown, CT). Sections were stained with Delafield’s Hemotoxylin and Eosin Y and viewed on a Universal microscope (Zeiss, Oberkochen, Germany).

Preparation of probes for UCP 1 and HS lipase
Interscapular brown adipose tissue was collected from 7-d-old PACAP+/+, PACAP+/-, and PACAP-/- littermates, frozen immediately in liquid nitrogen, and stored at -80 C. Tissue was ground into a fine powder using a chilled mortar and pestle. mRNA was isolated using the Ambion MicroPoly (A) Pure kit (Ambion, Inc., Austin, TX).

cDNAs for UCP 1 and HS lipase were isolated by RT-PCR to act as template to generate probes for Northern analysis. The mRNA (1 µg) was reverse transcribed in a 50-µl reaction that contained 2 mM oligo dT, 2 mM dNTPs, 1x first strand buffer, 0.01 M dithiothreitol, 5 U RNase inhibitor, and 100 U SuperScript II reverse transcriptase (Life Technologies, Inc., Burlington, Ontario, Canada). The reaction was incubated at 42 C for 90 min, and the enzyme was heat-inactivated at 90 C for 10 min.

cDNA (1 µl) generated from the above reaction was added to two 50-µl PCRs containing 2.5 U Taq polymerase (Life Technologies, Inc.), 1x Taq buffer (Life Technologies, Inc.), 2.5 mM MgCl2, 0.2 mM dNTPs (Life Technologies, Inc.), and 20 pmol sense primer and antisense primer. To isolate a fragment of the UCP 1 cDNA (318 bp) a sense primer (5'AAGGCCAGGCTTCCAGTACTATTAGGT3') and an antisense primer (5'GGTTTGATCCCATGCAGATGGCTCTG3') were used (36). For HS lipase, a 477-bp fragment was amplified using a sense primer (5'ATGGATTTACGCACGATGACACAG3') and an antisense primer (5'TAGCGTGACATACTCTTGCAGGAA3'; Ref. 37). PCR was carried out under the following conditions: denaturation at 94 C for 45 sec;annealing at 60 C for 45 sec; extension at 72 C for 1 min for 32 cycles and a long extension of 5 min. PCR products were separated on a 1.5% agarose gel and visualized under UV light using a still video system (Eagle Eye, Stratagene, San Diego, CA). The UCP 1 and HS lipase PCR products were cloned into the pGEM-T vector system (Promega Corp., Madison, WI) and transfected into XL-2 blue competent cells (Stratagene). Plasmids were purified using a miniprep kit (QIAGEN, Mississauga, Ontario, Canada) and sequenced. cDNA probes for UCP 1 and HS lipase were labeled with 32P using a random priming DNA labeling system according to the manufacturer (Life Technologies, Inc.). The labeled probes were purified on a NAP 5 Sephadex column (Amersham Pharmacia Biotech, Uppsala, Sweden), boiled for 7 min, and iced immediately.

Northern blot of HS lipase and UCP 1
Interscapular brown adipose tissue collected from 7-d-old PACAP+/+, PACAP+/-, and PACAP-/- littermates was frozen immediately in liquid nitrogen and stored at -80 C. Each tissue was ground into a fine powder using a chilled mortar and pestle. Total RNA was isolated using TRIzol as described by the manufacturer (Life Technologies, Inc.). Total RNA from each genotype was pooled to obtain enough RNA for Northern analysis.

A formaldehyde agarose gel was prepared consisting of 210 ml 2% agarose in diethylpyrocarbonate-treated H2O, 60 ml 12.3 M formaldehyde and 66 ml 5x formaldehyde gel running buffer (0.1 M 3[N-morholino]propanesulfonic acid, pH 7.0; 40 mM sodium acetate; 5 mM EDTA). The gel was prerun at 50 V for 5 min. For each genotype, 15 µg total RNA, 3.5 µl formaldehyde, 10 µl formamide, and 2 µl 10xformaldehyde gel loading buffer (50% glycerol; 1 mM EDTA, pH 8.0; 0.25% bromophenol blue; 0.25% xylene cyanol) was loaded onto the gel and run at 60 V for 5 h. When the dye front had migrated 8 cm, the gel was stopped; marker lanes were cut off and stained with ethidium bromide, then visualized under UV light using a still video system (Eagle Eye, Stratagene). The remaining part of the gel was soaked in diethylpyrocarbonate-treated H2O for 15 min, and the RNA was transferred to a positively charged nylon membrane (Ambion, Inc.) via capillary transfer overnight in 10 mM NaOH. The membrane was soaked in 2x SSC and 0.1% SDS for 5 min at room temperature, dried, and baked at 65 C for 30 min. The membrane was prehybridized in ULTRAhyb hybridization buffer (Ambion, Inc.) for 2 h at 55 C.

Both the UCP 1 and HS lipase probes and 50 µl of sea urchin sperm DNA (300 mg/ml) were added to the hybridization buffer and incubated at 55 C with shaking overnight. The membrane was washed with 2x SSC and 0.2% SDS at 55 C for 15 min two times and with 0.2x SSC and 0.2% SDS at 55 C for 30 min two times, wrapped, and exposed to a Phosphor screen (Molecular Dynamics, Inc., Sunnyvale, CA) overnight. The image was developed on the STORM PhosphoImager, and data were analyzed using ImageQuant software (Molecular Dynamics, Inc.). The membrane was reprobed with a 32P-labeled cDNA made against mouse ß-actin under the same conditions as above to standardize the amount of RNA present.

Preparation of TH probe
Seven-day-old PACAP +/+, PACAP+/-, and PACAP-/- mice were euthanized using isoflurane, and adrenal glands were collected. mRNA from pooled adrenal glands was isolated using the MicroPoly (A) Pure mRNA isolation kit (Ambion, Inc.). mRNA (1 µg) was used as template in a RT reaction as above. cDNA (1 µl) generated from the RT reaction was used in a 50-µl PCR containing reagents as above, except for a different sense primer (5'GGTATTCGAGGAGAGGGATGGA3') and antisense primer (5'ACCCGACGCACAGAACTGAG3'; Ref. 38). The primers were used to generate a 240-bp fragment of the tyrosine hydroxylase cDNA. The products generated from the PCR were separated on a 1.5% agarose gel, stained with ethidium bromide, and visualized under UV light using a still video system (Eagle Eye, Stratagene). PCR products were cloned into the pGEM-T vector system (Promega Corp.) and sequenced to confirm their identity. The TH cDNA generated by the above RT-PCR was used as a probe in a Northern blot analysis. The TH cDNA was labeled and purified as above.

Northern blot for TH in adrenal gland
Adrenal glands were collected from 7-d-old PACAP+/+, PACAP+/-, and PACAP-/- littermates, frozen immediately in liquid nitrogen, and stored at -80 C. Each tissue was ground into a fine powder using a chilled mortar and pestle. Total RNA from 12 adrenal glands for each genotype was isolated using TRIzol as described by the manufacturer (Life Technologies, Inc.). Total RNA from each genotype was pooled to obtain enough RNA for Northern analysis.

A formaldehyde agarose gel was prepared and prerun as above but in a total volume of 50 ml. For each genotype, 12 µg adrenal gland RNA, 3.5 µl formaldehyde, 10 µl formamide, and 2 µl 10x formaldehyde gel loading buffer was loaded onto the gel and run at 40 V for 4 h. When the dye front had migrated 6.5 cm, the gel was stopped, and the RNA was transferred and fixed to a positively charged nylon membrane (Ambion, Inc.) as above. The prehybridization and hybridization reactions were run under the same conditions as above, except the hybridization solution contained a probe specific to TH. The membrane was washed twice with 2x SSC and 0.2% SDS at 55 C for 10 min, wrapped, and exposed to a Phosphor screen (Molecular Dynamics, Inc.) overnight. The image was developed, analyzed, and standardized as above.

Plasma catecholamines
Plasma catecholamine concentrations were determined in blood obtained by cardiac puncture with a heparinized needle-syringe from mice anesthetized with isoflurane. Blood (200 µl) was transferred to a centrifuge tube containing 4 µl of preservative solution (pH 6.5) consisting of ethylene glycol-bis (ß-amino-ethyl ether)-N,N,N',N'-tetraacetic acid (95 mg/ml) and glutathione (60 mg/ml). Blood samples were immediately centrifuged for 5 min at 12,000 revolutions/min. Plasma was then transferred to another tube and stored at -80 C until assayed. Plasma concentrations of epinephrine, norepinephrine, and dopamine were quantified by means of an isocratic high-performance liquid chromatographic system (HPLC, Gilson, Villiers-Le-Bel, France) coupled with an electrochemical detector Coulochem II (model 5200; ESA, Inc., Bedford, MA) according to the methods previously published in detail (39).

Tissue catecholamines
Tissue catecholamine contents were determined in the adrenal glands and interscapular brown adipose tissue obtained from anesthetized mice. The tissue was excised and immediately frozen in liquid nitrogen. Frozen tissue was ground into a fine powder using a chilled mortar and pestle and weighed. The powdered tissue was then added to 500 µl of 0.2 N acetic acid containing 3 mM sodium metabisulfite and 5 mM EDTA and mixed vigorously (modified from Ref. 40). The homogenate was centrifuged at 12,000 x g for 15 min. The supernatant was transferred to a new tube and stored at -80 C until assayed. Catecholamines were extracted from the supernatant according to the methods described for plasma catecholamine extraction (39) with slight modifications as follows. To 300 µl of the supernatant in a 15-ml glass tube with a screw cap, 20 µl of an aqueous solution containing dihydroxybenzylamine (10 ng/ml prepared with 0.08 M acetic acid) served as internal standard and 1 ml of 2 M NH4OH-NH4Cl buffer (pH 8.7) containing 0.1% diphenylborate-ethanolamine and 0.5% EDTA were added. After the addition of 5 ml of n-heptane containing 1% n-octanol and 0.25% tetraoctylammonium bromide, the sample solution was mixed with a rotating mixer (Reax 2, Caframo, Wiarton, Ontario, Canada) for 5 min and centrifuged at 2500 revolutions/min for 5 min. Then, 4 ml of the organic phase were transferred to a conic tube, mixed with 2 ml of n-octanol and 600 µl of 0.08 M acetic acid for 5 min, and centrifuged at 2500 revolutions/min for 5 min. The organic phase was discarded, and the aqueous phase was transferred to an amber microtube for the HPLC coupled with the electrochemical detector Coulochem II (ESA, Inc.). The supernatant extracts were analyzed by injecting 20 µl of the aqueous phase into the HPLC column (CSC-Vitess, 3 µm, 5 x 0.46 cm, CSC Sciences, Montréal, Québec, Canada) through a complete filling with an aliquot of 100 µl by means of an autosampling injector (model 231–401, Gilson). Pump flow of the mobile phase was 0.8 ml/min. The effluent was monitored at the following potentials: +300 mV for the first electrode, +60 mV for the second and screen electrode, and -300 mV for the third and quantifying electrode. Full-scale sensitivity was 50 nA and 1 µA for brown adipose tissue and adrenals, respectively.

Significance (P < 0.05) of catecholamine levels in the three genotypes in plasma, brown adipose tissue, and adrenal tissue was determined by a one-way ANOVA, and significance between genotypes was determined using the Tukey-Kramer multiple comparison test.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
PACAP-/- mice survive at 24 C, but not 21 C
Previously, we have shown that PACAP null mice born to heterozygous breeding pairs housed at 21 C die in their second postnatal week in a wasted state (5). Here we show that most PACAP null mice born to female heterozygotes bred and housed at 24 C survive with no signs of the previously reported phenotype. At 24 C, 13 of 17 (76%) PACAP-/- mice were alive at postnatal d 14 compared with only 3 of 28 (11%) mice at 21 C (Fig. 2Go).



View larger version (15K):
[in this window]
[in a new window]
 
Figure 2. Postnatal survival of PACAP-/- mice compared with wild-type and heterozygous controls when bred and raised at either 21 C or 24 C. A, Postnatal survival of PACAP+/+, PACAP+/-, and PACAP-/- mice bred and housed at 21 C. B, Postnatal survival of PACAP+/+, PACAP+/-, and PACAP-/- mice bred and housed at 24 C. P0, Postnatal d 0; P14, postnatal d 14.

 
Temperature challenge severely affects PACAP null mice
A temperature challenge at 21 C shows that the body temperature of PACAP null mice drops faster than their wild-type littermates in both mixed strain mice and mice backcrossed seven times (Fig. 3Go). The mean values for body temperature were tightly grouped for each genotype with little variation. After a 10-min separation from the mother, the knockout mice had a significantly (P < 0.05) lower body temperature than the wild-type controls in both groups of mice. The lower body temperature of the PACAP null mice compared with wild-type controls persisted for the remainder of the experiment (Fig. 3Go, A and B).



View larger version (17K):
[in this window]
[in a new window]
 
Figure 3. Loss of body temperature in PACAP-/- compared with PACAP+/+ mice when subjected to a temperature challenge at 21 C. A, Loss of core body temperature in 7-d-old mixed strain PACAP+/+(n = 7) and PACAP-/- (n = 9) mice when exposed to a temperature challenge at 21 C. B, Loss of core body temperature in 6-d-old backcrossed PACAP+/+ (n = 5) and PACAP-/- (n = 7) mice when exposed to a temperature challenge at 21 C. A significant difference between body temperatures of wild-type and PACAP null mice at a sampling time is represented by * (P < 0.05) or ** (P < 0.01).

 
Brown adipocytes in null mice are differentiated and of normal mass
Interscapular brown fat mass to body mass ratios were calculated for PACAP+/+, PACAP+/-, and PACAP-/- mice at postnatal d 7. There was no significant difference (P > 0.05) between the interscapular brown fat mass to body mass ratios for each genotype (Fig. 4AGo). Histological examination of brown adipose tissue from PACAP+/+, PACAP+/-, and PACAP-/- mice shows no difference in the appearance of brown adipose tissue among the three genotypes (Fig. 4BGo). Brown adipocytes of PACAP null mice contain multiple, lipid-filled droplets within the cytoplasm, a feature representative of differentiated brown adipose tissue.



View larger version (83K):
[in this window]
[in a new window]
 
Figure 4. Presence and morphology of brown adipose tissue in PACAP+/+, PACAP+/-, and PACAP-/- mice. A, Interscapular brown adipose tissue (BAT) mass to body mass ratios for PACAP+/+, PACAP+/-, and PACAP-/- mice at 7 d after birth. B, Histological sections of brown adipose tissue from 7-d-old PACAP+/+, PACAP+/-, and PACAP-/- mice show the presence of lipid droplets in all three genotypes.

 
UCP 1 and HS lipase are expressed in brown adipocytes of PACAP null mice
Levels of HS lipase mRNA in brown adipose tissue were measured by Northern blot. In the PACAP-/- mice, HS lipase expression was 1.6 times higher than in PACAP+/+ mice. The heterozygous PACAP mice also expressed HS lipase at levels 1.6 times higher than wild-type controls (Fig. 5Go). In PACAP-/- mice, UCP 1 mRNA levels in brown adipocytes were 1.6 times higher than PACAP+/+ and PACAP+/- controls (Fig. 5Go). Northern blots were repeated to confirm quantitative results. Because pooled tissue had to be used due to small sample size, statistical analysis of the data could not be performed.



View larger version (52K):
[in this window]
[in a new window]
 
Figure 5. Northern blot analysis of brown adipose tissue showing expression of hormone sensitive lipase (HSL) and UCP 1 mRNA in 7-d-old PACAP+/+, PACAP+/-, and PACAP-/- mice raised at 21 C. Each value represents the amount of HSL or UCP 1 mRNA present in each of the three genotypes. Relative band intensity resulting from the ß-actin Northern blot was used to standardize the amount of mRNA present for each genotype.

 
TH is expressed in the adrenal gland of PACAP null mice
TH mRNA expression levels in the adrenal medulla of PACAP null mice are twice as high as in heterozygous and wild-type controls (Fig. 6Go). Because of the small size of the adrenal glands in the 7-d-old mice pups, pooled tissue was used, which prevents statistical analysis of the data. The Northern blot was repeated three times to confirm quantitative results.



View larger version (31K):
[in this window]
[in a new window]
 
Figure 6. Northern blot analysis of adrenal tissue showing expression of TH mRNA in 7-d-old PACAP+/+, PACAP+/-, and PACAP-/-mice raised at 21 C. Each value represents the amount of TH mRNA present in each of the three genotypes. Relative band intensity resulting from the ß-actin Northern blot was used to standardize the amount of mRNA present for each genotype.

 
Norepinephrine and dopamine are low in brown adipose tissue of PACAP null mice
In brown adipose tissue, norepinephrine levels were significantly (P < 0.05) lower in PACAP-/- mice compared with both PACAP+/- and PACAP+/+ littermates (Fig. 7Go). Norepinephrine levels in plasma and adrenal tissue of 7-d-old PACAP+/+, PACAP+/-, and PACAP-/- mice did not differ (P > 0.05) among the three genotypes (Fig. 7Go). Epinephrine levels in brown adipose tissue, plasma, and adrenal tissue did not differ among the genotypes (Fig. 7Go). In brown adipose tissue, PACAP null mice showed significantly lower levels of dopamine than wild-type mice, but were not different from heterozygotes (Fig. 7Go). Also, dopamine in the plasma of heterozygote and null mice was significantly lower (P < 0.05) than that seen in wild-type mice. Dopamine levels in adrenal tissue did not differ between genotypes (Fig. 7Go).



View larger version (20K):
[in this window]
[in a new window]
 
Figure 7. Dopamine, norepinephrine (NE), and epinephrine (EPI) levels in plasma, brown adipose tissue, and adrenal tissue of 7-d-old PACAP+/+, PACAP+/-, and PACAP-/- mice raised at 21 C. An asterisk above a barrepresents a significance difference (P < 0.05) between that value and the value for the wild-type control only; double asterisks above a bar represent a significant difference (P < 0.05) between that value and the values for the two other genotypes.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The mortality of PACAP null mice increases greatly if they are raised at 21 C compared with 24 C, suggesting that PACAP plays a role in thermogenesis (Fig. 2Go). The temperature challenge study confirms the importance of PACAP in thermoregulation as both mixed strain and seventh backcrossed PACAP null mice lost core body temperature more readily than wild-type controls (Fig. 3Go). Therefore, normal mechanisms to increase body temperature in times of cold stress are not functioning correctly in PACAP null mice.

Previous experiments have shown a role for PACAP in thermoregulation. Reserpine-induced hypothermia in mice was reversed by the administration of PACAP-38. Vasoactive intestinal polypeptide did not elicit the same response, which suggests that the PAC1 receptor mediates the hypothermia-reversing effects of PACAP (41). Pataki et al. (42, 43) showed that cerebroventricular administration of PACAP induced hyperthermia in rats. The pathway involved in PACAP-induced hyperthermia is unknown. However, PACAP is produced in the hypothalamus, a site of thermoregulatory control, and has been shown to regulate thermogenic hormones such as thyroid hormones and catecholamines (1).

The main mechanism for adaptive thermogenesis in neonatal rodents is activation of nonshivering thermogenesis in brown adipose tissue by UCP 1 (20). We found that brown adipose tissue of the PACAP-/- mice is present and fully differentiated, as is the brown adipose tissue of PACAP+/- and PACAP+/+ littermates. The calculated interscapular brown fat mass to body mass ratios for PACAP+/+, PACAP+/-, and PACAP-/- mice at postnatal d 7 were not significantly different from one another (Fig. 4AGo). Histological examination of brown adipose tissue shows the presence of multiple lipid-filled droplets in the cytoplasm of the brown adipocytes (Fig. 4BGo). In undifferentiated brown adipocytes, lipid droplets are absent or sparse (44). Therefore, we conclude that the thermoregulatory problems associated with the lack of PACAP are not due to a lack of brown adipose tissue or to an inability of brown adipose tissue to differentiate during embryogenesis in the PACAP null mice.

Brown adipocytes of PACAP-/- mice express two enzymes, HS lipase and UCP 1, that function in the breakdown of stored fats for the production of heat. In PACAP null mice, HS lipase and UCP 1 mRNAs are produced at levels at least as high as wild-type controls (Fig. 5Go). The ability of brown adipocytes from PACAP-/- mice to express both HS lipase and UCP 1 suggests the lack of PACAP is not affecting transcription of these enzymes. In fact, both HS lipase and UCP 1 mRNA are up-regulated in the PACAP null mice compared with wild-type controls. Brown adipose tissue of PACAP null mice is likely functional in nonshivering thermogenesis if a regulatory signal reaches the brown adipocytes.

Norepinephrine, which affects brown adipocyte function, is produced and secreted from two sources. The first source is in sympathetic nerve endings terminating on brown adipocytes, and the second is in the adrenal medulla where it is released into circulation. As the main hormone involved in adaptive thermogenesis, norepinephrine production in PACAP null pups that are unable to thermoregulate was assessed. Because the majority of norepinephrine supplied to brown adipocytes is released directly from the postganglionic nerve terminals innervating brown adipose tissue, we measured levels of catecholamines in extracted interscapular brown adipose tissue. The level of norepinephrine in interscapular brown adipose tissue (463 ng/g) was 171 times higher than levels of norepinephrine in plasma (2.7 ng/ml) and 2.4 times higher than levels in adrenal tissue (194 ng/g). PACAP null mice had significantly decreased levels of norepinephrine and its precursor dopamine in postganglionic nerve terminals innervating brown adipose tissue compared with wild-type and heterozygote controls, suggesting that in times of prolonged cold stress, lack of PACAP inhibits production of dopamine and norepinephrine. Another study showed abnormal catecholamine synthesis in adult PACAP null mice after an insulin challenge, where the lack of PACAP resulted in prolonged hypoglycemia and increased mortality from an inability to maintain sustained epinephrine release from the adrenal medulla (7).

Colocalization of PACAP and norepinephrine in sympathetic nerves that terminate in brown adipose tissue has not been studied, but the two hormones are colocalized in nerve terminals that synapse with arginine vasopressin neurons in the supraoptic nuclei of the hypothalamus. Together, PACAP and norepinephrine have a synergistic effect on vasopressin release (45). If PACAP and norepinephrine are colocalized in the terminals of postganglionic nerves innervating brown adipose tissue, the absence of PACAP in the null mice may prevent synergistic effects of PACAP and norepinephrine on brown adipocytes (Fig. 8Go).



View larger version (28K):
[in this window]
[in a new window]
 
Figure 8. Hypothesized role of PACAP in the sympathetic control of adaptive thermogenesis. A, One group of preganglionic nerves originate in thoracic (T) segments (T1–T5) of the spinal cord and synapse in the sympathetic ganglia; postganglionic nerves synapse on brown adipose tissue. A second group of sympathetic preganglionic nerves synapse directly on adrenal medullary cells. PACAP is known to be colocalized with acetylcholine (Ach) in the preganglionic neurons that synapse in the adrenal medulla. B, It is not yet elucidated whether there is colocalization of PACAP with Ach in preganglionic fibers that synapse in the sympathetic ganglia or whether there is colocalization of PACAP with norepinephrine (NE) in postganglionic neurons for sympathetic control of brown adipose tissue. EPI, Epinephrine; PAC1, PACAP-specific; C, cervical; L, lumbar; S, sacral spinal cord.

 
Although PACAP causes secretion of norepinephrine and epinephrine directly from the adrenal medulla via multiple signaling pathways, the catecholamines in the adrenal gland of 7-d-old PACAP null mice raised at 21 C were not significantly different from wild-type or heterozygote littermates. Plasma norepinephrine and epinephrine levels were not significantly different in the cold-stressed PACAP null mice compared with controls. Unexpectedly, dopamine levels in the plasma of PACAP+/-and PACAP-/- mice were significantly lower than wild-type mice; there is no clear explanation for this decrease, although dopamine levels in general are low in plasma and the adrenal, compared with brown adipose tissue (Fig. 7Go). Because production of heat from brown adipose tissue is activated almost exclusively by norepinephrine, it is not surprising that there were normal levels of epinephrine in all tissues examined and of norepinephrine in the adrenal gland and plasma of cold-stressed PACAP null mice.

Catecholamines are produced in an enzymatic reaction involving three main enzymes (TH, dopamine ß-hydroxylase, and phenylethanolamine N-methyltransferase). PACAP has been shown to regulate transcription and/or activity of all three enzymes in adrenal medullary cells. As the rate-limiting enzyme of catecholamine synthesis, the TH mRNA expression level in adrenal medulla of PACAP null mice was assessed and compared with controls. Normally, PACAP activates transcription of the TH gene, so decreased transcription of the TH gene in PACAP null mice was expected. However, in adrenal tissue of PACAP-/- mice, TH was expressed at levels twice as high as controls (Fig. 6Go). The up-regulation of TH mRNA expression in the adrenal medulla of PACAP null mice suggests an increased need for TH in the adrenal medulla of cold-stressed PACAP null mice. Therefore, the thermoregulatory problems of the PACAP null mice are not associated with decreased transcription of the TH gene. PACAP can regulate TH activity by phosphorylating serine residues of the TH protein through the cAMP-protein kinase A pathway (10, 46). Decreased TH activity after an insulin challenge was shown in adult PACAP-/- mice that were unable to maintain prolonged epinephrine release (7).

The present study suggests a role for PACAP in sustained activation of the sympathetic nervous system in times of prolonged physiological stress, such as cold stress. When raised at 21 C, PACAP null mice cannot supply appropriate levels of norepinephrine to brown adipocytes, and therefore adaptive thermogenesis of PACAP null mice is decreased. If PACAP also regulates other stress responses in which norepinephrine and epinephrine are released, this could explain why the structure of the PACAP peptide has remained highly conserved (1).


    Acknowledgments
 
We acknowledge the role of Kevin Cummings and Dr. Frank Jirik in the initial observation of temperature sensitivity. We thank Sanae Yamaguchi for technical assistance with the catecholamine analyses, Wendy Lin for assistance with animal handling, and Dr. Nigel Livingston for providing us with temperature monitoring equipment.


    Footnotes
 
Funding for this work was provided by operating grants (to N.M.S. and N.Y.) and a graduate scholarship (to S.L.G.) from the Canadian Institutes of Health Research.

Abbreviations: dNTP, Deoxynucleoside triphosphate; HS, hormone sensitive; PACAP, pituitary adenylate cyclase-activating polypeptide;PAC1, PACAP-specific; TH, tyrosine hydroxylase; UCP, uncoupling protein.

Received April 15, 2002.

Accepted for publication July 15, 2002.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Sherwood NM, Krueckl SL, McRory JE 2000 The origin and function of the pituitary adenylate cyclase-activating polypeptide (PACAP)/glucagon superfamily. Endocr Rev 21:619–670[Abstract/Free Full Text]
  2. Yada T, Sakurada M, Ihida K, Nakata M, Murata F, Arimura A, Kikuchi M 1994 Pituitary adenylate cyclase activating polypeptide is an extraordinarily potent intra-pancreatic regulator of insulin secretion from islet ß-cells. J Biol Chem 269:1290–1293[Abstract/Free Full Text]
  3. Watanabe T, Shimamoto N, Takahashi A, Fujino M 1995 PACAP stimulates catecholamine release from adrenal medulla: a novel noncholinergic secretagogue. Am J Physiol 269:E903–E909
  4. Rawlings SR, Hezareh M 1996 Pituitary adenylate cyclase-activating polypeptide (PACAP) and PACAP/vasoactive intestinal polypeptide receptors: action on the anterior pituitary gland. Endocr Rev 17:4–29[Abstract/Free Full Text]
  5. Gray SL, Cummings KJ, Jirik FR, Sherwood NM 2001 Targeted disruption of the pituitary adenylate cyclase-activating polypeptide gene results in early postnatal death associated with dysfunction of lipid and carbohydrate metabolism. Mol Endocrinol 15:1739–1747[Abstract/Free Full Text]
  6. Hashimoto H, Shintani N, Tanaka K, Mori W, Hirose M, Matsuda T, Sakaue M, Miyazaki J, Niwa H, Tashiro F, Yamamoto K, Koga K, Tomimoto S, Kunugi A, Suetake S, Baba A 2001 Altered psychomotor behaviors in mice lacking pituitary adenylate cyclase-activating polypeptide (PACAP). Proc Natl Acad Sci USA 98:13355–13360[Abstract/Free Full Text]
  7. Hamelink C, Tjurmina O, Damadzic R, Young WS, Weihe E, Lee HW, Eiden LE 2002 Pituitary adenylate cyclase-activating polypeptide is a sympathoadrenal neurotransmitter involved in catecholamine regulation and glucohomeostasis. Proc Natl Acad Sci USA 99:461–466[Abstract/Free Full Text]
  8. Jamen F, Persson K, Bertrand G, Rodriguez-Henche N, Puech R, Bockaert J, Ahren B, Brabet P 2000 PAC1 receptor-deficient mice display impaired insulinotropic response to glucose and reduced glucose tolerance. J Clin Invest 105:1307–1315[Medline]
  9. Otto C, Kovalchuk Y, Wolfer DP, Gass P, Martin M, Zuschratter W, Grone HJ, Kellendonk C, Tronche F, Maldonado R, Lipp HP, Konnerth A, Schutz G 2001 Impairment of mossy fiber long-term potentiation and associative learning in pituitary adenylate cyclase activating polypeptide type I receptor-deficient mice. J Neurosci 21:5520–5527[Abstract/Free Full Text]
  10. Arimura A 1998 Perspectives on pituitary adenylate cyclase activating polypeptide (PACAP) in the neuroendocrine, endocrine, and nervous systems. Jpn J Physiol 48:301–331[CrossRef][Medline]
  11. Isobe K, Yukimasa N, Nakai T, Takuwa Y 1996 Pituitary adenylate cyclase-activating polypeptide induces gene expression of the catecholamine synthesizing enzymes, tyrosine hydroxylase and dopamine ß-hydroxylase, through 3', 5'-cyclic adenosine monophosphate- and protein kinase C-dependent mechanisms in cultured porcine adrenal medullary chromaffin cells. Neuropeptides 30:167–175[CrossRef][Medline]
  12. Marley PD, Cheung CY, Thomson KA, Murphy R 1996 Activation of tyrosine hydroxylase by pituitary adenylate cyclase-activating polypeptide (PACAP-27) in bovine adrenal chromaffin cells. J Auton Nerv Syst 60:141–146[CrossRef][Medline]
  13. Choi HJ, Park SY, Hwang O 1999 Differential involvement of PKA and PKC in regulation of catecholamine enzyme genes by PACAP. Peptides 20:817–822[CrossRef][Medline]
  14. Vaudry D, Gonzalez BJ, Basille M, Yon L, Fournier A, Vaudry H 2000 Pituitary adenylate cyclase-activating polypeptide and its receptors: from structure to functions. Pharm Rev 52:269–324[Abstract/Free Full Text]
  15. Braas KM, May V 1999 Pituitary adenylate cyclase-activating polypeptides directly stimulate sympathetic neuron neuropeptide Y release through PAC1 receptor isoform activation of specific intracellular signaling pathways. J Biol Chem 274:27702–27710[Abstract/Free Full Text]
  16. Brandenburg CA, May V, Braas, KM 1997 Identification of endogenous sympathetic neuron pituitary adenylate cyclase-activating polypeptide (PACAP): depolarization regulates production and secretion through induction of multiple propeptide transcripts. J Neurosci 17:4045–4055[Abstract/Free Full Text]
  17. Spengler D, Waeber C, Pantaloni C, Holsboer F, Bockaert J, Seeburg PH, Journot L 1993 Differential signal transduction by five splice variants of the PACAP receptor. Nature 365:170–175[CrossRef][Medline]
  18. Shioda S, Shimoda Y, Hori T, Mizushima H, Ajiri T, Funahashi H, Ohtaki K, Ryushi T 2000 Localization of the pituitary adenylate cyclase-activating polypeptide receptor and its mRNA in the rat adrenal medulla. Neurosci Lett 295:81–84[CrossRef][Medline]
  19. Lamouche S, Yamaguchi N 2001 Role of PAC(1) receptor in adrenal catecholamine secretion induced by PACAP and VIP in vivo. Am J Physiol Regul Integr Comp Physiol 280:R510–R518
  20. Ricquier D, Miroux B, Larose M, Cassard-Doulcier AM, Bouillaud F 2000 Endocrine regulation of uncoupling proteins and energy expenditure. Int J Obes Relat Metab Disord 24:S86–S88
  21. Thomas SA, Palmiter RD 1997 Thermoregulatory and metabolic phenotypes of mice lacking noradrenaline and adrenaline. Nature 387:94–97[CrossRef][Medline]
  22. Commins SP, Marsh DJ, Thomas SA, Watson PM, Padgett MA, Palmiter R, Gettys TW 1999 Norepinephrine is required for leptin effects on gene expression in brown and white adipose tissue. Endocrinology 140:4772–4778[Abstract/Free Full Text]
  23. Takekoshi K, Ishii K, Nanmoku T, Shibuya S, Kawakami Y, Isobe K, Nakai T 2001 Leptin stimulates catecholamine synthesis in a PKC-dependent manner in cultured porcine adrenal medullary chromaffin cells. Endocrinology 142:4861–4871[Abstract/Free Full Text]
  24. Morrison SF, Sved AF, Passerin AM 1999 GABA-mediated inhibition of raphe pallidus neurons regulates sympathetic outflow to brown adipose tissue. Am J Physiol Regul Integr Comp Physiol 276:R290–R297
  25. Girardier L, Seydoux J 1986 Neural control of brown adipose tissue. In: Trayhurn P, Nicholls DG, eds. Brown adipose tissue. London: Edward Arnold Ltd; 122–131
  26. Derry DM, Daniel H 1969 Sympathetic nerve development in the brown adipose tissue of the rat. Can J Physiol Pharmacol 48:160–168
  27. Lowell BB, Spiegelman BM 2000 Towards a molecular understanding of adaptive thermogenesis. Nature 404:652–660[Medline]
  28. Ganong WF 1999 Review of medical physiology. 19th ed. Stanford: Appleton and Lange; 93–98, 343–344
  29. Fleury C, Neverova M, Collins S, Raimbault S, Champigny O, Levi-Meyrueis C, Bouillaud F, Seldin MF, Surwit RS, Ricquier D, Warden CH 1997 Uncoupling protein-2: a novel gene linked to obesity and hyperinsulinemia. Nat Genet 15:269–272[CrossRef][Medline]
  30. Boss O, Samec S, Paoloni-Giacobino A, Rossier C, Dulloo A, Seydoux J, Muzzin P, Giacobino JP 1997 Uncoupling protein-3: a new member of the mitochondrial carrier family with tissue-specific expression. FEBS Lett 408:39–42[CrossRef][Medline]
  31. Gong DW, He Y, Karas M, Reitman M 1997 Uncoupling protein-3 is a mediator of thermogenesis regulated by thyroid hormone, ß3-adrenergic agonists, and leptin. J Biol Chem 272:24129–24132[Abstract/Free Full Text]
  32. Nedergaard J, Golozoubova V, Matthias A, Asadi A, Jacobsson A, Cannon B 2001 UCP 1: the only protein able to mediate adaptive non-shivering thermogenesis and metabolic inefficiency. Biochem Biophys Acta 1504:82–106[Medline]
  33. Golozoubova V, Hohtola E, Matthias A, Jacobsson A, Cannon B, Nedergaard J 2001 Only UCP1 can mediate adaptive nonshivering thermogenesis in the cold. FASEB J 15:2048–2050[Free Full Text]
  34. Enerbäck S, Jacobsson A, Simpson EM, Guerra C, Yamashita H, Harper ME, Kozak LP 1997 Mice lacking mitochondrial uncoupling protein are cold-sensitive but not obese. Nature 387:90–93[CrossRef][Medline]
  35. Harper ME, Dent RM, Bezaire V, Antoniou A, Gauthier A, Monemdjou S, McPherson R 2001 UCP3 and its putative function: consistencies and controversies. Biochem Soc Trans 29:768–773[CrossRef][Medline]
  36. Soumano K, Desbiens S, Rabelo R, Bakopanos E, Camirand A, Silva JE 2000 Glucocorticoids inhibit the transcriptional response of the uncoupling protein-1 gene to adrenergic stimulation in a brown adipose cell line. Mol Cell Endocrinol 165:7–15[CrossRef][Medline]
  37. Plee-Gautier E, Grober J, Duplus E, Langin D, Forest C 1996 Inhibition of hormone-sensitive lipase gene expression by cAMP and phorbol esters in 3T3–F442A and BFC-1 adipocytes. Biochem J 318:1057–1063
  38. Ichikawa S, Sasaoka T, Nagatsu T 1991 Primary structure of mouse tyrosine hydroxylase deduced from its cDNA. Biochem Biophys Res Commun 176:1610–1616[CrossRef][Medline]
  39. Yamaguchi N 1993 In vivo evidence for adrenal catecholamine release mediated by nonnicotinic mechanism: local medullary effect of VIP. Am J Physiol Regul Integr Comp Physiol 265:R766–R771
  40. Vollmer RR, Meyers-Schoy SA, Kolibal-Pegher SS, Edwards DJ 1995 The role of the adrenal medulla in neural control of blood pressure in rats. Clin Exp Hypertens 17:649–667
  41. Masuo Y, Noguchi J, Morita S, Matsumoto Y 1995 Effects of intracerebroventricular administration of pituitary adenylate cyclase-activating polypeptide (PACAP) on the motor activity and reserpine-induced hypothermia in murines. Brain Res 700:219–226[CrossRef][Medline]
  42. Pataki I, Adamik A, Jászberényi M, Mácsai M, Telegdy G 2000 Pituitary adenylate cyclase-activating polypeptide induces hyperthermia in the rat. Neuropharmacology 39:1303–1308[CrossRef][Medline]
  43. Pataki I, Adamik A, Glover V, Tóth G, Telegdy G 2002 The effects of isatin (indole-2, 3-dione) on pituitary adenylate cyclase-activating polypeptide-induced hyperthermia in rats. BMC Neurosci 3:2–5[CrossRef][Medline]
  44. Casteilla L, Penicaud L, Cousin B, Calise D 2000 Choosing an adipose depot for sampling. In: Ailhaud G, ed. Adipose tissue protocols, vol 155. Totowa, NJ: Humana Press; 1–14
  45. Shioda S, Yada T, Muroya S, Uramura S, Nakajo S, Ohtaki H, Hori T, Shimoda Y, Funahashi H 2000 Functional significance of colocalization of PACAP and catecholamine in nerve terminals. Ann NY Acad Sci 921:211–217[Medline]
  46. Moser A, Scholz J, Gänsle A 1999 Pituitary adenylate cyclase-activating polypeptide (PACAP-27) enhances tyrosine hydroxylase activity in the nucleus accumbens of the rat. Neuropeptides 33:492–497[CrossRef][Medline]



This article has been cited by other articles:


Home page
Pharmacol. Rev.Home page
D. Vaudry, A. Falluel-Morel, S. Bourgault, M. Basille, D. Burel, O. Wurtz, A. Fournier, B. K. C. Chow, H. Hashimoto, L. Galas, et al.
Pituitary Adenylate Cyclase-Activating Polypeptide and Its Receptors: 20 Years after the Discovery
Pharmacol. Rev., September 1, 2009; 61(3): 283 - 357.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
D. Bousquet-Moore, X. M. Ma, E. A. Nillni, T. A. Czyzyk, J. E. Pintar, B. A. Eipper, and R. E. Mains
Reversal of Physiological Deficits Caused by Diminished Levels of Peptidylglycine {alpha}-Amidating Monooxygenase by Dietary Copper
Endocrinology, April 1, 2009; 150(4): 1739 - 1747.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
B. A. Adams, S. L. Gray, E. R. Isaac, A. C. Bianco, A. J. Vidal-Puig, and N. M. Sherwood
Feeding and Metabolism in Mice Lacking Pituitary Adenylate Cyclase-Activating Polypeptide
Endocrinology, April 1, 2008; 149(4): 1571 - 1580.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
K. J. Cummings, C. Willie, and R. J. A. Wilson
Pituitary adenylate cyclase-activating polypeptide maintains neonatal breathing but not metabolism during mild reductions in ambient temperature
Am J Physiol Regulatory Integrative Comp Physiol, March 1, 2008; 294(3): R956 - R965.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. Lacombe, V. Lelievre, C. E. Roselli, W. Salameh, Y.-h. Lue, G. Lawson, J.-M. Muller, J. A. Waschek, and E. Vilain
Delayed testicular aging in pituitary adenylate cyclase-activating peptide (PACAP) null mice
PNAS, March 7, 2006; 103(10): 3793 - 3798.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
J. P. Segal, N. R. Stallings, C. E. Lee, L. Zhao, N. Socci, A. Viale, T. M. Harris, M. B. Soares, G. Childs, J. K. Elmquist, et al.
Use of Laser-Capture Microdissection for the Identification of Marker Genes for the Ventromedial Hypothalamic Nucleus
J. Neurosci., April 20, 2005; 25(16): 4181 - 4188.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. J. Harmar, W. J. Sheward, C. F. Morrison, B. Waser, M. Gugger, and J. C. Reubi
Distribution of the VPAC2 Receptor in Peripheral Tissues of the Mouse
Endocrinology, March 1, 2004; 145(3): 1203 - 1210.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
K. J. Cummings, J. D. Pendlebury, N. M. Sherwood, and R. J. A. Wilson
Sudden neonatal death in PACAP-deficient mice is associated with reduced respiratory chemoresponse and susceptibility to apnoea
J. Physiol., February 15, 2004; 555(1): 15 - 26.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. Zhu, C. Tamvakopoulos, D. Xie, J. Dragovic, X. Shen, J. E. Fenyk-Melody, K. Schmidt, A. Bagchi, P. R. Griffin, N. A. Thornberry, et al.
The Role of Dipeptidyl Peptidase IV in the Cleavage of Glucagon Family Peptides: IN VIVO METABOLISM OF PITUITARY ADENYLATE CYCLASE-ACTIVATING POLYPEPTIDE-(1-38)
J. Biol. Chem., June 13, 2003; 278(25): 22418 - 22423.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
O. Skott
Pituitary adenylate cyclase-activating polypeptide and adrenomedullary function
Am J Physiol Regulatory Integrative Comp Physiol, February 1, 2003; 284(2): R586 - R587.
[Full Text] [PDF]


Home page
EndocrinologyHome page
A. Arimura
Editorial: Impaired Adaptive Thermogenesis in Pituitary Adenylate Cyclase-Activating Polypeptide-Deficient Mice
Endocrinology, October 1, 2002; 143(10): 3715 - 3716.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gray, S. L.
Right arrow Articles by Sherwood, N. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gray, S. L.
Right arrow Articles by Sherwood, N. M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals