Endocrinology Vol. 143, No. 10 3984-3993
Copyright © 2002 by The Endocrine Society
A Prostaglandin F2
Analog Induces Suppressors of Cytokine Signaling-3 Expression in the Corpus Luteum of the Pregnant Rat: A Potential New Mechanism in Luteolysis
J. D. Curlewis,
S. P. Tam,
P. Lau,
D. H. L. Kusters,
J. L. Barclay,
S. T. Anderson and
M. J. Waters
School of Biomedical Sciences, Department of Physiology and Pharmacology and Institute for Molecular Biosciences, University of Queensland, Queensland 4072, Australia
Address all correspondence and requests for reprints to: J. D. Curlewis, Ph.D., Department of Physiology and Pharmacology, University of Queensland, Queensland 4072, Australia. E-mail: .
 |
Abstract
|
|---|
PRL and placental lactogen (PL) play key roles in maintaining the rodent corpus luteum through pregnancy. Suppressors of cytokine signaling (SOCS) have been shown to decrease cell sensitivity to cytokines, including PRL, and so here we have addressed the issue of whether luteolysis induced by prostaglandin F2
(PGF2
) might up-regulate SOCS proteins to inhibit PRL signaling. In d 19 pregnant rats, cloprostenol, a PGF2
analog, rapidly induced transcripts for SOCS-3 and, to a lesser extent, SOCS-1. We also found increased SOCS-3 protein in the ovary by immunoblot and in the corpus luteum by immunohistochemistry. Increased SOCS-3 expression was preceded by an increase in STAT3 tyrosine phosphorylation 10 min after cloprostenol injection and was maintained for 4 h, as determined by gel shift and immunohistochemistry. Induction of SOCS-3 was accompanied by a sharp decrease in active STAT5, as determined by gel-shift assay and by loss of nuclear localized STAT5. Four hours after cloprostenol administration, the corpus luteum was refractory to stimulation of STAT5 by PRL administration, and this was not due to down-regulation of PRL receptor. Therefore, induction of SOCS-3 by PGF2
may be an important element in the initiation of luteolysis via rapid suppression of luteotropic support from PL.
 |
Introduction
|
|---|
IN RODENTS, the corpus luteum is essential for the maintenance of pregnancy because of the key roles of secreted progesterone in facilitating embryo implantation and decidualization of the endometrial stroma as well as maintaining quiescence of the uterine myometrium. Pituitary PRL supports the corpus luteum of early pregnancy in rodents, and placental lactogens (PL), acting through the PRL receptor, support it from midpregnancy to term (reviewed in Ref. 1). The importance of PRL and its receptor in maintaining the corpus luteum of pregnancy in rodents was earlier demonstrated by studies with neutralizing antisera to PRL (2) and was more recently demonstrated with both PRL and PRL receptor knockout mice (3, 4). Likewise, the importance of the key signaling intermediate used by the PRL receptor to support the rodent corpus luteum, signal transducer and activator of transcription 5 (STAT5), is illustrated by the inability of STAT5a/b double knockout mice to form or maintain a corpus luteum (5). PRL is thought to maintain progesterone output from the rodent corpus luteum by a range of complementary actions, including facilitation of the luteotropic actions of estrogen by increasing the synthesis of estrogen receptors
and ß (6), and by up-regulating LH receptors (7, 8). PRL also increases cholesterol substrate availability for progesterone synthesis by increasing high density lipoprotein-binding sites (9, 10), luteal cholesterol esterase activity (11), and the P450 side-chain cleavage enzyme (12). The repression of 20
-hydroxysteroid dehydrogenase (20
-HSD) expression by PRL (13, 14) is also an important element in the luteotropic actions of PRL, because it prevents further metabolism of progesterone to 20
-hydroxyprogesterone (reviewed in Ref. 1). This repression, like the up-regulation of estrogen receptor and potentially other actions listed above, is believed to involve STAT5b signaling (15). These actions are brought to an end by luteolysis at the end of pregnancy, through a prostaglandin F2
(PGF2
)-dependent process that is absent in the PGF2
receptor knockout mouse (16). Recent gene array data (17) show that PGF2
and PRL have opposite effects on the expression of many genes in the rat corpus luteum, raising the possibility of functional antagonism between these two hormones.
We have recently reported that the STAT5a-dependent actions of PRL in signaling to the milk protein ß-lactoglobulin gene promoter are inhibited by members of the suppressors of cytokine signaling (SOCS) family of rapid response genes (18). Moreover, we observed an induction of SOCS-3 during the initial stages of mammary gland involution caused by pup withdrawal (18). Mammary gland involution requires STAT3 (19), and SOCS-3 transcript expression is strongly up-regulated by STAT3 (20). Considering the parallels between the apoptotic processes of mammary gland involution and luteolysis, we tested the hypothesis that a major element in the luteolytic action of PGF2
in the rat is blockade of the luteotropic action of PRL/PL by induction of SOCS proteins. This study reports that an analog of PGF2
is able to potently induce SOCS-3 expression, which would contribute substantially to its role in luteolysis.
 |
Materials and Methods
|
|---|
Materials
Ovine PRL (oPRL-20) was obtained from the National Hormone and Peptide Program (Baltimore, MD). Goat anti-PRL receptor (s46) was a gift from J. Djiane (Jouy-en-Josas, France). Goat anti-SOCS-3 (sc 7009), rabbit anti-STAT1 (sc346X), anti-STAT3 (sc482X), and anti-STAT5 (sc835X) were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). Rabbit anti-SOCS-3 antibody was a gift from D. J. Hilton (Melbourne, Australia). Biotinylated donkey antirabbit antibody (RPN1004), streptavidin-horseradish peroxidase (HRP; RPN1015), HRP-conjugated sheep antimouse antibody (NA931), and HRP-conjugated donkey antirabbit antibody (NA934) were purchased from Amersham Pharmacia Biotech (Uppsala, Sweden). Biotinylated rabbit antigoat antibody (85-9943) was obtained form Zymed Laboratories, Inc. (South San Francisco, CA). Donkey antirabbit Texas Red conjugate (711-075-152) was purchased from Jackson ImmunoResearch Laboratories, Inc. (West Grove, PA). HRP-conjugated rabbit antigoat antibody (31402) was purchased from Pierce Chemical Co. (Rockford, IL).
Animals
All experiments were performed on d 19 pregnant Wistar rats (day of mating plug = d 1). Animals were injected sc with cloprostenol (5 µg in 0.25 ml saline; Estrumate, Schering Plough Animal Health Corp., North Ryde, Australia) or vehicle and then were killed 0.516 h later with an overdose of pentobarbitone. The ovaries were rapidly removed and frozen on solid CO2 (for Northern blots, Western blots, and EMSAs) or were immersion-fixed in 4% paraformaldehyde in 0.1 M phosphate buffer for 4 h (for immunohistochemistry). In one experiment animals were treated with cloprostenol, followed 3 h and 25 min later by a sc injection of oPRL (250 µg) or vehicle and then were killed at 4 h after the cloprostenol. In all experiments three animals were used for each treatment group. These experiments were approved by the University of Queensland animal ethics committee according to the National Health and Medical Research Council (Australia) guidelines.
Northern hybridization
Total RNA was isolated from ovaries using TRIzol reagent (Life Technologies, Inc., Gaithersburg, MD), and Northern blots were performed for SOCS-1, SOCS-2, SOCS-3, and cytokine-inducible SH2-containing protein (CIS) as previously described (18). Membranes were stripped and rehybridized with a probe to 18S rRNA for standardization (18). Densitometer scans were also performed as previously described (18), and results were expressed as the fold induction relative to vehicle-treated controls collected at 0.5 h.
Immunoblotting and immunoprecipitation
The immunoblotting procedure was undertaken using the protocol described by Tam et al. (18), with minor modifications. Briefly, frozen ovaries were homogenized in RIPA buffer [150 mM NaCl, 1% Nonidet P-40, 0.5% sodium deoxycholate, 0.1% sodium dodecyl sulfate, and 50 mM Tris (pH 7.5)] with complete protease inhibitor cocktail (catalogue no. 1697498, Roche, Mannheim, Germany). Lysates were then boiled in Laemmli sample buffer before being centrifuged.
For SOCS-3 immunoblotting, total lysates containing 150 µg protein were electrophoresed on 13% (29:1) SDS-PAGE gels and then transferred onto nitrocellulose membranes. The prepared nitrocellulose membranes were incubated with Tris-buffered saline (pH 7.5) containing 3% teleostean gelatin (Sigma, St. Louis, MO; catalog no. G 7765) and 0.2% Tween 20 to block nonspecific binding. The membranes were probed with goat anti-SOCS-3 antibody (sc7009) at 1:250 at 4 C overnight. Thereafter, membranes were incubated with HRP-conjugated rabbit antigoat antibody at 1:25,000 for 1.5 h at room temperature, followed by development with ECL Plus (Amersham Pharmacia Biotech). For the positive control, total cell lysate from Flag-SOCS-3 cDNA vector-transfected HEK-293 cells were used as previously described (18).
For PRL receptor immunoblotting, total lysate containing 200 µg protein was electrophoresed on 8% (29:1) SDS-PAGE gels and then transferred onto nitrocellulose membranes. The prepared nitrocellulose membranes were blocked with Tris-buffered saline (pH 7.5) containing 5% skim milk powder/0.2% Tween 20 and probed with goat anti-PRL receptor s46 (1:5000) (21, 22) at 4 C overnight. Thereafter, membranes were incubated with HRP-conjugated rabbit antigoat antibody at 1:25,000 for 1 h at room temperature, followed by development with ECL Plus (Amersham Pharmacia Biotech). For the positive control, total cell lysate from rabbit PRL receptor cDNA vector-transfected COS-1 cells was used as previously described (18). SOCS-3 and PRL receptor Western blots were quantified by densitometry, and results were expressed as the fold induction relative to that in vehicle-treated controls.
For immunoprecipitation of STAT3, ovaries were homogenized in RIPA buffer with 10 mM NaF, 1 mM Na3VO4, 1 mM Na4P2O7, and complete protease inhibitor cocktail (Roche). After 30-min incubation, the lysate was cleared by 30-min centrifugation at 15,000 rpm in a microcentrifuge at 4 C. Lysate containing 1.5 mg protein (as determined by the bicinchoninic acid protein assay, Pierce Chemical Co.) were immunoprecipitated for 2 h at 4 C with 3 µg anti-STAT3 antibody bound to protein A/Sepharose (Amersham Pharmacia Biotech). After extensive washing, bound proteins were eluted by boiling in SDS-PAGE sample buffer, run on 8.5% SDS-PAGE gels, and transferred to nitrocellulose membranes.
The prepared nitrocellulose membranes were blocked with Tris-buffered saline (pH 7.5) containing 3% BSA/0.1% Tween 20 and probed with monoclonal phosphotyrosine antibody 4G10 at 1:1000 (Upstate Biotechnology, Inc., Lake Placid, NY) at room temperature for 2 h. Thereafter, membranes were incubated with HRP-conjugated sheep antimouse antibody at 1:10,000 for 1 h at room temperature, followed by development with ECL Plus (Amersham Pharmacia Biotech). The membrane was stripped and reprobed with anti-STAT3 antibody at 1:1000.
Immunohistochemistry
Localization of SOCS-3 immunoreactivity in the ovary was performed using two SOCS-3 primary antibodies with different protocols. Paraffin sections (5 µm) were dewaxed, rehydrated, pretreated with 3% H2O2, blocked with 10% normal horse serum, and then incubated with either rabbit anti-SOCS-3 (Hilton; 1:200) or nonimmune rabbit serum (negative control) overnight at 4 C. After washing in PBS, sections were incubated with biotinylated donkey antirabbit (1:200) for 2 h at room temperature, washed, then incubated with streptavidin-HRP complex (1:200) for another 2 h. Sections were developed for 57 min with diaminobenzidene substrate before being counterstained with hematoxylin, dehydrated, and mounted. To verify the specificity of SOCS-3 staining in response to cloprostenol, immunolabeling with another antibody was also performed on fixed ovaries that were equilibrated in 30% sucrose/0.1 M PBS before being frozen and sectioned (10 µm) on a cryostat. Sections were washed in PBS, treated with 3% H2O2, serum-blocked, then incubated with goat anti-SOCS-3 antibody (sc7009; 1:1000) for 24 h at 4 C. After further washing in PBS, biotinylated rabbit antigoat was used as the secondary antibody, followed by streptavidin-HRP complex and diaminobenzidene for visualization. All immunolabeling was performed on slides with paired ovaries, one from each treatment. Sections were viewed with a Zeiss Axioskop light microscope (Carl Zeiss, New York, NY), and images were acquired with an Olympus Corp. DP11 digital camera system (New Hyde Park, NY).
STAT3 and STAT5 immunostaining were examined on fixed ovarian tissue from which cryostat sections were prepared as described above. Sections were then incubated with either rabbit anti-STAT3 (sc482X; 1:1000) or rabbit anti-STAT5 (sc835X; 1:1000) for 24 h at 4 C. They were then rinsed in PBS, incubated with donkey antirabbit Texas red (1:400) for 18 h at 4 C, washed, and coverslipped. Confocal immunofluorescence images were obtained using a Nikon Eclipse E600 upright microscope (Melville, NY) with a confocal scanning system [Radiance 2000HP Scanhead with three descanned detectors, Bio-Rad Laboratories, Inc. (Richmond, CA)] equipped with a four-line argon laser (488-nm line) and a helium/neon laser (568-nm line). A 570LP (long-pass) filter was used; the excitation/emission maxima for Texas Red is 596/615 nm. Images were captured with the Lasersharp 2000 software (Bio-Rad Laboratories, Inc.) and edited in Adobe Photoshop 4.0 (Adobe Systems, San Jose, CA).
Oligonucleotide probes and EMSA
Double-stranded oligonucleotide probes used in EMSA and for cold competition were: STAT5 DNA binding element, 5'-AGA TTTCTAGGAATTCAATCC-3' (sc-2565; Santa Cruz Biotechnology, Inc.); STAT DNA-binding element on SOCS-3 promoter, 5'-CAGTTCCAGGAATCGGGGGGC-3' (20); and acute phase response element, GATCCTTCCGGGAATTCCTA (23). The methodology for EMSA and supershift has been previously described in detail (18). Cold competition studies involved coincubation of unlabeled probes with labeled probes at 10- and 50-fold molar excesses with nuclear extracts in binding buffer for 30 min on ice before gel separation.
Statistics
All data were log transformed before analysis to normalize variance. Northern blots were analyzed by one-way ANOVA. Where significant treatment effects were obtained, Duncans new multiple range test was then used to compare individual means. For Western blots, two-way ANOVA was used to test for effects of treatment and time. However, because there were significant (P < 0.05) treatment x time interactions in both analysis (Figs. 2
and 10
), we then performed independent one-way ANOVA at each time point.

View larger version (37K):
[in this window]
[in a new window]
|
Figure 2. Western blot for SOCS-3 in ovaries from animals killed 0.58 h after treatment with vehicle (-) or cloprostenol (+). Dissected ovaries were homogenized with RIPA buffer and then analyzed for protein expression of SOCS-3 as described in Materials and Methods. Endogenous and Flag-SOCS-3 fusion proteins are indicated (arrows). The positive control marker for SOCS-3 consists of a flag-tagged SOCS-3 protein product that is 2 kDa greater in molecular mass than endogenous protein, as previously described (18 ). The bottom panel shows the mean induction relative to vehicle-treated controls (±SEM; n = 3 rats). *, P < 0.05 compared with vehicle-treated rats at the same time.
|
|

View larger version (33K):
[in this window]
[in a new window]
|
Figure 10. Resistance to PRL signaling at 4 h is not due to down-regulation of PRL receptor. Total protein lysates from cloprostenol- or vehicle-treated ovaries were immunoblotted for PRL receptor as described in Materials and Methods. PRL receptor was down-regulated only at 8 h after cloprostenol treatment. The bottom panel shows mean induction relative to vehicle-treated controls (±SEM; n = 3 rats). **, P < 0.01 compared with vehicle-treated rats at the same time.
|
|
 |
Results
|
|---|
PGF2
analog induces SOCS-3 mRNA and protein expression in the ovary
Administration of cloprostenol to d 19 pregnant rats caused a rapid and significant (P < 0.01, by ANOVA) increase in SOCS-1 and SOCS-3 mRNA. The increase in SOCS-1 mRNA was only evident at 0.5 h, whereas the increase in SOCS-3 mRNA was more sustained, lasting from 0.54 h after cloprostenol treatment (Fig. 1
). This increased SOCS-3 mRNA expression could be detected as early as 15 min after cloprostenol administration (results not shown). SOCS-2 and CIS mRNA were expressed in the ovary, but were not influenced by cloprostenol.

View larger version (31K):
[in this window]
[in a new window]
|
Figure 1. Cloprostenol induces SOCS-3 mRNA expression in the ovary. Day 19 pregnant Wistar rats were injected sc with cloprostenol (5 µg) or vehicle and were then killed 0.516 h later. Ovaries were dissected, and total RNA was extracted. The RNA was then analyzed for SOCS gene expression by Northern analysis and was normalized with the 18S rRNA probe as previously described (18 ). The top panel shows representative Northern blots. The bottom panels show the mean induction of SOCS mRNA ± SEM (n = 3 rats) for vehicle-treated (0.5 and 4 h) and cloprostenol-treated (0.58 h) groups. P < 0.05 compared with either vehicle-treated control.
|
|
SOCS-3 protein expression in the ovary was determined by Western blot. Ovaries from cloprostenol- and vehicle-treated rats were collected 0.5, 2, 4, and 8 h after treatment. At 2 and 4 h, cloprostenol caused a significant (P < 0.05) increase in SOCS-3 protein (Fig. 2
), but at 8 h, SOCS-3 protein expression was not different between vehicle and cloprostenol.
Effect of PGF2
analog on distribution of SOCS-3 protein in the ovary
The cellular distribution of SOCS-3 in the ovary at d 19 of pregnancy was examined 4 h after the injection of either vehicle or cloprostenol. In both groups of animals SOCS-3 immunoreactivity was largely confined to the corpora lutea (Fig. 3a
), with low levels of staining also present in some interstitial cells and blood vessels. Within luteal cells, SOCS-3 immunoreactivity was confined to the cytoplasmic compartment. Overall SOCS-3 immunoreactivity was more intense in the corpora lutea of cloprostenol-treated animals, although, as shown in Fig. 3
, ch, the distribution was not uniform across all cells of a corpus luteum, and the intensity also differed between corpora lutea (not shown).

View larger version (193K):
[in this window]
[in a new window]
|
Figure 3. SOCS-3 immunoreactivity in the ovary of d 19 pregnant rats obtained 4 h after vehicle or cloprostenol injection. SOCS-3 labeling (brown) was observed predominantly in corpora lutea of ovaries immunolabeled with rabbit anti-SOCS-3 antibody (a), but not in those immunolabeled with nonimmune rabbit serum (b). Within luteal cells, cytoplasmic SOCS-3 immunolabeling was more intense in the corpora lutea of cloprostenol-treated animals (d and f) than in vehicle controls (c and e). Sections are counterstained with hematoxylin (blue). Differences between treatments in the intensity of cytoplasmic SOCS-3 labeling were confirmed with a goat anti-SOCS3 antibody: vehicle (g) vs. cloprostenol (h). Results are representative of three rats for each treatment.
|
|
PGF2
analog inhibits STAT5 activation
Previous studies have shown that a low level of nuclear phosphorylated STAT5 is maintained through pregnancy, presumably due to activation of PRL receptor by PL (24). Here we used immunofluorescence to examine the cellular distribution of STAT5 in luteal cells from vehicle- or cloprostenol-treated animals. Four hours after vehicle injection, STAT5 immunostaining in the majority of luteal cells was most intense in the nucleus compared with cytoplasm (Fig. 4
, A and C). In contrast, 4 h after cloprostenol treatment, the nucleus was devoid of immunostaining and appears as a black circle surrounded by cytoplasmic immunostaining for STAT5 (Fig. 4
, B and D). Similar differences in STAT5 cellular localization were also evident in corpora lutea collected 2 h after cloprostenol or vehicle injection (results not shown).

View larger version (192K):
[in this window]
[in a new window]
|
Figure 4. Nuclear STAT5 immunostaining in luteal cells is reduced by cloprostenol. Confocal images of STAT5 immunoreactivity in the corpus luteum of ovaries obtained 4 h after vehicle (A and C) or cloprostenol (B and D) injection. Sections were labeled with rabbit anti-STAT5 antibody and visualized with donkey antirabbit Texas Red conjugate. Results are representative of the pattern seen in three rats from each treatment.
|
|
We also used EMSAs to evaluate the effect of cloprostenol on STAT5 in the ovary at 0.5, 2, 4, and 8 h after cloprostenol or vehicle treatment. In Fig. 5A
we used a STAT5 DNA-binding element and found that a high level of active STAT5 was maintained during the sampling period in vehicle-treated controls. In contrast, active STAT5 was reduced at all time points after cloprostenol injection. Supershift with anti-STAT5 confirmed that the predominant DNA element-binding activity was due to STAT5. This result was confirmed with the STAT DNA-binding element from the SOCS-3 promoter (Fig. 5B
), which binds STAT1, -3, and -5 (20, 25). Again, active STAT was present at all time points after vehicle injection, and activity was inhibited by cloprostenol. Supershift with anti-STAT5 confirmed that the major band was due to active STAT5, but in cloprostenol-treated animals a faint band just above the position of the main band of active STAT was seen up to 4 h after treatment. This additional faint band could be due to activation of either STAT1 or STAT3.

View larger version (52K):
[in this window]
[in a new window]
|
Figure 5. Nuclear localized STAT5 DNA binding in ovaries of d 19 pregnant rats is inhibited by cloprostenol treatment. Ovaries obtained from pregnant rats treated with cloprostenol (+) or vehicle (-) for 0.58 h were extracted for nuclear protein, which was subjected to EMSA. A, The method and the STAT5 DNA-binding element used as a probe were previously described (18 55 ). The STAT5 gel-shift band was confirmed by STAT5-specific antibody supershift. Equal loading was confirmed by Oct-1 gel shift (lower panel). Three individual rats from each treatment group were analyzed. B, EMSA using the STAT DNA-binding element on SOCS-3 promoter shows evidence for binding of nuclear protein in addition to STAT5. Nuclear extracts from A were analyzed by EMSA and STAT5 antibody supershift using radiolabeled STAT-responsive element of the SOCS-3 promoter. Three rats from each treatment group were analyzed.
|
|
PGF2
analog causes STAT3 activation
Additional EMSAs were undertaken to identify the STATs activated by cloprostenol injection. In Fig. 6A
nuclear extracts from ovaries collected 0.5 h after vehicle or cloprostenol injection show strong binding to the STAT DNA-binding element from the SOCS-3 promoter (control; lanes 7 and 8). Supershift with anti-STAT1 had no appreciable effect (lanes 1 and 2). Supershift with anti-STAT5 (lanes 5 and 6) moved the major band in both vehicle- and cloprostenol-treated samples, but a faint band, just above the major STAT5 band, remained visible. In contrast, supershift with anti-STAT3 (lanes 3 and 4) reduced the apparent width of the main band, which is most evident in the cloprostenol-treated sample (lane 4). Cold competition with either probe inhibited binding (lanes 912). In Fig. 6B
an additional experiment was performed on ovarian nuclear extracts from cloprostenol-treated animals collected 0.5 h after treatment. In the two supershift experiments anti-STAT5 shifted the lower band of active STAT (lanes 1 and 4), but a second band of slightly lower mobility remained evident. However, when anti-STAT3 and anti-STAT5 were used together (lanes 2 and 5), both the upper and lower bands were shifted. Cold competition with the SOCS-3 probe reduced binding in both bands (lane 7). In contrast, competition with the STAT5 probe (10-fold molar excess) did not remove the upper band (lane 8). Finally, cold competition (10-fold molar excess) with the acute phase response element probe, which preferentially binds STAT3, resulted in loss of the upper band (lane 10) with the lower band also reduced at 50-fold molar excess (lane 11).

View larger version (48K):
[in this window]
[in a new window]
|
Figure 6. Cloprostenol treatment induces STAT3 binding to the STAT DNA-binding element on SOCS-3 promoter in ovaries from pregnant rats. A, EMSA was performed on nuclear extracts from ovaries collected 0.5 h after treatment with vehicle (-) or cloprostenol (+). In vehicle-treated ovarian nuclear extract, only STAT5 is present when analyzed by anti-STAT5 antibody supershift and cold competition studies. Cloprostenol-treated nuclear extracts showed both STAT3 and STAT5 gel-shift bands when analyzed by antibody supershift. The results are representative of two independent experiments. B, Ovarian nuclear extracts from two individual rats treated with cloprostenol (0.5 h) were analyzed by EMSA. STAT3 and -5 were found to be present in the extracts by both antibody supershift and cold competition analyses.
|
|
To verify that STAT3 is activated by cloprostenol treatment, nuclear ovarian extracts, collected 10 min and 2 h after vehicle or cloprostenol injection, were immunoprecipitated with anti-STAT3, followed by Western blot with antiphosphotyrosine. Blots were then stripped and reprobed with anti-STAT3. The results in Fig. 7
show increased tyrosine-phosphorylated STAT3 in ovary from cloprostenol-treated animals at both 10 min and 2 h.

View larger version (26K):
[in this window]
[in a new window]
|
Figure 7. Cloprostenol induces STAT3 tyrosine phosphorylation in the ovary 10 min and 2 h after injection. Ovarian protein lysates from two individual cloprostenol-treated (+) or vehicle-treated (-) rats were immunoprecipitated for STAT3 and immunoblotted with antiphosphotyrosine antibody. Tyrosine phosphorylation of STAT3 was induced by cloprostenol treatment. Reprobing of the membrane with anti-STAT3 antibody indicated that STAT3 protein was not up-regulated.
|
|
Finally, we used immunohistochemistry to investigate the cellular localization of STAT3 in luteal cells 4 h after vehicle or cloprostenol treatment. In vehicle-treated animals, intense STAT3 immunoreactivity was found predominantly in the cytoplasm, with the nucleus evident as a dark circle (Fig. 8
). In contrast, 4 h after cloprostenol treatment the intensity of STAT3 immunostaining in luteal cells was greater in the nucleus than in the cytoplasm.

View larger version (100K):
[in this window]
[in a new window]
|
Figure 8. Nuclear STAT3 immunostaining in luteal cells is increased by cloprostenol. Confocal images of STAT3 immunoreactivity in the corpus luteum of ovaries obtained 4 h after vehicle (A) or cloprostenol (B) injection. Sections were labeled with rabbit anti-STAT3 antibody and developed with donkey antirabbit Texas Red conjugate. Results are representative of the pattern seen in three rats for each treatment.
|
|
Response to PRL injection
We determined whether the corpus luteum of cloprostenol-treated animals could respond to an injection of PRL with increased STAT3 or STAT5 activity. All animals were treated with cloprostenol, followed 3 h and 25 min later by an injection of PRL (250 µg oPRL, sc) or vehicle. Rats were killed 4 h after cloprostenol treatment, and ovarian nuclear extracts were subjected to EMSA with both the STAT5 DNA-binding element (Fig. 9A
) and the STAT DNA-binding element from the SOCS-3 promoter (Fig. 9B
). Treatment with PRL did not stimulate the level of active STAT above that in the controls (Fig. 9
), which suggests that after cloprostenol treatment, the corpus luteum is resistant to PRL. Supershift with anti-STAT5 and anti-STAT3 confirmed that neither STAT3 nor STAT5 binding was affected by PRL treatment.

View larger version (58K):
[in this window]
[in a new window]
|
Figure 9. Ovarian STAT3 and -5 nuclear binding is unresponsive to PRL after cloprostenol treatment. Day 19 pregnant rats were injected with cloprostenol, followed 3.25 h later with an injection of oPRL (250 µg, sc; +) or vehicle (-). Nuclear extracts were analyzed for STATs by EMSA with the STAT5 DNA-binding element (A) and the STAT DNA-binding element (B) on SOCS-3 promoter.
|
|
Resistance to PRL signaling is not due to down-regulation of PRL receptor
The very rapid loss of nuclear STAT5 translocation from 0.54 h after cloprostenol and the absence of a STAT5 response to PRL stimulation at 4 h could be due to a rapid loss of PRL receptor from luteal cells. We therefore quantified PRL receptor in cytosolic extracts from ovaries by Western blot with a well validated polyclonal antiserum (21). An immunoreactive band of the appropriate size for the PRL receptor was present in the ovary (Fig. 10
), and at 2 and 4 h after injection there was no difference between vehicle- and cloprostenol-treated animals. However, 8 h after cloprostenol there was a significant (P < 0.01) reduction in the intensity of the immunoreactive band.
 |
Discussion
|
|---|
PRL and PL are thought to play a central role in maintaining the rodent corpus luteum through generation of active STAT5a/b. In this study we have shown that cloprostenol treatment of d 19 pregnant rats reduces active STAT5 in the corpus luteum for at least 8 h. This indicates that the Janus kinase 2 (JAK2)/STAT5 signaling pathway, which is normally activated by PL binding to the PRL receptor at this stage of pregnancy, is inhibited by cloprostenol. Further, cloprostenol, presumably acting through the PGF2
receptor (FP receptor), also causes a rapid and substantial increase in SOCS-3 mRNA, which is evident from 0.54 h after treatment. At the time of maximum SOCS-3 protein expression as detected by Western blot (4 h after cloprostenol treatment), almost all of the SOCS-3 immunoreactivity within the ovary was confined to the corpora lutea. As SOCS-3 is able to inhibit the generation of active STAT5 (18, 26, 27), we propose that SOCS-3 induction is a major element in the luteolytic actions of PGF2
, through blockade of tropic support by activated PRL receptor. The involvement of SOCS-3 as an inhibitory protein parallels its postulated role in decreasing the sensitivity of the mammary gland to PRL during lactational involution (18) and its role in the induction of refractoriness of the hepatocyte to GH by inflammatory cytokines such as IL-1ß (28). This differs from the role played by SOCS-1 in blocking production of
2-macroglobulin in the antimesometrial decidual cells of the rat uterus (29). Although we did find a weak induction of SOCS-1 by cloprostenol, we believe that the greater magnitude and duration of SOCS-3 induction favor it as the major inhibitory SOCS in the rat corpus luteum.
Evidence for loss of active STAT5 in response to cloprostenol
In these experiments on the d 19 pregnant rat we have confirmed that active STAT5 is present in the corpus luteum of control animals, as demonstrated in previous studies of rats on d 15 and 17 of pregnancy (24, 30). We used two approaches to confirm the presence of active STAT5 in the corpus luteum. First, immunohistochemistry with anti-STAT5 showed much stronger staining in the nucleus than in the cytoplasm of luteal cells, and second, gel-shift analysis of nuclear extracts from whole ovary confirmed the presence of active STAT5 in all vehicle-treated animals. However, when animals were treated with cloprostenol, both methods showed a marked reduction in active or nuclear STAT5 at all time points examined between 0.5 and 8 h by EMSA and at 2 and 4 h by immunohistochemistry. In late pregnancy (d 15) PRL injection does induce a small increase in active STAT5, even though there is sustained activation of STAT5 by the persistently elevated plasma concentrations of PL (24). However, in our experiments we were unable to reinduce STAT5 activation in cloprostenol-treated animals by injection of a large dose of PRL, indicating that the corpus luteum was resistant to PRL signaling through the JAK/STAT5 pathway. This resistance to PRL that we observed after cloprostenol injection could well be due to the induction of SOCS-3, but it is also possible that other factors, such as a reduction in PRL receptor content on luteal cells, are involved. It is known that PRL receptor mRNA expression declines over the period of natural luteolysis (31), and PRL receptor expression itself is dependent on active STAT5 (32). In the present study we used Western blots to examine PRL receptor protein expression and could not detect a decrease in expression until after 4 h postinjection, although by 8 h postinjection PRL receptor expression was significantly decreased. This is in agreement with the study by Telleria et al. (31) and is to be expected given the proposed role of STAT5 in promoting PRL receptor expression (32). This subsequent down-regulation of PRL receptor would therefore maintain resistance to the tropic effects of PRL at this later time (8 h) when SOCS-3 expression has declined.
Mechanism for induction of SOCS-3 expression
It is of interest to consider the pattern of induction of SOCS transcripts examined here (SOCS-1 to -3 and CIS) in response to cloprostenol. In these late pregnant rats cloprostenol strongly induced SOCS-3 and weakly induced SOCS-1, but was without effect on CIS and SOCS-2. This is distinct from the induction of all of these transcripts by PRL in nonpregnant, lactating rat ovary (18), with a shorter period of induction evident for PRL-induced SOCS-3 transcripts than that seen here with cloprostenol. Given that PRL also strongly induces CIS transcripts in rat adrenal gland and mammary gland (18), it would appear that the stimulus for SOCS gene induction differs between cloprostenol and PRL, concordant with their differing mechanisms of action and the fact that active STAT5 is markedly decreased by cloprostenol. STAT5 is considered to be a major inducing factor for CIS (33), and the lack of CIS induction supports the view that STAT5 is not instrumental here in terms of SOCS-3 induction. EMSA supershifts with anti-STAT provide no evidence for active STAT1, in agreement with previous studies reporting that there is no active STAT1 in the ovary (30, 34). However, in their analysis of control of the SOCS-3 promoter by leukemia inhibitory factor, Auernhammer et al. (20) identified key STAT3-regulated cis elements, and we have shown here, by gel-shift analysis and immunohistochemistry, that cloprostenol is able to rapidly activate STAT3. This is accompanied by rapid (10 min) tyrosine phosphorylation of STAT3, which is maintained for at least 4 h. Moreover, increased binding of STAT3 to the SOCS-3 regulatory element described by Auernhammer et al. (20) in response to addition of cloprostenol was also shown in gel supershift experiments.
Ligand activation of the PRL receptor itself induces tyrosine and serine phosphorylation of STAT3 by a protein kinase C
-dependent mechanism (35), but it is difficult to reconcile how such an effect could account for the difference between vehicle- and cloprostenol-treated animals in the present study. A more likely mechanism could involve a direct interaction between the PG FP receptor and the JAK/STAT3 pathway. Although there is no publication in support of such an interaction for this receptor, there is substantial evidence that other G protein-coupled receptor (GPCR) can bind to and activate JAKs and hence also activate STATs. Examples include the angiotensin II receptor, which couples through Gq
(36) to JAK2, and the TSH receptor, which couples through the Gs
(37). The bradykinin B2R (38), the serotonin HT2A receptor (39), and the endothelin ETA receptor (40) are other GPCRs that activate JAK kinases and hence STATs. In these cases and for others involving a range of g protein-coupled receptor (GPCR), such as the bombesin, vasopressin, and
2-adrenergic receptors, the ubiquitous Src tyrosine kinase has also been shown to be rapidly activated by ligand binding (41, 42), and this is a strong activator of STAT3, the major inducer of SOCS-3 expression (20, 43). Activation of Src by GPCRs can occur by direct association with Gs
or Gi
(44), by trans-activation of tyrosine kinase receptors such as the epidermal growth factor receptor (45), or by other means, such as activation by Pyk2, a tyrosine kinase activated by elevated intracellular Ca2+ (46). There is evidence that the PG FP receptor can increase Src-like kinase activity (47), although definitive identification of Src is lacking. In the MC3T3-E1 osteoblastic line, a range of proteins are rapidly tyrosine phosphorylated in response to PGF2
(48).
It should be noted that Src would not be inhibited by elevated SOCS-3, whereas the generation of active STAT5 through binding to tyrosine-phosphorylated PRL receptor and other cytokine receptors would be blocked (49). The JAK inhibitor, SOCS-1, selectively inhibits cytokine-induced, but not v-Src induced, JAK-STAT activation (49, 50). This is unlikely to be the complete mechanism, however, because Src can induce nuclear translocation (but not activation) of STAT5b, although it cannot do this for STAT5a (51). There may be an additional input through activation of the MAPK (ERK1/2) pathway as a result of cloprostenol acting on the FP receptor (52), as MAPKs are able to fully activate STAT3 through phosphorylation of Ser727 (53). Hence, the minimal model here would be activation of Src or a Src kinase member by cloprostenol, followed by activation of STAT3 by tyrosine phosphorylation and serine phosphorylation, and thence induction of SOCS-3, which would block the actions of PRL to maintain luteal function. This model could be generalized to immune and inflammatory mechanisms involving PG-mediated actions in the presence of immune modulatory cytokines.
In conclusion, we have identified a novel mechanism that could be a major element in the initiation of luteolysis by PGF2
in rodents. Blockade of the luteotropic actions of PL by SOCS proteins in late pregnancy (Fig. 11
) would complement the other actions of PGF2
that result from induction of Nur77 (54), such as increased expression of 20
-HSD, with the two actions together resulting in rapid functional luteolysis.
 |
Acknowledgments
|
|---|
The authors thank the NIDDK National Hormone and Peptide Program and Dr A. F. Parlow for the gift of purified PRL.
 |
Footnotes
|
|---|
This work was supported in part by a grant from the Queensland Cancer Fund (to M.J.W.).
Abbreviations: CIS, Cytokine-inducible SH2-containing protein; FP receptor, PGF2
receptor; GPCR, G protein-coupled receptor; HRP, horseradish peroxidase; 20
-HSD, 20
-hydroxysteroid dehydrogenase; JAK, Janus kinase; oPRL, ovine PRL; PL, placental lactogen; PGF2
, prostaglandin F2
; SOCS, suppressors of cytokine signaling; STAT, signal transducer and activator of transcription.
Received March 25, 2002.
Accepted for publication June 18, 2002.
 |
References
|
|---|
- Risk M, Gibori G 2000 Mechanisms of luteal cell regulation by prolactin. In: Horseman ND, ed. Prolactin. Boston: Kluwer Academic; 265295
- Yoshinaga K 1974 Ovarian progestin secretion in lactating rats: effect of intrabursal injection of prolactin antiserum, prolactin and LH. Endocrinology 94:829834[Abstract/Free Full Text]
- Horseman ND, Zhao W, Montecino-Rodriguez E, Tanaka M, Nakashima K, Engle SJ, Smith F, Markoff E, Dorshkind K 1997 Defective mammopoiesis, but normal hematopoiesis, in mice with a targeted disruption of the prolactin gene. EMBO J 16:69266935[CrossRef][Medline]
- Ormandy CJ, Camus A, Barra J, Damotte D, Lucas B, Buteau H, Edery M, Brousse N, Babinet C, Binart N, Kelly PA 1997 Null mutation of the prolactin receptor gene produces multiple reproductive defects in the mouse. Genes Dev 11:167178[Abstract/Free Full Text]
- Teglund S, McKay C, Schuetz E, van Deursen JM, Stravopodis D, Wang D, Brown M, Bodner S, Grosveld G, Ihle JN 1998 Stat5a and Stat5b proteins have essential and nonessential, or redundant, roles in cytokine responses. Cell 93:841850[CrossRef][Medline]
- Frasor J, Park K, Byers M, Telleria C, Kitamura T, Yu-Lee LY, Djiane J, Park-Sarge OK, Gibori G 2001 Differential roles for signal transducers and activators of transcription 5a and 5b in PRL stimulation of ER
and ERß transcription. Mol Endocrinol 15:21722181[Abstract/Free Full Text]
- Segaloff DL, Wang HY, Richards JS 1990 Hormonal regulation of luteinizing hormone/chorionic gonadotropin receptor mRNA in rat ovarian cells during follicular development and luteinization. Mol Endocrinol 4:18561865[Abstract/Free Full Text]
- Gafvels M, Bjurulf E, Selstam G 1992 Prolactin stimulates the expression of luteinizing hormone/chorionic gonadotropin receptor messenger ribonucleic acid in the rat corpus luteum and rescues early pregnancy from bromocriptine-induced abortion. Biol Reprod 47:534540[Abstract]
- Murphy BD, Rajkumar K, McKibbin PE, Macdonald GJ, Buhr MM, Grinwich DL 1985 The effects of hypophysectomy and administration of pituitary hormones on luteal function and uptake of high density lipoproteins by luteinized ovaries and adrenals of the rat. Endocrinology 116:15871597[Abstract/Free Full Text]
- Rajkumar K, Couture RL, Murphy BD 1985 Binding of high-density lipoproteins to luteal membranes: the role of prolactin, luteinizing hormone, and circulating lipoproteins. Biol Reprod 32:546555[Abstract]
- Aten RF, Kolodecik TR, Macdonald GJ, Behrman HR 1995 Modulation of cholesteryl ester hydrolase messenger ribonucleic acid levels, protein levels, and activity in the rat corpus luteum. Biol Reprod 53:11101117[Abstract]
- Hickey GJ, Oonk RB, Hall PF, Richards JS 1989 Aromatase cytochrome P450 and cholesterol side-chain cleavage cytochrome P450 in corpora lutea of pregnant rats: diverse regulation by peptide and steroid hormones. Endocrinology 125:16731682[Abstract/Free Full Text]
- Lamprecht SA, Lindner HR, Strauss 3rd JF 1969 Induction of 20
-hydroxysteroid dehydrogenase in rat corpora lutea by pharmacological blockade of pituitary prolactin secretion. Biochim Biophys Acta 187:133143[Medline]
- Albarracin CT, Parmer TG, Duan WR, Nelson SE, Gibori G 1994 Identification of a major prolactin-regulated protein as 20
-hydroxysteroid dehydrogenase: coordinate regulation of its activity, protein content, and messenger ribonucleic acid expression. Endocrinology 134:24532460[Abstract/Free Full Text]
- Zhong L, Parmer TG, Robertson MC, Gibori G 1997 Prolactin-mediated inhibition of 20
-hydroxysteroid dehydrogenase gene expression and the tyrosine kinase system. Biochem Biophys Res Commun 235:587592[CrossRef][Medline]
- Sugimoto Y, Segi E, Tsuboi K, Ichikawa A, Narumiya S 1998 Female reproduction in mice lacking the prostaglandin F receptor. Roles of prostaglandin and oxytocin receptors in parturition. Adv Exp Med Biol 449:317321[Medline]
- Stocco C, Callegari E, Gibori G 2001 Opposite effect of prolactin and prostaglandin F2
on the expression of luteal genes as revealed by rat cDNA expression array. Endocrinology 142:41584161[Abstract/Free Full Text]
- Tam SP, Lau P, Djiane J, Hilton DJ, Waters MJ 2001 Tissue-specific induction of SOCS gene expression by PRL. Endocrinology 142:50155026[Abstract/Free Full Text]
- Chapman RS, Lourenco P, Tonner E, Flint D, Selbert S, Takeda K, Akira S, Clarke AR, Watson CJ 2000 The role of Stat3 in apoptosis and mammary gland involution. Conditional deletion of Stat3. Adv Exp Med Biol 480:129138[Medline]
- Auernhammer CJ, Bousquet C, Melmed S 1999 Autoregulation of pituitary corticotroph SOCS-3 expression: characterization of the murine SOCS-3 promoter. Proc Natl Acad Sci USA 96:69646969[Abstract/Free Full Text]
- Waters MJ, Daniel N, Bignon C, Djiane J 1995 The rabbit mammary gland prolactin receptor is tyrosine-phosphorylated in response to prolactin in vivo and in vitro. J Biol Chem 270:51365143[Abstract/Free Full Text]
- Jahn GA, Daniel N, Jolivet G, Belair L, Bole-Feysot C, Kelly PA, Djiane J 1997 In vivo study of prolactin (PRL) intracellular signalling during lactogenesis in the rat: JAK/STAT pathway is activated by PRL in the mammary gland but not in the liver. Biol Reprod 57:894900[Abstract]
- Wegenka UM, Lutticken C, Buschmann J, Yuan J, Lottspeich F, Muller-Esterl W, Schindler C, Roeb E, Heinrich PC, Horn F 1994 The interleukin-6-activated acute-phase response factor is antigenically and functionally related to members of the signal transducer and activator of transcription (STAT) family. Mol Cell Biol 14:31863196[Abstract/Free Full Text]
- Russell DL, Richards JS 1999 Differentiation-dependent prolactin responsiveness and stat (signal transducers and activators of transcription) signaling in rat ovarian cells. Mol Endocrinol 13:20492064[Abstract/Free Full Text]
- Emanuelli B, Peraldi P, Filloux C, Sawka-Verhelle D, Hilton D, Van Obberghen E 2000 SOCS-3 is an insulin-induced negative regulator of insulin signaling. J Biol Chem 275:1598515991[Abstract/Free Full Text]
- Pezet A, Favre H, Kelly PA, Edery M 1999 Inhibition and restoration of prolactin signal transduction by suppressors of cytokine signaling. J Biol Chem 274:2449724502[Abstract/Free Full Text]
- Dif F, Saunier E, Demeneix B, Kelly PA, Edery M 2001 Cytokine-inducible SH2-containing protein suppresses PRL signaling by binding the PRL receptor. Endocrinology 142:52865293[Abstract/Free Full Text]
- Boisclair YR, Wang J, Shi J, Hurst KR, Ooi GT 2000 Role of the suppressor of cytokine signaling-3 in mediating the inhibitory effects of interleukin-1ß on the growth hormone-dependent transcription of the acid-labile subunit gene in liver cells. J Biol Chem 275:38413847[Abstract/Free Full Text]
- Barkai U, Prigent-Tessier A, Tessier C, Gibori GB, Gibori G 2000 Involvement of SOCS-1, the suppressor of cytokine signaling, in the prevention of prolactin-responsive gene expression in decidual cells. Mol Endocrinol 14:554563[Abstract/Free Full Text]
- Russell DL, Norman RL, Dajee M, Liu X, Henninghausen L, Richards JS 1996 Prolactin-induced activation and binding of stat proteins to the IL-6RE of the
2-macroglobulin (
2M) promoter: relation to the expression of
2M in the rat ovary. Biol Reprod 55:10292038[Abstract]
- Telleria CM, Parmer TG, Zhong L, Clarke DL, Albarracin CT, Duan WR, Linzer DI, Gibori G 1997 The different forms of the prolactin receptor in the rat corpus luteum: developmental expression and hormonal regulation in pregnancy. Endocrinology 138:48124820[Abstract/Free Full Text]
- Galsgaard ED, Nielsen JH, Moldrup A 1999 Regulation of prolactin receptor (PRLR) gene expression in insulin-producing cells. Prolactin and growth hormone activate one of the rat prlr gene promoters via STAT5a and STAT5b. J Biol Chem 274:1868628692[Abstract/Free Full Text]
- Matsumoto A, Masuhara M, Mitsui K, Yokouchi M, Ohtsubo M, Misawa H, Miyajima A, Yoshimura A 1997 CIS, a cytokine inducible SH2 protein, is a target of the JAK-STAT5 pathway and modulates STAT5 activation. Blood 89:31483154[Abstract/Free Full Text]
- Dajee M, Fey GH, Richards JS 1998 Stat 5b and the orphan nuclear receptors regulate expression of the
2-macroglobulin (
2M) gene in rat ovarian granulosa cells. Mol Endocrinol 12:13931409[Abstract/Free Full Text]
- Peters CA, Maizels ET, Robertson MC, Shiu RP, Soloff MS, Hunzicker-Dunn M 2000 Induction of relaxin messenger RNA expression in response to prolactin receptor activation requires protein kinase C
signaling. Mol Endocrinol 14:576590[Abstract/Free Full Text]
- Ali MS, Sayeski PP, Dirksen LB, Hayzer DJ, Marrero MB, Bernstein KE 1997 Dependence on the motif YIPP for the physical association of Jak2 kinase with the intracellular carboxyl tail of the angiotensin II AT1 receptor. J Biol Chem 272:2338223388[Abstract/Free Full Text]
- Park ES, Kim H, Suh JM, Park SJ, You SH, Chung HK, Lee KW, Kwon OY, Cho BY, Kim YK, Ro HK, Chung J, Shong M 2000 Involvement of JAK/STAT (Janus kinase/signal transducer and activator of transcription) in the thyrotropin signaling pathway. Mol Endocrinol 14:662670[Abstract/Free Full Text]
- Ju H, Venema VJ, Liang H, Harris MB, Zou R, Venema RC 2000 Bradykinin activates the Janus-activated kinase/signal transducers and activators of transcription (JAK/STAT) pathway in vascular endothelial cells: localization of JAK/STAT signalling proteins in plasmalemmal caveolae. Biochem J 351: 257264
- Guillet-Deniau I, Burnol AF, Girard J 1997 Identification and localization of a skeletal muscle secrotonin 5-HT2A receptor coupled to the Jak/STAT pathway. J Biol Chem 272:1482514829[Abstract/Free Full Text]
- Peeler TC, Conrad KM, Baker KM 1996 Endothelin stimulates sis-inducing factor-like DNA binding activity in CHO-K1 cells expressing ETA receptors. Biochem Biophys Res Commun 221:6266[CrossRef][Medline]
- Luttrell LM, Daaka Y, Lefkowitz RJ 1999 Regulation of tyrosine kinase cascades by G-protein-coupled receptors. Curr Opin Cell Biol 11:177183[CrossRef][Medline]
- Rodriguez-Fernandez JL, Rozengurt E 1996 Bombesin, bradykinin, vasopressin, and phorbol esters rapidly and transiently activate Src family tyrosine kinases in Swiss 3T3 cells. Dissociation from tyrosine phosphorylation of p125 focal adhesion kinase. J Biol Chem 271:2789527901[Abstract/Free Full Text]
- Cao X, Tay A, Guy GR, Tan YH 1996 Activation and association of Stat3 with Src in v-Src-transformed cell lines. Mol Cell Biol 16:15951603[Abstract]
- Ma YC, Huang J, Ali S, Lowry W, Huang XY 2000 Src tyrosine kinase is a novel direct effector of G proteins. Cell 102:635646[CrossRef][Medline]
- Saito Y, Berk BC 2001 Transactivation: a novel signaling pathway from angiotensin II to tyrosine kinase receptors. J Mol Cell Cardiol 33:37[CrossRef][Medline]
- Eguchi S, Iwasaki H, Inagami T, Numaguchi K, Yamakawa T, Motley ED, Owada KM, Marumo F, Hirata Y 1999 Involvement of PYK2 in angiotensin II signaling of vascular smooth muscle cells. Hypertension 33:201206[Abstract/Free Full Text]
- Caverzasio J, Palmer G, Suzuki A, Bonjour JP 2000 Evidence for the involvement of two pathways in activation of extracellular signal-regulated kinase (Erk) and cell proliferation by Gi and Gq protein-coupled receptors in osteoblast-like cells. J Bone Miner Res 15:16971706[CrossRef][Medline]
- Hakeda Y, Shiokawa M, Mano H, Kameda T, Raisz LG, Kumegawa M 1997 Prostaglandin F2
stimulates tyrosine phosphorylation and mitogen-activated protein kinase in osteoblastic MC3T3E1 cells via protein kinase C activation. Endocrinology 138:18211828[Abstract/Free Full Text]
- Iwamoto T, Senga T, Naito Y, Matsuda S, Miyake Y, Yoshimura A, Hamaguchi M 2000 The JAK-inhibitor, JAB/SOCS-1 selectively inhibits cytokine-induced, but not v-Src induced JAK-STAT activation. Oncogene 19:47954801[CrossRef][Medline]
- Krebs DL, Hilton DJ 2000 SOCS: physiological suppressors of cytokine signaling. J Cell Sci 113:28132819[Abstract]
- Kazansky AV, Kabotyanski EB, Wyszomierski SL, Mancini MA, Rosen JM 1999 Differential effects of prolactin and src/abl kinases on the nuclear translocation of STAT5B and STAT5A. J Biol Chem 274:2248422492[Abstract/Free Full Text]
- Stocco CO, Lau LF, Gibori G 2002 A calcium/calmodulin-dependent activation of ERK1/2 mediates JunD phosphorylation and induction of nur77 and 20
-hsd genes by prostaglandin F2
in ovarian cells. J Biol Chem 277:32933302[Abstract/Free Full Text]
- Wen Z, Zhong Z, Darnell Jr JE 1995 Maximal activation of transcription by Stat1 and Stat3 requires both tyrosine and serine phosphorylation. Cell 82:241250[CrossRef][Medline]
- Stocco CO, Zhong L, Sugimoto Y, Ichikawa A, Lau LF, Gibori G 2000 Prostaglandin F2
-induced expression of 20
-hydroxysteroid dehydrogenase involves the transcription factor NUR77. J Biol Chem 275:3720237211[Abstract/Free Full Text]
- Chen C, Clarkson RW, Xie Y, Hume DA, Waters MJ 1995 Growth hormone and colony-stimulating factor 1 share multiple response elements in the c-Fos promoter. Endocrinology 136:45054516[Abstract]
This article has been cited by other articles:

|
 |

|
 |
 
S. T Anderson, N. N M Isa, J. L Barclay, M. J Waters, and J. D Curlewis
Maximal expression of suppressors of cytokine signaling in the rat ovary occurs in late pregnancy
Reproduction,
September 1, 2009;
138(3):
537 - 544.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. C. Peluffo, R. L. Stouffer, and M. Tesone
Activity and expression of different members of the caspase family in the rat corpus luteum during pregnancy and postpartum
Am J Physiol Endocrinol Metab,
November 1, 2007;
293(5):
E1215 - E1223.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. L. Barclay, S. T. Anderson, M. J. Waters, and J. D. Curlewis
Characterization of the SOCS3 Promoter Response to Prostaglandin E2 in T47D Cells
Mol. Endocrinol.,
October 1, 2007;
21(10):
2516 - 2528.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Stocco, C. Telleria, and G. Gibori
The Molecular Control of Corpus Luteum Formation, Function, and Regression
Endocr. Rev.,
February 1, 2007;
28(1):
117 - 149.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. T. Anderson, J. L. Barclay, K. J. Fanning, D. H. L. Kusters, M. J. Waters, and J. D. Curlewis
Mechanisms Underlying the Diminished Sensitivity to Prolactin Negative Feedback during Lactation: Reduced STAT5 Signaling and Up-Regulation of Cytokine-Inducible SH2 Domain-Containing Protein (CIS) Expression in Tuberoinfundibular Dopaminergic Neurons
Endocrinology,
March 1, 2006;
147(3):
1195 - 1202.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. P. Piekorz, S. Gingras, A. Hoffmeyer, J. N. Ihle, and Y. Weinstein
Regulation of Progesterone Levels during Pregnancy and Parturition by Signal Transducer and Activator of Transcription 5 and 20{alpha}-Hydroxysteroid Dehydrogenase
Mol. Endocrinol.,
February 1, 2005;
19(2):
431 - 440.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Lau, S. J. Nixon, R. G. Parton, and G. E. O. Muscat
ROR{alpha} Regulates the Expression of Genes Involved in Lipid Homeostasis in Skeletal Muscle Cells: CAVEOLIN-3 AND CPT-1 ARE DIRECT TARGETS OF ROR
J. Biol. Chem.,
August 27, 2004;
279(35):
36828 - 36840.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Stocco, J. Djiane, and G. Gibori
Prostaglandin F2{alpha} (PGF2{alpha}) and Prolactin Signaling: PGF2{alpha}-Mediated Inhibition of Prolactin Receptor Expression in the Corpus Luteum
Endocrinology,
August 1, 2003;
144(8):
3301 - 3305.
[Abstract]
[Full Text]
[PDF]
|
 |
|