| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLE |
Fundación IVI para el Estudio de la Reproducción (R.G., C.S., J.R., A.P.); Department of Pediatrics, Obstetrics, and Gynecology (C.S., J.R., A.P.), Valencia University School of Medicine; and Department of Obstetrics and Gynecology, Hospital Universitario Dr. Peset (A.P.), Valencia 46020, Spain
Address all correspondence and requests for reprints to: Antonio Pellicer, M.D., FIVIER, Guardia Civil 23, esc 6. pta 7, Valencia 46020, Spain. E-mail: apellicer{at}interbook.net.
| Abstract |
|---|
|
|
|---|
Ovarian hyperstimulation was induced with pregnant mares serum gonadotropin, or pregnant mares serum gonadotropin plus hCG. Time-course experiments analyzed VP and the expression of whole VEGF mRNA in the mesentery and the ovaries. VP and ovarian mRNA VEGF expression increased to peak values after 48 h. No significant change in expression was observed in the mesentery. To further prove the ovarian origin of VEGF, we showed that VP was not altered when ovariectomized rats were treated with gonadotropins. The ovary expressed VEGF120 and VEGF164 isoforms. Immunohistochemistry showed VEGF in granulosa and zona pellucida of preovulatory and atretic follicles and in granulosa-lutein and endothelial cells of whole corpus luteum.
A specific VEGF receptor-2 inhibitor (SU5416) was administered in three different protocols: on a daily basis, every 48 h, or two injections after hCG. Increased VP was reversed when SU5416 was administered every 48 h or two injections after hCG. These results show that the ovary is the main source of VEGF120 and VEGF164, which act through the VEGF receptor-2 to increase VP, and provide new insights into the prevention of OHSS.
| Introduction |
|---|
|
|
|---|
In women who develop OHSS, VEGF is expressed and produced by granulosa-lutein cells (5, 6, 7, 8, 9, 10) and is released into the follicular fluid (5, 11, 12) in response to hCG (10), inducing increased capillary permeability (5, 11, 12). The isoform VEGF165 has been specifically identified in human follicular fluid (13). Similarly, we have shown that hCG stimulates the release of VEGF in human endothelial cells, which, in turn, acts in an autocrine manner to increase vascular permeability (VP) (12). Thus, both cell types may be involved in the production and release of VEGF in women treated with gonadotropins who develop OHSS. If the endothelium is involved, we still do not know whether only the vessels of the ovary or the entire vascular tree participate in the mechanisms leading to OHSS.
The human VEGF gene has been mapped to chromosome 6p12 (14) and is made up of eight exons. Exons 15 and 8 are always present in VEGF mRNA, whereas the expression of exons 6 and 7 is regulated by alternative splicing. This phenomenon produces various VEGF isoforms differing in length, but with a common region. In humans, five different VEGF mRNAs have been detected encoding the isoforms VEGF121, VEGF145, VEGF165, VEGF189, and VEGF206 (15). The isoforms VEGF121 and VEGF165 appear to be mainly involved in the process of angiogenesis (16) and are characteristic products of the ovary (17).
The VEGF gene shows the same exonic structure in rodents and humans (18). Murine VEGF-expressed isoforms VEGF120, VEGF144, VEGF164, VEGF188, and VEGF205 differ in only one amino acid length compared with human VEGF isoforms, showing a 95% protein homology (19). Similar to those in human ovary (5, 6, 7, 8, 9, 10), hybridization studies in the rat ovary have demonstrated whole VEGF mRNA expression predominately after the LH surge (20).
The receptors for VEGF are present in the endothelial cells and belong to the tyrosine kinase receptor family (21). They are also present in the inner theca of human follicles (9, 10). Two specific endothelial cell membrane receptors for VEGF have been identified, VEGF receptor-1 (VEGFR-1; Flt-1) and VEGFR-2 (Flk-1/KDR) (22, 23). The receptor Flk-1/KDR appears to be mainly involved in regulating VP, angiogenesis, and vasculogenesis (23, 24). Targeting the Flk-1/KDR receptor has been a goal for researchers working in gynecological oncology. Different specific VEGFR-2 blockers have been used in animal models that reduce tumor growth (25, 26) and ascites (26, 27). Although the mechanism of ascites may be different in neoplasms and OHSS (27), nobody has tried to date to reverse ascites formation in OHSS targeting the VEGF system.
Based on the above information, we have employed an in vivo murine model to induce OHSS, considering the two main characteristics, ovarian enlargement and increased VP leading to ascites (13). Using this model, we have first investigated the hormonal conditions inducing OHSS, the involvement of VEGF in the process, the tissue source(s) of VEGF, and the specific VEGF isoforms involved in OHSS. Finally, the effect of blocking the VEGFR-2 on VP, as a new strategy to prevent and treat OHSS, was assayed.
| Materials and Methods |
|---|
|
|
|---|
Animals, stimulation protocols, and experimental design
Immature female Wistar rats were obtained from Harlam Iberica (Sant Feliu de Codina, Spain) and were kept at least 1 wk in our laboratory before starting the experiments. They were fed a standard diet and allowed free access to water with a 12-h light, 12-h dark schedule (lights on from 07001900 h). All studies used 22-d-old animals (4248 g) and were conducted in accordance with the NIH Guidelines for the Care and Use of Laboratory Animals. Protocols for animal handling were approved by the ethical animal committee of the Valencia University School of Medicine.
In the first series of experiments, we investigated the hormonal conditions involving OHSS. Animals were divided into three groups. The control group (n = 48) received ip injections of 0.1 ml saline from d 2226. The PMSG group (n = 48) received 10 IU PMSG for 4 consecutive days and 0.1 ml saline on the fifth day. The OHSS group (n = 48) was given 10 IU PMSG for 4 consecutive days and 30 IU hCG on the fifth day to induce OHSS (28).
Time-course experiments were performed measuring VP at 6 h before and 0, 2, 24, 48, and 96 h after hCG or saline treatment. Each time point included eight animals per experimental group. The mesentery, which is representative of a highly vascularized tissue, and one ovary from at least four animals per group at each time point were frozen for mRNA VEGF analysis, whereas the other ovary of the same animal was used for immunohistochemistry analysis. First, we compared mRNA VEGF levels among the three groups at each time point in the ovary and the mesentery independently to find out the timing of VEGF expression. Second, the source of VEGF expression was reassured by comparing VEGF/ß-actin ratios between ovary and mesentery at each time point in the OHSS group. Finally, VEGF isoform expression was studied. Immunohistochemical analysis was also performed on the ovaries of these animals to prove VEGF protein production.
A second series of experiments was designed to investigate the ovary as the source of VEGF in hyperstimulated animals measuring VP as the end point. Four groups of animals were established. The control group (n = 8) receiving saline as described above. The OHSS group (n = 8) was given PMSG and hCG as described above. The ovariectomized and hyperstimulated group (n = 8), in which the animals were anesthetized with ketamine (100 mg/kg) and the ovaries were removed 24 h before stimulation with PMSG and hCG, was the OHSS group. The ovariectomized group (n = 8) consisted of animals ovariectomized under anesthesia and treated with saline as in the control group.
Permeability assays
To measure VP, a previously described method was used (28, 29). Rats were anesthetized with ketamine and heated on a thermal blanket to avoid hypothermia. A fixed volume (0.2 ml) of 5 mM Evans Blue (EB) dye diluted in distilled water was injected via the femoral vein. Thirty minutes after dye injection, the peritoneal cavity was filled with 5 ml 0.9% saline (21 C; pH 6) and massaged for 30 sec. Subsequently, the fluid was quietly extracted with a Vialon vascular catheter (BD Biosciences, Madrid, Spain) to prevent tissue or vessel damage. To avoid any protein interference, peritoneal fluid was recovered in tubes containing 0.05 ml 0.1 N NaOH. After centrifugation at 900 x g for 12 min, the EB concentration was measured at 600 nm on a Shimadzu 1201 spectrophotometer (Izasa, Madrid, Spain). The level of the extravasated dye in the recovered fluid was expressed as micrograms of EB per 100 g body weight.
mRNA expression of VEGF
RNA isolation.
RNA extraction was performed according to the method described by Chomczynski and Sacchi (30) with minor modifications using the TRIzol reagent. Briefly, each tissue was weighed, and 500 µl TRIzol reagent/100 mg tissue weight were added. Total RNA was separated from DNA and proteins by adding 250 µl chloroform and was precipitated with isopropanol (overnight, -20 C). The precipitate was washed twice in ethanol, air-dried, and resuspended in 75% diethylpyrocarbonate (DEPC)-treated water. The amount of RNA was quantified by spectrophotometry on a SmartSpec 3000 spectrophotometer (Bio-Rad Laboratories, Inc., Barcelona, Spain).
RT.
RT was carried out using the Advantage RT-for-PCR Kit (CLONTECH Laboratories, Inc., Palo Alto, CA,). Mastermix per sample was prepared as follows: 4 µl 5x reaction buffer, 1 µl deoxy-NTP mix (10 mM each), 0.5 µl recombinant ribonuclease inhibitor, and 1 µl Moloney murine leukemia virus reverse transcriptase. One microgram of each sample was diluted to a final volume of 12.5 µl in DEPC-treated water plus 1 µl oligo(dT)18; the mixture was heated at 70 C for 2 min and kept on ice until Mastermix (6.5 µl) was added. For each RT, a blank was prepared using all of the reagents except the RNA sample, for which an equivalent volume of DEPC water (12.5 µl) was substituted. The RT blank was used to prepare the PCR blank (below). Once all components were mixed, the samples were incubated at 42 C for 1 h, then heated at 94 C for 5 min to stop cDNA synthesis and destroy deoxyribonuclease activity. The product was diluted to a final volume of 100 µl with DEPC-treated water and stored at 20 C until PCR analysis.
Real-time PCR.
Primers for quantitative PCR were designed using the Primers Express Software (PE Applied Biosystems, Warrington, UK) and synthesized (PE Applied Biosystems, Barcelona, Spain) The sense ß-actin primer was 5'-616AGGGAAATCGTGCGTGACAT635-3', and the antisense ß-actin primer was 5'-764AACCGCTCATTGCCGATAGT745-3' (NCBI accession no. 55574), giving rise to a expected PCR product of 149 bp. The VEGF primers were designed to amplify a region common to all VEGF isoforms, so the sense VEGF primer was 5'-114CAGCTATTGCCGTCCAATTGA124-3', and the antisense VEGF primer was 5'-244CCAGGGCTTCATCATTGCA226-3', where a 131-bp PCR product was expected (NCBI accession no. AF215726).
To amplify cDNA, the RT samples were diluted to a final concentration of 12.5 µg total cDNA/µl. In each reaction, a total of 4 µl (50 µg cDNA) from each RT tube was mixed with 12.5 µl SYBR Green PCR master mix (PE Applied Biosystems) containing nucleotides, Taq DNA polymerase, MgCl2, and reaction buffer with SYBR green; 13 µl 0.5 µM VEGF or ß-actin primers and double distilled water were added to a final volume of 25 µl.
Real-time PCR was performed using an ABI PRISM 7700 Sequence Detection System (Perkin Elmer Corp., Norwalk, CT) according to the manufacturers instructions with a heated lid (105 C), an initial denaturation step at 95 C for 10 min, followed by 40 cycles of 95 C for 15 sec and 60 C for 1 min. Each sample was amplified in duplicate for VEGF or ß-actin, giving rise to four reactions per sample. In parallel, 6-fold serial dilutions of known concentrations of VEGF and ß-actin cDNA were run with each analysis as a calibration curve. Quantification data were analyzed at the beginning of the exponential phase (cycles 1825) with ABI PRISM 1.7 analysis software. Background fluorescence was removed by setting a noise band. Duplicates showing more than a 5% variation were discarded. To validate a real-time PCR, standard curves with r > 0.95 and slope values between 3.1 and 3.4 were required.
For each sample, the amounts of VEGF cDNA and ß-actin cDNA were determined with relation to the standard curves. The VEGF/ß-actin ratio was used to estimate and compare the relative VEGF expression. The results of each PCR experiment were confirmed in a minimum of three consecutive experiments.
At the end of the PCR reaction, all products reached a plateau. To determine whether other nonexpected products were also amplified, the PCR products from each VEGF or ß-actin after 40 cycles were subjected to a subsequent agarose-4% gel electrophoresis with ethidium bromide to confirm amplification specificity.
VEGF isoforms
Primer sequences to detect VEGF isoforms were previously described (31) and were synthesized using Custom Primers (Life Technologies, Inc., Barcelona, Spain). The sense VEGF primer 5'-10CTGCTCTCTTGGGTGCACTGG30-3' (sequences are numbered on the basis of the cDNA for rat VEGF164, with the first base of the initiation codon designated 1) (32) was located in exon 1. The antisense primer was 5'-572CACCGCCTTGGCTTGTCACAT552-3' and was matched to a common region downstream from the alternative splicing site (32). Thus, this pair of primers would generate a different sized product for each of the splicing forms of VEGF mRNA. The predicted PCR products for the three major forms, VEGF120, VEGF164, and VEGF188, would be 431, 563, and 635 bp, respectively.
To amplify cDNA, 100 µg total cDNA from each RT tube were mixed with a Mastermix prepared as follows: 2.5 µl 10x reaction buffer, 2.5 µl 25 mM MgCl2, and 0.1 µl Taq polymerase (5 IU/µl; Bioline, London, UK); 0.5 µl 10 mM dNTPs mix (Sigma), 1.25 µl of each primer (25 µM; Life Technologies, Inc.) for VEGF, and double-distilled water were added to a final volume of 25 µl/sample.
PCR reactions were carried out using an Eppendorf Mastercycler Personal (Eppendorf, Hamburg, Germany), with the following program using a heated lid (105 C): first heated to 94 C for 5 min, then 2630 cycles of 92 C for 30 sec, 60 C for 30 sec, and 72 C for 90 sec, with a final extension of 72 C for 5 min, and cooled down to 4 C. Products were then electrophoresed in a 1.5% agarose gel in the presence of ethidium bromide, and bands were analyzed in an image analysis system (Gelprinter Plus, Madrid, Spain) using 1D software (TDI, Madrid, Spain).
VEGF protein localization
Ovarian samples for immunohistochemical experiments were fixed in formalin embedded in paraffin, sectioned, and mounted on glass slides. Twelve serial sections (5 µm) from each sample were prepared for immunohistochemistry, and the first and last sections were stained with hematoxylin-eosin. The tissue sections were deparaffinized in xylene and dehydrated in a graded series of ethanol. After deparafination, sections were boiled in citrate buffer (0.05 M) in a microwave oven to unmask antigens. Endogenous peroxidase was quenched with 3% (vol/vol) hydrogen peroxide (10 min at room temperature), samples were rinsed three times for 5 min each time in PBS, and nonspecific binding was blocked with dehydrated nonfat milk (50 mg/ml diluted in PBS). Thereafter, tissue sections were rinsed with PBS-0.05% Tween 20 (PBS-T) three times and then incubated with 1:100 mouse antihuman VEGF antibody (which recognizes rat VEGF) overnight at 4 C. After washing four times with PBS-T, sections were incubated with biotinylated rabbit antimouse IgG (90 min, 1:300 dilution at 37 C) to amplify the signal. Sections were rinsed four times with PBS-T and then incubated with horseradish peroxidase-conjugated extravidin (30 min, 1:40 dilution at room temperature), washed with PBS-T four times, and incubated for 10 min with working substrate solution (0.2 ml stock amino ethyl carbazol solution with 3.8 ml 0.05 M acetate buffer, pH 6.0; immediately before use, 20 µl 3% H2O2 was added) to detect the signal; reaction was terminated by rinsing the slides gently with distilled water. Finally, slides were counterstained with Mayers hematoxylin, rinsed with water, mounted with glycerol gelatin, and viewed with an Olympus Corp. BH2 microscope (Melville, NY). Negative controls were included in each experiment by incubating tissue sections with antibody dilution buffer instead of the primary antibody. Positive control slides consisted of human hemangiosarcoma cells.
Blocking experiments
A series of blocking experiments was designed. Three protocols were assayed to inhibit increased permeability in OHSS animals by blocking the VEGFR-2. A total of 100 mg of the free powder compound SU5416 was diluted to a final concentration of 25 mg/ml in dimethylsulfoxide and kept at 4 C until it was used. For these experiments, a total of eight animals were included in each of the five experimental groups. The control group (n = 8) was treated as described above. The OHSS group (n = 8) was treated as previously described. In the OHSS inhibition group, rats were treated with PMSG and hCG in the same way as the OHSS animals, but SU5416 was added by ip injections (25 mg/kg·d) in three different forms: daily administration (q-24 h) of SU5416 coincidental with the injection of PMSG and hCG (d 2226), administration of SU5416 every 48 h (q-48 h; d 23, 25, and 27), and injection of SU5416 on the day of hCG treatment and 24 h later (p-hCG; d 26 and 27). VP was measured in all groups at one time point according to the maximal VP observed in the first series of experiments.
Statistical analysis
Data were expressed as the mean ± SEM. In the first series of VP and VEGF expression experiments, a nonparametric Kruskal-Wallis statistical method was used to find differences among groups at each time point. For this purpose, we previously normalized the VEGF/ß-actin ratio in PMSG and hCG groups with the VEGF/ß-actin ratio in the control group at each time point. In the experiments in which VP was measured to determine the relevance of the ovary as the source of VEGF and in the blocking experiments, a Mann-Whitney test was used to compare VP in OHSS group to those in the other groups. This test was also employed to find differences in VEGF expression between the ovary and the mesentery in the OHSS group. In this case the VEGF/ß-actin ratio in the ovary was normalized to the VEGF/ß-actin ratio in the mesentery at each time point in the OHSS group. Significance was defined as P < 0.05. Statistical analysis was carried out using the Statistical Package for Social Sciences (SPSS, Inc., Chicago, IL).
| Results |
|---|
|
|
|---|
Time-course determinations of VP using the EB method are shown in Fig. 1
. As observed, the VP induced by PMSG doubled the amount of extravasated dye observed in controls, although no significant changes during the different time points were found. The average VP measured with this method in control animals was 2.1 (range, 1.52.6) µg EB/100 g body weight. Two hours after hCG, the OHSS group showed a significant (P < 0.05) increase in VP (9.81 ± 2.3 µg EB/100 g body weight) compared with the PMSG and control groups. Maximal VP (26.1 ± 5.1 µg EB/100 g body weight; P < 0.001) was observed 48 h after hCG administration and remained significantly (P < 0.01) elevated after 96 h (18.6 ± 4.7 µg EB/100 g body weight).
|
Ovarian and mesentery mRNA VEGF expression
Whole VEGF expression in the ovaries of the PMSG group was 2- to 3-fold greater than that in the controls, but their values did not change during the time course. Whole VEGF expression in the ovaries of the PMSG group at 6 and 0 h was similar to that in the OHSS group, but a significant increase in VEGF expression was detected at 24 (4.3 ± 0.9; P < 0.05) and 48 h (5.6 ± 1.5; P < 0.05) after hCG administration in the OHSS compared with the control and PMSG groups (Fig. 2A
). This highest VEGF expression was coincidental with maximal VP to EB. Unlike the ovary, the expression of VEGF mRNA in the mesentery was not different among groups at any time point and did not change during the study period in any group (Fig. 2B
).
|
|
|
|
|
|
| Discussion |
|---|
|
|
|---|
The relevance of hCG in increasing capillary permeability was observed 2 h after hCG administration and peaked after 48 h. Interestingly, it was coincidental in time with the maximal expression of VEGF mRNA in the ovary. The link between VEGF and increased VP was further supported by the inhibitory experiments employing SU5416, in which we showed that the vascular changes can be prevented to a great extent by targeting the Flk-1/KDR receptor. Therefore, the present experiments show for the first time in vivo a close relationship between increased VEGF expression and capillary permeability in the OHSS model.
The fact that an increase in VEGF expression in both groups of stimulated animals was actually observed before a significant increase in VP suggests that other vasoactive substances may be involved in the early stages of OHSS. However, the coincidence in timing of VEGF expression and increased VP after 48 h and the inhibitory effects on VP of a VEGFR-2 inhibitor show a clear relationship between both phenomena after 2 d. This is of clinical relevance because OHSS first appears 36 d after hCG (33), emphasizing the role of molecules active 48 h after hCG, such as VEGF.
Several studies suggest an ovarian origin of the mediator and ascitic fluid present in OHSS (34, 35). In hyperstimulated women the ovary is also the source of VEGF and other cytokines (36, 37). The granulosa-luteinized cells of the ovarian follicle seem to be the main source of VEGF in response to hCG (6). Our studies (12) have shown that the endothelium has hCG receptors and responds to this gonadotropin by releasing VEGF and increasing the amount of KDR receptors present in the cell surface, suggesting that endothelial cells may be also involved in the pathogenesis of OHSS. Thus, provided that the ovary is involved in the pathogenesis of increased VP, the granulosa-luteinized cell may not be the only source of VEGF.
To clarify this issue in our model, we analyzed the expression of VEGF in a highly vascularized tissue, the mesentery, compared with that in ovaries of hyperstimulated rats. We found that hCG induced a significant increase in VEGF mRNA expression in the ovaries coincidental with peak VP, whereas the mesenteric contribution to VEGF mRNA expression did not change over time. To further prove our findings, we measured VP in ovariectomized animals after the administration of PMSG and hCG. No increase in VP was observed in the absence of the ovaries. This experiment does not exclude that other ovarian vasoactive substances, acting shortly after hCG administration, could also be removed from the circulation, but prove the ovarian origin of VEGF responsible for increased VP after 48 h.
The corpus luteum should be the source of VEGF (20). Employing immunohistochemistry, we further explored this issue in hyperstimulated animals. Both endothelial and granulosa-luteinized cells showed a positive signal. The endothelial cells of the neovascularized corpus luteum stained particularly high for VEGF. As VEGF is expressed and produced in granulosa-luteal cells (5, 6, 7, 8, 9, 10), this finding could be interpreted as a coparticipation of endothelial cells in this biological function, but also could be the result of a rapid release of VEGF from the granulosa cells on the vessels. It was surprising to observe the strong staining in the zona pellucida of the oocyte in atretic or preovulatory follicles. Further experiments employing in situ hybridization will clarify whether VEGF is produced in the oocyte.
Only the VEGF121 and VEGF165 isoforms are expressed in ovarian tissue, as shown in normal and malignant human ovary (8, 17) and in women with OHSS (13). This is in accordance with our rat model, in which we observed that, independently of the group analyzed, the ovaries only expressed these isoforms (VEGF120 and VEGF164), whereas the mesentery expressed all of the major VEGF isoforms. Taken together, these findings indicate that the changes in VP related to VEGF were based on the variation in the quantity, not the pattern, of expression of the VEGF isoforms and suggest that the augmented expression of VEGF120 and VEGF164 isoforms in the ovary is responsible for the increased VP in OHSS.
VEGF stimulation of KDR/Flk-1 is known to result in phosphorylation of the Src family of protein kinases (38) starting KDR signal transduction implicated in the development of endothelial reorganization, membrane ruffling, and chemotactic contraction (22). These morphological changes have often been observed in endothelial monolayers undergoing barrier changes in response to inflammatory mediators, implying that KDR-triggered intracellular cascade of events could be involved in the permeability response to VEGF (39, 40, 41).
SU5416 is a novel synthetic compound that was developed to inhibit KDR signaling in different cancers by avoiding the initial VEGFR-2 phosphorylation. Increasing doses of SU5416, administered in a murine cancer model, showed a significant dose-dependent decrease in tumor growth and VP, with the best results at a nontoxic dose of 25 mg/kg·d (42).
SU5416 treatment does not affect surface expression of Flk-1/KDR or the affinity of the receptor for VEGF. Instead, the durability of the activity of SU5416 is attributable to its long-lasting ability to specifically inhibit VEGF-dependent phosphorylation of Flk-1/KDR and subsequent downstream signaling, but SU5416 is not an irreversible inhibitor of Flk-1/KDR tyrosine kinase (43). Although Flk-1/KDR is probably up-regulated in the gonadotropin-treated animals (12), the massive doses of SU5416 administered (25 mg/kg) prevented the possibility of any appreciable effect due to up-regulation (42). SU5416 abolished the possibility of Src activation, posterior signal transduction, and the consequent vascular leakage, thus avoiding OHSS symptoms as seen by the significant blockage obtained in groups q48 and p-hCG.
A very interesting point is that the administration of SU5416 during ovarian stimulation with PMSG, but not after the hCG injection, was unable to block increasing permeability as seen in the q-24 h group. This finding agrees with the fact that OHSS appears in humans during the luteal phase after hCG administration (6, 13) and suggests that temporary inhibition of VEGFR-2 previous to hCG injection may not be a valid strategy to avoid the onset of the syndrome. Contrarily, the administration of SU5416 in q48 and p-hCG groups effectively reversed the increased VP, implying that injection of this compound after hCG may be critical to block increasing permeability in the OHSS. These observations open the possibility of establishing an effective treatment with a single injection of SU5416, avoiding the possible toxic effects of a longer inhibitory treatment (44).
The ability to reverse hCG action on VP by targeting the VEGFR-2 employing SU5416 not only supported the key role of VEGF in OHSS, but also provided new insights into the development of strategies to prevent and treat the syndrome based on its pathophysiological mechanism rather than using empirical approaches as we do today. In fact, tumor growth, neoangiogenesis, and ascites formation have been prevented in animals with different ovarian neoplasms targeting the VEGF system (25, 26, 27, 45, 46, 47, 48, 49), specifically the Flk-1 receptor with SU5416 (42, 50). Herein, we present evidence that the same approach can be used in the OHSS model.
| Acknowledgments |
|---|
| Footnotes |
|---|
Abbreviations: DEPC, Diethylpyrocarbonate; EB, Evans Blue; hCG, human chorionic gonadotropin; OHSS, ovarian hyperstimulation syndrome; PBS-T, PBS-0.05% Tween 20; PMSG, pregnant mares serum gonadotropin; VEGF, vascular endothelial growth factor; VEGFR, vascular endothelial growth factor receptor; VP, vascular permeability.
Received February 20, 2002.
Accepted for publication July 18, 2002.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
S. R. Soares, R. Gomez, C. Simon, J. A. Garcia-Velasco, and A. Pellicer Targeting the vascular endothelial growth factor system to prevent ovarian hyperstimulation syndrome Hum. Reprod. Update, April 2, 2008; (2008) dmn008v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Villasante, A. Pacheco, E. Pau, A. Ruiz, A. Pellicer, and J.A. Garcia-Velasco Soluble vascular endothelial-cadherin levels correlate with clinical and biological aspects of severe ovarian hyperstimulation syndrome Hum. Reprod., March 1, 2008; 23(3): 662 - 667. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Alvarez, I. Alonso-Muriel, G. Garcia, J. Crespo, J. Bellver, C. Simon, and A. Pellicer Implantation is apparently unaffected by the dopamine agonist Cabergoline when administered to prevent ovarian hyperstimulation syndrome in women undergoing assisted reproduction treatment: a pilot study Hum. Reprod., December 1, 2007; 22(12): 3210 - 3214. [Abstract] [Full Text] [PDF] |
||||
![]() |
P.D. Taylor, H. Wilson, S.G. Hillier, S.J. Wiegand, and H.M. Fraser Effects of inhibition of vascular endothelial growth factor at time of selection on follicular angiogenesis, expansion, development and atresia in the marmoset Mol. Hum. Reprod., October 1, 2007; 13(10): 729 - 736. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Aboulghar Preventing Ovarian Hyperstimulation Syndrome J. Clin. Endocrinol. Metab., August 1, 2007; 92(8): 2882 - 2884. [Full Text] [PDF] |
||||
![]() |
C. Alvarez, L. Marti-Bonmati, E. Novella-Maestre, R. Sanz, R. Gomez, M. Fernandez-Sanchez, C. Simon, and A. Pellicer Dopamine Agonist Cabergoline Reduces Hemoconcentration and Ascites in Hyperstimulated Women Undergoing Assisted Reproduction J. Clin. Endocrinol. Metab., August 1, 2007; 92(8): 2931 - 2937. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Villasante, A. Pacheco, A. Ruiz, A. Pellicer, and J. A. Garcia-Velasco Vascular Endothelial Cadherin Regulates Vascular Permeability: Implications for Ovarian Hyperstimulation Syndrome J. Clin. Endocrinol. Metab., January 1, 2007; 92(1): 314 - 321. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Gomez, M. Gonzalez-Izquierdo, R. C. Zimmermann, E. Novella-Maestre, I. Alonso-Muriel, J. Sanchez-Criado, J. Remohi, C. Simon, and A. Pellicer Low-Dose Dopamine Agonist Administration Blocks Vascular Endothelial Growth Factor (VEGF)-Mediated Vascular Hyperpermeability without Altering VEGF Receptor 2-Dependent Luteal Angiogenesis in a Rat Ovarian Hyperstimulation Model Endocrinology, November 1, 2006; 147(11): 5400 - 5411. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Pau, I. Alonso-Muriel, R. Gomez, E. Novella, A. Ruiz, J. A. Garcia-Velasco, C. Simon, and A. Pellicer Plasma levels of soluble vascular endothelial growth factor receptor-1 may determine the onset of early and late ovarian hyperstimulation syndrome Hum. Reprod., June 1, 2006; 21(6): 1453 - 1460. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Kitajima, T. Endo, K. Nagasawa, K. Manase, H. Honnma, T. Baba, T. Hayashi, H. Chiba, N. Sawada, and T. Saito Hyperstimulation and a Gonadotropin-Releasing Hormone Agonist Modulate Ovarian Vascular Permeability by Altering Expression of the Tight Junction Protein Claudin-5 Endocrinology, February 1, 2006; 147(2): 694 - 699. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Lambeng, Y. Wallez, C. Rampon, F. Cand, G. Christe, D. Gulino-Debrac, I. Vilgrain, and P. Huber Vascular Endothelial-Cadherin Tyrosine Phosphorylation in Angiogenic and Quiescent Adult Tissues Circ. Res., February 18, 2005; 96(3): 384 - 391. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Garcia-Velasco and A. Pellicer Reply: coasting acts through down regulation of VEGF gene expression and protein secretion Hum. Reprod., February 1, 2005; 20(2): 575 - 576. [Full Text] [PDF] |
||||