| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
REPRODUCTION-DEVELOPMENT |
Population Council (Z.Z., A.Z.W., Z.-M.F., D.M., C.Y.C., C.-L.C.C.) and Rockefeller University (C.-L.C.C.), New York, New York 10021
Address all correspondence and requests for reprints to: Ching-Ling C. Chen, Ph.D., Population Council, 1230 York Avenue, New York, New York 10021. E-mail: . chen{at}popcbr.rockefeller.edu
| Abstract |
|---|
|
|
|---|
-tubulin mRNA levels were not changed by any of the cAMP treatments. Inhibin
-subunit mRNA, on the other hand, was evidently increased by cAMP treatment in both MA-10 and Sertoli cells. However, inhibin
-subunit mRNA levels were elevated at 6090 min before the suppression of GATA-1 mRNA detected. The inhibitory effect of cAMP on GATA-1 mRNA and protein was shown to be specific to testicular cells. The GATA-1 mRNA expressed in MEL, a mouse erythroid leukemia cell line, was not affected by cAMP. The reduction of GATA-1 mRNA by cAMP can be prevented when a translational inhibitor, cycloheximide, is added. In summary, we demonstrated that gonadotropins via cAMP negatively regulate the mRNA and protein levels of GATA-1, but not GATA-4, in testicular cells. The inhibitory effect on GATA-1 gene expression was specific to testicular cells and was not observed in erythroid cells. | Introduction |
|---|
|
|
|---|
We and others have recently shown that mRNAs and proteins encoding GATA-1 and GATA-4 were detected in the Sertoli and Leydig cells of mouse and rat testis and the tumor cell lines derived from these testicular cells (13, 14, 15, 16, 17, 18, 20, 21). RT-PCR analysis revealed that testis-specific GATA-1 mRNA was also identified in MA-10, a mouse Leydig tumor cell line (16). Moreover, we have recently demonstrated that the two GATA-binding proteins play important roles in up-regulating the basal transcription of inhibin/activin
- and ß-B-subunit genes in testicular cells (16, 21). Our new findings indicated that GATA-1 transactivates both
- and ß-B-subunit gene transcription in two testicular tumor cell lines through interaction with the GATA motifs in their basal promoters, whereas GATA-4 transactivates only the ß-B-subunit promoter in these cells (21). GATA-4, however, was also shown to up-regulate the
-subunit gene promoter in other testicular tumor cell lines (18, 19).
The GATA-1 protein was shown to be expressed in an age- and spermatogenic cycle-specific manner in the testis (13, 14). The expression of GATA-4 gene in the testis was also suggested to be age-dependent (17, 18) but not stage-specific (18). In addition, GATA-4 gene can be induced by retinoic acid in cardiac cells (10) and by gonadotropins in testicular tumor cell lines (18, 19). However, the regulation of GATA-1 gene expression by hormones or other factors has not yet been studied in testicular cells. Because both gonadotropins/cAMP (for reviews, see Refs. 22, 23, 24, 25) and GATA-1 (16, 21) were shown to stimulate inhibin
-subunit gene expression in Sertoli and Leydig cells, the possible relationship of these regulators was thus investigated. In this study, we examined the effect of gonadotropins/cAMP on the expression of GATA-1 gene in testicular cells and presented unexpected observations that gonadotropins and cAMP negatively regulated GATA-1 (but not GATA-4) mRNA and protein levels in testicular cells, including MA-10 Leydig tumor cells and isolated rat Sertoli cells.
| Materials and Methods |
|---|
|
|
|---|
MEL cell line DS-19 (28), a mouse erythroleukemia cell line, was obtained from Dr. Shigeru Sassa (Rockefeller University, New York, NY). MEL cells were grown in modified Hams F-12 medium with 3.2 g/liter NaHCO3, 20 mM HEPES, 10% calf serum, pH 7.3 (29), and plated at a density of 1.0 x 105 cells/ml in 100-mm Petri dishes. For studies of the regulation of GATA-1 mRNA in MEL cells, the cells were plated at a density of 1.0 x 105 per dish. Forty-eight hours later, the cells were treated with cAMP or other hormones as indicated. Total RNA or nuclear protein was isolated from each dish for further analysis.
Primary cultures of Sertoli cells were prepared from 21-d-old Sprague Dawley male rats (Charles River Laboratories, Inc., Wilmington, MA) using procedures described previously (30, 31, 32, 33, 34). The use of animals for this study was approved by the Rockefeller University Animal Care and Use Committee. Briefly, Sertoli cells were isolated from seminiferous tubules by sequential enzymatic treatments of trypsin, collagenase/dispase, and hyaluronidase (Sigma, St. Louis, MO) suspended in Hams F-12 Nutrient Mixture/DMEM (F-12/DMEM; 1:1, vol/vol) (Life Technologies, Inc., Rockville, MD) as described elsewhere (30). Leydig cells were removed from the cell preparation using 1 M glycine in F12/DMEM containing 2 mM EDTA, 20 U/ml deoxyribonuclease I, and 0.003% soybean trypsin inhibitor (wt/vol). Freshly isolated Sertoli cells were plated on 100-mm Petri dishes (9-ml media/dish) at a density of 7 x 104 cells/cm2 in F-12/DMEM supplemented with gentamicin (20 mg/liter), sodium bicarbonate (1.2 g/liter), 15 mM HEPES, bovine insulin (10 mg/liter), human transferrin (5 mg/liter), bacitracin (5 mg/liter), and epidermal growth factor (2.5 µg/liter). Cells were incubated at 35 C in a humidified atmosphere of 95% air-5% CO2 (vol/vol) for 2448 h. The contaminating germ cells were then removed by placing in a hypotonic solution containing 20 mM Tris-HCl, pH 7.4, for 2.5 min (32). The purity of Sertoli cells was greater than 95%, when examined microscopically, after cells were fixed in acetone and stained with toluidine blue. Ovine FSH (0500 ng/ml) (National Hormone and Pituitary Program, NIH, lot no. AFP7028D), cAMP (0.10.3 mM), or forskolin (10 µM) at specified concentrations was added to the Sertoli cell-enriched cultures and incubated for 4 h before the cells were harvested for RNA extraction. Three replicate dishes were used for each treatment. Control cultures included Sertoli cells receiving no treatment or vehicle alone (0.1% dimethylsulfoxide). Cell viability was routinely monitored by trypan blue staining before and after treatment. No change in cell viability was detected in cultures treated with corresponding hormones or factors.
Progenitor Leydig cells (PLC), from 21-d-old rat testes, were provided by Dr. Matthew Hardy (Population Council, New York, NY) and were purified, as described previously by Shan et al. (35). Purity of Leydig cell fractions was evaluated by histochemical staining for 3ß-hydroxysteroid dehydrogenase activity (35).
Northern blot analysis
Total RNAs were prepared from MA-10, MEL, and rat Sertoli cells by extraction with TRIzol Reagent (Life Technologies, Inc.). Briefly, TRIzol Reagent was added to the cultured cells at a concentration of 1 ml per 10-cm2 culture dish. After extraction of the cell lysates with chloroform, total RNA was isolated by precipitation with isopropanol and was subjected to Northern blot analysis. The RNA was denatured with 6% formaldehyde and 50% formamide, fractionated in 1.1% agarose gel, and transferred onto Nytran-Plus membranes (Schleicher \|[amp ]\| Schuell, Inc., Keene, NH) as described previously (16, 21). 32P-radiolabeled specific cDNA was used as a hybridization probe for the detection of the corresponding mRNA on the blot. Autoradiograms were obtained by exposure of the RNA blots to x-ray films.
Expression plasmids, containing full-length cDNAs encoding mouse GATA-1 (pXM/GATA-1) (3) and GATA-4 (pMT2-mGATA-4) (10) were kindly provided by Dr. Stuart Orkin (Harvard Medical School, Boston, MA) and Dr. David Wilson (Washington University, St. Louis, MO), respectively, and were used to prepare radioactive probes for the identification of GATA-1 and GATA-4 mRNA on the RNA blots. Inhibin
-subunit mRNA was detected by using a human inhibin
-subunit cDNA (36) as a hybridization probe. A human
-tubulin cDNA fragment, isolated from human placenta (27), was used for detection. Glyceraldehyde-3-phosphate dehydrogenase (G3PDH) cDNA probe was prepared from rat testis, by RT-PCR, using primers described below.
Analysis of GATA-1 and other testicular mRNA by RT-PCR
The RT-PCR was carried out, as described previously (16, 21), using Titan One Tube RT/PCR Kit (Roche Molecular Biochemicals, Indianapolis, IN). Briefly, RT was performed using 2 µg of each total RNA isolated from cultured cells, 1 µM of each primer, 5 mM dithiothreitol, and 1 µl enzyme mixture containing reverse transcriptase and Taq DNA polymerase at 52 C for 30 min. After denaturation at 94 C for 2 min, the cDNAs were amplified 30 cycles by PCR at 94 C for 30 sec, 52 C for 30 sec, and 68 C for 90 sec in each amplification cycle. Forward primer (CAGGGATCCCATGGATTTTCCTGGTC, 26-mer) from translation initiation codon and reverse primer (TCCACAGTTCACACACTCTCTGGC, 24-mer) containing sequence complementary to amino acids 201209 of the zinc finger domain of mGATA-1 gene (3) were used for the analysis of GATA-1 mRNA by RT-PCR (16, 21). An aliquot of the RT-PCR products was subjected to agarose gel electrophoresis, followed by transferring to Nytran membrane. GATA-1 mRNA was verified by hybridization to a radiolabeled mGATA-1 cDNA probe. For analysis of rat androgen-binding protein (ABP) mRNA, forward primer TCGGCTGAATGATGGGAGATG and reverse primer AGAGATGTAGAAAGGACCTCC were derived from nucleotides no. 22002220 and 39583978 of the rat ABP gene (37). The generated RT-PCR products for ABP cDNA were verified by Southern blot analysis as described above.
The levels of total RNA used in each sample were further quantified by measurement of G3PDH or ß-actin mRNA levels by RT-PCR analysis. The primers used for analysis of G3PDH mRNA, forward primer ACCACAGTCCATGCCATCAC and reverse primer TCCACCACCCTGTTGCTG, were purchased from CLONTECH Laboratories, Inc. (Palo Alto, CA). The primers used for analysis of ß-actin mRNA, forward primer CGGCGAATTCGAAGCTGAGG and reverse primer TCCATCTTTCCTCATGGTCAGTGG, were also purchased from CLONTECH Laboratories, Inc.
Preparation of nuclear extracts
Nuclear extracts were prepared from MA-10 or MEL cells using procedures previously described by our and other laboratories (16, 21, 38). Briefly, cell pellets were collected and suspended in hypotonic buffer [10 mM HEPES (pH 7.9), 10 mM KCl, 1.5 mM MgCl2, 0.2 mM phenylmethylsulfonylfluoride, and 0.5 mM dithiothreitol] at 400 µl/dish for 10 min on ice. Nuclear proteins were extracted from the swollen cells in a buffer, 20 µl/dish, similar to the above hypotonic buffer except that 420 mM KCI and 25% glycerol were included. Aliquots of nuclear extracts were stored at -70 C until use.
Western blot analysis of GATA-1 protein
GATA-1 proteins in the nuclear extracts of MA-10 and MEL cells treated with or without cAMP were examined by Western blot analysis as described previously (21). Nuclear proteins prepared from MA-10 and MEL cells were subjected to SDS-PAGE using 10% polyacrylamide gel. After transferring the nuclear proteins onto Immun-Blot polyvinylidene difluoride membrane (Bio-Rad Laboratories, Inc., Hercules, CA), the membrane was placed in a solution containing 3% nonfat milk in TBS [10 mM Tris-HCl (pH 8.0), 150 mM NaCl, and 0.05% Tween-20] at 4C overnight. GATA-1 protein on the membrane was identified by incubation with anti-GATA-1 antiserum at 1:100 to 1:300 dilution (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) for 60 min at room temperature, followed by alkaline phosphatase-conjugated secondary antibody (Santa Cruz Biotechnology, Inc.) at 1:1500 to 1:2000 dilutions for 45 min at room temperature. GATA-1 protein was visualized using 5-bromo-4-chloro-3-indoyl phosphate p-toluidine salt and p-nitro blue tetrazolium chloride (Bio-Rad Laboratories, Inc.).
| Results |
|---|
|
|
|---|
|
|
-subunit, but not ß-subunit, gene in Sertoli cells (36, 39, 40, 41, 42). As shown in Fig. 2C
-subunit mRNA was elevated by FSH treatment, in a dose-dependent manner, at a concentration as low as 10 ng/ml (lane 4), progressively increased at 100 ng/ml (data not shown), and reached the maximal levels when 150 ng/ml (lane 5) or higher dose of FSH was added to the Sertoli cell culture medium.
cAMP suppresses GATA-1 (but not GATA-4) mRNA levels in MA-10 Leydig tumor cell line
It was suggested that Sertoli cells were the major sites of expressing GATA-1 gene in the testis (13, 14, 15, 16, 20), and immunostainable GATA-1 was observed in the Sertoli (but not Leydig) cells of mouse testis (14). However, our recent observations revealed that the two GATA-binding proteins were also expressed in MA-10, a mouse Leydig tumor cell line (16, 21). The levels of GATA-1 mRNA observed in MA-10 cells were higher than those obtained from primary cultures of rat Sertoli cells (Fig. 3A
). The expression of GATA-1 gene in Leydig cells was further confirmed by the detection of GATA-1 mRNA, by RT-PCR analysis from normal Leydig cells purified from 21-d-old rat testes, PLC (Fig. 3B
). To exclude the possibility that the detection of GATA-1 mRNA in PLC was a result of contamination of Sertoli cells, the presence of ABP mRNA, which is a Sertoli cell-specific mRNA, in PLC fraction was analyzed (Fig. 3C
). Our results indicated that ABP mRNA was not detected in the Leydig cell preparations, suggesting that the detected GATA-1 mRNA is expressed by the Leydig cells.
|
As shown in Fig. 4A
, GATA-1 mRNA levels were also markedly decreased by cAMP treatment in MA-10 Leydig tumor cell cultures. When 0.3 mM cAMP was administered to MA-10 cell cultures for 4 h, more than 95% of the GATA-1 mRNA was abolished (Fig. 4A
) (also see Fig. 6A
). The inhibition was also found when lower concentrations (such as 50 µM) of cAMP were used (data not shown). However, under the same condition, GATA-4 mRNA levels were not changed by cAMP at any concentration administered (Fig. 4B
). As shown previously (43, 44, 45), cAMP stimulated the expression of inhibin/activin
-subunit (Fig. 4C
), but not ß-B-subunit (data not shown), gene in these cells. In addition,
-tubulin mRNA (Fig. 4D
) and ribosomal RNA (data not shown) levels were not affected by the treatment. Our results thus suggested that the inhibitory effect of cAMP was specific to GATA-1 mRNA in MA-10 cells.
|
|
|
cAMP decreases GATA-1 protein levels in MA-10 cells
The effect of cAMP on GATA-1 protein levels in MA-10 and MEL cells was determined by Western blot analysis (Fig. 7
). Similar to the observed decrease in GATA-1 mRNA (Figs. 4
and 6
), treatment of MA-10 cells with cAMP, at 0.31.0 mM for 4 h, resulted in a decrease in immunoreactive GATA-1 protein (Fig. 7A
). Under the same condition, the GATA-1 protein levels in MEL cells were not changed by cAMP treatment (Fig. 7B
). The suppression of GATA-1 protein by cAMP, observed in MA-10 cells, was also confirmed by the decrease in the amount of GATA-1 protein binding to the GATA motifs in the inhibin
-subunit promoter, as determined by EMSA (data not shown).
|
-subunit mRNA levels by cAMP could be detected as early as 30 min after treatment, which is 6090 min before the reduction of GATA-1 mRNA was observed.
|
-tubulin mRNA was not significantly affected by cycloheximide at any concentration (15 µg/ml) employed (Fig. 9B
|
| Discussion |
|---|
|
|
|---|
- and ß-B-subunit genes, whereas GATA-4 up-regulated only ß-B-subunit gene transcription, in two testicular tumor cell lines derived from Sertoli and Leydig cells (16, 21). Both GATA-binding proteins (13, 14, 15, 16, 17, 18, 20, 21, 48) and inhibin/activin
- and ß-B-subunit genes (for reviews, see Refs. 22, 23, 24, 25) are expressed in high levels in immature mouse and rat testis, and in the Sertoli and Leydig cells and the tumor cell lines derived from these testicular cells. In this study, we provided the evidence that gonadotropins, via cAMP, negatively regulated the GATA-1 mRNA and protein levels in MA-10 and rat Sertoli cells but not in MEL cells, which expressed high levels of GATA-1. GATA-4 mRNA was previously shown to be stimulated by hCG in the mLTC-1 Leydig cell line (18) and by FSH in the MSC-1 Sertoli tumor cell line, which was stably transfected with a FSH receptor (19). However, our results indicated that GATA-4 mRNA levels were not affected either by FSH or cAMP treatment in rat Sertoli cell cultures and MA-10 cells, even though, under these conditions, inhibin
-subunit mRNA was evidently increased. The explanations for the observed discrepancy of the gonadotropins/cAMP effect on the expression of GATA-4 gene in different testicular cell lines remained to be determined. The reduction of GATA-1 mRNA levels by cAMP could be prevented by treatment with a transcriptional or a translational inhibitor, actinomycin D or cycloheximide, respectively, suggesting that the suppression of GATA-1 mRNA by cAMP may involve the synthesis of other proteins and mRNA in testicular cells. Similar suppressive effects of gonadotropins and cAMP have been demonstrated in other testis-expressing genes (49, 50). We have previously shown that clusterin mRNA levels were markedly decreased by treatment of MA-10 cells with cAMP for 17 h (27, 49). The suppression of clusterin mRNA levels was not attributable to the inhibition of clusterin gene transcription, as analyzed by nuclear run-on assay and transient transfection using a reporter CAT gene driven by different regions of the clusterin gene promoter (49). The reduction of clusterin mRNA by cAMP was suggested to be the result of an increase in the degradation of clusterin mRNA through synthesis of a destabilizing protein(s) and its mRNA (49). Although the time required for gonadotropins and cAMP to decrease GATA-1 and clusterin mRNA levels in testicular cells was different (2 and 17 h, respectively), similar mechanisms, such as induction of the synthesis of a destabilizing protein(s), may be employed for the suppression of these mRNA levels.
Alternatively, gonadotropins and cAMP may inhibit the transcriptional activity of GATA-1 gene, using a mechanism similar to that observed in
-retinoic acid receptor (51) or FSH receptor (52). It was suggested that FSH suppressed the all-trans-retinoic acid-induced nuclear localization, transcriptional transactivation, and protein expression of the
-retinoic acid receptor in the MSC-1 mouse Sertoli cell line (51). The down-regulation of the steady-state levels of FSH receptor, after exposure of Sertoli cells to FSH or cAMP, was mediated by changes in chromatin structure (52). cAMP may also induce posttranslational modifications in the GATA-binding proteins that could affect their DNA-binding and/or transcriptional activities. Whether gonadotropins and cAMP, acting at the transcriptional level, mRNA stability or posttranslational modification to negatively regulate GATA-1 mRNA in testicular cells is currently being investigated in our laboratory.
We have demonstrated that the transcription of inhibin
-subunit gene in testicular cells can be activated by both gonadotropins and GATA-1 (16, 44). The elevation of inhibin
-subunit mRNA by gonadotropins/cAMP was acting at the transcriptional level, through interaction with a cAMP- response element (CRE) motif in the promoter region of the
-subunit gene (44, 53, 54, 55) with CRE-binding protein (CREB) (54). We also showed that GATA-1 transactivated inhibin
-subunit gene transcription through interaction with two GATA motifs in the promoter region (16). Mutations of either or both of the GATA motifs markedly decreased the basal promoter activity of
-subunit gene in testicular cells; however, they did not affect the stimulatory effect of cAMP on the transcription of the
-subunit gene (16). This was also supported by our observations, in this study, that the elevation of inhibin
-subunit mRNA levels by cAMP was observed at 6090 min before the suppression of GATA-1 mRNA occurred (Fig. 8
).
Our preliminary observations revealed that mutation of the CRE motif, which resides proximal to the two GATA motifs in the
-subunit promoter, drastically increased the effect of GATA-1 on the transactivation of
-subunit gene (Feng, Z.-M., and C.-L.Chen, unpublished data), suggesting that CRE-binding protein(s) and GATA-1 may compete their bindings to the neighboring CRE and GATA motifs, respectively, in the
-subunit gene. Therefore, although our observations suggested that gonadotropins and GATA-1 may stimulate the
-subunit gene transcription via separate mechanisms, the levels of the CRE-binding protein(s) and GATA-1 binding to the CRE and GATA motifs, respectively, in the
-subunit promoter may play roles in regulating
-subunit gene transcription in testicular cells. Under normal culture condition, GATA-1 mRNA and protein, which are present in high levels in the absence of cAMP treatment, may play as one of the major modulators in the activation of the basal transcription of
-subunit gene. Upon treatment with gonadotropins or cAMP, the phosphorylated form of CREB or related protein(s), through interaction with the CRE motif, may act as a major regulator in the stimulation of
-subunit gene expression in testicular cells, The decrease in GATA-1 expression by gonadotropins/cAMP treatment may prevent the competition of GATA-1 and CREB or related protein for binding to the
-subunit promoter. The relationship of GATA-1 and CREB or related protein(s) in the regulation of the
-subunit gene expression in testicular cells, with or without gonadotropins/cAMP treatment, is currently under investigation.
In summary, we have demonstrated that the two testis-expressing GATA-binding proteins, GATA-1 and GATA-4, not only exert different functions on the transactivation of testicular genes, such as inhibin/activin subunit genes, but also respond differently to hormones, such as gonadotropins, in testicular cells.
| Acknowledgments |
|---|
| Footnotes |
|---|
1 Current address: Research Institute of Sericulture, Chinese Academy of Agricultural Sciences, Zhenjiang City, Jian Su 212018, Peoples Republic of China. ![]()
Abbreviations: ABP, Androgen-binding protein; CRE, cAMP- response element; CREB, CRE-binding protein; G3PDH, glyceraldehyde-3-phosphate dehydrogenase; IBMX, 3-isobutyl-1-methylxanthine; MEL, mouse erythroid leukemia cell line; PLC, progenitor Leydig cells.
Received July 17, 2001.
Accepted for publication November 8, 2001.
| References |
|---|
|
|
|---|
-subunit gene in MA-10 Leydig tumor cells. Mol Endocrinol 12:378390
-subunit gene in vivo and in vitro. Mol Endocrinol 3:2935[Abstract]
-and ß-subunit mRNA levels and inhibin secretion. Mol Cell Endocrinol 55:101105[CrossRef][Medline]
- and ß-subunit mRNA levels in rat Sertoli cells. Mol Cell Endocrinol 68:4552[CrossRef][Medline]
-subunit promoter in MA-10 Leydig tumor cells. J Mol Endocrinol 13:3947[Abstract]
- nuclear localization and transcriptional activation in mouse Sertoli cell line. J Biol Chem 275:41454151
inhibin gene by cyclic adenosine 3',5'-monophosphate after transfection into rat granulosa cells. Mol Endocrinol 5:521534[Abstract]
gene and its promoter. Biochem Biophys Res Commun 186:293300[CrossRef][Medline]This article has been cited by other articles:
![]() |
R. S. Viger, S. M. Guittot, M. Anttonen, D. B. Wilson, and M. Heikinheimo Role of the GATA Family of Transcription Factors in Endocrine Development, Function, and Disease Mol. Endocrinol., April 1, 2008; 22(4): 781 - 798. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. S. Viger, H. Taniguchi, N. M. Robert, and J. J. Tremblay The 25th Volume: Role of the GATA Family of Transcription Factors in Andrology J Androl, July 1, 2004; 25(4): 441 - 452. [Full Text] [PDF] |
||||
![]() |
H.-J. Shi, A. Z. Wu, M. Santos, Z.-M. Feng, L. Huang, Y.-M. Chen, K. Zhu, and C.-L. C. Chen Cloning and Characterization of Rat Spermatid Protein SSP411: A Thioredoxin-Like Protein J Androl, July 1, 2004; 25(4): 479 - 493. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. A. LaVoie The Role of GATA in Mammalian Reproduction Experimental Biology and Medicine, December 1, 2003; 228(11): 1282 - 1290. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Tremblay and R. S. Viger Transcription Factor GATA-4 Is Activated by Phosphorylation of Serine 261 via the cAMP/Protein Kinase A Signaling Pathway in Gonadal Cells J. Biol. Chem., June 6, 2003; 278(24): 22128 - 22135. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Anttonen, I. Ketola, H. Parviainen, A.-K. Pusa, and M. Heikinheimo FOG-2 and GATA-4 Are Coexpressed in the Mouse Ovary and Can Modulate Mullerian-Inhibiting Substance Expression Biol Reprod, April 1, 2003; 68(4): 1333 - 1340. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||