help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhang, Z.
Right arrow Articles by Chen, C.-L. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhang, Z.
Right arrow Articles by Chen, C.-L. C.
Endocrinology Vol. 143, No. 3 829-836
Copyright © 2002 by The Endocrine Society


REPRODUCTION-DEVELOPMENT

Gonadotropins, via cAMP, Negatively Regulate GATA-1 Gene Expression in Testicular Cells

Zhifang Zhang1, Ai Zhen Wu, Zong-Ming Feng, Dolores Mruk, C. Yan Cheng and Ching-Ling C. Chen

Population Council (Z.Z., A.Z.W., Z.-M.F., D.M., C.Y.C., C.-L.C.C.) and Rockefeller University (C.-L.C.C.), New York, New York 10021

Address all correspondence and requests for reprints to: Ching-Ling C. Chen, Ph.D., Population Council, 1230 York Avenue, New York, New York 10021. E-mail: . chen{at}popcbr.rockefeller.edu


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We and others demonstrated that the mRNAs encoding GATA-binding proteins, GATA-1 and GATA-4, were detected in mouse and rat testis, and in isolated rat Sertoli cells and testicular tumor cell lines derived from Leydig and Sertoli cells. In this study, we investigated the possible effects of gonadotropins and cAMP on the expression of GATA-binding protein genes in testicular cells. Unexpectedly, FSH negatively regulated GATA-1 (but not GATA-4) mRNA in a dose-dependent manner in primary cultures of rat Sertoli cells isolated from 21-d-old animals. GATA-1 mRNA was also negatively regulated by cAMP in a dose- and time-dependent manner in MA-10, a mouse Leydig tumor cell line. When 0.3 mM cAMP was administered to MA-10 cell cultures for 4 h, more than 95% of the GATA-1 mRNA and protein was abolished. The reduction of GATA-1 mRNA by cAMP can be mimicked by treatment with forskolin, which elevates intracellular cAMP levels. The inhibitory effect of cAMP was specific to the GATA-1 gene, given that GATA-4 and {alpha}-tubulin mRNA levels were not changed by any of the cAMP treatments. Inhibin {alpha}-subunit mRNA, on the other hand, was evidently increased by cAMP treatment in both MA-10 and Sertoli cells. However, inhibin {alpha}-subunit mRNA levels were elevated at 60–90 min before the suppression of GATA-1 mRNA detected. The inhibitory effect of cAMP on GATA-1 mRNA and protein was shown to be specific to testicular cells. The GATA-1 mRNA expressed in MEL, a mouse erythroid leukemia cell line, was not affected by cAMP. The reduction of GATA-1 mRNA by cAMP can be prevented when a translational inhibitor, cycloheximide, is added. In summary, we demonstrated that gonadotropins via cAMP negatively regulate the mRNA and protein levels of GATA-1, but not GATA-4, in testicular cells. The inhibitory effect on GATA-1 gene expression was specific to testicular cells and was not observed in erythroid cells.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
GATA-1 BELONGS TO the GATA-binding protein family, members of which recognize a consensus sequence (T/A)GATA(A/G) and share conserved zinc fingers in their DNA-binding domains. GATA-1 was originally identified as a transcription factor exclusively required for the cell-specific expression of globin genes and other erythroid lineage-specific genes (1, 2, 3, 4, 5). The expression of other GATA-binding proteins was also tissue-specific (6, 7). GATA-2 was expressed in erythroid cells; embryonic brain, liver, and cardiac muscle (6); and endothelial cells (8). GATA-3 was identified in definitive erythrocytes, T lymphocytes, embryonic tissues, and placenta (6, 9). GATA-4, GATA-5, and GATA-6 were predominantly observed in the heart, intestine, and gut (10, 11, 12). In gonads, GATA-1, GATA-4, and GATA-6 were identified in the testis (10, 11, 13, 14, 15, 16, 17, 18), and GATA-4 and GATA-6 were detected in the ovary (10, 11, 17, 19). The mouse testicular GATA-1 mRNA was shown to be transcribed from a testis-specific promoter that is 8 kb upstream from that in erythroid cells. The remaining exons that encode the GATA-1 protein are commonly used by both testis and erythroid transcripts (13, 15, 16).

We and others have recently shown that mRNAs and proteins encoding GATA-1 and GATA-4 were detected in the Sertoli and Leydig cells of mouse and rat testis and the tumor cell lines derived from these testicular cells (13, 14, 15, 16, 17, 18, 20, 21). RT-PCR analysis revealed that testis-specific GATA-1 mRNA was also identified in MA-10, a mouse Leydig tumor cell line (16). Moreover, we have recently demonstrated that the two GATA-binding proteins play important roles in up-regulating the basal transcription of inhibin/activin {alpha}- and ß-B-subunit genes in testicular cells (16, 21). Our new findings indicated that GATA-1 transactivates both {alpha}- and ß-B-subunit gene transcription in two testicular tumor cell lines through interaction with the GATA motifs in their basal promoters, whereas GATA-4 transactivates only the ß-B-subunit promoter in these cells (21). GATA-4, however, was also shown to up-regulate the {alpha}-subunit gene promoter in other testicular tumor cell lines (18, 19).

The GATA-1 protein was shown to be expressed in an age- and spermatogenic cycle-specific manner in the testis (13, 14). The expression of GATA-4 gene in the testis was also suggested to be age-dependent (17, 18) but not stage-specific (18). In addition, GATA-4 gene can be induced by retinoic acid in cardiac cells (10) and by gonadotropins in testicular tumor cell lines (18, 19). However, the regulation of GATA-1 gene expression by hormones or other factors has not yet been studied in testicular cells. Because both gonadotropins/cAMP (for reviews, see Refs. 22, 23, 24, 25) and GATA-1 (16, 21) were shown to stimulate inhibin {alpha}-subunit gene expression in Sertoli and Leydig cells, the possible relationship of these regulators was thus investigated. In this study, we examined the effect of gonadotropins/cAMP on the expression of GATA-1 gene in testicular cells and presented unexpected observations that gonadotropins and cAMP negatively regulated GATA-1 (but not GATA-4) mRNA and protein levels in testicular cells, including MA-10 Leydig tumor cells and isolated rat Sertoli cells.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell culture and treatment
MA-10, a mouse Leydig tumor cell line, was provided by Dr. Mario Ascoli (University of Iowa, Iowa City, IA). The MA-10 cells were plated at a density of 1.5–2 x 106 cells in 100-mm Petri dishes. The cells were maintained as previously described (26, 27) in Waymouth MB752/1 modified to contain 1.1 g/liter NaHCO3, 20 mM HEPES, 50 µg/ml gentamycin, and 15% horse serum, pH 7.4. For the studies of hormone treatment, MA-10 cells were plated at a density of 3.0 x 106 per 100-mm dish. Forty-eight hours later, cAMP, hormones, cycloheximide, or actinomycin D was added to the medium as indicated. Cells were collected, and RNA or nuclear extract was isolated from each dish.

MEL cell line DS-19 (28), a mouse erythroleukemia cell line, was obtained from Dr. Shigeru Sassa (Rockefeller University, New York, NY). MEL cells were grown in modified Ham‘s F-12 medium with 3.2 g/liter NaHCO3, 20 mM HEPES, 10% calf serum, pH 7.3 (29), and plated at a density of 1.0 x 105 cells/ml in 100-mm Petri dishes. For studies of the regulation of GATA-1 mRNA in MEL cells, the cells were plated at a density of 1.0 x 105 per dish. Forty-eight hours later, the cells were treated with cAMP or other hormones as indicated. Total RNA or nuclear protein was isolated from each dish for further analysis.

Primary cultures of Sertoli cells were prepared from 21-d-old Sprague Dawley male rats (Charles River Laboratories, Inc., Wilmington, MA) using procedures described previously (30, 31, 32, 33, 34). The use of animals for this study was approved by the Rockefeller University Animal Care and Use Committee. Briefly, Sertoli cells were isolated from seminiferous tubules by sequential enzymatic treatments of trypsin, collagenase/dispase, and hyaluronidase (Sigma, St. Louis, MO) suspended in Ham’s F-12 Nutrient Mixture/DMEM (F-12/DMEM; 1:1, vol/vol) (Life Technologies, Inc., Rockville, MD) as described elsewhere (30). Leydig cells were removed from the cell preparation using 1 M glycine in F12/DMEM containing 2 mM EDTA, 20 U/ml deoxyribonuclease I, and 0.003% soybean trypsin inhibitor (wt/vol). Freshly isolated Sertoli cells were plated on 100-mm Petri dishes (9-ml media/dish) at a density of 7 x 104 cells/cm2 in F-12/DMEM supplemented with gentamicin (20 mg/liter), sodium bicarbonate (1.2 g/liter), 15 mM HEPES, bovine insulin (10 mg/liter), human transferrin (5 mg/liter), bacitracin (5 mg/liter), and epidermal growth factor (2.5 µg/liter). Cells were incubated at 35 C in a humidified atmosphere of 95% air-5% CO2 (vol/vol) for 24–48 h. The contaminating germ cells were then removed by placing in a hypotonic solution containing 20 mM Tris-HCl, pH 7.4, for 2.5 min (32). The purity of Sertoli cells was greater than 95%, when examined microscopically, after cells were fixed in acetone and stained with toluidine blue. Ovine FSH (0–500 ng/ml) (National Hormone and Pituitary Program, NIH, lot no. AFP7028D), cAMP (0.1–0.3 mM), or forskolin (10 µM) at specified concentrations was added to the Sertoli cell-enriched cultures and incubated for 4 h before the cells were harvested for RNA extraction. Three replicate dishes were used for each treatment. Control cultures included Sertoli cells receiving no treatment or vehicle alone (0.1% dimethylsulfoxide). Cell viability was routinely monitored by trypan blue staining before and after treatment. No change in cell viability was detected in cultures treated with corresponding hormones or factors.

Progenitor Leydig cells (PLC), from 21-d-old rat testes, were provided by Dr. Matthew Hardy (Population Council, New York, NY) and were purified, as described previously by Shan et al. (35). Purity of Leydig cell fractions was evaluated by histochemical staining for 3ß-hydroxysteroid dehydrogenase activity (35).

Northern blot analysis
Total RNAs were prepared from MA-10, MEL, and rat Sertoli cells by extraction with TRIzol Reagent (Life Technologies, Inc.). Briefly, TRIzol Reagent was added to the cultured cells at a concentration of 1 ml per 10-cm2 culture dish. After extraction of the cell lysates with chloroform, total RNA was isolated by precipitation with isopropanol and was subjected to Northern blot analysis. The RNA was denatured with 6% formaldehyde and 50% formamide, fractionated in 1.1% agarose gel, and transferred onto Nytran-Plus membranes (Schleicher \|[amp ]\| Schuell, Inc., Keene, NH) as described previously (16, 21). 32P-radiolabeled specific cDNA was used as a hybridization probe for the detection of the corresponding mRNA on the blot. Autoradiograms were obtained by exposure of the RNA blots to x-ray films.

Expression plasmids, containing full-length cDNAs encoding mouse GATA-1 (pXM/GATA-1) (3) and GATA-4 (pMT2-mGATA-4) (10) were kindly provided by Dr. Stuart Orkin (Harvard Medical School, Boston, MA) and Dr. David Wilson (Washington University, St. Louis, MO), respectively, and were used to prepare radioactive probes for the identification of GATA-1 and GATA-4 mRNA on the RNA blots. Inhibin {alpha}-subunit mRNA was detected by using a human inhibin {alpha}-subunit cDNA (36) as a hybridization probe. A human {alpha}-tubulin cDNA fragment, isolated from human placenta (27), was used for detection. Glyceraldehyde-3-phosphate dehydrogenase (G3PDH) cDNA probe was prepared from rat testis, by RT-PCR, using primers described below.

Analysis of GATA-1 and other testicular mRNA by RT-PCR
The RT-PCR was carried out, as described previously (16, 21), using Titan One Tube RT/PCR Kit (Roche Molecular Biochemicals, Indianapolis, IN). Briefly, RT was performed using 2 µg of each total RNA isolated from cultured cells, 1 µM of each primer, 5 mM dithiothreitol, and 1 µl enzyme mixture containing reverse transcriptase and Taq DNA polymerase at 52 C for 30 min. After denaturation at 94 C for 2 min, the cDNAs were amplified 30 cycles by PCR at 94 C for 30 sec, 52 C for 30 sec, and 68 C for 90 sec in each amplification cycle. Forward primer (CAGGGATCCCATGGATTTTCCTGGTC, 26-mer) from translation initiation codon and reverse primer (TCCACAGTTCACACACTCTCTGGC, 24-mer) containing sequence complementary to amino acids 201–209 of the zinc finger domain of mGATA-1 gene (3) were used for the analysis of GATA-1 mRNA by RT-PCR (16, 21). An aliquot of the RT-PCR products was subjected to agarose gel electrophoresis, followed by transferring to Nytran membrane. GATA-1 mRNA was verified by hybridization to a radiolabeled mGATA-1 cDNA probe. For analysis of rat androgen-binding protein (ABP) mRNA, forward primer TCGGCTGAATGATGGGAGATG and reverse primer AGAGATGTAGAAAGGACCTCC were derived from nucleotides no. 2200–2220 and 3958–3978 of the rat ABP gene (37). The generated RT-PCR products for ABP cDNA were verified by Southern blot analysis as described above.

The levels of total RNA used in each sample were further quantified by measurement of G3PDH or ß-actin mRNA levels by RT-PCR analysis. The primers used for analysis of G3PDH mRNA, forward primer ACCACAGTCCATGCCATCAC and reverse primer TCCACCACCCTGTTGCTG, were purchased from CLONTECH Laboratories, Inc. (Palo Alto, CA). The primers used for analysis of ß-actin mRNA, forward primer CGGCGAATTCGAAGCTGAGG and reverse primer TCCATCTTTCCTCATGGTCAGTGG, were also purchased from CLONTECH Laboratories, Inc.

Preparation of nuclear extracts
Nuclear extracts were prepared from MA-10 or MEL cells using procedures previously described by our and other laboratories (16, 21, 38). Briefly, cell pellets were collected and suspended in hypotonic buffer [10 mM HEPES (pH 7.9), 10 mM KCl, 1.5 mM MgCl2, 0.2 mM phenylmethylsulfonylfluoride, and 0.5 mM dithiothreitol] at 400 µl/dish for 10 min on ice. Nuclear proteins were extracted from the swollen cells in a buffer, 20 µl/dish, similar to the above hypotonic buffer except that 420 mM KCI and 25% glycerol were included. Aliquots of nuclear extracts were stored at -70 C until use.

Western blot analysis of GATA-1 protein
GATA-1 proteins in the nuclear extracts of MA-10 and MEL cells treated with or without cAMP were examined by Western blot analysis as described previously (21). Nuclear proteins prepared from MA-10 and MEL cells were subjected to SDS-PAGE using 10% polyacrylamide gel. After transferring the nuclear proteins onto Immun-Blot polyvinylidene difluoride membrane (Bio-Rad Laboratories, Inc., Hercules, CA), the membrane was placed in a solution containing 3% nonfat milk in TBS [10 mM Tris-HCl (pH 8.0), 150 mM NaCl, and 0.05% Tween-20] at 4C overnight. GATA-1 protein on the membrane was identified by incubation with anti-GATA-1 antiserum at 1:100 to 1:300 dilution (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) for 60 min at room temperature, followed by alkaline phosphatase-conjugated secondary antibody (Santa Cruz Biotechnology, Inc.) at 1:1500 to 1:2000 dilutions for 45 min at room temperature. GATA-1 protein was visualized using 5-bromo-4-chloro-3-indoyl phosphate p-toluidine salt and p-nitro blue tetrazolium chloride (Bio-Rad Laboratories, Inc.).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
FSH suppresses GATA-1 (but not GATA-4) mRNA levels in primary cultures of rat Sertoli cells
Because GATA-binding proteins were shown to be predominantly expressed in the Sertoli cells of mouse and rat testis (13, 14, 15, 16, 17, 18, 20, 21), the regulation of GATA-1 and GATA-4 by gonadotropins was first investigated in the primary cultures of Sertoli cells isolated from 21-d-old rats. Administration of FSH, at 300 or 500 ng/ml, to the cultures of Sertoli cells markedly decreased GATA-1 mRNA levels (Fig. 1AGo). The suppression of GATA-1 mRNA levels in the Sertoli cells was a result of elevated intracellular cAMP, given that forskolin (10 µM), which is an activator of adenylyl cyclase (lanes 8 and 9) and cAMP (0.3 mM, data not shown), can mimic the negative effect of FSH on the regulation of GATA-1 gene expression in Sertoli cells. The reduction of GATA-1 mRNA levels by FSH in rat Sertoli cells occurred in a dose-dependent fashion (Fig. 2AGo). Addition of FSH to primary cultures of Sertoli cells, at the concentration of 1 (lane 3), 10 (lane 4), or 100 (data not shown) ng/ml, did not significantly affected GATA-1 mRNA levels. Treatment of rat Sertoli cells with FSH, at 150 ng/ml for 4 h, resulted in a decrease of approximately 70% of GATA-1 mRNA (Fig. 2AGo).



View larger version (38K):
[in this window]
[in a new window]
 
Figure 1. FSH and forskolin decreased GATA-1 mRNA levels in rat Sertoli cells. Primary cultures of Sertoli cells, prepared from 21-d-old rat testes, were treated with FSH or forskolin, as indicated, for 4 h. Two micrograms each of total RNA, isolated from cultured Sertoli cells, were subjected to RT-PCR analysis of GATA-1 (A) and G3PDH (B) mRNA as described in Materials and Methods.

 


View larger version (57K):
[in this window]
[in a new window]
 
Figure 2. The effect of FSH on the regulation of GATA-1 (A), GATA-4 (B), and inhibin {alpha}-subunit (C) mRNA levels in rat Sertoli cells. Primary cultures of 21-d-old rat Sertoli cells were treated without or with various concentrations of FSH, as indicated, for 4 h. Fifteen micrograms each of total RNA, isolated from Sertoli cells, were subjected to Northern blot analysis of GATA-1, GATA-4, and inhibin {alpha}-subunit mRNA.

 
The inhibitory effect of FSH and forskolin on GATA-1 mRNA levels observed in Sertoli cells is specific to the GATA-1 gene. Under the conditions that GATA-1 mRNA levels were suppressed by FSH (Fig. 2AGo), GATA-4 mRNA levels were not changed by treatment with FSH (Fig. 2BGo) or forskolin (data not shown). We and others have previously demonstrated that FSH stimulates the expression of inhibin/activin {alpha}-subunit, but not ß-subunit, gene in Sertoli cells (36, 39, 40, 41, 42). As shown in Fig. 2CGo, inhibin {alpha}-subunit mRNA was elevated by FSH treatment, in a dose-dependent manner, at a concentration as low as 10 ng/ml (lane 4), progressively increased at 100 ng/ml (data not shown), and reached the maximal levels when 150 ng/ml (lane 5) or higher dose of FSH was added to the Sertoli cell culture medium.

cAMP suppresses GATA-1 (but not GATA-4) mRNA levels in MA-10 Leydig tumor cell line
It was suggested that Sertoli cells were the major sites of expressing GATA-1 gene in the testis (13, 14, 15, 16, 20), and immunostainable GATA-1 was observed in the Sertoli (but not Leydig) cells of mouse testis (14). However, our recent observations revealed that the two GATA-binding proteins were also expressed in MA-10, a mouse Leydig tumor cell line (16, 21). The levels of GATA-1 mRNA observed in MA-10 cells were higher than those obtained from primary cultures of rat Sertoli cells (Fig. 3AGo). The expression of GATA-1 gene in Leydig cells was further confirmed by the detection of GATA-1 mRNA, by RT-PCR analysis from normal Leydig cells purified from 21-d-old rat testes, PLC (Fig. 3BGo). To exclude the possibility that the detection of GATA-1 mRNA in PLC was a result of contamination of Sertoli cells, the presence of ABP mRNA, which is a Sertoli cell-specific mRNA, in PLC fraction was analyzed (Fig. 3CGo). Our results indicated that ABP mRNA was not detected in the Leydig cell preparations, suggesting that the detected GATA-1 mRNA is expressed by the Leydig cells.



View larger version (33K):
[in this window]
[in a new window]
 
Figure 3. Detection of GATA-1 mRNA in MA-10 and purified normal Leydig cells. A, Twenty micrograms each of total RNA isolated from 21-d-old testis, MA-10, and rat Sertoli cells from 21-d-old animals (lanes 1–3) were subjected to Northern blot analysis of GATA-1 mRNA; B–D, 0.5 µg each of total RNA from 21-d-old rat testis (lane 1) and 1 µg each of total RNA of purified rat Leydig cells isolated from 21-d-old animals (lane 2) were used for the analysis of GATA-1 (B), ABP (C), and ß-actin (D) mRNA, by the RT-PCR method.

 
In view of the fact that GATA-1 gene is expressed in MA-10 cells in a level higher than that in the cultured Sertoli cells (Fig. 3AGo) and that the expression of GATA-1 gene in mouse (15) and rat (our unpublished observations) Sertoli cells was markedly reduced, with time, during culture (compared with those freshly isolated from testes), the following studies on the regulation of GATA-1 gene expression by gonadotropins were performed using MA-10 cells.

As shown in Fig. 4AGo, GATA-1 mRNA levels were also markedly decreased by cAMP treatment in MA-10 Leydig tumor cell cultures. When 0.3 mM cAMP was administered to MA-10 cell cultures for 4 h, more than 95% of the GATA-1 mRNA was abolished (Fig. 4AGo) (also see Fig. 6AGo). The inhibition was also found when lower concentrations (such as 50 µM) of cAMP were used (data not shown). However, under the same condition, GATA-4 mRNA levels were not changed by cAMP at any concentration administered (Fig. 4BGo). As shown previously (43, 44, 45), cAMP stimulated the expression of inhibin/activin {alpha}-subunit (Fig. 4CGo), but not ß-B-subunit (data not shown), gene in these cells. In addition, {alpha}-tubulin mRNA (Fig. 4DGo) and ribosomal RNA (data not shown) levels were not affected by the treatment. Our results thus suggested that the inhibitory effect of cAMP was specific to GATA-1 mRNA in MA-10 cells.



View larger version (71K):
[in this window]
[in a new window]
 
Figure 4. Suppression of GATA-1 (but not GATA-4) mRNA by cAMP in MA-10 cells. Different concentrations of cAMP were added, as indicated, to the culture medium of MA-10 cells. Cells were harvest at 4 h after treatment, and total RNAs were isolated. Sixteen micrograms each of MA-10 RNA were subjected to Northern blot analysis for the detection of GATA-1 (A), GATA-4 (B), inhibin {alpha}-subunit (C), and {alpha}-tubulin (D) mRNA levels.

 


View larger version (61K):
[in this window]
[in a new window]
 
Figure 6. Forskolin mimicked cAMP in the suppression of GATA-1 mRNA levels in MA-10 cells. MA-10 (A) and MEL (B) cells were treated, as indicated, with 10 µM forskolin (fors), or with 0.3 mM cAMP in the presence or absence of 0.3 mM IBMX. The GATA-1 mRNA levels in these cells were examined by Northern blot analysis. Treatment times were: 4 h for MA-10 cells, and 8 h for MEL cells.

 
cAMP exerts no effect on GATA-1 gene expression in erythroid cells
The effect of cAMP on GATA-1 mRNA levels in erythroid cells was next studied in mouse erythroleukemia (MEL) cells, which express high levels of GATA-1 (Figs. 5AGo and 6BGo and Refs. 3, 5). Treatment with cAMP at concentrations from 0.05–1.0 mM did not affect the expression of GATA-1 gene in MEL cells (Fig. 5AGo). As expected, the GATA-4 gene is not expressed in MEL cells (Fig. 5BGo). These observations suggested that the negative effect of cAMP on GATA-1 mRNA is specific to testicular cells.



View larger version (58K):
[in this window]
[in a new window]
 
Figure 5. cAMP exerts no effect on GATA-1 mRNA levels in MEL cells. MEL cells were treated with various concentrations of cAMP, for 4 h, before harvest. Sixteen micrograms each of total RNA isolated from MEL cells were applied onto Northern blot analysis for GATA-1 (A), GATA-4 (B), and {alpha}-tubulin (C) mRNA levels.

 
The suppression of GATA-1 gene expression was a direct result of elevated intracellular cAMP, given that forskolin (10 µM, lanes 3–4, Fig. 6AGo) and hCG (40 ng/ml, data not shown) can mimic the cAMP effect, to negatively regulate GATA-1 mRNA levels in MA-10 cells. Treatment with forskolin or phosphodiesterase inhibitor, 3-isobutyl-1-methylxanthine (IBMX), to increase cAMP levels in MEL cells, did not cause any significant change in GATA-1 mRNA levels in these erythroid cells (Fig. 6BGo).

cAMP decreases GATA-1 protein levels in MA-10 cells
The effect of cAMP on GATA-1 protein levels in MA-10 and MEL cells was determined by Western blot analysis (Fig. 7Go). Similar to the observed decrease in GATA-1 mRNA (Figs. 4Go and 6Go), treatment of MA-10 cells with cAMP, at 0.3–1.0 mM for 4 h, resulted in a decrease in immunoreactive GATA-1 protein (Fig. 7AGo). Under the same condition, the GATA-1 protein levels in MEL cells were not changed by cAMP treatment (Fig. 7BGo). The suppression of GATA-1 protein by cAMP, observed in MA-10 cells, was also confirmed by the decrease in the amount of GATA-1 protein binding to the GATA motifs in the inhibin {alpha}-subunit promoter, as determined by EMSA (data not shown).



View larger version (65K):
[in this window]
[in a new window]
 
Figure 7. Western blot analysis of the effect of cAMP on GATA-1 protein levels in MA-10 (A) and MEL (B) cells. MA-10 and MEL cells were treated with different doses of cAMP, as indicated, for 4 h before harvest. Nuclear proteins, extracted from these cells, were subjected to Western blot analysis for GATA-1 protein as described in Materials and Methods. Twenty micrograms each of MA-10 nuclear extracts (A) and 6 µg each of MEL nuclear proteins (B) were used for analysis.

 
Time course of the suppression of GATA-1 mRNA by cAMP
The inhibitory effect of cAMP on GATA-1 gene expression was shown to be time-dependent (Fig. 8AGo). The decrease in GATA-1 mRNA could be detected at 2 h after cAMP treatment in MA-10 cells. As shown in Figs. 4Go and 6Go, less than 5% of the GATA-1 mRNA remained in the cells treated with 0.3 mM cAMP for 4 h (Fig. 8AGo) or longer period of time, such as 16 or 24 h (data not shown). The levels of GATA-4 mRNA were not altered at any time during the treatment with cAMP (Fig. 8CGo). On the other hand, the increase in inhibin {alpha}-subunit mRNA levels by cAMP could be detected as early as 30 min after treatment, which is 60–90 min before the reduction of GATA-1 mRNA was observed.



View larger version (60K):
[in this window]
[in a new window]
 
Figure 8. Time course of the effect of cAMP on GATA-1 (A), inhibin {alpha}-subunit (B), and GATA-4 (C) mRNA levels in MA-10 cells. MA-10 cells were treated with 0.3 mM cAMP and were harvested at varied time periods after treatment as indicated in the figure. Sixteen micrograms of total RNA, isolated form MA-10 cells, were subjected to Northern blot analysis. The mRNAs encoding GATA-binding proteins and inhibin {alpha}-subunit were identified.

 
The possibility of the involvement of protein synthesis in the suppression of GATA-1 mRNA by cAMP
The inhibitory effect of cAMP on GATA-1 mRNA levels could be blocked by addition of a translational inhibitor, cycloheximide, 30 min before the treatment with cAMP (Fig. 9AGo). Our results indicate that, even when the lowest dose (1 µg/ml) of cycloheximide was administered, the prevention of the inhibitory effect of cAMP on GATA-1 mRNA levels could be observed. In addition, {alpha}-tubulin mRNA was not significantly affected by cycloheximide at any concentration (1–5 µg/ml) employed (Fig. 9BGo). Our observations suggest that the suppression of GATA-1 mRNA by cAMP may involve the synthesis of other protein(s). The reduction of GATA-1 mRNA by cAMP could also be prevented by treatment of MA-10 cells with an inhibitor of transcription, actinomycin D, in a dose-dependent manner, suggesting that synthesis of other mRNA(s) may also be involved in the suppression of GATA-1 mRNA by cAMP (data not shown).



View larger version (50K):
[in this window]
[in a new window]
 
Figure 9. Effect of cycloheximide on the down-regulation of GATA-1 mRNA by cAMP. MA-10 cells were preincubated with different concentrations of cycloheximide (CHX) for 30 min and then treated with or without 0.3 mM cAMP as indicated for 4 h. Total RNAs were isolated and subjected to Northern blot analysis for GATA-1 (A) and {alpha}-tubulin (B) mRNA. The exposure time for the autoradiogram shown in A and B was 16 h.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Recent studies from our and others laboratories demonstrated that GATA-1 and GATA-4 play important roles in the regulation of several gonadal-expressing genes, including inhibin/activin subunits (16, 18, 19, 21, 46), Müllerian-inhibiting substance (MIS) (17, 47), and steroidogenic factor 1 (46). We showed that GATA-1 transactivated both inhibin/activin {alpha}- and ß-B-subunit genes, whereas GATA-4 up-regulated only ß-B-subunit gene transcription, in two testicular tumor cell lines derived from Sertoli and Leydig cells (16, 21). Both GATA-binding proteins (13, 14, 15, 16, 17, 18, 20, 21, 48) and inhibin/activin {alpha}- and ß-B-subunit genes (for reviews, see Refs. 22, 23, 24, 25) are expressed in high levels in immature mouse and rat testis, and in the Sertoli and Leydig cells and the tumor cell lines derived from these testicular cells. In this study, we provided the evidence that gonadotropins, via cAMP, negatively regulated the GATA-1 mRNA and protein levels in MA-10 and rat Sertoli cells but not in MEL cells, which expressed high levels of GATA-1. GATA-4 mRNA was previously shown to be stimulated by hCG in the mLTC-1 Leydig cell line (18) and by FSH in the MSC-1 Sertoli tumor cell line, which was stably transfected with a FSH receptor (19). However, our results indicated that GATA-4 mRNA levels were not affected either by FSH or cAMP treatment in rat Sertoli cell cultures and MA-10 cells, even though, under these conditions, inhibin {alpha}-subunit mRNA was evidently increased. The explanations for the observed discrepancy of the gonadotropins/cAMP effect on the expression of GATA-4 gene in different testicular cell lines remained to be determined.

The reduction of GATA-1 mRNA levels by cAMP could be prevented by treatment with a transcriptional or a translational inhibitor, actinomycin D or cycloheximide, respectively, suggesting that the suppression of GATA-1 mRNA by cAMP may involve the synthesis of other proteins and mRNA in testicular cells. Similar suppressive effects of gonadotropins and cAMP have been demonstrated in other testis-expressing genes (49, 50). We have previously shown that clusterin mRNA levels were markedly decreased by treatment of MA-10 cells with cAMP for 17 h (27, 49). The suppression of clusterin mRNA levels was not attributable to the inhibition of clusterin gene transcription, as analyzed by nuclear run-on assay and transient transfection using a reporter CAT gene driven by different regions of the clusterin gene promoter (49). The reduction of clusterin mRNA by cAMP was suggested to be the result of an increase in the degradation of clusterin mRNA through synthesis of a destabilizing protein(s) and its mRNA (49). Although the time required for gonadotropins and cAMP to decrease GATA-1 and clusterin mRNA levels in testicular cells was different (2 and 17 h, respectively), similar mechanisms, such as induction of the synthesis of a destabilizing protein(s), may be employed for the suppression of these mRNA levels.

Alternatively, gonadotropins and cAMP may inhibit the transcriptional activity of GATA-1 gene, using a mechanism similar to that observed in {alpha}-retinoic acid receptor (51) or FSH receptor (52). It was suggested that FSH suppressed the all-trans-retinoic acid-induced nuclear localization, transcriptional transactivation, and protein expression of the {alpha}-retinoic acid receptor in the MSC-1 mouse Sertoli cell line (51). The down-regulation of the steady-state levels of FSH receptor, after exposure of Sertoli cells to FSH or cAMP, was mediated by changes in chromatin structure (52). cAMP may also induce posttranslational modifications in the GATA-binding proteins that could affect their DNA-binding and/or transcriptional activities. Whether gonadotropins and cAMP, acting at the transcriptional level, mRNA stability or posttranslational modification to negatively regulate GATA-1 mRNA in testicular cells is currently being investigated in our laboratory.

We have demonstrated that the transcription of inhibin {alpha}-subunit gene in testicular cells can be activated by both gonadotropins and GATA-1 (16, 44). The elevation of inhibin {alpha}-subunit mRNA by gonadotropins/cAMP was acting at the transcriptional level, through interaction with a cAMP- response element (CRE) motif in the promoter region of the {alpha}-subunit gene (44, 53, 54, 55) with CRE-binding protein (CREB) (54). We also showed that GATA-1 transactivated inhibin {alpha}-subunit gene transcription through interaction with two GATA motifs in the promoter region (16). Mutations of either or both of the GATA motifs markedly decreased the basal promoter activity of {alpha}-subunit gene in testicular cells; however, they did not affect the stimulatory effect of cAMP on the transcription of the {alpha}-subunit gene (16). This was also supported by our observations, in this study, that the elevation of inhibin {alpha}-subunit mRNA levels by cAMP was observed at 60–90 min before the suppression of GATA-1 mRNA occurred (Fig. 8Go).

Our preliminary observations revealed that mutation of the CRE motif, which resides proximal to the two GATA motifs in the {alpha}-subunit promoter, drastically increased the effect of GATA-1 on the transactivation of {alpha}-subunit gene (Feng, Z.-M., and C.-L.Chen, unpublished data), suggesting that CRE-binding protein(s) and GATA-1 may compete their bindings to the neighboring CRE and GATA motifs, respectively, in the {alpha}-subunit gene. Therefore, although our observations suggested that gonadotropins and GATA-1 may stimulate the {alpha}-subunit gene transcription via separate mechanisms, the levels of the CRE-binding protein(s) and GATA-1 binding to the CRE and GATA motifs, respectively, in the {alpha}-subunit promoter may play roles in regulating {alpha}-subunit gene transcription in testicular cells. Under normal culture condition, GATA-1 mRNA and protein, which are present in high levels in the absence of cAMP treatment, may play as one of the major modulators in the activation of the basal transcription of {alpha}-subunit gene. Upon treatment with gonadotropins or cAMP, the phosphorylated form of CREB or related protein(s), through interaction with the CRE motif, may act as a major regulator in the stimulation of {alpha}-subunit gene expression in testicular cells, The decrease in GATA-1 expression by gonadotropins/cAMP treatment may prevent the competition of GATA-1 and CREB or related protein for binding to the {alpha}-subunit promoter. The relationship of GATA-1 and CREB or related protein(s) in the regulation of the {alpha}-subunit gene expression in testicular cells, with or without gonadotropins/cAMP treatment, is currently under investigation.

In summary, we have demonstrated that the two testis-expressing GATA-binding proteins, GATA-1 and GATA-4, not only exert different functions on the transactivation of testicular genes, such as inhibin/activin subunit genes, but also respond differently to hormones, such as gonadotropins, in testicular cells.


    Acknowledgments
 
We wish to thank Drs. Stuart Orkin and David Wilson for providing mGATA-1 and mGATA-4 expression plasmid, respectively; Drs. Shigeru Sassa and Mario Ascoli for MEL and MA-10 cell lines, respectively; and Dr. Matthew P. Hardy for purified Leydig cells, ovine FSH from the National Hormone and Pituitary Program, NIH, and the assistance from the Tissue Culture Core of the Center for Biomedical Research Population Council.


    Footnotes
 
This work was supported by NIDDK/NIH Grant DK-34449 (to C.-L.C) and by NICHD/NIH through cooperative agreement [U54(HD-13541)] as part of the Specialized Cooperative Centers Program in Reproduction Research. The study was also supported, in part, by a Dewitt Wallace Fellowship (to Z. Z.).

1 Current address: Research Institute of Sericulture, Chinese Academy of Agricultural Sciences, Zhenjiang City, Jian Su 212018, People’s Republic of China. Back

Abbreviations: ABP, Androgen-binding protein; CRE, cAMP- response element; CREB, CRE-binding protein; G3PDH, glyceraldehyde-3-phosphate dehydrogenase; IBMX, 3-isobutyl-1-methylxanthine; MEL, mouse erythroid leukemia cell line; PLC, progenitor Leydig cells.

Received July 17, 2001.

Accepted for publication November 8, 2001.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Evans T, Reitman M, Felsenfeld G 1988 An erythroid-specific DNA-binding factor recognizes a regulatory sequence common to all chicken globin genes. Proc Natl Acad Sci USA 85:5976–5980[Abstract/Free Full Text]
  2. Wall L, deBoer E, Grosveld F 1988 The human ß-globin gene 3' enhancer contains multiple binding sites for an erythroid-specific protein. Genes Dev 2:1089–1100[Abstract/Free Full Text]
  3. Tsai S-F, Martin DI, Zon LI, D’Andrea AD, Wong GG, Orkin SH 1989 Cloning of cDNA for the major DNA-binding protein of the erythroid lineage through expression in mammalian cells. Nature 339:446–451[CrossRef][Medline]
  4. Martin DI, Orkin SH 1990 Transcriptional activation and DNA binding by the erythroid factor GF-1/NF-El1/Eryf 1. Genes Dev 4:1886–1898[Abstract/Free Full Text]
  5. Tsai S-F, Strauss E, Orkin SH 1991 Functional analysis and in vivo footprinting implicate the erythroid transcription factor GATA-1 as a positive regulator of its own promoter. Genes Dev 5:919–931[Abstract/Free Full Text]
  6. Yamamoto M, Ko LJ, Leonard MW, Beug H, Orkin SH, Engel JD 1990 Activity and tissue-specific expression of the transcription factor NF-E1 multigene family. Genes Dev 4:1650–1662[Abstract/Free Full Text]
  7. Orkin SH 1992 GATA-binding transcription factors in hematopoietic cells. Blood 80:575–581[Free Full Text]
  8. Lee M-E, Temizer DH, Clifford JA, Quertermous T 1991 Cloning of the GATA-binding protein that regulates endothelin-1 gene expression in endothelial cells. J Biol Chem 266:16188–16192[Abstract/Free Full Text]
  9. George KM, Leonard MW, Roth ME, Lieuw KH, Kiossis D, Grosveld F, Engel JD 1994 Embryonic expression and cloning of the murine GATA-3 gene. Development 120:2673–2686[Abstract/Free Full Text]
  10. Arceci RJ, King AA, Simon MC, Orkin SH, Wilson DB 1993 Mouse GATA-4: a retinoic acid-inducible GATA-binding transcription factor expressed in endodermally derived tissues and heart. Mol Cell Biol 13:2235–2246[Abstract/Free Full Text]
  11. Grepin C, Dagnino L, Robitaille L, Haberstroh L, Antakly T, Nemer M 1994 A hormone-encoding gene identifies a pathway for cardiac but not skeletal muscle gene transcription. Mol Cell Biol 14:3115–3129[Abstract/Free Full Text]
  12. Laverriere AC, MacNeill C, Mueller C, Poelmann RE, Burch JB, Evans T 1994 GATA-4/5/6, a subfamily of three transcription factors transcribed in developing heart and gut. J Biol Chem 269:23177–23184[Abstract/Free Full Text]
  13. Ito E, Toki T, Ishihara H, Ohtani H, Gu L, Yokoyama M, Engel JD, Yamamoto M 1993 Erythroid transcription factor GATA-1 is abundantly transcribed in mouse testis. Nature 362:466–468[CrossRef][Medline]
  14. Yomogida K, Ohtani H, Harigae H, Ito E, Nishimune Y, Engel JD, Yamamoto M 1994 Developmental stage- and spermatogenic cycle-specific expression of transcription factor GATA-1 in mouse Sertoli cells. Development 120:1759–1766[Abstract]
  15. Onodera K, Yomogida K, Suwabe N, Takahashi S, Muraosa Y, Hayashi N, Ito E, Gu L, Rassoulzadegan M, Engel JD, Yamamoto M 1997 Conserved structure, regulatory elements, and transcriptional regulation from the GATA-1 gene testis promoter. J Biochem 121:251–263[Abstract/Free Full Text]
  16. Feng Z-M, Wu AZ, Chen C-LC 1998 Testicular GATA-1 factor up-regulates the promoter activity of rat inhibin {alpha}-subunit gene in MA-10 Leydig tumor cells. Mol Endocrinol 12:378–390[Abstract/Free Full Text]
  17. Viger RS, Mertineit C, Trasler JM, Nemer M 1998 Transcription factor GATA-4 is expressed in a sexually dimorphic pattern during mouse gonadal development and is a potent activator of the Müllerian inhibiting substance promoter. Development 125:2665–2675[Abstract]
  18. Ketola I, Rahman N, Toppari J, Bielinska M, Porter-Tinge SB, Tapanainen JS, Huhtaniemi IT, Wilson DB, Heikinheimo M 1999 Expression and regulation of transcription factors GATA-4 and GATA-6 in developing mouse testis. Endocrinology 140:1470–1480[Abstract/Free Full Text]
  19. Heikinheimo M, Ermolaeva M, Bielinska M, Rahman NA, Narita N, Huhtaniemi IT, Tapanainen JS, Wilson DB 1997 Expression and hormonal regulation of transcription factors GATA-4 and GATA-6 in the mouse ovary. Endocrinology 138:3505–3514[Abstract/Free Full Text]
  20. Chen C-LC, Feng Z-M, Chung K, Boitani C, Bardin CW, GATA-1 and GATA-4 genes are co-expressed in the Sertoli cells and Leydig tumor cell lines of the testis. Program of the 78th Annual Meeting of The Endocrine Society, San Francisco, CA, 1996 (Abstract P2-564)
  21. Feng Z-M, Wu AZ, Zhang Z, Chen C-LC 2000 GATA-1 and GATA-4 transactivate inhibin/activin ß-B-subunit gene transcription in testicular cells. Mol Endocrinol 14:1820–1835[Abstract/Free Full Text]
  22. Chen C-LC, Feng Z-M, Morris PL, Bardin CW 1992 Controls for inhibin subunit genes and their consequences in the testis. In: Molecular cell biology of reproduction, Serono Symposia. Vol 90. New York: Raven Press; 97–108
  23. Chen C-LC 1993 Editorial: Inhibin and activin as paracrine/autocrine factors. Endocrinology 132:4–5[Free Full Text]
  24. Mayo KE 1994 Inhibin and activin. Molecular aspects of regulation and function. Trends Endocrinol Metab 5:407–415[CrossRef][Medline]
  25. Mather JP, Moore A, Li R-H 1997 Activins, inhibins, and follistatins: further thoughts on a growing family of regulators. Proc Soc Exp Biol Med 215:209–222[CrossRef][Medline]
  26. Ascoli M 1981 Characterization of several clonal lines of cultured Leydig tumor cells: gonadotropin receptors and steroidogenic responses. Endocrinology 108:88–95[Abstract/Free Full Text]
  27. Pignataro OP, Feng Z-M, Chen CL-C 1992 Cyclic AMP negatively regulates clusterin gene expression in Leydig tumor cell lines. Endocrinology 130:2745–2750[Abstract/Free Full Text]
  28. Ohta Y, Tanaka M, Tarada M, Miller OJ, Bank A, Marks PA, Rifkind RA 1976 Erythroid cell differentiation: murine erythroleukemia cell variant with unique pattern of induction by polar compounds. Proc Natl Acad Sci USA 73:1232–1236[Abstract/Free Full Text]
  29. Meguro K, Igarashi K, Yamamoto M, Sassa FH 1995 The role of the erythroid-specific delta-aminolevulinate synthase gene expression in erythroid heme synthesis. Blood 86:940–948[Abstract/Free Full Text]
  30. Cheng CY, Mather JP, Byer AL, Bardin CW 1986 Identification of hormonally responsive proteins in primary Sertoli cell culture medium by anion-exchange high performance liquid chromatography. Endocrinology 118:480–488[Abstract/Free Full Text]
  31. Cheng CY, Chen C-LC, Feng ZM, Marshall A, Bardin CW 1988 Rat clusterin isolated from primary Sertoli cell-enriched culture medium is sulfated glycoprotein-2 (SGP-2). Biochem Biophys Res Commun 155:398–404[CrossRef][Medline]
  32. Grima J, Wong CCS, Zhu LJ, Zong SD, Cheng CY 1998 Testin secreted by Sertoli cells is associated with the cell surface, and its expression correlates with the disruption of Sertoli-germ cell junctions but not the inter-Sertoli tight junction. J Biol Chem 273:21040–21053[Abstract/Free Full Text]
  33. Mruk DD, Cheng CY 1999 Sertolin is a novel gene marker of cell-cell interactions in the rat testis. J Biol Chem 174:27056–27068
  34. Samy ET, Li JCH, Grima J, Lee WM, Silvestrini B, Cheng CY 2000 Sertoli cell prostaglandin D2 synthetase is a multifunctional molecule: its expression and regulation. Endocrinology 141:710–721[Abstract/Free Full Text]
  35. Shan LX, Phillips DM, Bardin CW, Hardy MP 1993 Differential regulation of steroidogenic enzymes during differentiation optimizes testosterone production by adult rat Leydig cells. Endocrinology 133:2277–2283[Abstract/Free Full Text]
  36. Keinan D, Madigan MB, Bardin CW, Chen C-LC 1989 Expression and regulation of testicular inhibin {alpha}-subunit gene in vivo and in vitro. Mol Endocrinol 3:29–35[Abstract/Free Full Text]
  37. Joseph DR, Hall SH, Conti M, French FS 1988 The gene structure of rat androgen-binding protein: identification of potential regulatory deoxyribonucleic acid elements of a follicle-stimulating hormone-regulated protein. J Mol Endocrinol 2:3–13
  38. Andrews NC, Faller DV 1991 A rapid micropreparation technique for extraction of DNA-binding proteins from limiting numbers of mammalian cells. Nucleic Acids Res 19:2494
  39. Feng ZM, Bardin CW, Chen C-LC 1989 Characterization and regulation of testicular inhibin ß-subunit messenger RNA. Mol Endocrinol 3:939–948[Abstract/Free Full Text]
  40. Toebosch AM, Robertson DM, Trapman J, Klaassen P, de Paus RA, de Jong FH, Grootegoed JA 1988 Effects of FSH and IGF-I on immature rat Sertoli cells: inhibin {alpha}-and ß-subunit mRNA levels and inhibin secretion. Mol Cell Endocrinol 55:101–105[CrossRef][Medline]
  41. Klaij IA, Toebosch AM, Themmen AP, Shimasaki S, de Jong FH, Grootegoed JA 1990 Regulation of inhibin {alpha}- and ß-subunit mRNA levels in rat Sertoli cells. Mol Cell Endocrinol 68:45–52[CrossRef][Medline]
  42. Klaij IA, Timmerman MA, Blok LJ, Grootegoed JA, de Jong FH 1992 Regulation of inhibin ßB-subunit mRNA expression in rat Sertoli cells: consequences for the production of bioactive and immunoreactive inhibin. Mol Cell Endocrinol 85:237–246[CrossRef][Medline]
  43. Chen C-LC, Pignataro OP, Feng Z-M 1993 Inhibin/activin subunits and activin receptor are co-expressed in Leydig tumor cells. Mol Cell Endocrinol 83:105–115
  44. Feng Z-M, Chen C-LC 1994 Negative control of rat inhibin {alpha}-subunit promoter in MA-10 Leydig tumor cells. J Mol Endocrinol 13:39–47[Abstract/Free Full Text]
  45. Feng Z-M, Wu AZ, Chen C-LC 1995 Characterization and regulation of two testicular inhibin/activin ß-B-subunit messenger ribonucleic acids which are transcribed from alternate initiation sites. Endocrinology 136:947–955[Abstract]
  46. Tremblay JJ, Viger RS 2001 GATA factors differentially activate multiple gonadal promoters through conserved GATA regulatory elements. Endocrinology 142:977–986[Abstract/Free Full Text]
  47. Tremblay JJ, Viger RS 1999 Transcription factor GATA-4 enhances Müllerian inhibiting substance gene transcription through a direct interaction with the nuclear receptor SF-1. Mol Endocrinol 13:1388–1401[Abstract/Free Full Text]
  48. Feng Z-M, Wu AZ, Zhang L, Zhang Z, Chen C-LC, Coexpression and interaction of GATA-binding proteins with FOG in the regulation of inhibin and activin subunit gene transcription in testicular cells. Program of the 82nd Annual Meeting of The Endocrine Society, Toronto, Canada, 2000 p 248 (Abstract 1017)
  49. Rosemblit N, Feng Z-M, Chen C-LC 1996 Analysis of the rat clusterin gene promoter and cyclic AMP-regulated mRNA stability in testicular cells. J Mol Endocrinol 16:287–296[Abstract/Free Full Text]
  50. Knustsen HK, Tasken KA, Eskild W, Jahnsen T, Hansson V 1991 Adenosine 3',5'-monophosphate-dependent stabilization of messenger ribonucleic acids (mRNAs) for protein kinase-A (PKA) subunits in rat Sertoli cells: rapid degradation of mRNAs for PKA subunits is dependent on ongoing RNA and protein synthesis. Endocrinology 129:2496–2502[Abstract/Free Full Text]
  51. Braun KW, Tribley WA, Griswold MD, Kim KH 2000 Follicle-stimulating hormone inhibits all-trans-retinoic acid-induced retinoic acid receptor {alpha}- nuclear localization and transcriptional activation in mouse Sertoli cell line. J Biol Chem 275:4145–4151[Abstract/Free Full Text]
  52. Griswold MD, Kim JS, Tribley WA 2001 Mechanisms involved in the homologous down-regulation of transcription of the follicle-stimulating hormone receptor gene in Sertoli cells. Mol Cell Endocrinol 173:95–107[CrossRef][Medline]
  53. Albiston AL, Lock P, Burger HG, Krozowski ZS 1990 Cloning and characterization of the rat alpha-inhibin gene. Mol Cell Endocrinol 68:121–128[CrossRef][Medline]
  54. Pei L, Dodson R, Schoderbek WE, Maurer RA, Mayo K-E 1991 Regulation of the {alpha} inhibin gene by cyclic adenosine 3',5'-monophosphate after transfection into rat granulosa cells. Mol Endocrinol 5:521–534[Abstract/Free Full Text]
  55. Su J-G, Hsueh AJW 1992 Characterization of mouse inhibin {alpha} gene and its promoter. Biochem Biophys Res Commun 186:293–300[CrossRef][Medline]



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
I. Qamar, E. Park, E.-Y. Gong, H. J. Lee, and K. Lee
ARR19 (Androgen Receptor Corepressor of 19 kDa), an Antisteroidogenic Factor, Is Regulated by GATA-1 in Testicular Leydig Cells
J. Biol. Chem., July 3, 2009; 284(27): 18021 - 18032.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
R. S. Viger, S. M. Guittot, M. Anttonen, D. B. Wilson, and M. Heikinheimo
Role of the GATA Family of Transcription Factors in Endocrine Development, Function, and Disease
Mol. Endocrinol., April 1, 2008; 22(4): 781 - 798.
[Abstract] [Full Text] [PDF]


Home page
J AndrolHome page
R. S. Viger, H. Taniguchi, N. M. Robert, and J. J. Tremblay
The 25th Volume: Role of the GATA Family of Transcription Factors in Andrology
J Androl, July 1, 2004; 25(4): 441 - 452.
[Full Text] [PDF]


Home page
J AndrolHome page
H.-J. Shi, A. Z. Wu, M. Santos, Z.-M. Feng, L. Huang, Y.-M. Chen, K. Zhu, and C.-L. C. Chen
Cloning and Characterization of Rat Spermatid Protein SSP411: A Thioredoxin-Like Protein
J Androl, July 1, 2004; 25(4): 479 - 493.
[Abstract] [Full Text] [PDF]


Home page
Exp. Biol. Med.Home page
H. A. LaVoie
The Role of GATA in Mammalian Reproduction
Experimental Biology and Medicine, December 1, 2003; 228(11): 1282 - 1290.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. J. Tremblay and R. S. Viger
Transcription Factor GATA-4 Is Activated by Phosphorylation of Serine 261 via the cAMP/Protein Kinase A Signaling Pathway in Gonadal Cells
J. Biol. Chem., June 6, 2003; 278(24): 22128 - 22135.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
M. Anttonen, I. Ketola, H. Parviainen, A.-K. Pusa, and M. Heikinheimo
FOG-2 and GATA-4 Are Coexpressed in the Mouse Ovary and Can Modulate Mullerian-Inhibiting Substance Expression
Biol Reprod, April 1, 2003; 68(4): 1333 - 1340.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhang, Z.
Right arrow Articles by Chen, C.-L. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhang, Z.
Right arrow Articles by Chen, C.-L. C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals