help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sewer, M. B.
Right arrow Articles by Waterman, M. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sewer, M. B.
Right arrow Articles by Waterman, M. R.
Endocrinology Vol. 143, No. 4 1280-1290
Copyright © 2002 by The Endocrine Society


INTRACELLULAR SIGNAL SYSTEMS

Transcriptional Activation of Human CYP17 in H295R Adrenocortical Cells Depends on Complex Formation among p54nrb/NonO, Protein-Associated Splicing Factor, and SF-1, a Complex That Also Participates in Repression of Transcription

Marion B. Sewer, Viet Q. Nguyen, Ching-Jung Huang, Philip W. Tucker, Norio Kagawa and Michael R. Waterman1

Department of Biochemistry and Center in Toxicology, Vanderbilt University School of Medicine (M.B.S., V.Q.N., N.K., M.R.W.), Nashville, Tennessee 37232-0146; and Molecular Genetics and Microbiology, University of Texas (C.-J.H., P.W.T.), Austin, Texas 78705

Address all correspondence and requests for reprints to: Dr. Marion B. Sewer, Department of Biochemistry, Vanderbilt University School of Medicine, 606 Light Hall, Nashville, Tennessee 37232-0146. E-mail: . marion{at}toxicology.mc.vanderbilt.edu


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The first 57 bp upstream of the transcription initiation site of the human CYP17 (hCYP17) gene are essential for both basal and cAMP-dependent transcription. EMSA carried out by incubating H295R adrenocortical cell nuclear extracts with radiolabeled -57/-38 probe from the hCYP17 promoter showed the formation of three DNA-protein complexes. The fastest complex contained steroidogenic factor (SF-1) and p54nrb/NonO, the intermediate complex contained p54nrb/NonO and polypyrimidine tract-binding protein-associated splicing factor (PSF), and the slowest complex contained an SF-1/PSF/p54nrb/NonO complex. (Bu)2cAMP treatment resulted in a cAMP-inducible increase in the binding intensity of only the upper complex and also activated hCYP17 gene transcription. SF-1 coimmunoprecipitated with p54nrb/NonO, indicating direct interaction between these proteins. Functional assays revealed that PSF represses basal transcription. Further, the repression of hCYP17 promoter-reporter construct luciferase activity resulted from PSF interacting with the corepressor mSin3A. Trichostatin A attenuated the inhibition of basal transcription, suggesting that a histone deacetylase interacts with the SF-1/PSF/p54nrb/NonO/mSin3A complex. Our studies lend support to the idea that the balance between transcriptional activation and repression is essential in the control of adrenocortical steroid hormone biosynthesis.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
STEROID HORMONE biosynthesis in the adrenal cortex involves the coordinate action of several steroid hydroxylase cytochrome P450 enzymes whose genes (CYP) are transcriptionally activated by the peptide hormone ACTH via a cAMP/cAMP-dependent protein kinase (PKA) signaling pathway (1). ACTH directs increased steroid hydroxylase gene transcription via the activation of adenyl cyclase and subsequent increase in intracellular cAMP. This second messenger then activates PKA, which is presumed to induce gene transcription by phosphorylating transcription factors, coactivators, and/or other proteins in the ACTH signaling pathway. The precise proteins phosphorylated and the specific sites of phosphorylation remain to be elucidated. One important factor that has been determined, however, is that the ACTH/cAMP-dependent increase in gene transcription is inhibited by cycloheximide (CHX) (2). The CHX-sensitive nature of steroid hormone biosynthesis leads to the speculation that ACTH/cAMP stimulates the synthesis of intermediary protein(s) essential for inducing the transcription of steroid hydroxylase genes.

CYP17 encodes P450c17, which catalyzes both the 17{alpha}-hydroxylation of pregnenolone and progesterone required for cortisol biosynthesis and the 17,20-lyase activity of 17{alpha}-hydroxylated steroids producing androgens. In cholesterol-synthesizing species other than rodents, CYP17 is expressed in the adrenal cortex for both cortisol and androgen biosynthesis and in the gonads for androgen biosynthesis. Elevated levels of P450c17 activity produce higher levels of adrenal androgens. Like all steroidogenic genes, CYP17 from different species contains a binding site for the transcription factor steroidogenic factor-1 (SF-1). SF-1 was originally identified as a steroidogenic, tissue-specific transcription factor that regulates the expression of steroid hydroxylase enzymes in the gonads and the adrenal cortex (3, 4). A role for SF-1 in the regulation of the hypothalamic-pituitary-steroidogenic axis and organogenesis has emerged from studies of mice containing a targeted disruption of the SF-1-encoding gene (5). SF-1 belongs to the zinc finger nuclear receptor family of transcription factors and binds as a monomer to a DNA element that contains the motif PyCAAGGTCA (6, 7).

Studies of transcriptional regulation of CYP17 in cows and humans has been actively pursued because of the gene product’s key role in a branch point of adrenocortical steroidogenesis. Transcriptional control of human CYP17 (hCYP17) gene expression in human adrenocortical H295R cells reveals that both basal and cAMP-responsive elements lie within the first 63 bp upstream of the transcriptional initiation site and that a second basal transcription element lies between -184 to -206 bp (8). Recently, it was also found that Sp1, Sp3, and NF-1C are essential for optimal basal transcription of hCYP17 (9). Studies of cultured bovine adrenocortical cells (10, 11) and bovine fetal adrenals (12) indicate that transcription of the bovine CYP17 (bCYP17) gene is regulated by ACTH/cAMP via two cAMP regulatory sequences (CRS1 and CRS2) in the 5'-flanking region of the gene that bind to the homeodomain proteins Pbx1, Meis1, and Pknox (10) and the orphan nuclear receptors chicken ovalbumin upstream promoter-transcription factor-1 (COUP-TF) and SF-1, respectively. COUP-TF1 acts through CRS2 to suppress transcription and SF-1 stimulates gene expression at the same site (13). Unlike bCYP17, hCYP17 is found to contain only one CRS. Thus, differences in the biochemical basis of transcriptional regulation of steroid hydroxylase genes appears to occur not only in a tissue-specific manner, but also in a species-specific manner.

Our goal in the current study was to identify transacting factors essential for basal and cAMP-dependent transcription of hCYP17. We report copurification of SF-1, p54nrb/NonO, and protein-associated splicing factor (PSF), which bind to the CRS (-57/-38) of the hCYP17 promoter. p54nrb is the human homolog of murine NonO. p54nrb/NonO is a ubiquitously expressed 54-kDa protein originally identified as a non-POU domain-containing, octamer-binding protein that contains both DNA- and RNA-binding domains (14). p54nrb/NonO shares significant sequence identity with PSF, an essential mammalian splicing factor (15). PSF and p54nrb/NonO also bind each other (16). We show that SF-1 and p54nrb/NonO interact with each other and, when bound as a complex to the hCYP17 promoter, regulate both basal and cAMP-dependent transcriptional activation. We further show that this cAMP-dependent increased binding is cell line selective, time dependent, and CHX sensitive. Moreover, PSF recruits the corepressor mSin3A to the hCYP17 promoter, resulting in repression, which is then alleviated upon cAMP stimulation and subsequent activation of SF-1. Our findings lead us to postulate that cAMP-dependent activation of hCYP17 gene transcription occurs upon the release of mSin3A and the histone deacetylase (HDAC) from the SF-1/p54nrb/NonO/PSF complex. They reveal that repression of CYP17 transcription plays an integral role in maintaining optimal steroidogenic capacity in the adrenal cortex, although the biochemical basis of repression may vary among species.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Preparation of plasmid constructs
A plasmid containing a 1.8-kb fragment of the hCYP17 promoter fused to the luciferase gene in the pGL3 vector (Promega Corp., Madison, WI) was obtained from Dr. J. M. McAllister (Pennsylvania State University, Hershey, PA). This plasmid was used to generate several deletion constructs via PCR amplification using oligonucleotides corresponding to -1123/-1098 (GATCTTTGTTGGACCCTTATCAGTGG), -707/-682 (TGATGAGCAAAGAAGGTGTTGATGG), and -332/-307 (CCAGTGATTTTGATTTTGCAGCATGG) of the sense strand. A KpnI site was added to the 5'-end of each oligonucleotide to clone the newly amplified sequences into the pGL3 vector. An oligonucleotide corresponding to the noncoding strand (89/115) of the pGL3 vector was also used in each PCR. The 57-bp and 37-bp pGL3 constructs were generated by ligating double-stranded oligonucleotides corresponding to the region -57/-2 and -37/-2, respectively, of the hCYP17 5'-flank upstream of the luciferase gene in the pGL3 vector. The plasmids containing mutations at the putative SF-1-binding sites (mut1-pGL3 and mut2-pGL3) were constructed in the same manner as the 57-pGL3 construct, except synthesized oligonucleotides contained mutations of -48/-47 (GG to TT) in the mut1-pGL3 plasmid and -57/-53 (AAAAG to TTTTT) in the mut2-pGL3 plasmid. Data obtained from luciferase assays (relative luciferase light units) were normalized to the protein content of each sample. The expression vector for SF-1 was provided by Dr. K. Morohashi (National Institute for Basic Biology, Okazaki, Japan), and the expression vectors for NonO and PSF have been previously described (16).

Cell culture, transient transfection, and luciferase assay
H295R adrenocortical cells (17) were donated by Dr. William E. Rainey (University of Texas Southwestern Medical Center, Dallas, TX) and cultured in DMEM/Ham’s F-12 medium (Life Technologies, Inc., Gaithersburg, MD) supplemented with 10% Nu-Serum I (Collaborative Biomedical Products, Bedford, MA), 0.5% ITS Plus (Collaborative Biomedical Products), and antibiotics. Mouse Y1 adrenal cells were cultured in DMEM supplemented with 10% bovine calf serum (Summit Biotechnology, Fort Collins, CO) and antibiotics. Twenty-four hours before transfection, cells were subcultured onto six-well culture dishes. Reporter (0.4 µg) and expression (1 µg) plasmids were transfected into H295R cells using the Effectene nonliposomal lipid transfection reagent (QIAGEN, Valencia, CA) for 24 h, followed by an additional 12-h incubation in the presence or absence of 1 mM (Bu)2cAMP and/or 250 nM trichostatin A (TSA). Cells were harvested, and cellular extracts were prepared for luciferase assays (Promega Corp.) and determination of protein concentration (Pierce Chemical Co., Rockford, IL).

EMSA
For nuclear extract isolation, cells were subcultured onto 100-mm dishes for 24 h, followed by incubation with 1 mM (Bu)2cAMP and/or 40 µM CHX for an additional period ranging from 30 min to 12 h. Nuclear extracts were prepared according to the method of Dignam et al. (18). Double-stranded oligonucleotides were labeled with [{alpha}-32P]dCTP (3000 Ci/mmol; NEN Life Science Products) by a fill-in reaction using DNA polymerase I, Klenow fragment (Stratagene, La Jolla, CA). Five micrograms of nuclear protein, 0.5 µg poly(dI-dC), 50 µg BSA, and 32P-labeled probe (10,000 cpm) were mixed in 25 µl binding buffer [20 mM HEPES (pH 7.9), 80 mM KCl, 5 mM MgCl2, 2% Ficoll, 5% glycerol, 0.1 mM EDTA, and 0.2 mM dithiothreitol] on ice. For competition assay, a 200-fold excess of unlabeled competitor oligonucleotide was added to the reaction mixture. For supershift assays, incubation conditions were identical, except for the addition of an antibody to SF-1 or Dax-1 (gifts from Dr. K. Morohashi, National Institute for Basic Biology, Okazaki, Japan), PSF (gift from Dr. J. Patton, Vanderbilt University, Nashville, TN), NonO (14), COUP-TF1, or Nur77/NGF-1B (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) in a preincubation for 10 min with nuclear extracts and binding buffer before the addition of radiolabeled probe. Recombinant SF-1 (obtained from Dr. K. L. Parker, University of Texas Southwestern Medical Center, Dallas, TX) was produced using the TNT-coupled reticulocyte lysate system (Promega Corp.) according to the manufacturer’s specifications using T7 polymerase. The DNA-protein complexes were resolved on a 5% polyacrylamide/0.5% Ficoll/0.5x TBE gel, and dried gels were visualized by autoradiography.

Purification of p54nrb/NonO and immunoprecipitation
Purification of nuclear proteins from H295R cells by hCYP17(-57/-38) chromatography was carried out generally as described by Kagawa et al. (19). Twelve copies of the tandemly repeated -57/-38 of the hCYP17 promoter (synthesized oligonucleotides contained SalI sites at the 3'-ends and XhoI sites at the 5'-ends) were inserted into pBluescript at the SalI/XhoI sites. The 12 x -57/-38 fragment was isolated by restriction digestion with HindIII and KpnI, followed by agarose gel electrophoresis. This fragment was then labeled with [{alpha}-32P]dCTP and biotinylated dATP (bio-7-dATP, Life Technologies, Inc.) using Klenow fragment. The labeled fragment was then incubated with a 100-µl bed volume of streptavidin-agarose (Life Technologies, Inc.) on ice for 30 min and used for DNA affinity chromatography with nuclear extracts (25 mg protein) that were isolated from H295R cells, untreated or treated with (Bu)2cAMP for 12 h.

For immunoprecipitation assays nuclear proteins were incubated with anti-NonO antiserum and protein A-Sepharose beads overnight at 4 C with rotation. The mixture was then centrifuged, and the supernatant was removed. Beads were washed and resuspended in SDS-PAGE gel loading buffer for Western blotting. The supernatant was used for EMSA and SDS-PAGE.

Western blotting
H295R nuclear extracts (5 µg/lane) or eluate from DNA affinity purification (~3 µg/lane) were subjected to SDS-PAGE (8%) and transferred onto a polyvinylidene difluoride membrane (Immobilon-P, Millipore Corp., Bedford, MA). Immunoblotting was carried out using anti-SF-1 (1:5000 dilution), anti-NonO (1:2500 dilution), anti-mSin3A (Santa Cruz Biotechnology, Inc.; 1:2500 dilution), and anti-PSF (1:5000 dilution) antisera. Protein expression was detected using the ECL Plus Western blot detection kit (Amersham Pharmacia Biotech, Arlington Heights, IL).

Nuclear in vitro run-on transcription assays
Transcriptional activation of hCYP17 was carried out using nuclei isolated from control or (Bu)2cAMP-treated (1 mM for 1, 2, 4, 8, or 12 h) cells. Briefly, cells were isolated into PBS and centrifuged for 5 min at 500 x g at 4 C (20, 21). Pellets were resuspended in lysis buffer [10 mM Tris (pH 7.4), 10 mM NaCl, 3 mM MgCl2, and 0.5% Nonidet P-40] and incubated on ice for 10 min, then centrifuged a second time. The supernatants were discarded, and the pellets were resuspended in lysis buffer for a second time, incubated on ice, and centrifuged as described above. Nuclei were resuspended in 200 µl glycerol buffer [50 mM Tris (pH 8.3), 40% glycerol, 5 mM MgCl2, and 0.1 mM EDTA] and stored at - 70 C until analyzed. Transcription was assayed by incubating 200 µl nuclei with 100 µCi [32P]UTP in 200 µl assay buffer [2.5 mM MnCl2, 125 mM Tris (pH 7.4), 12.5 mM MgCl2, 2.5 mM dithiothreitol, 2.5 mM ATP, 1.25 mM GTP, 1.25 mM CTP, and 375 mM KCl] for 45 min at room temperature. The reaction was stopped by incubation with 10 U deoxyribonuclease I (ribonculease-free, RQ1, Promega Corp.) for 5 min at 30 C. Nuclei were then treated with 1% SDS, 5 mM EDTA, 10 mM HEPES (pH 7.5), and 200 µg/ml proteinase K at 42 C for 30 min. Newly transcribed RNA was isolated using an RNeasy Midi Kit (QIAGEN).

cDNAs (10 µg) for hCYP17 and ß-actin were denatured in 0.25 M NaOH and 0.5 M NaCl for 10 min at 65 C, placed on ice, and diluted in 10x SSC solution. Samples were blotted onto nylon transfer membrane filters (Hybond-N+, Amersham Pharmacia Biotech) and UV cross-linked. Membranes were prehybridized for 4 h at 42 C in a 2x SSC solution containing 50% formamide, 5x Denhardt’s solution, 2% SDS, and 100 µg/ml denatured single-stranded salmon sperm DNA. Filters were hybridized to 32P-labeled RNA (5 x 106 cpm) for 72 h at 42 C, followed washes (two washes for 10 min each time in 2x SSC/0.2% SDS and two washes for 5 min each time in 0.2x SSC/0.2% SDS) at 42 C. The amount of probe bound to the filter was quantitated using a PhosphorImager (Molecular Dynamics, Inc., Sunnyvale, CA) and ImageQuant software.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Functional activity of hCYP17 promoter-reporter constructs
To ascertain what effect cAMP has on hCYP17 transcriptional activity, transient transfection assays were performed. Previous transient transfection assays demonstrated that elements essential for basal and cAMP responsiveness reside within the first 63 bp upstream of the transcriptional initiation site (8). Accordingly, transfection of constructs containing from 1.8 Kb to 57 bp upstream of the transcription start site of the hCYP17 5'-flanking region fused to the luciferase gene significantly increased both basal and cAMP-induced transcriptional activity (Fig. 1Go). The 1.8pGL3 plasmid produced basal luciferase activity 6-fold over that of the pGL3 control. Incubating the cells with (Bu)2cAMP for 12 h before harvest further stimulated transcriptional activity 4-fold. Deleting all but 57 bp of the hCYP17 5'-flanking region did not significantly decrease basal or cAMP-dependent transcription (Fig. 1Go). A construct containing the first 37 bp (minimal promoter/TATA box) of the hCYP17 5'-flanking region was unable to confer transcriptional activity, indicating the requirement of the interaction of proteins in the -57/-38 region with the basal transcriptional machinery.



View larger version (16K):
[in this window]
[in a new window]
 
Figure 1. Functional activity of hCYP17 promoter-reporter constructs. Transient transfection assays were performed as described in Materials and Methods. Promoter-reporter plasmids containing serial deletions of the hCYP17 promoter were transiently transfected into H295R cells. Twenty-four hours after transfection, cells were stimulated with (Bu)2cAMP and incubated for an additional 12 h. Luciferase activity and protein content were determined from the harvested cellular extracts. The data presented represent the mean ± SEM (error bars) of six separate experiments (n = 3 for each experiment).

 
Binding of nuclear proteins to the putative SF-1-responsive element in the hCYP17 CRS
Upon confirming that approximately the first 57 bp 5' of the transcriptional initiation site were essential for cAMP-dependent transcriptional activity of hCYP17, our next goal was to identify the proteins interacting with the -57/-38 region of the hCYP17. Thus, nuclear proteins were isolated from H295R and Y1 cells that were stimulated with (Bu)2cAMP for 12 h before harvest. EMSA analysis revealed binding of nuclear factors from both cell lines to the radiolabeled oligonucleotide probe corresponding to -57/-38 of the hCYP17 promoter (Fig. 2AGo). Nuclear extracts from mouse Y1 cells formed a single specific DNA-protein complex with the human CRS, whereas nuclear extracts isolated from human H295R cells formed three specific DNA-protein complexes. In nuclear extracts isolated from H295R cells that were stimulated with (Bu)2cAMP, the slowest migrating DNA-protein complex (upper complex) showed a cAMP-dependent increase in binding to the -57/-38 region of the hCYP17 promoter (Fig. 2AGo). Cold competition using excess unlabeled oligonucleotide probe and control nuclear extracts showed a concentration-dependent inhibition of the formation of all three complexes (Fig. 2BGo). In control experiments, unlabeled single-stranded oligonucleotides of -57/-38 and the Sp1-binding site from the bovine adrenodoxin gene (22) were unable to compete with the double-stranded -57/-38 probe for binding to nuclear proteins (data not shown).



View larger version (70K):
[in this window]
[in a new window]
 
Figure 2. Cell line-selective binding of nuclear proteins to region -57/-38 of the hCYP17 promoter. H295R and Y1 cells were subcultured onto 100-mm dishes and incubated for 12 h in the presence or absence of 1 mM (Bu)2cAMP. Nuclear proteins were isolated according to the method of Dignan et al. (18 ) and incubated with a 32P radiolabeled double-stranded oligonucleotide corresponding to region -57/-38 of the hCYP17 promoter. A, Lanes 1 and 2 are nuclear extracts isolated from H295R cells, and lanes 3 and 4 are nuclear extracts isolated from Y1 cells. Lanes 2 and 4 show extracts isolated from cells treated with (Bu)2cAMP. B, Cold competition using unlabeled excess (20- to 2000-fold) hCYP17 -57/-38 oligonucleotide probe and nuclear extracts isolated from control H295R cells. C, Binding of nuclear proteins [-, control; +, (Bu)2cAMP] isolated from H295R cells (lanes 1–6) was compared with binding to in vitro translated SF-1 (lanes 7–12, 1 or 2 µl of in vitro translation reaction mixture). Supershift assays using an antibody to SF-1 were performed by including the antibody in the reaction mixture (lanes 3 and 4, and 9 and 10). Cold competition assays were performed by adding a 200-fold excess unlabeled probe to the reaction mixture (lanes 5 and 6, and 11 and 12).

 
We performed antibody ablation experiments to determine which of the complexes contained SF-1. Preincubation with anti-SF-1 eliminated two of three DNA-protein complexes (Fig. 2CGo). However, when comparing the mobility of protein-DNA complexes formed by reticulocyte lysates containing in vitro translated SF-1 to H295R nuclear extracts, it appeared that the fastest migrating DNA-protein complex formed with H295R nuclear extracts contains only SF-1, whereas the slowest mobility complex contains SF-1 and another factor(s). To determine whether other transcription factors that bind to similar DNA consensus sequences as in the -57/-38 region of the hCYP17 promoter were components of the intermediate and/or fastest complexes, antibodies to COUP-TF, Nur77/NGF-1B, and Dax-1 were used in EMSA assays. Incubation with these antibodies in the EMSA reaction mixture, however, had no effect on the patterns seen in Fig. 2Go (data not shown).

Time course and CHX-sensitive nature of cAMP-inducible binding
To determine the kinetics for cAMP-inducible binding to the -57/-38 region of the hCYP17 promoter, nuclear extracts were isolated from cells that were stimulated with (Bu)2cAMP for time periods ranging from 30 min to 2 h. Figure 3AGo shows two of the time points (30 min and 2 h) tested. Incubation of cells for 2 h was sufficient to detect a cAMP-mediated increased binding intensity of the slowest DNA-protein complex, and the binding intensity of the other two DNA-protein complexes did not show time dependence.



View larger version (73K):
[in this window]
[in a new window]
 
Figure 3. Time course and CHX sensitivity of cAMP-inducible formation of the upper DNA-protein complex and CHX sensitivity of hCYP17 57-pGL3. A, Nuclear proteins were isolated from cells treated with 1 mM (Bu)2cAMP for 30 min (lanes 1 and 2) and 2 h (lanes 3 and 4) and incubated with radiolabeled -57/-38 oligonucleotide. Reaction mixtures were analyzed by PAGE to detect the formation of DNA-protein complexes. -, Control; +, (Bu)2cAMP. B, H295R cells were treated with 1 mM (Bu)2cAMP in the presence and absence of 40 µM CHX for 12 h. Nuclear extracts were isolated and used in gel-shift assays with radiolabeled double-stranded oligonucleotide corresponding to -57/-38 of the hCYP17 promoter. Lane 1, Control; lane 2, (Bu)2cAMP; lane 3, (Bu)2cAMP plus CHX; lane 4, CHX. Both time-course and CHX EMSA studies were performed six times, using freshly prepared nuclear proteins.

 
The cAMP-dependent transcription of several of the steroid hydroxylase genes has been shown to be CHX sensitive (2, 23, 24). When nuclear extracts were isolated from cells that were incubated for 12 h with (Bu)2cAMP in the presence of CHX, the cAMP-inducible binding of the slowest complex was decreased (Fig. 3BGo). No effect of CHX was found on the formation of the other DNA-protein complexes. A similar effect of CHX on decreasing the binding intensity of the cAMP-inducible complex also was observed with nuclear extracts that were isolated from cells treated for 2 h (data not shown).

Determination of the rate of transcriptional activation of hCYP17 by cAMP
Steroid hydroxylase gene transcription in the adrenal cortex is increased via an ACTH/cAMP-dependent pathway. Studies investigating the time required for cAMP to stimulate transcription of steroid hydroxylase genes have found that ACTH activates transcription of bovine CYP17 within 6 h after treatment (2). However, no published studies have examined gene transcription directly at earlier time points. Therefore, to determine whether the cAMP-inducible increase in binding of nuclear proteins to the hCYP17 promoter, particularly at the 2-h point (Fig. 3AGo), leads to increased hCYP17 transcriptional initiation of the endogenous locus, in vitro nuclear run-on assays were performed. Nuclei were isolated from control and (Bu)2cAMP-treated (1 mM for 1, 2, 4, 8, and 12 h) cells. As shown in Fig. 4AGo, cAMP activated the transcription of hCYP17 within 1 h. Graphical representation of the time course of activation shows that (Bu)2cAMP continues to induce transcription of endogenous hCYP17 over the entire 12-h period examined (Fig. 4BGo). This increased gene transcription detected by nuclear run-on assays allowed us to correlate the cAMP-inducible DNA-protein complex formation observed by EMSA with increased hCYP17 expression. Next we undertook identification of the other DNA-binding protein(s) acting with SF-1 to confer cAMP-dependent transcription of hCYP17.



View larger version (44K):
[in this window]
[in a new window]
 
Figure 4. cAMP-dependent transcriptional activation of endogenous hCYP17. Transcription in vitro run-on assays were performed using nuclei isolated from H295R cells that were stimulated with (Bu)2cAMP for 2, 4, 8, and 12 h before harvest. Briefly, nuclei were incubated with [32P]UTP, and the newly transcribed RNA was hybridized to nylon membranes that had hCYP17-pCW plasmid bound to them. A pMB-ß-actin plasmid was used as a control and for normalization. A, Representative blot showing cAMP-mediated activation of hCYP17 gene transcription. B, Graphical analysis of hCYP17 induction normalized to ß-actin. Data are expressed as a percentage of the control value and are the mean ± SEM (error bars) of four separate experiments.

 
Identification of the protein(s) that associates with SF-1
As the previously mentioned attempts to identify an additional protein(s) in the slowest complex by EMSA supershift experiments failed, we resorted to DNA affinity chromatography using the -57/-38 region as the ligand. Both Coomassie and silver staining of the SDS-PAGE gel containing the purified proteins revealed major bands at approximately 55 and 100 kDa (Fig. 5AGo). Mass spectrometry of the trypsin-digested bands and microsequencing of peptide fragments (shown in Table 1Go) identified the 55-kDa band as p54nrb (25), the human homolog of murine NonO (14). We were unable to detect SF-1 in the staining profile of Fig. 5AGo or in the mass spectrograph. However, we probed for and detected the presence of SF-1 in our eluate by Western blotting (Fig. 5BGo). Similar Western analyses immunologically confirmed the identities of the 55- and 100-kDa bands as p54nrb/NonO and PSF, respectively (Fig. 5BGo).



View larger version (58K):
[in this window]
[in a new window]
 
Figure 5. Purification of SF-1 binding partners, p54nrb/NonO and PSF, and confirmation of their participation in the hCYP17 promoter complexes. -57/-38 DNA affinity chromatography was used to copurify SF-1, p54nrb/NonO, and PSF as described in Materials and Methods. A, SDS-PAGE showing proteins purified from nuclear extracts using DNA affinity chromatography. B, Western blots of affinity chromatography-purified extracts probed for expression of p54nrb/NonO (Mr, 54 kDa), SF-1 (Mr, 52 kDa), and PSF (Mr, 70 kDa). Lane 1, Nuclear extracts; lane 2, DNA affinity-purified protein. Fifteen micrograms of nuclear extracts and 2 µl DNA affinity-purified protein were loaded onto the gel. C, Blots were probed for p54nrb/NonO and SF-1 protein expression. Western blots of nuclear extracts (lanes 1 and 2), eluate from DNA affinity chromatography (lanes 3 and 4), supernatant from immunoprecipitation with anti-NonO antiserum (lanes 5 and 6), and immunoprecipitate (lanes 7 and 8) are shown. D, Antibody ablation/supershift of DNA-protein complex formation by anti-NonO antiserum. Lanes 1 and 2, Without anti-NonO; lanes 3 and 4, with anti-NonO. ss, Supershifted band. E, Antibody ablation of DNA-protein complex formation by anti-PSF antiserum. Lanes 1 and 2, Without anti-PSF; lanes 3 and 4, with anti-PSF. -, Control; +, (Bu)2cAMP.

 

View this table:
[in this window]
[in a new window]
 
Table 1. Peptide sequences

 
We tested whether SF-1 would coimmunoprecipitate with p54nrb/NonO using anti-NonO antiserum. As shown in Fig. 5CGo, Western blots probed for SF-1 revealed its presence in the NonO immunoprecipitates. This indicated that SF-1 and p54nrb/NonO associate in the absence of DNA and that this protein complex might interact with the hCYP17 promoter. Consistent with this interpretation, when we preincubated nuclear proteins with anti-NonO antiserum before EMSA, we detected inhibition of the formation of the slowest and intermediate complexes and reduced intensity of the fastest complex (Fig. 5DGo). We also detected the presence of a faint supershifted band (Fig. 5DGo, lanes 3 and 4). These findings indicate that p54nrb/NonO contributes to the formation of the upper two complexes and is present in the fastest DNA-protein complex, as is SF-1. In antibody ablation experiments using anti-PSF antiserum, we were able to inhibit the formation of the upper two DNA-protein complexes by preincubating purified proteins with anti-PSF antiserum before gel electrophoresis (Fig. 5EGo), indicating the presence of PSF in both the intermediate and cAMP-inducible (slowest) complexes. We hypothesize that PSF is a member of the cAMP-inducible complex by virtue of its association with p54nrb/NonO (16). Taken together, our antibody ablation studies (Figs. 2CGo and 5Go, D and E) clearly identify either SF-1 and p54nrb/NonO binding in the fastest DNA-protein complex, p54nrb/NonO and PSF as comprising the intermediate complex, and SF-1, p54nrb/NonO, and PSF interacting to form the slowest, cAMP-inducible complex.

Characterization of nucleotides required for SF-1, p54nrb/NonO, and PSF binding to -57/-38 of the hCYP17 promoter
A series of oligonucleotides containing various base substitutions was created and used in gel shift assays to determine which nucleotides were necessary for the SF-1, p54nrb/NonO, and PSF binding. Two of these mutant oligonucleotide probes (Fig. 6AGo) that resulted in significant changes in DNA-protein complex formation are shown in Fig. 6BGo. Nuclear extracts incubated with radiolabeled mut1 formed only the intermediate complex. As SF-1 antibody ablation assays identified SF-1 as a component of the slowest and fastest complexes (Fig. 2BGo), mutation of residues -48/-47 in the mut1 oligonucleotide confirmed that SF-1 interacts with the hCYP17 promoter at these guanine residues (Fig. 6BGo). The mut2 oligonucleotide completely abolished formation of the slowest, cAMP-inducible complex (SF-1, p54nrb/NonO. and PSF) and significantly increased formation of the intermediate (p54nrb/NonO and PSF) and fastest (SF-1 or p54nrb/NonO) complexes. These findings lead us to conclude that mutation of residues from -57/-53 (mut2 probe) stabilizes the interaction of SF-1, p54nrb/NonO, and PSF with the DNA while at the same time preventing formation of the cAMP-inducible complex between these proteins (upper EMSA band). Apparently SF-1 can bind in two different ways to the hCYP17 CRS: the fastest band being binding independent of other proteins, and the slowest band being binding dependent on other proteins.



View larger version (47K):
[in this window]
[in a new window]
 
Figure 6. Mutational analysis of SF-1, p54nrb/NonO, and PSF binding and functional activity of mutant hCYP17 promoter-reporter constructs. A, Sequences of oligonucleotides synthesized for use as radiolabeled probes in EMSA. hCYP17 is the wild-type sequence corresponding to region -57/-38 of the hCYP17 promoter. Nucleotide residues in bold represent base substitutions. Lowercase nucleotides are not present in the hCYP17 gene. B, Nuclear extracts were isolated from H295R cells that were either untreated (-) or stimulated (+) with 1 mM (Bu)2cAMP for 12 h. Wild-type hCYP17 -57/-38 (lanes 1 and 2) were compared with mut1 (lanes 3 and 4) and mut2 (lanes 5 and 6). C, Transient transfection assays were performed as described in Materials and Methods. Twenty-four hours after transfection, cells were stimulated with (Bu)2cAMP and incubated for an additional 12 h. Luciferase activity and protein content were determined from the harvested cellular extracts. hCYP17 57-luciferase constructions contained mutations as depicted in A. Data are expressed as the fold increase in luciferase activity over pGL3 vector control and represent the mean ± SEM (error bars) of three separate experiments performed in triplicate.

 
Next we examined the functional activity of the minimal 57-bp region that contained mutations at the putative SF-1/nuclear receptor-binding sites. As shown in Fig. 6CGo, substitutions at -48/-47 (mut1, Fig. 6AGo) that abolished the ability of SF-1 to bind DNA (Fig. 6BGo) resulted in no significant change in basal luciferase activity, but attenuated cAMP-mediated transcription. A similar inhibition of cAMP-dependent transcriptional activity was conferred on mut2-pGL3 by virtue of substituting bases at positions -57/-53 (mut2, Fig. 6AGo). Thus, it is the complex of nuclear proteins in the upper band that imparts cAMP responsiveness to the hCYP17 CRS.

Functional consequences of the interaction of SF-1 with p54nrb/NonO and PSF
To provide support for in vivo interaction of SF-1 with p54nrb/NonO and PSF and their role in activating hCYP17 transcription, expression constructs for SF-1, NonO, and PSF were transiently transfected into H295R cells along with the hCYP17 57-pGL3 reporter construct. Overexpression of SF-1 resulted in an increase in basal, but not cAMP-induced, activity (Fig. 7AGo). Overexpression of p54nrb/NonO, however, repressed the basal transcriptional activity of the 57-pGL3 construct by about 50% and completely inhibited cAMP-dependent transcription. Overexpression of PSF resulted in a 90% decrease in basal transcriptional activity and a complete inhibition of cAMP-stimulated transcription. However, co-overexpression of p54nrb/NonO and SF-1 repressed basal transcription of 57-pGL3 approximately 50%, but had no significant effect on the fold induction of cAMP-stimulated transcription (Fig. 7AGo). Coexpression of SF-1 and PSF significantly inhibited both basal and cAMP-stimulated transcriptional activity, indicating PSF’s essential role in repression of cAMP-dependent transcription of the hCYP17 57-pGL3. The inhibitory effects of overexpressed PSF and p54nrb/NonO on hCYP17 57-pGL3 luciferase activity were seen in a concentration-dependent manner at expression plasmid concentrations ranging from 0.2–4 µg (data not shown).



View larger version (32K):
[in this window]
[in a new window]
 
Figure 7. Functional activity of SF-1, p54nrb/NonO, and PSF and the recruitment of corepressors and HDACs. A, H295R cells were transiently transfected with 57-pGL3 with or without SF-1-pCMV5, PSF-pCR3.1, or p54nrb/NonO-pCR3.1 for 24 h, followed by treatment with 1 mM (Bu)2cAMP for an additional 12 h. Cells were harvested, and luciferase activity and protein content were determined from the cell lysate. B, Western blot of mSin3A expression. Nuclear extracts were harvested from H295R cells treated (+) or untreated (-) with 1 mM (Bu)2cAMP. Lanes 1 and 2, Nuclear proteins; lanes 3 and 4, DNA affinity-purified proteins; lanes 5 and 6, immunoprecipitation with anti-NonO antiserum; lanes 7 and 8, immunoprecipitation with anti-PSF antiserum. C, Cells were transfected with 57-pGL3 with or without SF-1-pCMV5, PSF-pCR3.1, or p54nrb/NonO-pCR3.1 for 24 h, followed by treatment with 1 mM (Bu)2cAMP and/or 250 nM TSA for an additional 12 h. Luciferase activity and protein content were determined from the harvested cellular extracts. Data are expressed as relative luciferase light units per microgram protein and represent the mean ± SEM (error bars) of at least three separate experiments performed in triplicate.

 
PSF associates with mSin3A
Due to the repressive effect of PSF on the transcriptional activity of hCYP17 57-pGL3, we hypothesized that a corepressor(s) may be mediating the decreased transcriptional activity. Several laboratories have identified transcriptional corepressors (N-CoR, SMRT, mSin3A, and TRACS) that associate with unliganded nuclear receptors and result in suppression of basal transcriptional activity (26, 27, 28, 29). mSin3A is a mammalian homolog of the yeast HO gene repressor Sin3p, which has been demonstrated to act through Rpd3p (30), a histone deacetylase (HDAC) homolog (31, 32). Because a number of factors are thought to mediate repression through interaction with mSin3A (33, 34, 35), including PSF via TR transcription (16), we examined whether mSin3A associates with PSF in our hormone-responsive cells. Nuclear extracts isolated from cells incubated in the presence and absence of (Bu)2cAMP were immunoprecipitated with anti-PSF antiserum, followed by Western blotting for mSin3A. As shown in Fig. 7BGo, mSin3A is coimmunoprecipitated with PSF, suggesting that PSF and mSin3A associate. We were also able to coimmunoprecipitate mSin3A with p54nrb/NonO (Fig. 7BGo). Further, it has been demonstrated in direct binding experiments of the cloned proteins that mSin3A physically interacts with PSF and not p54nrb/NonO (16). Thus, we postulate that mSin3A coimmunoprecipitates with p54nrb/NonO through PSF and serves as a corepressor for this complex. No significant difference was observed in the levels of mSin3A detected in control vs. (Bu)2cAMP-treated immunoprecipitates (Fig. 7BGo). We hypothesize that cAMP has no effect on the amount of mSin3A immunoreactivity due to the dynamic nature of the interaction of these proteins with each other and with the hCYP17 promoter over the 12-h exposure period that was used in these experiments.

PSF/p54nrb/NonO-mediated transcriptional repression requires histone deacetylase activity
The association of mSin3A with unliganded nuclear receptors represses the basal transcription of target genes by the association of mSin3A with HDACs (26, 27, 28, 29). Recruitment of HDACs by corepressors causes a local change in the chromatin structure, resulting in the repression of gene transcription. As PSF associates with mSin3A, we examined the affect of TSA, an HDAC inhibitor, on 57-pGL3 transcriptional activity. Overexpression of both p54nrb/NonO and PSF significantly decreased basal luciferase activity of the 57-pGL3 construct (Fig. 7Go, A and C). However, treatment with 250 nM TSA abolished both the PSF- and p54nrb/NonO-mediated repression of 57-pGL3 activity (Fig. 7CGo). TSA also enhanced activity when cells were transfected with SF-1 alone or SF-1 plus p54nrb/NonO, PSF, or both p54nrb/NonO and PSF. These findings suggest that histone deacetylation plays a role in the repressor activity of p54nrb/NonO and PSF by recruitment to the complex when it contains mSin3A.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The transcriptional regulation of the steroid hydroxylase genes has been studied extensively. Although steroidogenesis in the adrenal cortex is initiated in response to increased intracellular cAMP via an ACTH pathway, individual genes involved in steroid hormone biosynthesis are regulated by distinct transcription factors. For example, bovine 11ß-hydroxlase is regulated by the orphan nuclear receptor SF-1 (4, 36). Human and bovine CYP21 are regulated by an adrenal-specific protein (37), and bovine CYP11A (P450scc) requires Sp1 (38), whereas transcriptional regulation of the human CYP11A gene is mediated by SF-1 and CBP/p300 (39). From these and many other studies it is evident that there is not only gene-specific regulation of the steroid hydroxylase genes, but also tissue- and species-selective modes of controlling steroid hormone biosynthesis.

Our present studies exemplify the species-specific nature of steroid hydroxylase gene transcription. In both human and bovine CYP17, SF-1 binds to similar, but subtly different, DNA sequences and plays an essential role in cAMP-dependent transcription. In bCYP17 competition of SF-1/COUP-TF1, binding to the site designated CRS2 regulates expression levels. Positive cAMP-mediated regulation is via SF-1 binding and repression is evoked by COUP-TF1 binding. The details of how the competitive binding of these two nuclear receptors is regulated remains to be established. In human CYP17, cAMP-dependent regulation is also dependent on SF-1 binding to the -57/-38 (CRS2-related) sequence. However, for SF-1 to regulate transcription of hCYP17 in human adrenocortical cells, we show here that it binds as a complex with two other proteins: p54nrb/NonO and PSF. This complex, or at least the SF-1/p54nrb/NonO complex, can serve as a positive activator of hCYP17 via cAMP. However, because PSF can interact with the corepressor mSin3A, the cAMP-dependent regulation of hCYP17 is always under tight control. Both basal and cAMP-dependent regulations of hCYP17 are repressed through mSin3A via an HDAC. We have not yet uncovered the regulator of HDAC activity, but this regulator modulates ACTH-mediated transcription of hCYP17, assuring that optimal levels of 17{alpha}-hydroxylase/17,20-lyase activity are maintained, assuring required levels of cortisol/adrenal androgen to meet physiological needs.

In H295R cells we find that binding of SF-1 alone to -57/-38 of hCYP17 is not sufficient for cAMP-mediated transcription. At least the SF-1/p54nrbNonO/PSF complex is required. It is interesting that in heterologous mouse adrenocortical Y1 cells, only SF-1 binding to this human element is observed. Thus, the tight transcriptional regulation of hCYP17 is lost in the heterologous system, emphasizing the importance of studying regulation of steroidogenesis in homologous cell systems, a point previously stressed by others (8, 9).

DNA affinity chromatography using the -57/-38 region of the hCYP17 promoter allowed for the purification of p54nrb/NonO and PSF. p54nrb/NonO contains two nucleic acid binding domains: a ribonuclear protein-binding motif and a helix-turn-helix motif (14). NonO has been shown to bind via its helix-turn-helix domain to double-stranded DNA with the A/T specificity similar to that seen with other octamer-binding proteins (14). It can also bind to RNA or single-stranded DNA via its ribonuclear protein domain, but with less sequence specificity (14). It has been found that NonO increases the binding activities of several transcription factors, including Oct-1 (40), to their response elements. Recently, PSF was identified as a negative regulator of the transcriptional activity of another steroidogenic gene, porcine CYP11A (P450 side-chain cleavage enzyme) (41). It was found that IGF-stimulated transcription of P450scc is activated by binding of Sp1 to an IGF response element and inhibited by PSF interacting with this same element (41). This study, showing PSF acting to repress porcine CYP11, provides another example of the importance of repression of transcription in modulating steroidogenic activity.

A novel finding compared with all other previous studies of steroidogenic gene regulation was the cAMP inducibility of the slowest mobility complex. This increase in the binding intensity of the SF-1/p54nrb/NonO/PSF complex after cAMP stimulation, occurs within 1–2 h after incubation with (Bu)2cAMP. Moreover, the increase in binding intensity seen when using nuclear extracts prepared from cells stimulated with (Bu)2cAMP was attenuated in extracts isolated from cells that were cotreated with (Bu)2cAMP and CHX. Thus, it appears that there is a CHX-sensitive component to the formation of the slowest mobility complex. CHX-inhibited binding of transcription factors has not previously been observed with steroidogenic genes. The cAMP-mediated increase in this binding intensity of the upper DNA-protein complex seen in EMSA assays is correlated with an increase in hCYP17 gene transcription, as nuclear run-on assays showed that cAMP-dependent transcription of the hCYP17 gene is activated within 2 h. Thus, the increase in binding to the -57/-38 region of the hCYP17 promoter occurs in a biologically relevant time frame.

The mechanism by which cAMP induces increased binding, as reflected by the accumulation of the slowest DNA-protein complex, is unclear. However, it is plausible that factors, such as changes in the phosphorylation state of SF-1, PSF, and/or p54nrb/NonO or ligand binding to SF-1, may play a role in the cAMP-inducible binding. We have recently uncovered the role of a phosphatase in this regulation (41A ), and further studies to determine how changes in phosphorylation mediate cAMP-inducible binding are currently underway. SF-1 has been shown to be phosphorylated by a MAPK-dependent pathway on serine 203 (42). Further, PSF has been found to interact with protein phosphatase 1 (43). Thus, it is possible that one of the identified binding proteins can undergo changes in phosphorylation state giving rise to increased transcription of hCYP17. It is also possible that cAMP increases the binding intensity of the slowest DNA-protein complex by de novo synthesis of SF-1, PSF, and/or p54nrb/NonO. The sensitivity of the slowest, cAMP-inducible complex to CHX suggests that de novo synthesis may be likely. Our findings suggest that PSF recruits a corepressor complex containing mSin3A and HDAC, thereby inhibiting basal transcription. cAMP stimulates activation of SF-1 (e.g. phosphorylation) and alleviates the repression. A similar finding, that PSF bound mSin3A and repressed unliganded thyroid hormone receptor, has been reported (16). We hypothesize that cAMP-dependent activation of hCYP17 gene transcription occurs upon the release of mSin3A and HDAC from the SF-1/p54nrb/NonO/PSF complex.

In conclusion, we have shown that SF-1, p54nrb/NonO, and PSF copurify and participate in the cAMP-dependent transcription of hCYP17. p54nrb/NonO binds PSF, which interacts directly with mSin3A and silences gene expression. Further, our studies show that cAMP-inducible binding of the SF-1/p54nrb/NonO/PSF complex to the -57/-38 region of the hCYP17 promoter alleviates this repression and acts to enhance gene transcription. Our present studies uncover a novel repressive mechanism that seems to be just as crucial as is activation in the regulation of hCYP17 and, thus, adrenocortical steroid hormone patterns.


    Footnotes
 
This work was supported by NIH Grants DK-28350 and ES-00267 (to M.R.W.), a UNCF/Merck Science Initiative Postdoctoral Fellowship (to M.B.S.), and NIH Postdoctoral Training Grant T32-CA-09582 (to M.B.S.).

1 Present address: Department of Biochemistry, Vanderbilt University School of Medicine, 607 Light Hall, Nashville, Tennessee 37232-0146. Back

Abbreviations: bCYP17, Bovine CYP17; CHX, cycloheximide; COUP-TF, chicken ovalbumin promoter-transcription factor; CRS, cAMP regulatory sequence; hCYP17, human CYP17; HDAC, histone deacetylase; PSF, protein-associated splicing factor; SF-1, steroidogenic factor-1; TSA, trichostatin A.

Received November 15, 2001.

Accepted for publication December 20, 2001.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Waterman MR 1994 Biochemical diversity of cAMP-dependent transcription of steroid hydroxylase genes in the adrenal cortex. J Biol Chem 269:27783–27786[Free Full Text]
  2. John ME, John MC, Boggaram V, Simpson ER, Waterman MR 1986 Transcriptional regulation of steroid hydroxylase genes by corticotropin. Proc Natl Acad Sci USA 83:4715–4719[Abstract/Free Full Text]
  3. Lala DS, Rice DA, Parker KL 1992 Steroidogenic factor I, a key regulator of steroidogenic enzyme expression, is the mouse homolog of fushi tarazu-factor I. Mol Endocrinol 6:1249–1258[Abstract/Free Full Text]
  4. Morohashi K, Honda S, Inomata Y, Handa H, Omura T 1992 A common trans-acting factor, Ad4-binding protein, to the promoters of steroidogenic P-450s. J Biol Chem 267:17913–17919[Abstract/Free Full Text]
  5. Luo X, Ikeda Y, Parker KL 1994 A cell-specific nuclear receptor is essential for adrenal and gonadal development and sexual differentiation. Cell 77:481–490[CrossRef][Medline]
  6. Parker KL, Schimmer BP 1997 Steroidogenic factor 1: a key determinant of endocrine development and function. Endocr Rev 18:391–377
  7. Rice DA, Mouw AR, Bogerd AM, Parker KL 1991 A shared promoter element regulates the expression of three steroidogenic enzymes. Mol Endocrinol 5:1552–1561[Abstract/Free Full Text]
  8. Rodriguez H, Hum DW, Staels B, Miller WL 1997 Transcription of the human genes for cytochrome P450scc and P450c17 is regulated differently in human adrenal NCI-H295 cells than in mouse adrenal Y1 cells. J Clin Endocrinol Metab 82:365–371[Abstract/Free Full Text]
  9. Lin CJ, Martens JWM, Miller WL 2001 NF-1C, Sp1, and Sp3 are essential for transcription of the human gene for P450c17 (steroid 17{alpha}-hydroxylase/17,20 lyase) in human adrenal NCI-H295R cells. Mol Endocrinol 15:1277–1293[Abstract/Free Full Text]
  10. Bischof LJ, Kagawa N, Moskow JJ, Takahashi Y, Iwamatsu A, Buchberg AM, Waterman MR 1998 Members of the meis1 and pbx homeodomain protein families cooperatively bind a cAMP-responsive sequence (CRS1) from bovine CYP17. J Biol Chem 273:7941–7948[Abstract/Free Full Text]
  11. Lund J, Ahlgren R, Wu DH, Kagimoto M, Simpson ER, Waterman MR 1990 Transcriptional regulation of the bovine CYP17 (P-450(17){alpha}) gene. Identification of two cAMP regulatory regions lacking the consensus cAMP-responsive element (CRE). J Biol Chem 265:3304–3312[Abstract/Free Full Text]
  12. Lund J, Faucher DJ, Ford SP, Porter JC, Waterman MR, Mason JI 1988 Developmental espression of bovine adrenocortical steroid hydroxylases. J Biol Chem 263:16195–16201[Abstract/Free Full Text]
  13. Bakke M, Lund J 1995b Transcriptional regulation of the bovine CYP17 gene: two nuclear orphan receptors determine activity of cAMP-responsive sequence 2. Endocr Res 21:509–516
  14. Yang Y-S, Hanke JH, Carayannopoulos L, Craft CM, Capra JD, Tucker PW 1993 NonO, a non-POU-domain-containing, octamer-binding protein, is the mammalian homolog of Drosophila nonAdiss. Mol Cell Biol 13:5593–5603[Abstract/Free Full Text]
  15. Patton JG, Porro EB, Galceran J, Tempst P, Nadal-Ginard B 1993 Cloning and characterization of PSF, a novel pre-mRNA splicing factor. Genes Dev 7:393–406[Abstract/Free Full Text]
  16. Mathur M, Tucker PW, Samuels HH 2001 PSF is a novel corepressor that mediates its effect through Sin3A and the DNA binding domain of nuclear hormone receptors. Mol Cell Biol 21:2298–2311[Abstract/Free Full Text]
  17. Staels B, Hum DW, Miller WL 1993 Regulation of steroidogenesis in NCI-H295 cells: a cellular model of the human fetal adrenal. Mol Endocrinol 7:423–433[Abstract/Free Full Text]
  18. Dignam JD, Lebovitz RM, Roeder RG 1983 Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res 11:1475–1489[Abstract/Free Full Text]
  19. Kagawa N, Ogo A, Takahashi Y, Iwamatsu A, Waterman MR 1994 A cAMP-regulatory sequence (CRS1) of CYP17 is a cellular target for the homeodomain protein Pbx1. J Biol Chem 269:18716–18719[Abstract/Free Full Text]
  20. Greenberg M, Bender TP 1997 Identification of newly transcribed RNA. In: Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K eds. Current protocols. New York: Wiley & Sons; 4.10.1–4.10.11
  21. Mari M, Cederbaum AI 2000 CYP2E1 Overexpression in HepG2 cells induces glutathione synthesis by transcriptional activation of {gamma}-glutamylcysteine synthetase. J Biol Chem 275:15563–15571[Abstract/Free Full Text]
  22. Cheng PY, Kagawa N, Takahashi Y, Waterman MR 2000 Three zinc finger nuclear proteins, Sp1, Sp3, and a ZBP-89 homologue, bind to the cyclic adenosine monophosphate-responsive sequence of the bovine adrenodoxin gene and regulate transcription. Biochemistry 39:4347–4357[CrossRef][Medline]
  23. Bird IM, Mason JI, Rainey WE 1998 Protein kinase A, protein kinase C, and Ca(2+)-regulated expression of 21-hydroxylase cytochrome P450 in H295R human adrenocortical cells. J Clin Endocrinol Metab 83:1592–1597[Abstract/Free Full Text]
  24. Waterman MR, Simpson ER 1989 Regulation of steroid hydroxylase gene expression is multifactorial in nature. Recent Prog Horm Res 45:533–563
  25. Dong B, Horowitz DS, Kobayashi R, Krainer AR 1993 Purification and cDNA cloning of HeLa cell p54nrb, a nuclear protein with two RNA recognition motifs and extensive homology to human splicing factor PSF and Drosophila NONA/BJ6. Nucleic Acids Res 21:4085–4092[Abstract/Free Full Text]
  26. Sande S, Privalsky M 1996 Identification of TRACs, family of co-factors that associate with, and modulate the activity of nuclear hormone receptors. Mol Endocrinol 10:813–825[Abstract/Free Full Text]
  27. Chen JD, Evans RM 1995 A transcriptional co-repressor that interacts with nuclear hormone receptors. Nature 377:454–457[CrossRef][Medline]
  28. Chen JD, Umesono K, Evans RM 1996 SMRT isoforms mediate repression and anti-repression of nuclear receptor heterodimers. Proc Natl Acad Sci USA 93:7567–7571[Abstract/Free Full Text]
  29. Horlein AJ, Naar AM, Heinzel T, Torchia J, Gloss B, Kurokawa R, Ryan A, Kamei Y, Soderstrom M, Glass CK, Rosenfeld MG 1995 Ligand-independent repression by the thyroid hormone receptor mediated by a nuclear co-repressor. Nature 377:397–404[CrossRef][Medline]
  30. Sternberg PW, Stern MJ, Clark I, Herskowitz I 1987 Activation of the yeast HO gene by release from multiple negative controls. Cell 48:567–577[CrossRef][Medline]
  31. Yang MW, Inouye C, Zeng Y, Bearss D, Seto E 1996 Transcriptional repression by YY1 is mediated by interaction with a mammalian homolog of the yeast global regulator RPD3. Proc Natl Acad Sci USA 93:12845–12850[Abstract/Free Full Text]
  32. Wolffe AP 1996 Histone deacetylase: a regulator of transcription. Science 272:371–372[CrossRef][Medline]
  33. Heinzel T, Lavinsky RM, Mullen TM, Soderstrom M, Laherty CD, Torchia J, Yang WM, Brard G, Ngo SD, Davie JR, Seto E, Eisenman RN, Rose DW, Glass CK, Rosenfeld MG 1997 A complex containing N-CoR, mSin3 and histone deacetylase mediates transcriptional repression. Nature 387:43–48[CrossRef][Medline]
  34. Laherty CD, Yang WM, Sun JM, Davie JR, Seto E, Eisenman RN 1997 Histone deacetylases associated with the mSin3 corepressor mediate mad transcriptional repression. Cell 89:349–356[CrossRef][Medline]
  35. Nagy LH, Kao HV, Chakravarti D, et al 1997 Nuclear receptor repression mediated by a complex containing SMRT, mSin3A, and histone deacetylase. Cell 89:373–380[CrossRef][Medline]
  36. Honda S, Morohashi K, Nomura M, Takeya H, Kitajima M, Omura T 1993 Ad4BP regulating steroidogenic P-450 gene is a member of steroid hormone receptor superfamily. J Biol Chem 267:7494–7502
  37. Kagawa N, Waterman MR 1992 Purification and characterization of a transcription factor which appears to regulate cAMP responsiveness of the human CYP21B gene. J Biol Chem 267:25213–25219[Abstract/Free Full Text]
  38. Ahlgren R, Suske G, Waterman MR, Lund J 1999 Role of Sp1 in cAMP-dependent transcriptional regulation of the bovine CYP11A gene. J Biol Chem 274:19422–19428[Abstract/Free Full Text]
  39. Monte D, DeWitte F, Hum DW 1998 Regulation of the human P450scc gene by steroidogenic factor 1 is mediated by CBP/p300. J Biol Chem 273:4585–4591[Abstract/Free Full Text]
  40. Yang Y-S, Yang M-C W, Tucker PW, Capra JD 1997 NonO enhances the association of many DNA-binding proteins to their targets. Nucleic Acids Res 25:2284–2292[Abstract/Free Full Text]
  41. Urban RJ, Bodenburg Y, Kurosky A, Wood TG, Gasic S 2000 Polypyrimidine tract-binding protein-associated splicing factor is a negative regulator of transcriptional activity of the porcine P450scc insulin-like growth factor response element. Mol Endocrinol 14:774–782[Abstract/Free Full Text]
  42. Sewer MB, Waterman MR, ACTH/cAMP-mediated transcription of the human CYP17 gene in the adrenal cortex is dependent on phosphatase activity. Endocrinology, in press
  43. Hammer GD, Krylova I, Zhang Y, Darimont BD, Simpson K, Weigel NL, Ingraham HA 1999 Phosphorylation of the nuclear receptor SF-1 modulates cofactor recruitment: integration of hormone signaling in reproduction and stress. Mol Cell 3:521–526[CrossRef][Medline]
  44. Hirano K, Erdodi F, Patton JG, Hartshorne DJ 1996 Interaction of protein phosphatase type 1 with a splicing factor. FEBS Lett 389:191–194[CrossRef][Medline]



This article has been cited by other articles:


Home page
Mol. Endocrinol.Home page
X. Dong, C. Yu, O. Shynlova, J. R. G. Challis, P. S. Rennie, and S. J. Lye
p54nrb Is a Transcriptional Corepressor of the Progesterone Receptor that Modulates Transcription of the Labor-Associated Gene, Connexin 43 (Gja1)
Mol. Endocrinol., August 1, 2009; 23(8): 1147 - 1160.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
T. Yazawa, Y. Inanoka, T. Mizutani, M. Kuribayashi, A. Umezawa, and K. Miyamoto
Liver Receptor Homolog-1 Regulates the Transcription of Steroidogenic Enzymes and Induces the Differentiation of Mesenchymal Stem Cells into Steroidogenic Cells
Endocrinology, August 1, 2009; 150(8): 3885 - 3893.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
F. M. J. Jacobs, S. van Erp, A. J. A. van der Linden, L. von Oerthel, J. P. H. Burbach, and M. P. Smidt
Pitx3 potentiates Nurr1 in dopamine neuron terminal differentiation through release of SMRT-mediated repression
Development, February 15, 2009; 136(4): 531 - 540.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
Y. Shi, M. D. Schonemann, and S. H. Mellon
Regulation of P450c17 Expression in the Early Embryo Depends on GATA Factors
Endocrinology, February 1, 2009; 150(2): 946 - 956.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. L. Amelio, L. J. Miraglia, J. J. Conkright, B. A. Mercer, S. Batalov, V. Cavett, A. P. Orth, J. Busby, J. B. Hogenesch, and M. D. Conkright
A coactivator trap identifies NONO (p54nrb) as a component of the cAMP-signaling pathway
PNAS, December 18, 2007; 104(51): 20314 - 20319.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. J. Kuhl, S. M. Ross, and K. W. Gaido
CCAAT/Enhancer Binding Protein {beta}, But Not Steroidogenic Factor-1, Modulates the Phthalate-Induced Dysregulation of Rat Fetal Testicular Steroidogenesis
Endocrinology, December 1, 2007; 148(12): 5851 - 5864.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
D. Li, A. N. Urs, J. Allegood, A. Leon, A. H. Merrill Jr., and M. B. Sewer
Cyclic AMP-Stimulated Interaction between Steroidogenic Factor 1 and Diacylglycerol Kinase {theta} Facilitates Induction of CYP17
Mol. Cell. Biol., October 1, 2007; 27(19): 6669 - 6685.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
X. Dong, J. Sweet, J. R. G. Challis, T. Brown, and S. J. Lye
Transcriptional Activity of Androgen Receptor Is Modulated by Two RNA Splicing Factors, PSF and p54nrb
Mol. Cell. Biol., July 1, 2007; 27(13): 4863 - 4875.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
E. B. Dammer, A. Leon, and M. B. Sewer
Coregulator Exchange and Sphingosine-Sensitive Cooperativity of Steroidogenic Factor-1, General Control Nonderepressed 5, p54, and p160 Coactivators Regulate Cyclic Adenosine 3',5'-Monophosphate-Dependent Cytochrome P450c17 Transcription Rate
Mol. Endocrinol., February 1, 2007; 21(2): 415 - 438.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
S. H. Mellon, S. R. Bair, C. Depoix, J.-L. Vigne, N. B. Hecht, and P. B. Brake
Translin Coactivates Steroidogenic Factor-1-Stimulated Transcription
Mol. Endocrinol., January 1, 2007; 21(1): 89 - 105.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. N. Urs, E. Dammer, and M. B. Sewer
Sphingosine Regulates the Transcription of CYP17 by Binding to Steroidogenic Factor-1
Endocrinology, November 1, 2006; 147(11): 5249 - 5258.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
T. Sugawara, N. Sakuragi, and H. Minakami
CREM confers cAMP responsiveness in human steroidogenic acute regulatory protein expression in NCI-H295R cells rather than SF-1/Ad4BP.
J. Endocrinol., October 1, 2006; 191(1): 327 - 337.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
T. Ozbay, A. Rowan, A. Leon, P. Patel, and M. B. Sewer
Cyclic Adenosine 5'-Monophosphate-Dependent Sphingosine-1-Phosphate Biosynthesis Induces Human CYP17 Gene Transcription by Activating Cleavage of Sterol Regulatory Element Binding Protein 1
Endocrinology, March 1, 2006; 147(3): 1427 - 1437.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
S. N Kelly, T J. McKenna, and L. S Young
Coregulatory protein-orphan nuclear receptor interactions in the human adrenal cortex
J. Endocrinol., July 1, 2005; 186(1): 33 - 42.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
J. Xu, N. Zhong, H. Wang, J. E. Elias, C. Y. Kim, I. Woldman, C. Pifl, S. P. Gygi, C. Geula, and B. A. Yankner
The Parkinson's disease-associated DJ-1 protein is a transcriptional co-activator that protects against neuronal apoptosis
Hum. Mol. Genet., May 1, 2005; 14(9): 1231 - 1241.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
C. E. Fluck and W. L. Miller
GATA-4 and GATA-6 Modulate Tissue-Specific Transcription of the Human Gene for P450c17 by Direct Interaction with Sp1
Mol. Endocrinol., May 1, 2004; 18(5): 1144 - 1157.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
J. K. Wickenheisser, V. L. Nelson-DeGrave, P. G. Quinn, and J. M. McAllister
Increased Cytochrome P450 17{alpha}-Hydroxylase Promoter Function in Theca Cells Isolated from Patients with Polycystic Ovary Syndrome Involves Nuclear Factor-1
Mol. Endocrinol., March 1, 2004; 18(3): 588 - 605.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
P. Val, C. Aigueperse, B. Ragazzon, G. Veyssiere, A.-M. Lefrancois-Martinez, and A. Martinez
Adrenocorticotropin/3',5'-Cyclic AMP-Mediated Transcription of the Scavenger akr1-b7 Gene in Adrenocortical Cells Is Dependent on Three Functionally Distinct Steroidogenic Factor-1-Responsive Elements
Endocrinology, February 1, 2004; 145(2): 508 - 518.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
W. Fan, T. Yanase, Y. Wu, H. Kawate, M. Saitoh, K. Oba, M. Nomura, T. Okabe, K. Goto, J. Yanagisawa, et al.
Protein Kinase A Potentiates Adrenal 4 Binding Protein/Steroidogenic Factor 1 Transactivation by Reintegrating the Subcellular Dynamic Interactions of the Nuclear Receptor with Its Cofactors, General Control Nonderepressed-5/Transformation/ Transcription Domain-Associated Protein, and Suppressor, Dosage-Sensitive Sex Reversal-1: a Laser Confocal Imaging Study in Living KGN Cells
Mol. Endocrinol., January 1, 2004; 18(1): 127 - 141.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
R. C. Fowkes, M. Desclozeaux, M. V. Patel, S. J. B. Aylwin, P. King, H. A. Ingraham, and J. M. Burrin
Steroidogenic Factor-1 and The Gonadotrope-Specific Element Enhance Basal and Pituitary Adenylate Cyclase-Activating Polypeptide-Stimulated Transcription of the Human Glycoprotein Hormone {alpha}-Subunit Gene in Gonadotropes
Mol. Endocrinol., November 1, 2003; 17(11): 2177 - 2188.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
E. Kiesler, F. Miralles, A.-K. O. Farrants, and N. Visa
The Hrp65 self-interaction is mediated by an evolutionarily conserved domain and is required for nuclear import of Hrp65 isoforms that lack a nuclear localization signal
J. Cell Sci., October 1, 2003; 116(19): 3949 - 3956.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
P. Percipalle, N. Fomproix, K. Kylberg, F. Miralles, B. Bjorkroth, B. Daneholt, and N. Visa
An actin-ribonucleoprotein interaction is involved in transcription by RNA polymerase II
PNAS, May 27, 2003; 100(11): 6475 - 6480.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. B. Sewer and M. R. Waterman
cAMP-dependent Protein Kinase Enhances CYP17 Transcription via MKP-1 Activation in H295R Human Adrenocortical Cells
J. Biol. Chem., February 28, 2003; 278(10): 8106 - 8111.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
M. B. Sewer and M. R. Waterman
Adrenocorticotropin/Cyclic Adenosine 3',5'-Monophosphate-Mediated Transcription of the Human CYP17 Gene in the Adrenal Cortex Is Dependent on Phosphatase Activity
Endocrinology, May 1, 2002; 143(5): 1769 - 1777.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sewer, M. B.
Right arrow Articles by Waterman, M. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sewer, M. B.
Right arrow Articles by Waterman, M. R.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals