| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
INSULIN-GLUCAGON-GI PEPTIDES-DIABETES MELLITUS |
Medical Research Council Group in Fetal and Neonatal Health and Development (B.D., C.C., T.C., D.J.H.), Lawson Health Research Institute, London, Ontario, Canada N6A4V2; Departments of Physiology, Medicine, and Paediatrics (D.J.H.), University of Western Ontario, London, Ontario, Canada N6A 5A5; and U257 Institut National de la Santé et de la Recherche Médicale (D.B., J.J., R.L.J.), 75014 Paris, France
Address all correspondence and requests for reprints to: Dr. Bertrand Duvillié, U457 Institut National de la Santé et de la Recherche Médicale, Hôpital R. Debré, 48 Bd Serrurier, 75019 Paris, France.
| Abstract |
|---|
|
|
|---|
- and ß-cells to the islets was not altered. This was supported by an increase in the number of cells containing immunoreactive proliferating cell nuclear antigen in both islet
- and ß-cells at E18.5 in insulin-deficient mice, and a significantly lower incidence of apoptotic cells, as determined by molecular histochemistry using the terminal deoxynucleotidyl transferase-mediated deoxy-UTP nick end labeling reaction. The density of blood vessels within sections of whole pancreas, or within islets, was determined by immunohistochemistry for the endothelial cell marker CD31 and was found to be increased 2-fold in insulin-deficient mice compared with controls at E18.5. However, no changes were found in the steady-state expression of mRNAs encoding vascular endothelial growth factor, its receptor Flk-1, IGF-I or -II, the IGF-I and insulin receptors, or insulin receptor substrates-1 or -2 in pancreata from Ins1-/-, Ins2-/- mice compared with Ins1-/-, Ins2+/- controls. Thus, we conclude that the relative hyperplasia of the islets in late gestation in the insulin-deficient mice was due to an increased islet cell proliferation coupled with a reduced apoptosis, which may be related to an increased vascularization of the pancreas. | Introduction |
|---|
|
|
|---|
To date, little is known about the autocrine or paracrine effects of insulin itself on the development of the ß-cells and on islet form and mass. Because insulin is able to induce the phosphorylation of the insulin receptor and its primary substrates, insulin receptor substrate-1 (IRS-1) and IRS-2 in rat pancreatic islets, this suggests that a functional insulin- signaling pathway is present in islets and that insulin could act as an autocrine or paracrine factor (5). Leibiger et al. (6) also reported that exocytosis of insulin from the ß-cell can promote insulin gene transcription via the insulin receptor and PI3K, and other kinases suggesting an autoregulation of insulin release. There are two nonallelic insulin genes in the mouse, Ins1 and Ins2, that encode two very similar proteins (7). As their expression in the mouse embryo was detected as soon as E9.5 in the primary pancreatic bud, it has been suggested that insulin is an early marker of pancreatic development (8). Maternal insulin is considered not to cross the placental barrier to the fetus in biologically meaningful amounts (9). We showed previously that disruption of the two insulin genes in the mouse by homologous recombination resulted in no embryonic lethality, but severe intrauterine growth retardation (10). These animals developed a severe diabetes immediately after suckling and they died within 48 h of birth with ketoacidosis (10). A pancreas was present with exocrine and islets, the latter containing all endocrine cell types including ß-cells, which were detected by using a ß-galactosidase marker derived from a LacZ gene inserted at the Ins2 locus. Inactivation of either the Ins1 or Ins2 locus individually resulted in a compensatory increase in ß-cell mass compared with wild-type animals at 24 months of age (11).
We have now used this model further to identify the effects of a complete lack of endogenous insulin on the morphometry and cell biology of the developing endocrine pancreas.
| Materials and Methods |
|---|
|
|
|---|
X-gal staining
Pancreata from Ins1-/-, Ins2-/- fetuses at E18.5 and Ins1-/-, Ins2+/- controls were rinsed in 0.1 M phosphate buffer, pH 7.3 [23 mM sodium phosphate monobasic, 77 mM sodium phosphate dibasic (Sigma, St. Louis, MO)] at room temperature for 10 min, and fixed for 15 min in 0.1 M phosphate buffer (pH 7.3) containing 0.2% (vol/vol) glutaraldehyde, 5 mM EGTA, and 2 mM MgCl2. They were subsequently washed three times for 5 min each in a wash buffer [2 mM MgCl2, 0.01% (wt/vol) deoxycholate, 0.01% (vol/vol) Nonidet-P40, in 0.1 M sodium phosphate, pH 7.3] and incubated for 24 h in wash buffer containing 5 mM K3Fe(CN)6 and 1 mg/ml 5-Br-4-Cl-3-indolyl-galactoside (X-gal), before photomicroscopy.
RT-PCR analysis
Total RNA was extracted from the dissected pancreata from Ins1-/-, Ins2-/- fetuses at E18.5 and Ins1-/-, Ins2+/- controls as described (12). The preparation was treated with RNase-free DNase and checked for the absence of DNA contamination. RT-PCR was performed on 1 µg of RNA/50 µl reaction volume using an Access PCR kit (Promega Corp., distributed by Fisher Scientific, Nepean, Ontario, Canada) as recommended by the suppliers. Thirty cycles of DNA amplification were used for each reaction, which produced radioactive hybridization signal intensities within the linear ranges. Experimentation with 20 cycles did not yield a hybridization signal, while 40 cycles gave a stronger, but maximal signal intensity. Signal intensities were quantified using a laser densitometer. The reaction was also carried out in the absence of reverse transcriptase to ensure that the amplified material had derived from RNA. Negative controls were done for each reaction by performing an RT-PCR on 9 µl of sterile water. An amplification for ß-actin with the primers 5' CGTGGGCCGCCCTAGGCACCA 3'/5' TTGGCCTTAGGGTTCAGGGGGG 3' to check that all reactions were done with the same quantity of RNA.
Transcripts were detected with the primer pairs
5' GGACCAGAGACCCTTT GCGGGG 3'5' GGCTGCTTTTGTAGGCTTCAGTGG 3' for IGF I, 5' CGCCCCAGCGAG ACTCTGTGC 3'/5' GCCCACGGGGTATCTGGGGAA 3' for IGF II, 5' GAGACGGCTT CTCTGCAGTA 3'/5' GGCAGAGAGGGAAGGCAGAG 3' for IGF I receptor, 5' GCGAA GATCCCTTGAAGAGGTGGG 3'/5' GCCCCGCTCCAGGGCAAAATGCTTCCG 3' for the insulin receptor (IR), 5' CAGCAGCAGCAACAGCAGCAGCA 3'/5' TTGACGAGG ACAACCTATCTGCAT 3' for IRS-1, and 5' ATACACTCTCATGAGGGCCA 3'/5' TCCGTTTACTGGGAAGGTCC 3' for IRS-2. The RT-PCR products were assessed by electrophoresis on a 2% agarose gel. For vascular endothelial growth factor (VEGF), the primer pair 5' CCTTGGC TTGTCACATCTGCAAG 3'/5' CAGATCATGCGGATCAAACCTCACCAA 3' was used and for Flk 1: 5' CACCAAAGAGAGGAACG 3'/5' ACAGGCAGAAACCAGTAG 3'. Primers for VEGF and Flk-1 were kindly provided by Dr. Guo Fong, Lawson Health Research Institute (London, Ontario, Canada).
Immunocytochemistry
Following excision, the pancreata were washed twice in PBS for 10 min each and fixed in 10% (vol/vol) formalin overnight at 4 C before embedding in paraffin. Histological sections of pancreas (5 µm) were cut from paraffin blocks with a rotary microtome and mounted on glass microscope slides (Superfrost plus, Fisher Scientific). Sections of whole pancreata were stained using the following specific primary antibodies: guinea pig anti-insulin (1:15) (provided by Dr. T. MacDonald, Department of Medicine, University of Western Ontario, Ontario, Canada), rabbit antiporcine glucagon (1:50, C-terminal 04A antiserum, kindly provided by Dr. R. Ungar, Dallas, TX), mouse antiendothelial cell CD31 (1:50, DAKO Corp., Santa Barbara, CA), mouse antiproliferating cell nuclear antigen (PCNA) (1:750, Sigma), mouse anticyclin D1 (1:750, Zymed Laboratories, Inc., South San Francisco, CA), rabbit anti-Nek2 (1:750, Zymed Laboratories, Inc.), and rabbit antipancreatic and duodenal homeobox factor 1 (Pdx-1) (a gift from Dr. C. V. Wright, Vanderbilt Medical Center, Nashville, TN). The secondary antibodies were either biotinylated antimouse (1:100), antiguinea pig (1:500), or antirabbit IgGs (1:30) (Vector Laboratories, Ltd., Burlington, Ontario, Canada). Visualization of the ligands was achieved using immunoperoxidase staining. All antisera were diluted in 0.01 M PBS (pH 7.5) containing 1% (wt/vol) BSA and 0.02% (wt/vol) sodium azide (100 µl per slide). Peptide immunoreactivity was visualized by incubation with fresh 1.89 mM diaminobenzidine (DAB) tetrahydrochloride (Fast DAB tablets, Sigma) for 2 min. Tissue sections were counterstained with Carrazis hematoxylin, dehydrated in ascending series of alcohols (50%, 70%, 90%, 100%, vol/vol), cleared in xylene and mounted under glass coverslip with Permount (Fisher Scientific). The presence of Pdx-1 was detected by immunofluorescence. Each method has been described by us in detail previously (3, 4).
Dual staining for PCNA and insulin, was performed by first undertaking immunohistochemistry for PCNA as described above using DAB as the chromogen. Before counterstaining and dehydration, the sections were then subjected to immunohistochemistry for insulin as described above, using alkaline phosphatase (blue) (alkaline phosphatase substrate kit III, Vector) as the chromogen. After incubation with antisera against insulin, antiguinea pig or antiporcine alkaline phosphatase conjugate (Sigma) was applied to the sections for 1 h, followed by incubation with alkaline phosphatase substrate for 20 min before washing and counter-staining with Mayers hemalum. Sections were mounted under glass coverslips with an aqueous mounting solution (Aquamount, Polysciences, Warrington, PA).
To demonstrate that pancreatic ductal tissue and acinar tissue could be appropriately identified for morphometric analysis, immunohistochemistry was performed with mouse antihuman cytokeratin 20 (1:50) (DAKO Corp.), or rabbit antihuman a amylase (1:2000) (Sigma), respectively. For the visualization of cytokeratin, tissues were first incubated with Bacto-Trypsin (0.015% wt/vol in Trizma buffer, pH 7.6) (Difco Laboratories, Detroit, MI) for 45 min at 37 C.
Apoptosis
Apoptotic nuclei were detected with a Promega Corp. kit (distributed by Fisher Scientific) under the conditions provided by the supplier. Briefly, the apoptotic detection system measured the fragmented DNA of apoptotic cells by catalytically incorporating fluorescein-12-UTP at the 3' DNA ends using the enzyme terminal deoxynucleotidyl transferase, which forms a polymeric tail using the principle of the terminal deoxynucleotidyl transferase-mediated deoxy-UTP nick end labeling assay. The fluorescein-12-deoxy-UTP-labeled DNA could then be visualized by fluorescence microscopy on a Carl Zeiss axioskop (Jena, Germany), and the apoptotic nuclei were counted using automated imaging software as described below.
Morphometric and statistical analysis
Morphometric analysis was performed using a Carl Zeiss transmitted-light microscope at a magnification of x250 or x400. Analyses were performed using the Northern Eclipse version 2.0 morphometric analysis software (Empix Imaging Co., Mississauga, Ontario, Canada). The area of the pancreatic islets, the size of the ß-cells, and the number of insulin-, glucagon-, PCNA-, cyclin G1-, Nek2-, Cd31-, Pdx-1-positive cells and apoptotic nuclei were each calculated for five tissue sections from each pancreas representing predominantly the head regions for each age. Individual cell area and total areas of immunoreactive cells within islets were circled for image analysis and selected by gray-level threshold. Pancreatic ß-cell mass was calculated following immunohistochemistry for insulin or the visualization of X-gal on sections obtained throughout pancreata of known weight. ß-Cell mass was estimated by calculating the mean percentage area of tissue containing cells immunoreactive for insulin per sectional area of pancreas (five sections per organ). This was then expressed as milligrams ß-cell mass based on the total pancreatic wet weight for individual animals. Differences between mean values for variables within individual experiments were compared statistically by two-way ANOVA, followed by a Scheffés test. For RT-PCR analysis, three separate RNA preparations, each from a separate animal, were used for each target gene product.
| Results |
|---|
|
|
|---|
|
-cells was determined by immunocytochemistry for glucagon (Fig. 1
-cell mass was also increased in insulin-deficient animals (E18.5, WT 38 ± 8 µg; Ins1-/-, Ins2+/- 45 ± 6 µg; Ins1-/-, Ins2-/- 68 ± 11 µg, P < 0.01 vs. WT).
|
|
|
-cells (Fig. 3
-cells contributed to an increased DNA synthesis in islets from Ins1-/-, Ins2-/- mice at E18.5 (Table 3
- or ß-cells was calculated, and was found to remain unchanged in Ins1-/-, Ins2-/- mice with relative islet cell hyperplasia (Table 4
|
|
|
|
|
|
|
|
| Discussion |
|---|
|
|
|---|
Because IGF-II is a potent stimulus to islet cell proliferation and prevents islet cell apoptosis in vivo (3), a logical hypothesis was that an altered local expression of IGF-II was associated with the islet cell hyperplasia of the insulin-deficient mice. No changes were seen by RT-PCR in the abundance of IGF-II mRNA expression within whole pancreas, or in the abundance of mRNAs for the IR or IGF-I receptor (IGF-IR) receptor, or their common intracellular substrates, IRS-1 and -2. However, any changes in expression specific to the islets may have been diluted by extraction of the whole tissue. The interactions of members of the insulin family are complex due to alternate usage of the IR or IGF-IR (14). IGF-1 and IGF-II usually exert their mitogenic actions via the IGF-IR (15). IGF-II also binds to the IGF-IIR, that is believed to act as a degradation pathway for IGF-II (16). However, there is also evidence that the effects of IGF-II may be mediated by the IR. Firstly, Igf-II-/-, Igf1r-/- mice display a more severe dwarfism than IgfIr -/- mice, suggesting that IGF-II interacts with an additional receptor (17). Genetic analysis of different mutants suggest that this receptor could be the IR (18). Secondly, in IgfIr-/- mouse fibroblasts transfected with human IR, IGF-II stimulates cell proliferation through the insulin receptor (19). Thirdly, there are two isoforms of the IR (IR-A and IR-B) in human and rodents, resulting from a different splicing of exon 11 (14, 20, 21). IR-A, but not IR-B, was found to bind IGF-II with an affinity close to that of insulin (14). These data suggest that IGF-II could, perhaps compensate for the absence of insulin in the insulin knock-out mice by binding and activation of the IR or IGF-IR, resulting in hyperplasia of the pancreatic islets. We cannot exclude any altered regulation of IGF-II at a posttranscriptional level in these studies.
Complete disruption of IRS-2 in mice carrying an heterozygous mutation for the IGF-IR (Irs-2-/-, Igf1r+/- mice) resulted in a severe absence of ß-cells in 4-wk-old animals (22). This phenotype was more pronounced than the 5060% reduction in ß-cells observed in islets of Irs2-/- mice (22). The analysis of Igf1r+/- and Igf1r+/-, Irs2+/- mice revealed also a reduction of 3050% in the islet area of insulin-positive cells, which was less severe than that in Igf1r+/-, Irs2-/- animals. These observations suggest that the IGF-IR and IRS-2 signaling pathway is critical for ß-cell development. Interestingly, mice carrying a null mutation of IRS-1 and heterozygous mutation for IRS-2 (Irs1-/-, Irs2+/-) displayed insulin resistance associated with normal islet morphology but a 2-fold increase of the ß-cell area at 4 wk or 4 months of age (22). These data suggest that IRS-1 is not necessary for the maintenance of the ß-cell mass, but that IRS-2 is crucial for a compensatory effect of the insulin resistance, causing islet hyperplasia. In the insulin-deficient animals studied here, it is likely that any compensation by an IGF leading to increased islet size would use the IGF-IR/IRS-2 pathway.
Alternatively, islet cell hyperplasia may have been driven in the absence of insulin by an increased expression of other growth factors known to be mitogenic for islet cells, such as fibroblast growth factors of hepatocyte growth factor (23, 24). However, the actions of these factors involves an increase in the number of islets through increased endocrine cell neogenesis within the pancreatic ductal tissue. This would involve both an increased mitogenic activity in the ductal epithelium, and an increased incidence of cells expressing the lineage-determining transcription factor, Pdx-1, neither of which were seen in the insulin-deficient mice. This demonstrates that Pdx-1 presence is not dependent on the presence of insulin gene expression, although Pdx-1 also functions as a regulator of insulin gene expression.
The vascularization of the pancreas, and particularly of the islets, was dramatically increased in the pancreas of the Ins1-/-, Ins2-/- mice compared with Ins1-/-, Ins2+/- controls. We hypothesize that the higher number of capillaries may influence cell proliferation and apoptosis within the islets, as shown to occur in tumors (25). Folkman et al. (26) found that transgenic mice expressing an oncogene within the ß-cells that recapitulated a progression from normality to hyperplasia, to neoplasia showed a pronounced angiogenic response. Vascularization can decrease apoptosis in pancreatic tumors and is a potential mechanism contributing to islet growth in the insulin-deficient mice. Dahri et al. (27) found a simultaneous reduction of cell proliferation, islet size, islet vascularization, and insulin content in rat fetuses at E21.5, where the pregnant mothers were subjected to a low protein diet, also supporting a direct relationship between the degree of vascularization in the pancreas and islet cell proliferation and apoptosis. Among factors that control the formation of the blood vessels are VEGF and its receptor Flk-1, but no modification of the expression of these factors was detected in the pancreas of the insulin-deficient mice. However, because of the low amounts of RNA extractable from the pancreas of insulin-deficient mice, and the low availability of animal numbers, the only practical analysis available was by RT-PCR, which is relatively insensitive as a method of quantification. The mechanism underlying increased blood vessel density therefore remains unknown.
We conclude that the insulin-deficient mouse displayed a relative pancreatic islet cell hyperplasia in late fetal life due to increased cell proliferation and a reduced apoptosis, and that this was associated with increased vascularization. Thus, insulin may normally act as a negative regulator of ß-cell mass within the developing pancreas to maintain equilibrium between insulin production and insulin demand within the growing fetus and neonate.
| Acknowledgments |
|---|
| Footnotes |
|---|
1 Present address: U457 Institut National de la Santé et de la Recherche Médicale, Hôpital R. Debré, 48 Bd Serrurier, 75019 Paris, France. ![]()
Abbreviations: DAB, Diaminobenzidine; E18.5, embryonic d 18.5; IR, insulin receptor; IRS, insulin receptor substrate; PCNA, proliferating cell nuclear antigen; VEGF, vascular endothelial growth factor.
Received September 7, 2001.
Accepted for publication December 20, 2001.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
M. M. Sachdeva and D. A. Stoffers Minireview: Meeting the Demand for Insulin: Molecular Mechanisms of Adaptive Postnatal ss-Cell Mass Expansion Mol. Endocrinol., June 1, 2009; 23(6): 747 - 758. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. V. Chakravarthy, Y. Zhu, M. B. Wice, T. Coleman, K. L. Pappan, C. A. Marshall, M. L. McDaniel, and C. F. Semenkovich Decreased Fetal Size Is Associated With {beta}-Cell Hyperfunction in Early Life and Failure With Age Diabetes, October 1, 2008; 57(10): 2698 - 2707. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Beith, E. U. Alejandro, and J. D. Johnson Insulin Stimulates Primary {beta}-Cell Proliferation via Raf-1 Kinase Endocrinology, May 1, 2008; 149(5): 2251 - 2260. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Okada, C. W. Liew, J. Hu, C. Hinault, M. D. Michael, J. Krtzfeldt, C. Yin, M. Holzenberger, M. Stoffel, and R. N. Kulkarni From the Cover: Insulin receptors in beta-cells are critical for islet compensatory growth response to insulin resistance PNAS, May 22, 2007; 104(21): 8977 - 8982. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. E. Gleason, D. N. Gross, and M. J. Birnbaum When the usual insulin is just not enough PNAS, May 22, 2007; 104(21): 8681 - 8682. [Full Text] [PDF] |
||||
![]() |
N. Herbach, B. Rathkolb, E. Kemter, L. Pichl, M. Klaften, M. H. de Angelis, P. A. Halban, E. Wolf, B. Aigner, and R. Wanke Dominant-Negative Effects of a Novel Mutated Ins2 Allele Causes Early-Onset Diabetes and Severe {beta}-Cell Loss in Munich Ins2C95S Mutant Mice Diabetes, May 1, 2007; 56(5): 1268 - 1276. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. M. Vuguin, M. H. Kedees, L. Cui, Y. Guz, R. W. Gelling, M. Nejathaim, M. J. Charron, and G. Teitelman Ablation of the Glucagon Receptor Gene Increases Fetal Lethality and Produces Alterations in Islet Development and Maturation Endocrinology, September 1, 2006; 147(9): 3995 - 4006. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. S. Narang and R. I. Mahato Biological and biomaterial approaches for improved islet transplantation. Pharmacol. Rev., June 1, 2006; 58(2): 194 - 243. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Daimon, G. Ji, T. Oizumi, T. Kido, M. Baba, Y. Jimbu, W. Kameda, S. Susa, H. Yamaguchi, H. Ohnuma, et al. Association of Nephrin Gene Polymorphisms With Type 2 Diabetes in a Japanese Population: The Funagata Study Diabetes Care, May 1, 2006; 29(5): 1117 - 1119. [Full Text] [PDF] |
||||
![]() |
M. Johansson, G. Mattsson, A. Andersson, L. Jansson, and P.-O. Carlsson Islet Endothelial Cells and Pancreatic {beta}-Cell Proliferation: Studies in Vitro and during Pregnancy in Adult Rats Endocrinology, May 1, 2006; 147(5): 2315 - 2324. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Ejrnaes, N. Videbaek, U. Christen, A. Cooke, B. K. Michelsen, and M. von Herrath Different Diabetogenic Potential of Autoaggressive CD8+ Clones Associated with IFN-{gamma}-Inducible Protein 10 (CXC Chemokine Ligand 10) Production but Not Cytokine Expression, Cytolytic Activity, or Homing Characteristics J. Immunol., March 1, 2005; 174(5): 2746 - 2755. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. K. Treutelaar, J. M. Skidmore, C. L. Dias-Leme, M. Hara, L. Zhang, D. Simeone, D. M. Martin, and C. F. Burant Nestin-Lineage Cells Contribute to the Microvasculature but Not Endocrine Cells of the Islet Diabetes, October 1, 2003; 52(10): 2503 - 2512. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Vincent, Y. Guz, M. Rozenberg, G. Webb, M. Furuta, D. Steiner, and G. Teitelman Abrogation of Protein Convertase 2 Activity Results in Delayed Islet Cell Differentiation and Maturation, Increased {alpha}-Cell Proliferation, and Islet Neogenesis Endocrinology, September 1, 2003; 144(9): 4061 - 4069. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |