help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tsubaki, J.
Right arrow Articles by Rosenfeld, R. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tsubaki, J.
Right arrow Articles by Rosenfeld, R. G.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Medline Plus Health Information
*Prostate Cancer
Endocrinology Vol. 143, No. 5 1778-1788
Copyright © 2002 by The Endocrine Society


GROWTH FACTORS-CYTOKINES-ONCOGENES

Differential Activation of the IGF Binding Protein-3 Promoter by Butyrate in Prostate Cancer Cells

Junko Tsubaki, Vivian Hwa, Stephen M. Twigg and Ron G. Rosenfeld

Department of Pediatrics (J.T., V.H., R.G.R.), Oregon Health Sciences University, Portland, Oregon 97201; and Kolling Institute of Medical Research (S.M.T.), University of Sydney, Royal North Shore Hospital, Sydney, New South Wales 2065, Australia

Address all correspondence and requests for reprints to: Vivian Hwa, Department of Pediatrics, School of Medicine NRC5, Oregon Health Sciences University, 3181 Southwest Sam Jackson Park Road, Portland, Oregon 97201-3402.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Sodium butyrate (NaB), a dietary micronutrient, is a potent growth inhibitor that initiates cell differentiation in many cell types, including prostate cancer cells. The molecular mechanisms by which these effects occur remain largely unknown. In this study, we investigated the effects of NaB on the expression of IGF binding protein (IGFBP)-3, a known growth regulator, in two human prostate cancer cell lines (PC-3 and LNCaP).

Treatment with NaB (0–10 mM) caused a dose-dependent stimulation of IGFBP-3 mRNA expression and parallel increases in protein levels. A specific histone deacetylase inhibitor, trichostatin A (TSA) similarly induced IGFBP-3 expression, indicating that histone hyperacetylation may be critical in the regulation of IGFBP-3 expression.

To investigate the molecular mechanism of NaB-regulated IGFBP-3 expression, 1.87 kb of the human IGFBP-3 gene promoter was cloned into the pGL2-basic luciferase reporter vector. In both PC-3 and LNCaP cells, NaB (10 mM) significantly increased luciferase activity 20- to 30-fold, compared with the untreated control. However, using 5' sequential deletion constructs of the IGFBP-3 promoter, the NaB response sequences in the IGFBP-3 promoter were different in PC-3 and LNCaP cells. Our studies identified a region, -75 to +69 from the start of transcription (+1), that is fully inducible by NaB treatment in LNCaP cells, but not in PC-3 cells. Unlike other well characterized NaB-regulated genes, Sp1 DNA sequences are not involved in NaB up-regulation of IGFBP-3 gene in LNCaP cells. Further deletion studies identified two independent regions critical for NaB-induced transactivation in LNCaP cells. These regions contain consensus binding sites for p53 and GATA, respectively, but mutational analyses and gel shift assays suggested that, while the p53 response element is required for NaB responsiveness, neither p53 nor GATA are involved.

In summary, we have demonstrated that 1) NaB significantly up-regulates IGFBP-3 mRNA and protein levels in PC-3 and LNCaP prostate cancer cells; and 2) novel butyrate- responsive elements lacking consensus Sp1 sites are used in LNCaP cells.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
BUTYRATE IS A short-chain fatty acid produced by microbial fermentation of dietary fiber and starch (1). It affects many physiological processes in cultured mammalian cells. In prostate cancer cells, as in other cell systems, induction of differentiation, growth arrest, and apoptosis in response to butyrate have been reported (2, 3, 4). Sodium butyrate (NaB) globally suppresses deacetylation of histones (5), resulting in histone hyperacetylation. Many genes are thus transcriptionally regulated by NaB, as well as by other histone deacetylase (HDAC) inhibitors (6, 7, 8, 9), including trichostatin A (TSA). An increasing number of genes that are regulated by hyperacetylation, are being described (6, 9, 10, 11, 12, 13, 14).

We have recently reported that IGF binding protein (IGFBP)-3 mRNA and protein levels are up-regulated by NaB in breast cancer cells (15). IGFBP-3 is a well characterized modulator of the actions of IGFs (16). In prostate cancer PC-3 cells, IGFBP-3 also mediates TGF-ß1-induced apoptosis, independently of the IGF signaling system (17). Although the IGFBP-3 gene and promoter have been cloned and characterized in human (18), rat (19), and bovine (20) species, limited information is known regarding functional response elements within the promoter regions. A recent study of a 1.87-kb human IGFBP-3 promoter in breast cancer cells showed a Sp1 site, upstream of the TATA box, as a critical NaB-response element (21). Sp1 sites are responsible for NaB- and other HDAC inhibitor-induced activation of the p21Waf1/Cip1 gene in colon cancer cells (22), osteosarcoma cells (23), breast cancer cells (24), human embryonic epithelial cells (25), and NIH3T3 cells (26).

In this study, we have investigated the effects of NaB on IGFBP-3 expression in the prostate cancer cell lines, PC-3 and LNCaP. We report here that NaB transcriptionally up- regulates IGFBP-3, working through several response elements within the promoter, in a cell line-dependent manner. Furthermore, we have identified novel NaB response elements, lacking consensus Sp1 sites, that are used in LNCaP cells.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Materials
Sodium butyrate, trichostatin A, and BSA were purchased from Sigma (St. Louis, MO). [125I]-labeled IGF-I and monoclonal antibody against IGFBP-3 were kindly provided by Diagnostics Systems Laboratories, Inc. (Webster, TX). Polyclonal antibodies against acetylated histone H3 and acetylated histone H4 were purchased from Upstate Biotechnology, Inc. (Lake Placid, NY). Monoclonal antibodies against p21Waf1/Cip1 and p53 (DO-1) were purchased from Calbiochem (Cambridge, MA) and Santa Cruz Biotechnology, Inc. (Santa Cruz, CA), respectively. Monoclonal antibody against p53 (clone 421) for gel shifts was a generous gift from Dr. H. Lu (Department Biochemistry and Molecular Biology, Oregon Health Sciences University, Portland, OR).

Cell culture
PC-3 androgen-nonresponsive human prostate cancer cells and LNCaP androgen-responsive human prostate cancer cells were purchased from ATCC (Manassas, VA). Both cell lines were maintained in Roswell Park Memorial Institute (RPMI) medium 1640 supplemented with 2.0 g/liter glucose, 300 mg/liter L-glutamine (Life Technologies, Inc., Gaithersburg, MD), and 10% FBS.

Preparation of conditioned media (CM) and cell lysates (CL)
Cells were seeded in 12-well plates. At 90% confluency, they were incubated for 12 h in serum-free RPMI, then treated as indicated in serum-free media. CM samples were collected after 72 h and centrifuged at 1000 x g for 10 min. The harvested CM from duplicate wells within each experiment were pooled and stored at -20 C. Proteins in 40 µl of CM per lane were analyzed by Western immunoblot or Western ligand blot under nonreducing conditions.

CL samples were harvested at 24 h post treatment by washing with PBS, and then lysing with 150 µl of cold RIPA lysis buffer (20 mM Tris, pH 8.0, 150 mM NaCl, 1% IGEPAL, 0.5% sodium deoxycholate, 0.1% SDS) plus a cocktail of protease inhibitors (Roche Molecular Biochemicals, Mannheim, Germany). Plates were rocked for 30 min at 4 C, and the lysates were collected and centrifuged at 10,000 x g for 10 min at 4 C. The lysates from duplicate wells within each experiment were pooled and stored at -20 C. Total protein concentration was determined for each sample using the DC Protein Assay Reagent (Bio-Rad Laboratories, Inc., Hercules, CA), and 20 µg of total protein per sample were examined by Western immunoblot under reducing conditions.

Western immunoblot and ligand blot analysis
For acetylated histone H3 and H4, and p21Waf1/Cip1 detection, CL samples were size-fractionated by SDS-PAGE under reducing conditions and electroblotted onto nitrocellulose filters (Hybond, Amersham Pharmacia Biotech, Piscataway, NJ). Filters were blocked with 5% nonfat dry milk/TBS-T for 1 h at room temperature, then incubated in a primary antibody at 4 C overnight. The appropriate secondary antibody was added, and immunoreactive proteins were detected using enhanced chemiluminescence (NEN Life Science Products, Boston, MA).

CM samples were separated on nonreducing 12% SDS-PAGE, and IGFBP-3 was analyzed by Western immunoblot or by Western ligand blot. For the ligand blot, filters were washed in 3% IGEPAL for 30 min, blocked with 1% BSA/TBS-T (20 mM Tris-Cl, pH 7.6, 150 mM NaCl, 0.1% Tween-20) for 2 h, and then incubated overnight with 2.0 x 106 cpm of [125I]-labeled IGF-I. The membranes were washed, dried and exposed to film (BioMax MS, Eastman Kodak Co., Rochester, NY) for 12–18 h.

Total RNA isolation and Northern blot analysis
Cells were grown in six-well plates until 95% confluent, then incubated in serum-free media for 12 h, before treatment for 24 h in serum-free media as indicated. Total RNA was isolated from duplicate wells (RNeasy Kit; QIAGEN, Valencia, CA), and 5 µg (for p21Waf1/Cip1) or 10 µg (for IGFBP-3 in LNCaP) of total RNA per sample were separated on a 1% formaldehyde agarose gel and transferred to nylon membranes (GeneScreenPlus; NEN Life Science Products). Blots were hybridized at 65 C with full-length cDNA probes random-labeled with [32P]deoxy(d)CTP (Prime-It II; Stratagene, Cedar Creek, TX), washed and autoradiographed. Membranes were subsequently stripped in 0.1x SSC with 0.1% SDS at 95 C for 10 min, and hybridized with ß-actin probes as an internal control for equal loading.

Plasmids
A 1.87-kb human IGFBP-3 promoter-luciferase reporter construct pGL2(-1805/+69), and a series of deletion mutant constructs (see Figs. 3AGo and 4AGo) including pGL2(-1080/+69), pGL2(-722/+69), pGL2(-152/+69), pGL2(-120/+69), pGL2(-75/+69), pGL2(-10/+69) and pGL2(-62/-10), were generated as described previously (21). The transcription start site of the IGFBP-3 promoter, +1, is based on the sequence determined by Cubbage et al. (18). To generate pGL2(-45/+69), pGL2(-75/+69) was double digested with BglI and EcoRI, and the released fragment was subcloned into SmaI-EcoRI sites in the pGL2 basic vector. To generate pGL2(-75/-10), the SmaI site in the multiple cloning site of pGL2(-75/+69) was deleted, then double digested with BamHI and SmaI, and subcloned into pGL2 basic vector (BamHI and SmaI). The plasmid pGL2(-62/-10) was double digested with BglI and EcoRI, to generate pGL2(-45/-10), in the same procedure as pGL2(-45/+69).



View larger version (19K):
[in this window]
[in a new window]
 
Figure 3. Analysis of IGFBP-3 promoter activation by sodium butyrate or TSA. A, Schematic representation of 1.87 kb and deletion variants of the IGFBP-3 promoter-luciferase constructs. B, PC-3 and LNCaP cells were transiently transfected with the panel of IGFBP-3 promoter-luciferase reporter constructs, and luciferase activity was measured after 18 h treatment with 10 mM sodium butyrate or 1 µM TSA. Relative fold induction of luciferase activity ± SE is shown.

 


View larger version (17K):
[in this window]
[in a new window]
 
Figure 4. Localization of NaB response elements in the IGFBP-3 promoter functional in LNCaP cells. A, Schematic representation of further deletion variants of the IGFBP-3 promoter. The sequence of -75/+69 is presented as a reference, and the numbering was determined from the start of transcription indicated as +1. B, LNCaP cells were transiently transfected with each of the promoter-luciferase construct indicated in A, and luciferase activity (relative fold induction ± SE) was determined after 10-mM sodium butyrate treatment for 18 h.

 
Site-directed mutagenesis
Specific nucleotides in the -75/+69 sequence were mutated by using the QuikChange Mutagenesis kit (Stratagene, La Jolla, CA). Briefly, pairs of primers (-68/-39, CGCGCGTTCCGGGCGGTTGCCTGGGCCAC, designated as p53mut), (-10/+18, CGGGCCGCCCAGGGCCGAGCACTGCGGC, designated as GATAmut), (-18/+10, GGCGCGCCCGAACCCGCCCGCCAGATGCGAGC, designated as Mut.3) were used to mutate the putative p53-binding site (-57/-48, GGGCGTGTCC), the putative GATA-binding site (-2/+8, CCAGATGCGA), and the site adjacent (5') to the GATA response element, respectively. The plasmid pGL2(-75/+69) was used as a template to generate each mutant, which were designated as pGL2-p53mut, pGL2-GATAmut and pGL2-Mut.3, respectively. A double mutant (with p53mut and GATAmut), and then triple mutant, pGL2-triple (with p53mut, GATAmut and Mut.3), were subsequently generated.

Transfections and luciferase assay
PC-3 cells were plated onto 12-well plates. At 60% confluency, they were transfected for 24 h with 0.25 µg DNA/well of the relevant IGFBP-3 promoter-reporter construct and with 0.25 µl of TransIT-LT1 (Mirus, Madison, WI) per well. Cells were then washed with PBS, followed by treatment with or without 10 mM NaB, or with 1 µM TSA, in serum-free media for 18 h. LNCaP cells were plated in 6-well plates. At 60% confluency, they were transfected for 24 h with 1 µg DNA/well of plasmid and 2 µl of TransIT-Insecta (Mirus) per well, as for PC-3 cells. Luciferase activities in CL were measured using the Luciferase Assay System (Promega Corp., Madison, WI) and a luminometer (Wallac, Inc., Gaithersburg, MD), as recommended by the manufacturers. Luciferase activities were normalized by the amount of the protein in CL, using the Bradford protein assay method (Bio-Rad Laboratories, Inc.). Each experiment was performed in triplicate for PC-3 cells or in duplicate for LNCaP and repeated at least three times, independently.

Preparation of nuclear extracts
PC-3 cells and LNCaP cells were seeded in five 15-cm culture dishes for each treatment. At 80% confluency, they were incubated for 12 h in serum-free RPMI before treatment with 10 mM NaB, or with 1 µM adriamycin as indicated. At 18 h post treatment (NaB) or 4 h post treatment (adriamycin), cells were harvested with cold PBS and pooled. Pelleted cells were treated with 500 µl of ice-cold lysis buffer (10 mM HEPES [N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid, pH 7.9], 1.5 mM MgCl2, 10 mM KCl, 0.5 mM deoxythymidine; DTT) for 15 min. After centrifugation at 14,000 rpm for 20 sec, the supernatants were removed. The nuclei were washed once with the same volume of buffer, resuspended in 350 µl of extraction buffer [20 mM HEPES (pH 7.9), 25% glycerol, 420 mM NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 0.5 mM phenylmethylsulfonyl fluoride, 0.5 mM DTT], and rocked for 1 h at 4 C. After centrifugation for 30 min at 4 C, the supernatants were dialyzed against 1 liter of dialysis buffer [20 mM HEPES (pH 7.9), 20% glycerol, 100 mM KCl, 0.2 mM EDTA, 0.5 mM phenylmethylsulfonyl fluoride, 0.5 mM DTT] for 1 h at 4 C. After centrifugation for 20 sec at 4 C, recovered supernatants were snap frozen in liquid nitrogen and stored at -70 C. Protein concentration was determined by Bradford assay.

EMSA
The plasmid pGL2(-75/+69) was digested with SacI and HindIII to yield a 144-bp IGFBP-3 promoter fragment (-75/+69). For the p53 consensus sequence, annealed 5'-overhang oligonucleotides, designated as GLN-LTR (5'-AGATCCAGGACATGCCCGGGCAAGCCCAT-3') (27), were used. The underlined nucleotides represent the overhang added to GLN-LTR. The reaction mixtures (50 µl) contained 50 ng of oligonucleotides, 50 µCi of {alpha}[32P]dCTP, 2.5 U of Klenow fragment (Life Technologies, Inc.), and 4 µl of 5 mM 3dNTP mix (dGTP, dATP, and dTTP). The reactions were allowed to proceed for 30 min at 25 C, followed by addition of 4 µl of 5 mM dCTP. The labeled probe was purified by using a Sephadex G-50 column (Amersham Pharmacia Biotech). For EMSAs, the DNA-protein binding reaction was conducted in a total volume of 20 µl reaction mixture, including 2 µg of poly (deoxyinosine-deoxycytidine) (Sigma), 8 µg of nuclear protein extract, and DNA-binding buffer [50 mM Tris-HCl (pH 7.5), 100 mM NaCl, 10 mM ß-mercaptoethanol, 0.1 mM EDTA, 500 µg/ml of BSA]. In some cases, 100 ng of synthetic double-stranded oligomer or cold DNA fragments were added as unlabeled competitors. The mixtures were incubated on ice for 10 min without antibody or, where applicable, 20 min with antibody, then incubated for a further 25 min at room temperature in the presence of a labeled probe and resolved on a 4% native acrylamide gel (acrylamide:bis-acrylamide = 79:1) containing 3% glycerol. After the prerun at 110 V for 2 h in 0.5x Tris-borate-EDTA buffer, the loaded gel was run at 200 V, dried, and placed on film (BioMax MS, Eastman Kodak Co.).

Densitometric analysis
To quantify the relative induction after Northern blot analyses or Western blot analyses, densitometric measurement was performed by using a GS-700 Imaging Densitometer with MultiAnalyst software (Bio-Rad Laboratories, Inc.).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Butyrate (NaB) treatment causes histone hyperacetylation and up-regulation of p21Waf1/Cip1 mRNA and protein levels in PC-3 and LNCaP prostate cancer cells
NaB has been shown to induce acetylation of core histones H3 and H4 in human mammary epithelial cell systems (15). We first studied whether similar inductions occurred in PC-3 and LNCaP prostate cancer cells. CL at 24 h post treatment showed distinct acetylation of histone H3 and H4 with 5- and 10-mM NaB treatments, detectable by successive Western immunoblots with antiacetylated histone H3 antibody and antiacetylated histone H4 antibody (Fig. 1AGo).



View larger version (49K):
[in this window]
[in a new window]
 
Figure 1. Effect of sodium butyrate on histone acetylation and p21Waf1/Cip1 expression. Serum-starved cells were treated with indicated concentrations of sodium butyrate. For Western immunoblots, CL were harvested at 24 h post treatment, and 20 µg of protein per lane were loaded onto 15% SDS-PAGE under reducing conditions. For Northern blots, total RNA was harvested at 18 h post treatment, and 5 µg per lane were electrophoresed. The membrane was probed with labeled full-length cDNA fragments for p21Waf1/Cip1. The same membrane was probed with labeled ß-actin, as an indicator of equal loading. A, Representative Western immunoblots with antibodies to acetylated histone H3 and H4. B, Representative Northern blots and Western immunoblots of p21Waf1/Cip1 expression. The data shown are representative of two independent experiments.

 
As the p21Waf1/Cip1 is known to be transcriptionally regulated by butyrate (11), we next investigated its mRNA and protein induction in PC-3 and LNCaP cells. A pronounced up-regulation of p21Waf1/Cip1 mRNA (12.1-fold increase at 10 mM NaB) with a concomitant increase in detectable protein was observed in PC-3 cells (Fig. 1BGo). In LNCaP cells, p21 was more modestly regulated by NaB (1.6-fold increase in mRNA levels at 10 mM NaB) (Fig. 1BGo). When cell numbers (PC-3 and LNCaP cells) were counted 24 h post treatment (10 mM NaB), the number of attached cells was unchanged when compared with the respective control (untreated cells) (data not shown), a finding that parallels our previous observations in breast cancer cells (15).

Butyrate up-regulates IGFBP-3 mRNA and protein levels in PC-3 and LNCaP cells
Butyrate is known to exert apoptotic effects in prostate cancer cells (2, 4). Because IGFBP-3 is proapoptotic (17, 28), we hypothesized that butyrate would up-regulate IGFBP-3 expression in prostate cancer cells, similar to our previous observations in breast cancer cells (15). The regulation of IGFBP-3 by butyrate in PC-3 and LNCaP cells was determined by Northern blot analysis, using total RNA harvested at 18 h post treatment. As shown in Fig. 2AGo, NaB induced the expression of IGFBP-3 mRNA in a dose-dependent manner, with a 2.9-fold increase at 5 mM NaB and a 3.8-fold increase at 10 mM NaB in PC-3 cells. In LNCaP cells, 5 mM and 10 mM NaB treatments induced a 6.5-fold increase and a 13.1-fold increase, respectively. As the basal level of IGFBP-3 in LNCaP cells was nearly undetectable, the induction of IGFBP-3 expression by NaB was more conspicuous in this cell line. Furthermore, TSA, a specific histone deacetylase inhibitor, also up-regulated IGFBP-3 mRNA levels, suggesting that among the pleiotropic effects of NaB, histone hyperacetylation may be critical for the regulation of IGFBP-3 in prostate cancer cells.



View larger version (60K):
[in this window]
[in a new window]
 
Figure 2. Regulation of IGFBP-3 by sodium butyrate and TSA. A, Representative Northern blots of the dose-dependent effect of sodium butyrate and TSA on the expression of IGFBP-3 mRNA. Serum-starved cells were treated for 18 h with various concentrations of sodium butyrate or TSA as indicated. Total RNA was harvested, and 5 µg (PC-3) or 10 µg (LNCaP) per lane were electrophoresed. The membrane was probed with labeled full-length cDNA fragments for IGFBP-3. The membrane was also probed with labeled ß-actin, as an indicator of equal loading. The data shown are representative of at least three separate experiments. B, Representative Western ligand blot of the time-dependent effect of sodium butyrate. Serum-starved PC-3 cells were treated with the indicated concentrations of sodium butyrate over 72 h. Western ligand blotting was done as indicated in Materials and Methods. C, Representative Western immunoblots with anti-IGFBP-3 monoclonal antibody. Dose-effects of sodium butyrate at 72 h post treatment in PC-3 and LNCaP cells are shown. The data shown were derived from at least three independent experiments.

 
The CM were then examined for changes in IGFBP-3 protein levels after NaB treatment. CM from PC-3 cells were collected 24 h, 48 h, and 72 h post treatment, and the presence of IGFBP-3 was analyzed by Western ligand blots. IGFBP-3 levels were increased at 24 h, after 5-mM NaB treatment, and were maximal 72 h following NaB treatment (Fig. 2BGo). Treatment with 1 mM NaB had no apparent effect on IGFBP-3 protein levels.

CM (72 h post treatment) from PC-3 and LNCaP cells were further analyzed by Western immunoblot (Fig. 2CGo). In PC-3 cells, up-regulation of IGFBP-3 was confirmed by immunoblot analysis. In addition, low molecular weight fragments of IGFBP-3 were also increased by NaB (data not shown). The increase in intact IGFBP-3 after treating cells with 5 mM and 10 mM NaB for 72 h was 3.9 fold and 5.6 fold, respectively. In LNCaP cells, intact IGFBP-3 was up-regulated in a dose- dependent manner (with a 4.4-fold increase at 5-mM treatment and a 13.5-fold increase at 10-mM treatment). IGFBP-3 fragments were not detected in the CM of LNCaP cells (data not shown).

LNCaP and PC-3 cells use different butyrate-responsive regions in the IGFBP-3 promoter
To investigate the molecular mechanisms underlying the effect of butyrate on IGFBP-3 gene expression, we employed the luciferase gene expression system. The human IGFBP-3 gene, 1.87 kb of promoter region, was cloned into the pGL2-basic luciferase reporter vector (designated pGL2(-1805/+69)), and luciferase activity was assayed after 18 h of NaB or TSA treatment, as described in Materials and Methods. Concentrations of NaB were titrated, and the greatest fold induction (26.5 ± 4.2 SE fold in PC-3 cells, and 25.8 ± 5.1 SE fold in LNCaP cells) was achieved after 10-mM NaB treatment (data not shown). All subsequent treatments were with 10 mM NaB or 1 µM TSA.

To determine the butyrate-responsive elements in PC-3 and LNCaP cells, 5' sequential deletions of the IGFBP-3 promoter (Fig. 3AGo) were tested. As shown in Fig. 3BGo, the NaB response regions in the IGFBP-3 promoter were different in PC-3 and LNCaP cells. Our studies identified a region (-75 to +69 from the transcription start site (designated pGL2(-75/+69), Fig. 3AGo), that retained near full luciferase activity (40.0 ± 4.5 SE fold) in LNCaP cells, while in PC-3 cells, only basal levels of activity were detected after NaB treatment. In the breast cancer system, it has been recently shown that the Sp1 site mediated the butyrate-induced transactivation of the IGFBP-3 gene (21). We speculate that the same Sp1 response element is used in PC-3 cells for butyrate-induced transactivation of the IGFBP-3 gene. The subsequent focus of this work, therefore, involved the identification of NaB- responsive regions functioning in LNCaP cells.

Identification of two separate regions critical for full promoter activation by NaB in LNCaP cells
To localize the NaB-responsive elements in LNCaP cells, additional deletion mutants, as shown in Fig. 4AGo, were generated. Compared with pGL2(-75/+69), NaB-induced luciferase activity was reduced by 50% in the pGL2(-45/+69) deletion construct which lacked 30 bp from the 5' end (Fig. 4BGo). This suggested that a critical region for responsiveness to NaB exists within (-75/-46). A further deletion, which removed the TATA box [pGL2(-10/+69)], abrogated activation of luciferase activity (Fig. 4BGo). The deletion construct, pGL2(-75/-10), carrying the intact TATA box and all the 5' sequences of -75/+69, resulted in activity similar to that observed for pGL2(-45/+69). Results from two sequential deletion constructs, pGL2(-62/-10) and pGL2(-45/-10), suggested that one critical response element is located within (-62/-45). Sequence analysis (TRANSFAC motif search, at 85% stringency, GenomeNet) (29) indicated a putative p53 response element within the region (-62/-45). A putative GATA response element that overlaps with the transcription start site (see Fig. 4AGo) was also identified.

The putative p53 site, but not the putataive GATA site, is required for NaB-induced transactivation in LNCaP cells
The two putative transcription factor binding sites (putative p53 response element and GATA response element) were further investigated for their involvement in NaB- induced IGFBP-3 promoter activation. The p53 site, the GATA site, and nucleotides immediately adjacent to the GATA site, were mutated by site-directed mutagenesis, using oligomers as shown in Fig. 5AGo (p53mut, GATAmut, and Mut.3 respectively). Luciferase assays in LNCaP cells showed that mutagenesis of the putative p53 site within the -75/69 construct (pGL2-p53mut) reduced luciferase gene activation by NaB to approximately 50% of that of pGL2(-75/+69), whereas mutations within the putative GATA site (pGL2-GATAmut) and Mut.3 (pGL2-Mut.3) did not alter NaB-induced transactivation (Fig. 5BGo). In addition, the pGL2-p53mut/GATAmut/Mut.3 showed activity similar to that of the pGL2-p53mut. These results indicate that the putative p53 response element is important for NaB-induced transactivation, whereas the GATA response element is not.



View larger version (22K):
[in this window]
[in a new window]
 
Figure 5. Mutational analysis of the -75/+69 IGFBP-3 promoter region in LNCaP cells. A, Schematic representation of each oligomer containing mutations (*). These oligomers were used to create each mutant within pGL2(-75/+69) as described in Materials and Methods. B, Mutant constructs were transiently transfected into LNCaP cells, and 10 mM butyrate-induced luciferase activities (relative fold induction ± SE) were determined.

 
Competitive EMSAs demonstrate that the putative p53 sequence binds transcription factors
To determine if nuclear proteins from NaB-treated LNCaP cells can interact with the butyrate-responsive element, EMSAs were performed using the 144-bp promoter fragment from pGL2(-75/+69) as a probe (Fig. 6Go). Several bands corresponding to DNA-protein complexes were observed (Fig. 6BGo). Nuclear extracts from untreated LNCaP cells gave identical profiles. Interestingly, nuclear extracts from PC-3 cells also gave the same gel-shift profiles.



View larger version (63K):
[in this window]
[in a new window]
 
Figure 6. Competitive EMSAs. A, A series of synthetic double-strand DNA fragments were used as competitors. No. 1: -75/(-59 (17 bp); no. 2: -60/(-41 (20 bp); no. 3: -12/+7 (19 bp); no. 4: +13/+30 (18 bp); TATA: -36/(-10 (27 bp). B, EMSAs were performed using 32P-labeled -75/+69 fragment (144 bp) incubated with nuclear extracts isolated from LNCaP cells or PC-3 cells treated (+) or untreated (-) with 10 mM butyrate. Excess amounts of the unlabeled -75/+69 fragments were also used as a competitor. C, Competitive EMSA using nuclear extracts of LNCaP cells. The mutated p53 oligomer (p53mut) or mutated GATA oligomer (GATAmut), shown in Fig. 5AGo, was employed as a competitor. The results are representative of three independent experiments.

 
The specificity of these complexes was confirmed by competition, using a 100-fold excess amount of unlabeled -75/+69 fragments (Fig. 6BGo). On the same gel, five additional DNA oligomers that corresponded to sequences within the -75/+69 fragment, were used as unlabeled competitors to identify specific DNA sequences that interacted with nuclear proteins. Like the -75/+69 fragment, fragment no. 2, which included the putative p53 response element, efficiently competed for binding. Fragment no. 3, which corresponded to the putative GATA element, showed partial competition. The remaining oligomers— fragment no. 1, TATA, no. 4 could not effectively compete, suggesting that the regions corresponding to no. 2 and no. 3 were both capable of binding nuclear protein. This was supported by competitive EMSAs in which unlabeled p53mut and GATAmut oligomers (Fig. 5AGo) were employed as competitors (Fig. 6CGo). These mutated oligomers were inefficient competitors. The same pattern of DNA-protein binding complexes was detected with nuclear extracts prepared from both PC-3 and LNCaP cells. Moreover, treatment with NaB (10 mM) for 18 h altered neither the mobility pattern nor intensity. These results suggest that a mechanism(s) other than alterations in DNA binding activity is responsible for NaB-mediated transcriptional activation, and for the observed differences in transcriptional activities in PC-3 and LNCaP cells.

Role of p53 protein
As the region containing a putative p53 response element (-57/-48) is partially responsible for NaB-induced transactivation in LNCaP cells, we then determined whether p53 could be involved. LNCaP cells are reported to carry wild-type p53 (30), and we confirmed this by demonstrating that 1 µM adriamycin increased p53 protein levels in a time-dependent manner (0–4 h) (Fig. 7AGo). In contrast, treatment with 10 mM NaB for up to 6 h did not alter p53 protein expression. Interestingly, longer treatment with NaB (12–24 h) actually resulted in down-regulation of p53 expression (Fig. 7AGo).



View larger version (43K):
[in this window]
[in a new window]
 
Figure 7. The p53 protein does not bind to the putative p53 response element in -75/+69 sequence. A, Western immunoblot showing that adriamycin, but not NaB, increases p53 protein levels in LNCaP cells. B, Representative EMSA with labeled -75/+69 fragment or GLN-LTR (see Materials and Methods) coincubated with nuclear extracts from LNCaP cells treated with either adriamycin (1 µM, 4 h) or NaB (10 mM, 18 h). Anti-p53 antibody (clone421) was included in the reaction mixture as indicated. Supershift of p53-GLN-LTR interaction is indicated by the arrow. Experiments were performed two independent times.

 
To further determine the role of p53 in NaB transcriptional regulation of IGFBP-3, EMSAs were performed using anti-p53 antibody (clone421). This antibody enhances DNA binding of the p53 protein and also results in supershifting of the DNA-protein complex (31). The previously published sequence GLN-LTR, which contains tandem copies of the p53 response element (27), was labeled and employed as a positive control. As shown in Fig. 7BGo, only nuclear extracts from 4 h adriamycin (1 µM)-treated LNCaP cells interacted with the labeled GLN-LTR oligomer, in the presence of the anti-p53 antibody. A faint band was detectable with nuclear extracts from untreated cells, but nuclear extracts from NaB-treated cells did not bind GLN-LTR. These results are consistent with our observations (Fig. 7AGo) that p53 is down-regulated 18 h post treatment with NaB (10 mM). Finally, using the -75/+69 fragment (144 bp) as a probe, EMSAs were performed in the presence or absence of anti-p53 antibody (clone421). As shown in Fig. 7BGo, no bands were supershifted in the presence of the antibody. Collectively, these data strongly suggested that the p53 protein is not involved in NaB-induced transactivation of the IGFBP-3 promoter in LNCaP cells.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In this study, we have shown that although butyrate transcriptionally up-regulates IGFBP-3 expression in both PC-3 and LNCaP prostate cancer cell lines, IGFBP-3 promoter studies demonstrate a striking difference in NaB-responsive elements that are used. We identified two novel regions critical for NaB-induced transactivation in LNCaP cells. One of these corresponds to a single copy of a putative p53 binding site, but the p53 protein itself was shown not to be involved.

Butyrate and related analogs have been reported to induce cell growth inhibition, differentiation, and apoptosis in various cell systems, including prostate cancer cells (2, 3, 4). Butyrate increases the expression of many of the genes involved in these processes, including p21Waf1/Cip1 (11), caspase-3 (32), and Bax (33). Butyrate is a well recognized global histone deacetylase inhibitor, although it is also capable of histone methylation (34, 35). More recently, butyrate and the more specific histone deacetylase inhibitor, TSA (36), have been shown to also up-regulate IGFBP-3 expression in hepatocellular carcinoma cells (37) and in breast cancer cells (15). We now show that in the human prostate cancer cell lines, PC-3 and LNCaP, IGFBP-3 expression is similarly up-regulated in a dose- and time-dependent manner by both butyrate and TSA. That TSA had a similar effect to NaB implicates the histone deacetylase inhibitory activity of NaB in the induction of IGFBP-3 expression. Considering that IGFBP-3 is proapoptotic (28) and that it mediates the effect of other growth inhibitory agents, such as retinoic acid (38), vitamin D (39), TGFß (17, 38), antiestrogens (40), TNF{alpha} (41), and p53 (42), it is not unexpected that butyrate also up-regulates IGFBP-3 expression.

The result of inhibiting histone deacetylases is histone hyperacetylation, which subsequently permits transcriptional regulation of genes such as p21Waf1/Cip1 (22), galectin-1 (43), G{alpha}i2 (44), and the mouse ferritin H (45) gene. Specific response elements, particularly Sp1 response elements, have been shown to be essential (23, 24) for the binding of multiprotein complexes that include Sp1, Sp3, the histone acetyltransferase p300/CBP, HDAC1, and ZBP-89 transcription factors (21, 46, 47). A recent study in breast cancer cells indicated that the Sp1 site within the IGFBP-3 promoter is critical in the regulation of IGFBP-3 by NaB (21). Our results suggest that, like the breast cancer cells, the same Sp1 site is most likely used for butyrate regulation of IGFBP-3 expression in PC-3 cells. However, in LNCaP cells, IGFBP-3 promoter-luciferase activity is still fully inducible in the absence of consensus Sp1 sites. Moreover, in LNCaP cells, butyrate induces p21Waf1/Cip1 mRNA up-regulation minimally, unlike in PC-3 cells, where a robust induction is seen. These results suggest that butyrate regulation of IGFBP-3 and p21Waf1/Cip1 genes in LNCaP cells does not appear to involve Sp1 response elements, and may reflect alterations in the multiprotein complexes necessary for transactivation through these sites. It is noted that Sp1 protein is detectable by immunoblot analysis in both PC-3 and LNCaP, and no regulation by NaB treatment was observed (data not shown).

Sequence analysis (TRANSFAC) of the 144 bp IGFBP-3 region (-75/+69 fragments) that confers wild-type NaB-inducible transactivation in LNCaP, identified putative binding sites for two transcription factors, p53 and GATA. The GATA family of transcription factors consists of six homologous members, which recognize the consensus DNA sequence 5'-(A/T)GATA(A/G)-3' (48). Among the GATA family members, a recent study showed that GATA-2 and -3 mRNA were predominantly expressed in human and mouse prostate, and that GATA-2 was significantly expressed in LNCaP cells (49). Butyrate-treated colon cancer cells studied with cDNA expression arrays showed significant induction of GATA-2 (50). However, in LNCaP cells, site-directed mutagenesis of the putative GATA site did not alter NaB- induced activation of the IGFBP-3 promoter. Although the putative GATA site did not appear to be transcriptionally active, nuclear proteins were shown to bind to this element by competitive EMSA. Further, the binding could not be competed with DNA sequences carrying mutations in the putative GATA site. These results indicate that, while nuclear proteins do bind to this site, the putative GATA site is not responsible for the observed effect of NaB on the IGFBP-3 promoter. The specific sequence(s) within -9 to +69 that is necessary for NaB-inducible promoter activity in LNCaP cells, remains to be further elucidated.

PC-3 cells are characterized by a p53-null mutation (51), whereas LNCaP cells carry wild-type p53 (30). Physical associations between p53 and HDACs have been reported, and TSA treatment is able to enhance p53 transactivation (52) or abrogate p53 transrepression (53), depending upon the targeted genes and cell type. The consensus binding site for p53 consists of two copies of the 10-bp motif 5'-PuPuPuC(A/T)(T/A)GPyPyPy-3', separated by 0–13 bp (54). IGFBP-3 is one of the p53-targeted genes (42), and, within the IGFBP-3 promoter region, there are 11 motifs corresponding to putative p53 binding sites (-722/-75, Fig. 3AGo) (55). However, our deletion studies excluded these regions as responsive to NaB- and TSA-treatment in both PC-3 and LNCaP cells. In contrast, although only a single copy of the putative p53 motif (-57/-48) is located within the (-75/+69 sequence, we showed by mutational analysis that this 10-bp sequence is critical for transactivation of the IGFBP-3 gene in LNCaP cells. Additionally, nuclear proteins can bind to this sequence.

The possible involvement of p53 in LNCaP cells was investigated. NaB treatment down-regulated p53 protein levels 6–24 h post treatment, consistent with previous reports in other cell systems (56, 57, 58), whereas adriamycin, as expected, up-regulated p53 protein expression. In gel-shift assays, nuclear extracts from adriamycin-treated LNCaP cells, but not from NaB-treated cells, interacted with the p53 consensus fragment GLN-LTR in the presence of the p53 antibody (clone421). This suggests that NaB does not activate p53. Further, with the -75/+69 fragment as a probe and NaB-treated nuclear extracts, addition of the p53 antibody (clone421) did not supershift protein-DNA complexes. The p53 protein, therefore, does not appear to be part of these complexes. Activated p53 in nuclear extracts from adriamycin-treated LNCaP also could not interact with the -75/+69 fragment (data not shown). Altogether, these results strongly suggest that p53 does not associate with the putative p53 site.

Because p53 is a member of a family of related transcription factors that includes p63 and p73 (59), other members of this family may be responsible for NaB responsiveness in LNCaP cells. Our preliminary data indicate that, by immunoblot analysis, p63, as reported previously (60), is not detectable in LNCaP cells and, although p73 was detected, there was no change in p73 protein levels following NaB treatment (data not shown). Further studies are necessary to elucidate the role(s), if any, of p73 in NaB-induced regulation of IGFBP-3. The interaction of transcription factors other than members of the p53 family with the same, or overlapping, sequences is equally probable.

While protein-DNA complexes were readily detectable in our EMSA studies, identical EMSA profiles were observed between control and NaB-induced conditions. These results indicated that the presence of nuclear proteins capable of binding DNA is not sufficient to mediate effects of NaB-induced IGFBP-3 promoter activity. We hypothesize that NaB may act predominantly through modification of acetylase/deacetylase activities of coactivators and/or corepressors, with minimal effects on DNA-protein interactions. However, it is still possible that NaB may, in vivo, be able to induce the formation of specific protein-DNA complexes capable of activating IGFBP-3 gene transcription.

The differential utilization of DNA sequences in response to butyrate may reflect alterations in available transcription factors between PC-3 and LNCaP cells. One important difference between these two cell lines is the status of the androgen receptor: PC-3 cells are androgen nonresponsive (61), whereas LNCaP cells are androgen responsive (62). Butyrate has been shown to cause ligand-independent activation of the AR to increase expression of PSA through binding to androgen response elements within the PSA gene promoter (63). However, the IGFBP-3 promoter pGL2(-75/+69) construct, which retained full promoter activity in LNCaP cells, does not contain consensus androgen response elements. This suggests that AR is unlikely to be involved in the transactivation of the IGFBP-3 promoter in LNCaP cells, although the possibility that AR might contribute some affects through nonclassical mechanism(s), cannot be ruled out.

In summary, at least three elements contribute to the effects of NaB on IGFBP-3 promoter activity: the Sp1 site and two novel NaB-response regions identified in this present study. One of the novel regions is located upstream of the TATA box, and corresponds to a single putative p53 response element. The other is located downstream of the TATA box, and its specific location remains to be delineated. In LNCaP cells, each of these two novel elements contribute partial promoter activity. Further studies are required to elucidate the critical transcription factors that are functional in LNCaP cells, which, ultimately, may lead to a better understanding of key modulators in prostate cancer progression.


    Acknowledgments
 
We thank Dr. H. Lu (Department of Biochemistry and Molecular Biology, Oregon Health Sciences University, Portland, OR) for kindly providing antibodies against p53 (clone421), p63 (Oncogene, Boston, MA) and p73, and technical suggestions for p53 experiments.


    Footnotes
 
This research was supported by NIH Grant CA-58110 and by U.S. Army Grant DAMD 17-00-1-0042.

Abbreviations: CL, Cell lysate; CM, conditioned media; d, deoxy; DTT, deoxythymidine; HDAC, histone deacetylase; IGFBP, IGF binding protein; NaB, sodium butyrate; RPMI, Roswell Park Memorial Institute; TSA, trichostatin A.

Received September 20, 2001.

Accepted for publication January 10, 2002.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Cummings JH, Pomare EW, Branch WJ, Naylor CP, Macfarlane GT 1987 Short chain fatty acids in human large intestine, portal, hepatic and venous blood. Gut 28:1221–1227[Abstract/Free Full Text]
  2. Carducci MA, Nelson JB, Chan-Tack KM, Ayyagari SR, Sweatt WH, Campbell PA, Nelson WG, Simons JW 1996 Phenylbutyrate induces apoptosis in human prostate cancer and is more potent than phenylacetate. Clin Cancer Res 2:379–387[Abstract/Free Full Text]
  3. Gleave ME, Sato N, Sadar M, Yago V, Bruchovsky N, Sullivan L 1998 Butyrate analogue, isobutyramide, inhibits tumor growth and time to androgen-independent progression in the human prostate LNCaP tumor model. J Cell Biochem 69:271–281[CrossRef][Medline]
  4. Maier S, Reich E, Martin R, Bachem M, Altug V, Hautmann RE, Gschwend JE 2000 Tributyrin induces differentiation, growth arrest and apoptosis in androgen-sensitive and androgen-resistant human prostate cancer cell lines. Int J Cancer 88:245–251[CrossRef][Medline]
  5. Candido EP, Reeves R, Davie JR 1978 Sodium butyrate inhibits histone deacetylation in cultured cells. Cell 14:105–113[CrossRef][Medline]
  6. Saito A, Yamashita T, Mariko Y, Nosaka Y, Tsuchiya K, Ando T, Suzuki T, Tsuruo T, Nakanishi O 1999 A synthetic inhibitor of histone deacetylase, MS-27–275, with marked in vivo antitumor activity against human tumors. Proc Natl Acad Sci USA 96:4592–4597[Abstract/Free Full Text]
  7. Kim YB, Lee KH, Sugita K, Yoshida M, Horinouchi S 1999 Oxamflatin is a novel antitumor compound that inhibits mammalian histone deacetylase. Oncogene 18:2461–2470[CrossRef][Medline]
  8. Han JW, Ahn SH, Park SH, Wang SY, Bae GU, Seo DW, Kwon HK, Hong S, Lee HY, Lee YW, Lee HW 2000 Apicidin, a histone deacetylase inhibitor, inhibits proliferation of tumor cells via induction of p21WAF1/Cip1 and gelsolin. Cancer Res 60:6068–6074[Abstract/Free Full Text]
  9. Richon VM, Sandhoff TW, Rifkind RA, Marks PA 2000 Histone deacetylase inhibitor selectively induces p21WAF1 expression and gene-associated histone acetylation. Proc Natl Acad Sci USA 97:10014–10019[Abstract/Free Full Text]
  10. McCaffrey PG, Newsome DA, Fibach E, Yoshida M, Su MS 1997 Induction of {gamma}-globin by histone deacetylase inhibitors. Blood 90:2075–2083[Abstract/Free Full Text]
  11. Archer SY, Meng S, Shei A, Hodin RA 1998 p21WAF1 is required for butyrate-mediated growth inhibition of human colon cancer cells. Proc Natl Acad Sci USA 95:6791–6796[Abstract/Free Full Text]
  12. Luciakova K, Hodny Z, Barath P, Nelson BD 2000 In vivo mapping of the human adenine nucleotide translocator-2 (ANT2) promoter provides support for regulation by a pair of proximal Sp1-activating sites and an upstream silencer element. Biochem J 352(Pt 2):519–523
  13. Lee BI, Park SH, Kim JW, Sausville EA, Kim HT, Nakanishi O, Trepel JB, Kim SJ 2001 MS-275, a histone deacetylase inhibitor, selectively induces transforming growth factor ß type II receptor expression in human breast cancer cells. Cancer Res 61:931–934[Abstract/Free Full Text]
  14. Kamitani H, Taniura S, Ikawa H, Watanabe T, Kelavkar UP, Eling TE 2001 Expression of 15-lipoxygenase-1 is regulated by histone acetylation in human colorectal carcinoma. Carcinogenesis 22:187–191[Abstract/Free Full Text]
  15. Tsubaki J, Choi WK, Ingermann AR, Twigg SM, Kim HS, Rosenfeld RG, Oh Y 2001 Effects of sodium butyrate on expression of members of the IGF-binding protein superfamily in human mammary epithelial cells. J Endocrinol 169:97–110[Abstract]
  16. Rajaram S, Baylink DJ, Mohan S 1997 Insulin-like growth factor-binding proteins in serum and other biological fluids: regulation and functions. Endocr Rev 18:801–831[Abstract/Free Full Text]
  17. Rajah R, Valentinis B, Cohen P 1997 Insulin-like growth factor (IGF)-binding protein-3 induces apoptosis and mediates the effects of transforming growth factor-ß1 on programmed cell death through a p53- and IGF-independent mechanism. J Biol Chem 272:12181–12188[Abstract/Free Full Text]
  18. Cubbage ML, Suwanichkul A, Powell DR 1990 Insulin-like growth factor binding protein-3. Organization of the human chromosomal gene and demonstration of promoter activity. J Biol Chem 265:12642–12649[Abstract/Free Full Text]
  19. Albiston AL, Saffery R, Herington AC 1995 Cloning and characterization of the promoter for the rat insulin-like growth factor-binding protein-3 gene. Endocrinology 136:696–704[Abstract]
  20. Erondu NE, Toland B, Boes M, Dake B, Moser DR, Bar RS 1997 Bovine insulin-like growth factor binding protein-3: organization of the chromosomal gene and functional analysis of its promoter. Endocrinology 138:2856–2862[Abstract/Free Full Text]
  21. Walker GE, Wilson EM, Powell D, Oh Y 2001 Butyrate, a histone deacetylase inhibitor, activates the human IGF binding protein-3 promoter in breast cancer cells: molecular mechanism involves an Sp1/Sp3 multiprotein complex. Endocrinology 142:3817–3827[Abstract/Free Full Text]
  22. Nakano K, Mizuno T, Sowa Y, Orita T, Yoshino T, Okuyama Y, Fujita T, Ohtani-Fujita N, Matsukawa Y, Tokino T, Yamagishi H, Oka T, Nomura H, Sakai T 1997 Butyrate activates the WAF1/Cip1 gene promoter through Sp1 sites in a p53-negative human colon cancer cell line. J Biol Chem 272:22199–22206[Abstract/Free Full Text]
  23. Sowa Y, Orita T, Minamikawa S, Nakano K, Mizuno T, Nomura H, Sakai T 1997 Histone deacetylase inhibitor activates the WAF1/Cip1 gene promoter through the Sp1 sites. Biochem Biophys Res Commun 241:142–150[CrossRef][Medline]
  24. Huang L, Sowa Y, Sakai T, Pardee AB 2000 Activation of the p21WAF1/CIP1 promoter independent of p53 by the histone deacetylase inhibitor suberoylanilide hydroxamic acid (SAHA) through the Sp1 sites. Oncogene 19:5712–5719[CrossRef][Medline]
  25. Wang CH, Tsao YP, Chen HJ, Chen HL, Wang HW, Chen SL 2000 Transcriptional repression of p21(Waf1/Cip1/Sdi1) gene by c-jun through Sp1 site. Biochem Biophys Res Commun 270:303–310[CrossRef][Medline]
  26. Xiao H, Hasegawa T, Isobe K 1999 Both Sp1 and Sp3 are responsible for p21waf1 promoter activity induced by histone deacetylase inhibitor in NIH3T3 cells. J Cell Biochem 73:291–302[CrossRef][Medline]
  27. Zauberman A, Barak Y, Ragimov N, Levy N, Oren M 1993 Sequence-specific DNA binding by p53: identification of target sites and lack of binding to p53-MDM2 complexes. EMBO J 12:2799–2808[Medline]
  28. Baxter RC 2001 Signalling pathways involved in antiproliferative effects of IGFBP-3: a review. Mol Pathol 54:145–148[Abstract/Free Full Text]
  29. Wingender E, Chen X, Hehl R, Karas H, Liebich I, Matys V, Meinhardt T, Pruss M, Reuter I, Schacherer F 2000 TRANSFAC: an integrated system for gene expression regulation. Nucleic Acids Res 28:316–319[Abstract/Free Full Text]
  30. Isaacs WB, Carter BS, Ewing CM 1991 Wild-type p53 suppresses growth of human prostate cancer cells containing mutant p53 alleles. Cancer Res 51:4716–4720[Abstract/Free Full Text]
  31. Siegel J, Fritsche M, Mai S, Brandner G, Hess RD 1995 Enhanced p53 activity and accumulation in response to DNA damage upon DNA transfection. Oncogene 11:1363–1370[Medline]
  32. Medina V, Edmonds B, Young GP, James R, Appleton S, Zalewski PD 1997 Induction of caspase-3 protease activity and apoptosis by butyrate and trichostatin A (inhibitors of histone deacetylase): dependence on protein synthesis and synergy with a mitochondrial/cytochrome c-dependent pathway. Cancer Res 57:3697–3707[Abstract/Free Full Text]
  33. Mandal M, Olson DJ, Sharma T, Vadlamudi RK, Kumar R 2001 Butyric acid induces apoptosis by up-regulating Bax expression via stimulation of the c-Jun N-terminal kinase/activation protein-1 pathway in human colon cancer cells. Gastroenterology 120:71–78[CrossRef][Medline]
  34. de Haan JB, Gevers W, Parker MI 1986 Effects of sodium butyrate on the synthesis and methylation of DNA in normal cells and their transformed counterparts. Cancer Res 46:713–716[Abstract/Free Full Text]
  35. Parker MI, de Haan JB, Gevers W 1986 DNA hypermethylation in sodium butyrate-treated WI-38 fibroblasts. J Biol Chem 261:2786–2790[Abstract/Free Full Text]
  36. Yoshida M, Kijima M, Akita M, Beppu T 1990 Potent and specific inhibition of mammalian histone deacetylase both in vivo and in vitro by trichostatin A. J Biol Chem 265:17174–17179[Abstract/Free Full Text]
  37. Gray SG, Kytola S, Lui WO, Larsson C, Ekstrom TJ 2000 Modulating IGFBP-3 expression by trichostatin A: potential therapeutic role in the treatment of hepatocellular carcinoma. Int J Mol Med 5:33–41[Medline]
  38. Gucev ZS, Oh Y, Kelley KM, Rosenfeld RG 1996 Insulin-like growth factor binding protein 3 mediates retinoic acid- and transforming growth factor ß2-induced growth inhibition in human breast cancer cells. Cancer Res 56:1545–1550[Abstract/Free Full Text]
  39. Colston KW, Perks CM, Xie SP, Holly JM 1998 Growth inhibition of both MCF-7 and Hs578T human breast cancer cell lines by vitamin D analogues is associated with increased expression of insulin-like growth factor binding protein-3. J Mol Endocrinol 20:157–162[Abstract]
  40. Huynh H, Yang X, Pollak M 1996 Estradiol and antiestrogens regulate a growth inhibitory insulin-like growth factor binding protein 3 autocrine loop in human breast cancer cells. J Biol Chem 271:1016–1021[Abstract/Free Full Text]
  41. Rozen F, Zhang J, Pollak M 1998 Antiproliferative action of tumor necrosis factor-alpha on MCF-7 breast cancer cells is associated with increased insulin-like growth factor binding protein-3 accumulation. Int J Oncol 13:865–869[Medline]
  42. Buckbinder L, Talbott R, Velasco-Miguel S, Takenaka I, Faha B, Seizinger BR, Kley N 1995 Induction of the growth inhibitor IGF-binding protein 3 by p53. Nature 377:646–649[CrossRef][Medline]
  43. Lu Y, Lotan R 1999 Transcriptional regulation by butyrate of mouse galectin-1 gene in embryonal carcinoma cells. Biochim Biophys Acta 1444:85–91[Medline]
  44. Yang J, Kawai Y, Hanson RW, Arinze IJ 2001 Sodium butyrate induces transcription from the G{alpha} i2 gene promoter through multiple Sp1 sites in the promoter and by activating the MEK- ERK signal transduction pathway. J Biol Chem 276:25742–25752[Abstract/Free Full Text]
  45. Tsuji Y, Moran E, Torti SV, Torti FM 1999 Transcriptional regulation of the mouse ferritin H gene. Involvement of p300/CBP adaptor proteins in FER-1 enhancer activity. J Biol Chem 274:7501–7507[Abstract/Free Full Text]
  46. Xiao H, Hasegawa T, Isobe K 2000 p300 collaborates with Sp1 and Sp3 in p21waf1/cip1 promoter activation induced by histone deacetylase inhibitor. J Biol Chem 275:1371–1376[Abstract/Free Full Text]
  47. Bai L, Merchant JL 2001 ZBP-89 promotes growth arrest through stabilization of p53. Mol Cell Biol 21:4670–4683[Abstract/Free Full Text]
  48. Martin DI, Tsai SF, Orkin SH 1989 Increased gamma-globin expression in a nondeletion HPFH mediated by an erythroid-specific DNA-binding factor. Nature 338:435–438[CrossRef][Medline]
  49. Perez-Stable CM, Pozas A, Roos BA 2000 A role for GATA transcription factors in the androgen regulation of the prostate-specific antigen gene enhancer. Mol Cell Endocrinol 167:43–53[CrossRef][Medline]
  50. Della Ragione F, Criniti V, Della Pietra V, Borriello A, Oliva A, Indaco S, Yamamoto T, Zappia V 2001 Genes modulated by histone acetylation as new effectors of butyrate activity. FEBS Lett 499:199–204[CrossRef][Medline]
  51. Tang DG, Li L, Chopra DP, Porter AT 1998 Extended survivability of prostate cancer cells in the absence of trophic factors: increased proliferation, evasion of apoptosis, and the role of apoptosis proteins. Cancer Res 58:3466–3479[Abstract/Free Full Text]
  52. Luo J, Su F, Chen D, Shiloh A, Gu W 2000 Deacetylation of p53 modulates its effect on cell growth and apoptosis. Nature 408:377–381[CrossRef][Medline]
  53. Murphy M, Ahn J, Walker KK, Hoffman WH, Evans RM, Levine AJ, George DL 1999 Transcriptional repression by wild-type p53 utilizes histone deacetylases, mediated by interaction with mSin3a. Genes Dev 13:2490–2501[Abstract/Free Full Text]
  54. el-Deiry WS, Kern SE, Pietenpol JA, Kinzler KW, Vogelstein B 1992 Definition of a consensus binding site for p53. Nat Genet 1:45–49[CrossRef][Medline]
  55. Bourdon JC, Deguin-Chambon V, Lelong JC, Dessen P, May P, Debuire B, May E 1997 Further characterisation of the p53 responsive element—identification of new candidate genes for trans-activation by p53. Oncogene 14:85–94[CrossRef][Medline]
  56. Janson W, Brandner G, Siegel J 1997 Butyrate modulates DNA-damage-induced p53 response by induction of p53-independent differentiation and apoptosis. Oncogene 15:1395–1406[CrossRef][Medline]
  57. Dangond F, Hafler DA, Tong JK, Randall J, Kojima R, Utku N, Gullans SR 1998 Differential display cloning of a novel human histone deacetylase (HDAC3) cDNA from PHA-activated immune cells. Biochem Biophys Res Commun 242:648–652[CrossRef][Medline]
  58. Pellizzaro C, Coradini D, Daniotti A, Abolafio G, Daidone MG 2001 Modulation of cell cycle-related protein expression by sodium butyrate in human non-small cell lung cancer cell lines. Int J Cancer 91:654–657[CrossRef][Medline]
  59. Marin MC, Kaelin Jr WG 2000 p63 and p73: old members of a new family. Biochim Biophys Acta 1470:M93–M100
  60. Signoretti S, Waltregny D, Dilks J, Isaac B, Lin D, Garraway L, Yang A, Montironi R, McKeon F, Loda M 2000 p63 is a prostate basal cell marker and is required for prostate development. Am J Pathol 157:1769–1775[Abstract/Free Full Text]
  61. Kaighn ME, Lechner JF, Narayan KS, Jones LW 1978 Prostate carcinoma: tissue culture cell lines. Natl Cancer Inst Monogr 49:17–21
  62. Horoszewicz JS, Leong SS, Kawinski E, Karr JP, Rosenthal H, Chu TM, Mirand EA, Murphy GP 1983 LNCaP model of human prostatic carcinoma. Cancer Res 43:1809–1818[Abstract/Free Full Text]
  63. Sadar MD, Gleave ME 2000 Ligand-independent activation of the androgen receptor by the differentiation agent butyrate in human prostate cancer cells. Cancer Res 60:5825–5831[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Am. J. Physiol. Cell Physiol.Home page
P. M. Yamada and K.-W. Lee
Perspectives in mammalian IGFBP-3 biology: local vs. systemic action
Am J Physiol Cell Physiol, May 1, 2009; 296(5): C954 - C976.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
V. Hwa, G. Haeusler, K. L. Pratt, B. M. Little, H. Frisch, D. Koller, and R. G. Rosenfeld
Total Absence of Functional Acid Labile Subunit, Resulting in Severe Insulin-Like Growth Factor Deficiency and Moderate Growth Failure
J. Clin. Endocrinol. Metab., May 1, 2006; 91(5): 1826 - 1831.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
M. Takaoka, C. E. Smith, M. K. Mashiba, T. Okawa, C. D. Andl, W. S. El-Deiry, and H. Nakagawa
EGF-mediated regulation of IGFBP-3 determines esophageal epithelial cellular response to IGF-I
Am J Physiol Gastrointest Liver Physiol, February 1, 2006; 290(2): G404 - G416.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
E. M. Ongeri, M. F. Verderame, and J. M. Hammond
Follicle-Stimulating Hormone Induction of Ovarian Insulin-Like Growth Factor-Binding Protein-3 Transcription Requires a TATA Box-Binding Protein and the Protein Kinase A and Phosphatidylinositol-3 Kinase Pathways
Mol. Endocrinol., July 1, 2005; 19(7): 1837 - 1848.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
K. E. B. Knudsen, A. Serena, A. K. B. Kjaer, H. Jorgensen, and R. Engberg
Rye Bread Enhances the Production and Plasma Concentration of Butyrate but Not the Plasma Concentrations of Glucose and Insulin in Pigs
J. Nutr., July 1, 2005; 135(7): 1696 - 1704.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
G. P. Dunn, K. C.F. Sheehan, L. J. Old, and R. D. Schreiber
IFN Unresponsiveness in LNCaP Cells Due to the Lack of JAK1 Gene Expression
Cancer Res., April 15, 2005; 65(8): 3447 - 3453.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
J. Ye, D. Shedd, and G. Miller
An Sp1 Response Element in the Kaposi's Sarcoma-Associated Herpesvirus Open Reading Frame 50 Promoter Mediates Lytic Cycle Induction by Butyrate
J. Virol., February 1, 2005; 79(3): 1397 - 1408.
[Abstract] [Full Text] [PDF]


Home page
JNCI J Natl Cancer InstHome page
L.-C. Li, P. R. Carroll, and R. Dahiya
Epigenetic Changes in Prostate Cancer: Implication for Diagnosis and Treatment
J Natl Cancer Inst, January 19, 2005; 97(2): 103 - 115.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
J. L. Merchant, L. Bai, and M. Okada
ZBP-89 Mediates Butyrate Regulation of Gene Expression
J. Nutr., July 1, 2003; 133(7): 2456S - 2460.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
I. B. Roninson
Tumor Cell Senescence in Cancer Treatment
Cancer Res., June 1, 2003; 63(11): 2705 - 2715.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
N. Camarero, A. Nadal, M. J. Barrero, D. Haro, and P. F. Marrero
Histone deacetylase inhibitors stimulate mitochondrial HMG-CoA synthase gene expression via a promoter proximal Sp1 site
Nucleic Acids Res., March 15, 2003; 31(6): 1693 - 1703.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tsubaki, J.
Right arrow Articles by Rosenfeld, R. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tsubaki, J.
Right arrow Articles by Rosenfeld, R. G.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Medline Plus Health Information
*Prostate Cancer


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals