| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
TRH-TSH-THYROID |
Unit of Human Genetics (C.C., J.P.), Centre Hospitalier de lUniversité Laval Research Center, Sainte-Foy, Québec, GIV 4G2, Canada; and Department of Biology (R.J.D.), University of Michigan, Ann Arbor, Michigan 48109
Address all correspondence and requests for reprints to: Dr. Jack Puymirat, CHU Laval Research Center, 2705 Boulevard Laurier, Sainte-Foy, Québec, G1V 4G2, Canada. E-mail: . jack.puymirat{at}crchul.ulaval.ca
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
There is evidence that shows that the expression and subsequent accumulation of brain microtubule-associated proteins (MAPs) are critical steps in the regulation of neurite outgrowth (for reviews, see Refs. 16, 17, 18), but T3 does not seem to regulate expression of MAPs in the developing brain (16, 19). Recently, we identified the small GC-box binding transcription factor, basic transcription element-binding protein (BTEB), as a T3-up-regulated gene in the developing rat brain. We also showed that overexpression of BTEB in N-2a cells induced neurites outgrowth (20). In the present study, we blocked BTEB gene expression in primary rat embryonic neuronal cultures using antisense oligonucleotides (ODNs) to determine whether BTEB is involved in the T3-induced neurite outgrowth observed in vivo. We analyzed the consequences of exposure to antisense ODNs on the effects of T3 on a specific neuronal population, the acetylcholinesterase (AChE)-positive neurons (AChE cells), which are known to be responsive to T3 (6, 7). We found that inhibition of BTEB gene expression completely blocked the effect of T3 on neurite branching, but not neurite elongation, in AChE cells. Titration of BTEB levels by T3 regulates the degree of neurite branching. BTEB is the first T3-regulated gene identified, thus far, to be implicated in the T3-induced neurite branching signaling pathway.
| Materials and Methods |
|---|
|
|
|---|
Cell culture
Dissociated cultures of cerebral hemisphere neurons, prepared from embryonic E-16 rat embryos, were dissociated and plated onto gelatin/liter-polylysine-coated coverslips at a uniform density of 150,000 or 25,000 cells (for tubulin experiments)/15-mm diameter wells, as previously described (7). Cells were grown in serum-free medium, in a 37 C incubator, with 5% CO2.
3-(4,5-dimethylthiazole-2-yl) 2,5-diphenyl tetrazolium bromide (MTT) assay
The potential toxicity of ODNs was determined using an MTT assay (22). Cells treated or not with ODNs were incubated with MTT (250 µg/ml) for 3 h at 37 C, and reduction was measured by colorimetric detection (540 nm) of the blue insoluble formazan product. This assay provides an estimate of the number of functioning mitochondria present in the cells; i.e. the quantity of formazan product is directly proportional to the number of metabolically active cells in the culture.
AChE and tubulin staining
For AchE staining, cells were fixed with 3% paraformaldehyde and incubated for 1 h with substrate solution containing 72 mM acetylthiocholine, 10 mM potassium ferricyanide, 60 mM cupric sulfate, and 100 mM sodium citrate in 50 mM Tris-HCl (pH 7.6), followed by a second incubation with 0.04% 3,3'-diaminobenzidine, 0.3% nickel ammonium sulfate, and 0.003% H2O2, as described (7).
For immunofluorescent detection of tubulin, cells were fixed with 3% paraformaldehyde for 10 min, washed with PBS, and permeabilized with 0.1% Triton X-100 for 10 min. The cells were incubated for 1 h with the ß-tubulin antibody (1:50; Roche Diagnostics, Laval, Québec, Canada), washed with PBS, and incubated with secondary antibody for 45 min (antimouse IgG-rhodamine; 1:50; Roche Diagnostics). Stained cells were mounted on a glass slide with PBS-glycerol 50% and stored at 4 C until morphometric analysis.
RNA extraction, RT-PCR, and Northern blot analysis
Total RNA was isolated from cells with Trizol reagent (Life Technologies, Inc., Grand Island, NY) and treated with deoxyribonuclease (Promega Corp., Madison, WI), following the manufacturers instructions. Two micrograms of RNA were reverse transcribed into cDNA using a reaction mixture of 200 U Moloney murine leukemia virus reverse transcriptase (Promega, Mont-Royal, Québec, Canada), 1x RT reaction buffer, 10 mM of each deoxynucleotide triphosphate, 30 U RNAguard (Amersham Pharmacia Biotech), and 50 pmol of each sequence specific-primer. cDNA was synthesized at 37 C for 1 h. Subsequently, one fourth of the RT reaction was used as a template for PCR analyses. We previously showed that c-jun mRNA levels were unaffected by T3 in primary neuronal cultures (Puymirat, J., personal communication). We therefore used c-jun mRNAs as our internal control in the RT-PCR assay. Oligonucleotide primer sequences were as follows: c-jun, F-5'GCTCCGAGGAACCGCTGCT3' and R-5'TCACGTTCTTGGGGCACAAG3'; BTEB F-5'GAACCGGCTCAGGAGGAGGG3' and R-5'GTCGCAGTCGCTCGGCGTCC3'. Standard PCR reaction mixture conditions, containing 200 µM deoxynucleotide triphosphates, 1.0 U Taq DNA polymerase (QIAGEN, Chatsworth, CA), 1x PCR reaction buffer, and 50 pmol of each primer set were used. Cycle characteristics for these primers were 94 C for 10 sec, 55 C for 30 sec, and 72 C for 30 sec. The PCR amplification products were resolved on a 1% agarose gel and stained with ethidium bromide. Peak areas associated with DNA bands were determined using the AlphaImager scan (Alpha Innovatech Corp., San Leandro, CA). PCR amplification gave products of 610- and 405-bp for c-jun and BTEB, respectively.
Western blot analysis
Cerebral hemisphere cultures, treated or not with 30 nM T3 in the absence or presence of ODNs (1.5 µM), were homogenized in 1 ml buffer A [250 mM sucrose; 20 mM Tris HCl, pH 7.8; 1. 1 mM MgCl2; 0.1% Triton X-100; 1 mM phenylmethylsulfonylfluoride; and a mix of protease inhibitors (Roche Diagnostics)] for 10 min at 4 C. Nuclei were removed by centrifugation, 5 min at 5,000 rpm, washed 3 times in the same buffer. Nuclear proteins were then extracted in a lysis buffer B [Buffer A, 5 mM dithiothreitol (DTT), 20% glycerol, and 400 mM KCl] for 20 min at 4 C. The samples were centrifuged at 16,000 x g for 5 min, and supernatant was diluted in Laemmli sample buffer. Samples were stored at -20 C until used. Fifty micrograms of nuclear proteins were separated by 10% SDS-polyacrylamide gels, transferred to polyvinylidene difluoride membrane, and probed with a affinity-purified anti-BTEB antibody (1/1000) in TBS containing 0.1% Tween. Detection was performed with a horseradish peroxidase-coupled antirabbit antibody (1:10,000; Jackson ImmunoResearch Laboratories, Inc., West Grove, PA) and ECL Western blotting detection reagents (Amersham Pharmacia Biotech). Western blots were normalized using a monoclonal antibody (2B3G8) prepared against an unknown 55-kDa nuclear protein. This nuclear protein is constitutively expressed in various tissues including neural cells, and its expression is independent of thyroid hormones (Puymirat, J., personal communication).
BTEB antibody production and affinity purification
The IgG fraction of a rabbit polyclonal antiserum, raised against a glutathione-S-transferase (GST)-Xenopus BTEB fusion protein (GST-xBTEB; Hoopfer, E. D., and R. J. Denver, unpublished), was further purified using an affinity column made with a GST-xBTEB-DNA-binding domain (GST-xBTEB[DBD]) fusion protein. A subtractive approach was used, where the column flow-through was retained, in which antibodies directed against the GST fusion tag and the highly conserved DBD (i.e. conserved among Sp family members) had been removed. Thus, the final IgG fraction used (the column flow-through) contained antibodies directed only against the N-terminal region of BTEB. Because the frog and rodent share sequence similarity in the N-terminal region, we reasoned that the anti-xBTEB IgGs would recognize a number of epitopes on the rodent BTEB protein.
GST-xBTEB[DBD] affinity column purification.
The affinity column was prepared using the Affi-Gel 10 support (Bio-Rad Laboratories, Inc., Hercules, CA), following the manufacturers protocol by coupling 2 mg GST-xBTEB[DBD] (2 mg/ml in 0.01 M 4-morpholinepropanesulfonic acid, pH 7.0) to 1 ml washed support (50% vol/vol bead suspension) for 4 h at 4 C. The support was incubated with 1 bed volume of 1 M ethanolamine HCl (pH 8.0) for 1 h at 4 C, transferred to a 10-ml Poly-Prep disposable column (Bio-Rad Laboratories, Inc.), and washed with 10 bed volumes of PBS (pH 7.0). The coupling efficiency was determined by comparing the OD280 values of the ligand solution before and after coupling. The IgG fraction of the anti-xBTEB serum was passed through the GST-xBTEB[DBD] affinity column equilibrated with 0.01 M Tris (pH 8.0), 0.15 M NaCl. The flow-through, which contained antibodies to the N-terminal region of xBTEB, was collected and reapplied to the affinity column twice. The specificity of the resultant IgGs obtained in the column flow-through (anti-xBTEB N-terminal region) was verified by Western blotting (i.e. this IgG fraction reacted strongly with the full-length xBTEB fusion protein but did not recognize GST-xBTEB[DBD] or GST alone; data not shown).
Morphometric analysis
Neurite outgrowth was estimated as described previously (2, 6). Several randomly chosen fields within the cultures were photographed in either a phase-contrast light microscope (for AChE neurons) or an epifluorescent microscope (for tubulin-positive neurons). Only neurons that were outside aggregates were analyzed. The number of neurites on each cell was counted, and cell length and point-branching were measured. The length of neurites was estimated by the index of neurite length. The index of neurite length was determined as x-fold cell diameter.
EMSA
Cell extracts were prepared, following methods described by Ranjan et al. (23). Cells were resuspended in a 5-fold packed cell volume of lysis buffer (0.4 M KCl; 20 mM HEPES, pH 7.8; 20% glycerol; 2 mM DTT; 0.5% IGEPAL CA-630; 75 U/ml aprotinin; 1 µg/ml leupeptin; 1 µg/ml pepstatin A). Cells were lysed by three cycles of freeze-thawing, and the lysate was clarified by centrifugation at 10,000 x g at 4 C. Protein content of the extract was determined using the Pierce Chemical Co. (Rockford, IL) protein assay.
For EMSA, a synthetic ODN corresponding to the sequence of the basic transcription element (21) was prepared: 5'gatcGAGAAGGAGGCGTGGCCAACCTCTTCCTCCGCACCGGTTGctag.
The 5' and 3' strands of the synthetic BTE ODN were annealed in a buffer containing 10 mM Tris (pH 7.5), 500 mM NaCl, 10 mM EDTA. Annealing was performed at 70 C for 5 min, followed by 37 C for 30 min. The double-stranded BTE was radiolabeled by Klenow fill-in with [
-32P]deoxy-CTP for 15 min at 30 C. Unincorporated [
-32P]deoxy-CTP was removed by Sephadex G50 spin column chromatography. For EMSA, 15 µg cellular protein was combined with 20,000 cpm 32P-labeled BTE in a buffer containing 1.4 µg poly(deoxyinosine-deoxycytidine), 20 mM HEPES (pH 7.8), 1 mM DTT, 0.1% IGEPAL CA-630, 50 mM KCl, and 20% glycerol and incubated at room temperature for 40 min. Unlabeled BTE or cytoplasmic actin cDNA were added to some reactions as specific and nonspecific competitors, respectively. Protein-DNA complexes were resolved on a 6% polyacrylamide, 0.25x Tris-borate EDTA minigel; the gel was dried and analyzed by phosphorimaging (Bio-Rad Laboratories, Inc.).
Statistical analysis
The data were expressed as mean ± SE. Results were analyzed by unpaired t test or one-way ANOVA on untransformed data.
| Results |
|---|
|
|
|---|
|
|
|
EMSA analysis was performed to determine whether antisense ODNs may affect the expression of other members of the Sp family proteins. EMSA detected several bands corresponding to Sp1 and Sp3, and the intensities of these bands were unaffected by any of the treatments (data not shown).
Potential effects of antisense or control non-sense ODNs on cell survival were determined using the MTT assay. Addition of 1.5 µM antisense or control non-sense ODNs had no effect on cell survival (0.377 ± 0.02, 0.42 ± 0.02, and 0.43 ± 0.005 optic density per well in control cells and cells treated with 1.5 µM antisense or control non-sense ODNs, respectively).
Effects of BTEB antisense oligonucleotides on T3-induced neurite outgrowth
Under our culture conditions, initiation of neurite outgrowth occurs during the first 3 d of culture, whereas elongation takes place after 3 d (see Ref. 26). To determine whether T3 influences the elaboration of neurites, we studied its effect on neurite outgrowth during the first 24 h of culture. Cells stained with the antitubulin antibody were examined. Treatment of the cultures, with 30 nM T3 during the first 24 h, did not affect the number of neurites per neuron nor the index of neurite length but significantly increased the number of branchpoints per neuron (Fig. 3
, compare B with A). The results were quantified and are presented in Table 1
. BTEB antisense ODNs were added to the media of cerebral hemisphere neurons, in the absence or presence of T3 during the first 24 h, to determine the effects of antisense exposure on neurite polarity and on T3-induced neurite branching. As shown in Table 1
, antisense ODNs (1.5 µM) completely abolished the T3-induced increase in the number of branchpoints per neuron (Fig. 3C
). This effect of antisense was dose-dependent (Table 1
). There was no significant effect of antisense ODNs on the elaboration of neurites nor on the index length of neurites (Table 1
). No effect of control non-sense or antisense ODNs was observed on neurite outgrowth in cell grown in the absence of T3 (data not shown). No effect was observed with 1.5 µM control non-sense ODNs, and neurons were indistinguishable from those grown without ODNs in the presence of T3 (Fig. 3
, compare B with D; Table 1
).
|
|
|
| Discussion |
|---|
|
|
|---|
Despite the fact that the effect of T3 on neurite outgrowth has been known for several years, the genes that mediate this effect have not been identified. We previously identified the small GC box-binding transcription factor BTEB as a T3-regulated gene in N-2aTRß1 and in the developing brain (20). To determine the functions of BTEB in the developing brain, we blocked the expression of BTEB by antisense ODNs in primary neuronal cultures. We show that the effects of T3 on neurite branching are completely abolished by BTEB antisense ODNs, whereas BTEB antisense ODNs had no effect on the T3-induced increase in neurite length. Surprisingly, we found no significant effect of BTEB antisense ODNs on neurite branching in cultures grown in the absence of T3, although BTEB mRNAs are expressed in these cells, albeit at a very low level. This lack of effect may be explained by the difficulties with quantifying a small effect on outgrowth by the methodology that we used. Although the effects of ODNs are relatively weak, they are statistically significant. The small effects of ODNs might be explained by the fact that the effect of T3 on neurite outgrowth is weak after 24 h of treatment and requires several days of treatment to become pronounced (6). Several criteria support the conclusion that this effect of antisense is specific to BTEB. The decreased level in BTEB mRNAs is associated with a decreased level in BTEB protein. In contrast, neither antisense nor control sense ODNs affected the levels of c-jun mRNA (see Fig. 2
), Sp1 protein, or Sp3 protein (determined by EMSA; data not shown). The fact that the levels of Sp1 and Sp3 proteins were unaltered in antisense ODN-treated cells argues against the effect on neurite branching being mediated by other Sp family proteins. Control non-sense ODN-treated neurons were indistinguishable from those cultured in the absence of ODNs. In addition, a potential cytotoxic effect of the ODNs was excluded by the MTT test. Taken together, our findings support the hypothesis that: 1) BTEB is involved in the neurite branching signaling pathway activated by T3 and; and 2) T3-induced neurite elongation and branching are controlled by different mechanisms. This is the first demonstration that the T3-induced increase in neurite length and arborization are regulated by distinct mechanisms. These results differ, however, from those previously reported in neuro-2a cells that overexpress BTEB (20). In these cells, the index of neurite outgrowth length was found to be increased by BTEB overexpression. This discrepancy may be explained by the fact that MAPs (including tau), which regulate the assembly and stability of microtubules and therefore neurite outgrowth, differ between neuro-2a cells and primary neurons (24). It has been hypothesized that neurite outgrowth results from changes in the cytoskeleton. The assembly and stability of microtubules are regulated by MAPs, including tau (found predominantly in axons) and MAP2 (found predominantly in dendrites) (for reviews, see Refs. 17 and 18). There is now evidence that the initial establishment of neurites depends, in part, on MAP2, whereas further neurite elongation depends, in part, on tau and microtubule stabilization (25, 26, 27, 28). MAP1 was found as a prominent component of microtubule proteins in neuro-2a cells, whereas MAP2 was found the major component of microtubule proteins in neurons (24). This may explain the differences observed between neuro-2a cells and primary neurons.
Recent data obtained in our laboratory indicate that T3 does not affect the levels of MAP2 and tau proteins in primary neurons, suggesting that the T3-induced neurite outgrowth is not mediated by the changes in the levels of MAPs by T3. This is in good agreement with other reports that show that the processing, rather than the expression, of MAPs is impaired in the hypothyroid brain (for review, see Ref. 19). The phosphorylation state of MAPs modulates their interaction with microtubules (17), and Diez-Guerra and Avila (29) recently showed that MAP2 phosphorylation plays a part in dendrite arborization in cultured hippocampal neurons. Furthermore, phosphorylation of MAPs modulates both dendrite branching and axon branching but with differences in sensitivity to phosphorylation and/or dephosphorylation by specific kinases and phosphatases (30). It is therefore possible that T3 up-regulates BTEB gene expression, which, in turn, modulates the phosphorylation and/or dephosphorylation of MAPs and/or tau by specific kinases and phosphatases. In conclusion, our results suggest that the immediate early transcription factor BTEB is one of the first intermediates in the T3-induced signaling pathway leading to neurite branching in the developing brain.
| Acknowledgments |
|---|
| Footnotes |
|---|
Abbreviations: AchE, Acetylcholinesterase; BTEB, basic transcription element-binding protein; DTT, dithiothreitol; GST, glutathione-S-transferase; MAP, microtubule-associated protein; MTT, 3-(4,5-dimethylthiazole-2-yl) 2,5-diphenyl tetrazolium bromide; ODN, oligodeoxynucleotide.
Received January 9, 2002.
Accepted for publication February 13, 2002.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
S. C Lema, J. T Dickey, I. R Schultz, and P. Swanson Thyroid hormone regulation of mRNAs encoding thyrotropin {beta}-subunit, glycoprotein {alpha}-subunit, and thyroid hormone receptors {alpha} and {beta} in brain, pituitary gland, liver, and gonads of an adult teleost, Pimephales promelas J. Endocrinol., July 1, 2009; 202(1): 43 - 54. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. M. Bonett, F. Hu, P. Bagamasbad, and R. J. Denver Stressor and Glucocorticoid-Dependent Induction of the Immediate Early Gene Kruppel-Like Factor 9: Implications for Neural Development and Plasticity Endocrinology, April 1, 2009; 150(4): 1757 - 1765. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Ohguchi, T. Tanaka, A. Uchida, K. Magoori, H. Kudo, I. Kim, K. Daigo, I. Sakakibara, M. Okamura, H. Harigae, et al. Hepatocyte Nuclear Factor 4{alpha} Contributes to Thyroid Hormone Homeostasis by Cooperatively Regulating the Type 1 Iodothyronine Deiodinase Gene with GATA4 and Kruppel-Like Transcription Factor 9 Mol. Cell. Biol., June 15, 2008; 28(12): 3917 - 3931. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. G. Fuhrken, C. Chen, P. A. Apostolidis, M. Wang, W. M. Miller, and E. T. Papoutsakis Gene Ontology-driven transcriptional analysis of CD34+ cell-initiated megakaryocytic cultures identifies new transcriptional regulators of megakaryopoiesis Physiol Genomics, April 1, 2008; 33(2): 159 - 169. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Bagamasbad, K. L. Howdeshell, L. M. Sachs, B. A. Demeneix, and R. J. Denver A Role for Basic Transcription Element-binding Protein 1 (BTEB1) in the Autoinduction of Thyroid Hormone Receptor J. Biol. Chem., January 25, 2008; 283(4): 2275 - 2285. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. C. Moeller, A. M. Dumitrescu, R. L. Walker, P. S. Meltzer, and S. Refetoff Thyroid Hormone Responsive Genes in Cultured Human Fibroblasts J. Clin. Endocrinol. Metab., February 1, 2005; 90(2): 936 - 943. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Martinez and F. C. A. Gomes Neuritogenesis Induced by Thyroid Hormone-treated Astrocytes Is Mediated by Epidermal Growth Factor/Mitogen-activated Protein Kinase-Phosphatidylinositol 3-Kinase Pathways and Involves Modulation of Extracellular Matrix Proteins J. Biol. Chem., December 13, 2002; 277(51): 49311 - 49318. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |