Endocrinology Vol. 143, No. 7 2610-2617
Copyright © 2002 by The Endocrine Society
GH and Epidermal Growth Factor Signaling in Normal and Laron Syndrome Fibroblasts
Corinne M. Silva,
Michael T. Kloth,
Andrew J. Whatmore,
James S. Freeth,
Neil Anderson,
Kristen K. Laughlin,
Trang Huynh,
Alyson J. Woodall and
Peter E. Clayton
Department of Internal Medicine (C.M.S., M.T.K., K.K.L.), Division of Endocrinology, University of Virginia, Charlottesville, Virginia 22908; Endocrine Sciences Research Group (A.J.W., J.S.F., T.H., A.J.W., P.E.C.) and Department of Surgery (N.A.), University of Manchester, Manchester, M13 9PT United Kingdom (N.A.)
Address all correspondence and requests for reprints to: Corinne M. Silva, Box 800746, University of Virginia Health System, Charlottesville, Virginia 22908. E-mail: . cms3e{at}virginia.edu
 |
Abstract
|
|---|
We have investigated and compared GH and epidermal growth factor (EGF) signaling in primary human skin fibroblasts from normal subjects and subjects with GH-binding protein-positive Laron syndrome (LS). In normal human fibroblasts, GH and EGF activate the tyrosine phosphorylation of signal transducer and activator of transcription (STAT)1 and STAT5b; in LS fibroblasts, EGF does, but GH does not. GH also activates the tyrosine phosphorylation of Janus kinase (JAK)2 in normal, but not LS, fibroblasts. Similarly, both GH and EGF activate MAPK in normal fibroblasts, but only EGF does in the LS fibroblasts. As in the 3T3-F442A mouse preadipocyte cell line, GH signaling to mitogen-activated protein kinase is partially inhibited by wortmannin treatment, indicating a role for phosphatidylinositol 3-kinase (PI3K) in this signaling pathway. The exogenous expression of the GH receptor in one family of LS fibroblasts (H1) but not the other (M) restores signaling to a STAT5 reporter element. Together, these results indicate that the mechanism of defective GH signaling in two families of LS fibroblasts are different but that both occur at a level close to, and specific for, the GH receptor.
 |
Introduction
|
|---|
IN 1966, LARON et al. (1) described a syndrome caused by GH receptor (GHR) deficiency that resulted in extreme GH insensitivity despite elevated serum levels of GH. Patients with Laron syndrome (LS) display decreased levels of serum IGF-1, severe growth retardation, obesity, and hypoglycemia (2). The vast majority of LS patients are a result of a mutation in the extracellular domain of the GHR, causing decreased GH binding and a corresponding decreased level of GH binding protein (GHBP), representing the extracellular domain of the GHR normally found in serum (3). However, over the past few years, a number of GHBP-positive LS patients have been described (4, 5, 6). One of these has a homozygous point mutation in exon 6 that causes a replacement of aspartate by histidine at codon 152 (D152H) (7). This mutation is in the dimerization domain of the GHR and thus results in the inability of the GHR to signal intracellularly and/or be expressed at normal levels (7, 8). A number of cases have also been described in which mutation of the GHR occurs in the transmembrane or intracellular domains (5, 6). These mutations, usually occurring by a splice site defect, result in a lack of the intracellular signaling domain of the GHR (9, 10). Because the extracellular domain is translated, these patients are GHBP positive. A few patients of GHBP-positive LS have been described in which the patients have been found to express normal, full-length receptor (11, 12). Because these LS patients are still GH insensitive and thus display the characteristics described above, it is proposed that these patients have a defect in the intracellular signaling pathway that is normally activated by GH in target cells. This biologic defect is an experiment of nature that may provide key insight into the signaling processes that are required for GH signaling in target human cells.
We have described previously the isolation of primary human fibroblasts from three girls of two families (H and M) with GHBP-positive LS (4, 12). In family M, there is no mutation in the GHR, and family H is heterozygous for the D152H mutation. Although normal human fibroblasts grown in culture show GH-induced 3H-thymidine incorporation and production of IGF binding protein-3, the LS fibroblasts did not (12). Thus, these LS fibroblasts display GH insensitivity in vitro as well as in vivo. To begin to characterize the signaling defect(s) present in these fibroblasts, we began by investigating the Janus kinase (JAK)/signal transducer and activator of transcription (STAT) pathway in LS vs. normal fibroblasts in culture (13). Both normal and LS fibroblasts express JAK2 and STATs 1, 3, and 5 proteins. EMSA demonstrated that lysates from GH-treated normal fibroblasts displayed specific binding to the lactogenic hormone response region (LHRR) (but not the m67 c-sis inducible element or interferon regulatory element), and this binding was supershifted by anti-STAT5b and anti-STAT1 antibodies. In contrast, lysates isolated from the H1 fibroblasts showed no binding to the LHRR, but the M fibroblasts showed some binding.
In the studies presented here, we have continued our characterization of the GH-induced signaling pathways in normal human fibroblasts and compared that with LS fibroblasts to determine the defect present in these cells. We have compared GH signaling with that of the epidermal growth factor (EGF) to determine whether the GH insensitivity is due to a general signaling defect or is specific to the GH pathway. Our data support a GHR-specific defect that involves both the JAK/STAT and MAPK pathways.
 |
Materials and Methods
|
|---|
Reagents
Recombinant human GH (rhGH) was obtained from Genentech, Inc. (San Francisco, CA). Recombinant human EGF (rhEGF) was purchased from Life Technologies, Inc. (Gaithersburg, MD). The enhanced chemiluminescence kit was purchased from Amersham Pharmacia Biotech (Arlington Heights, IL). Monoclonal antiphosphotyrosine antibody was from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). Polyclonal STAT5a- and STAT5b-specific antibodies were developed in our laboratory. Peptides used to generate the antibodies correspond to the unique C-terminal region of the STAT5 proteins. 32P-
-ATP (4500 µCi/µg) was purchased from ICN Pharmaceuticals, Inc. Ltd. (Thames, UK), P81 phosphocellulose paper from Whatman International Ltd. (Maidstone, UK) and protein assay kits from Bio-Rad Laboratories, Inc. Ltd. (Hemel Hempstead, UK). Wortmannin was obtained from Sigma (Poole, UK). Anti-p70S6K (phosphorylation of ribosomal protein S6 kinase) antisera were produced by Dr. N. Anderson as reported previously (14). Acrylamide, bisacrylamide, and prestained molecular weight standards as well as all tissue culture reagents were from Life Technologies, Inc./BRL. Except where noted, other reagents were either reagent or molecular biological grade from Sigma (St. Louis, MO).
Cell culture
Primary human fibroblast cultures were established, with local ethics committee approval, from skin explants from three normal controls and three GHBP-positive LS girls (H1, M1, and M2), as described previously (12). Human fibroblasts were maintained in vented 75-cm2 tissue culture flasks (Costar Corp., Cambridge, MA) in DMEM culture medium supplemented with 10% fetal bovine serum (FBS), 5 mM L-glutamine, 50 IU/ml penicillin, 50 µg/ml streptomycin, and 1 µg/ml fungizone. Cells were passaged (1:4) upon reaching monolayer confluence (56 d) by treatment with 1 mg/ml trypsin/0.4 mg/ml EDTA, and medium was changed every 23 d. Experiments were performed on subconfluent human fibroblast cultures between passages 4 and 12. All cells were serum starved in DMEM culture medium containing 0.1% BSA for 1824 h before experimentation. IM-9 cells were obtained from the American Type Culture Collection (Manassas, VA) and 3T3-F442A cells were kindly provided by Dr. P. J. Bertics (University of Wisconsin). IM-9 cells were grown as suspension cultures in Nalge T175 flasks in a 37 C, 5% CO2 incubator in MEM supplemented with nonessential amino acids, glutamine, and 10% FBS. 3T3-F442A cells were grown in DMEM/10% FBS on Nalge T80 flasks. Cells were passaged every 3 d at 1:10 (IM-9) or 1:20 (3T3-F442A).
Preparation of protein lysates
Cells were preincubated overnight in media containing 0.1% BSA at 37 C. Cells were then treated with media alone (control), rhGH at 200 ng/ml (or the doses shown in each experiment), or 10 ng/ml rhEGF at 37 C for the times indicated. At the end of this incubation, cells were washed in PBS and then lysed in buffer containing 150 mM NaCl, 5 mM EDTA, 1% Triton X-100/1% deoxycholate, 50 mM Tris (pH 7.4). All lysis buffers contained protease and phosphatase inhibitors [leupeptin, aprotinin, vanadate, phenylmethylsulfonyl fluoride (PMSF)]. Lysates were stored at -70 C until use. Upon thawing, lysates were centrifuged at 100,000 x g for 30 min at 4 C and resulting supernatants analyzed as described below.
Immunoblotting and immunoprecipitation
Amount of total protein in the cell lysates was determined using the BCA protein assay kit (Pierce Chemical Co., Rockford, IL). For immunoprecipitation, 500 µg lysate was incubated with antibody overnight at 4 C. Protein A-agarose for polyclonal antibodies, or protein G PLUS-agarose for monoclonal antibodies (Santa Cruz Biotechnology, Inc.) was added for an additional 1 h at 4 C. Agarose pellets were washed three times in detergent buffer and bound proteins were removed by boiling in 1x Laemmli buffer. To analyze cell extracts directly, detergent lysates were mixed 1:1 with Laemmli buffer (15). Lysates or immunoprecipitates were fractionated through a 7.5% polyacrylamide gel, electrophoretically transferred to nitrocellulose, and blotted as described previously (16, 17). Blocking buffers were TBS-T (0.15 M NaCl; 0.1% Tween-20; 50 mM Tris, pH 8.0) and 3% BSA for the antiphosphotyrosine antibody or 5% nonfat dry milk for all other antibodies. Secondary antibodies were either donkey antirabbit or sheep antimouse conjugated to horseradish peroxidase, and antibody binding was detected using the enhanced chemiluminescence detection kit (Amersham Pharmacia Biotech). In some cases blots were stripped in buffer (2% SDS; 0.1 M 2-mercaptoethanol; 62.5 mM Tris, pH 6.8) at 70 C for 80 min and rinsed extensively in TBS-T before being reprobed.
MAPK activity assay
In experiments to determine the role of PI3K, fibroblasts were preincubated in the presence and absence of 100 nM wortmannin for 15 min before treatment with or without GH. In all other experiments, cells were treated with GH (02000 ng/ml) for 030 min at 37 C, and incubations were terminated by aspiration of the medium. Cells were washed with PBS (4 C) before being harvested in extraction buffer (50 mM ß-glycerophosphate; pH 7.3; 1.5 mM EDTA; 1 mM benzamidine; 0.5 mM Na3VO4; 1 mM dithiothreitol; 0.1 mM PMSF; and 1 µg/ml each leupeptin, pepstatin A, and aprotinin). Samples were rapidly frozen in liquid nitrogen and stored at -70 C until assayed. MAPK activity was measured in triplicate by the ability of cell extracts to phosphorylate T669 peptide as reported previously (18, 19). T669, a 21 amino acid peptide corresponding to the sequence of the EGF receptor (EGFR) phosphorylated by MAPK (KRELVEPL*TPSGEAPNQALLR, with the asterisk representing the threonine phosphorylation site), was a generous gift from Dr. J. Tavaré (University of Bristol, Bristol, UK) and subsequently from Affiniti Research Products Limited (Exeter, UK). In brief, 520 µl cell extract (containing 7.530 µg protein) was incubated for 10 min at 37 C with 50 µM ATP (containing 200 µCi/ml 32P-
-ATP) in the presence and absence of 0.2 mM T669. Reactions were terminated by spotting 25-µl aliquots onto 2-cm2 squares of P-81 phosphocellulose paper and immersion in 150 mM phosphoric acid. Samples were washed four times with phosphoric acid and once with ethanol before being air dried and counted for radioactivity. This assay was linear over incubation times from 5 to 20 min and also across a range (540 µg/50-µl assay) of protein concentrations (data not shown).
In three independent experiments, MAPK was immunoprecipitated from cell extracts with anti-MAPK antisera and assayed for activity. Activity was significantly stimulated in GH-treated cells, compared with untreated cells (mean ± SD; GH = 6.1 ± 2.5 pmol PO4 incorporated vs. control = 1.3 ± 0.75 pmol PO4 incorporated, P < 0.05). Immunoprecipitation was not used routinely because of the large number of cells required for this procedure. To standardize for variability in extracted protein between experiments, the protein content of each cell extract was determined using the protein assay kit (Bio-Rad Laboratories, Inc.) and MAPK activity calculated as the mean pmol of phosphate incorporated into T669/mg of protein. To remove the effect of variable baseline activity, results were expressed as the mean fold induction (FI) over basal activity. Interassay coefficients of variation (CVs) calculated from four separate assays of the same lysate were 10.8% and 11.9% at 0 and 200 ng/ml GH, respectively. The intraassay CV, estimated from triplicate measurements on 38 individual lysates, were 11.7% and 11.2% at 0 and 200 ng/ml GH, respectively.
Assay for p70S6K
Cells were pretreated in the presence or absence of wortmannin (100 nM) for 15 min before incubation with or without GH (200 ng/ml) for 15 min. Experiments were terminated by removal of the medium and washing the cells in PBS (4 C). Cells were lysed in buffer B (50 mM Tris, pH 8.0 at 4 C; 120 mM NaCl; 20 mM NaF; 1 mM EDTA; 5 mM EGTA; 10 mM sodium pyrophosphate; 1% Nonidet P-40 containing 1 mM PMSF; 1 mM sodium vanadate; and 2 µg/ml each of leupeptin, aprotinin, and pepstatin A) and stored at -70 C until assayed. Immunoblotting was performed as detailed above except membranes were blotted with an anti-p70S6K antibody (1:500).
Transfection of human GHR and activation of an LHRR-luciferase construct
Primary fibroblast transfections were performed with Lipofectamine Plus (Invitrogen Life Technologies, Inc., Carlsbad, CA). Fibroblasts were cotransfected with a vector containing the LHRR linked to a luciferase reporter gene (LHRR-luc) and either empty pcDNA1 or pcDNA1 containing the full-length human GHR (flhGHR). The plasmid encoding the flhGHR was kindly provided by Dr. Richard Ross (University of Sheffield, Sheffield, UK). The LHRR contains two copies of the consensus sequence from the bovine ß-casein gene (AGATTTCTAGGAATTCAAATC) that we have used previously in EMSAs (17). Transfected cells were treated with or without GH for 24 h and luciferase activity measured in the cell lysates by using a chemiluminescent assay. Results are expressed as the ratio of FI in luciferase activity in response to GH in cells transfected ± flhGHR (FI + GHR/FI-GHR).
For experiments investigating signaling by the GHR mutant, 293HEK cells were transfected by electroporation with the LHRR-luc plasmid (as above) and 5 µg flhGHR alone or with increasing concentrations of the D152H mutant of the GHR (kindly provided by Dr. Joelle Finidori, INSERM, Paris, France) at ratios of 4:1, 1:1, 1:4, and 1:9 (wt:D152H) or 5 µg D152H alone. Cells were then treated with 20, 200, or 200 ng/ml rhGH and assayed for luciferase assay as above. Each point was done in triplicate.
Statistics
All statistical analysis was performed using the Statistical Package for Social Sciences (SPSS, Inc., Chicago, IL). No significant differences were found among M1 and M2, and this family (family M) was analyzed together. Differences within groups were analyzed by one-way ANOVA and Bonferroni post hoc tests. Differences in MAPK activity between control and LS fibroblasts were examined by independent t tests.
 |
Results
|
|---|
To continue our characterization of the signaling defects in LS fibroblasts, we first investigated the activation of the STAT proteins not only in response to GH but also in response to EGF. In many cell line models, as well as in vivo experiments, both GH and EGF have been shown to activate STATs 1, 3, and 5 (20, 21, 22). Thus, comparing activation of these STATs by both GH and EGF allowed us to determine whether defective signaling is specific to the GH pathway or a more general defect in STAT signaling affecting multiple pathways. We analyzed GH- and EGF-induced tyrosine phosphorylation of STAT proteins by immunoprecipitating with STAT1-, STAT3-, STAT5a-, and STAT5b-specific antibodies followed by antiphosphotyrosine Western blotting. As shown in Fig. 1
, STATs 1, 3, and 5b are expressed at readily detectable levels in all the fibroblasts investigated (bottom panels). Although we have previously reported, using RT-PCR (13), that the mRNA for STAT5a is found in human fibroblasts, we detected a relatively low level of STAT5a protein in these cells and thus were unable to determine consistently its tyrosine phosphorylation (data not shown). However, we did find that in normal human fibroblasts (N4) both GH and EGF activated STAT1 and STAT5b tyrosine phosphorylation. STAT3 tyrosine phosphorylation was not detectable in normal fibroblasts in response to GH and was barely detectable in response to EGF. These results demonstrate that the major STATs activated by both GH and EGF in normal human fibroblasts are STAT1 and STAT5b. However, there was no GH-induced tyrosine phosphorylation of the STAT proteins in the three LS fibroblasts (H1, M1, M2). In contrast, EGF was able to activate STAT1 and STAT5b in all three LS fibroblasts. EGF-induced STAT3 tyrosine phosphorylation was also detectable in at least one Laron fibroblast (M1).

View larger version (89K):
[in this window]
[in a new window]
|
Figure 1. Tyrosine phosphorylation of STATs in normal and LS fibroblasts. Normal (N4) or LS (H1, M1, M2) fibroblasts were treated for 15 min with media alone (Cont), 200 ng/ml rhGH or 100 ng/ml rhEGF and lysates prepared as described in Materials and Methods. Lysates were incubated with antibody for either STAT1 (top panels), STAT3 (middle panels), or STAT5b (bottom panels). Immunoprecipitates (IPs) were then analyzed by Western blotting with antiphosphotyrosine (top panels of each IP or the corresponding STAT antibody (bottom panels). Arrows on the right indicate the specific band in each case.
|
|
We next investigated activation of the kinases responsible for phosphorylating the STAT proteins, JAK2 in response to GH and the EGFR in response to EGF. As shown in Fig. 2A
, GH activated the tyrosine phosphorylation of JAK2 in normal human fibroblasts, as it did in IM-9 lymphocytes as seen previously (23). However, there was no detectable GH- induced JAK2 tyrosine phosphorylation in the three LS fibroblasts. In contrast, EGF induced the tyrosine phosphorylation of the EGFR in the normal and all three LS fibroblasts (Fig. 2B
). Although we did detect different amounts of EGFR in the four human fibroblast lines, the amount of EGFR did not depend on the phenotype of the fibroblasts (normal vs. LS). The EGFR levels did, however, correlate with the level of EGF-induced STAT activation, particularly of STAT1 and STAT3 (Fig. 1
). We have found a similar correlation between EGFR and EGF-induced STAT activation in other human and mouse cell lines (Kloth, M., K. Laughlin, and C. Silva, unpublished data).

View larger version (51K):
[in this window]
[in a new window]
|
Figure 2. Tyrosine phosphorylation of JAK2 and EGFR kinases in normal and LS fibroblasts. Normal (N4) or LS (H1, M1, M2) fibroblasts or human IM-9 lymphocytes were treated and detergent lysates isolated as described in Fig. 1 and Materials and Methods. Lysates were incubated with either anti-JAK2 antibody (A) or anti-EGFR antibody (B). Immunoprecipitates (IP) were analyzed by Western blotting with antiphosphotyrosine (top panels) or anti-JAK2 (A, bottom panel) and anti-EGFR (B, bottom panel).
|
|
The data to this point indicate that GH signaling to the JAK-STAT pathway is defective in LS fibroblasts. Because GH is also known to induce the MAPK pathway, we next investigated MAPK activation in normal and LS fibroblasts using an in vitro kinase assay (see Materials and Methods). We first determined the maximal time and dose at which GH activates MAPK in the human fibroblast system. Treatment of normal fibroblasts with 200 ng/ml GH resulted in the transient activation of MAPK with maximal activity seen after 5 min and returning to basal levels after 30 min (Fig. 3
, left panel). Incubation of normal fibroblasts for 5 min with a range of GH concentrations (02000 ng/ml) elicited a bell-shaped curve for activation of MAPK (Fig. 3
, right panel). Significant activation over basal was detected at 5 ng/ml GH, rising to a maximum at 200 ng/ml, before declining at 2000 ng/ml. This bell-shaped curve of activation is characteristic of required dimerization of the receptor by one GH molecule, with a sequential binding at site 1 and then site 2 (24). This model predicts that a high level of GH would act as an antagonist, inhibiting downstream signaling, as proposed by Fuh et al. (25). Indeed, we have seen previously that high levels of GH inhibit GH-induced activation of tyrosine phosphorylation (26). Figure 3B
demonstrates that a high concentration (2000 ng/ml) of GH begins to inhibit signaling to the MAPK pathway.

View larger version (21K):
[in this window]
[in a new window]
|
Figure 3. Effect of GH on MAPK activity in normal human fibroblasts. In the left panel, normal fibroblasts were treated with 200 ng/ml GH for 030 min and cell extracts assayed for MAPK activity as described in Materials and Methods. Data from seven independent experiments are expressed as mean FI over basal ± SEM. In the right panel, normal fibroblasts were treated for 5 min with a range of GH concentrations (02000 ng/ml) and cell extracts assayed for MAPK activity. Values represent the mean FI ± SEM from a minimum of 15 independent experiments. Significant differences above basal are indicated ( ).
|
|
To investigate the mechanism(s) involved in GH-dependent activation of MAPK, we inhibited PI3K, an enzyme proposed to mediate GH signaling to MAPK in mouse 3T3-F442A fibroblasts (14). We first determined the efficacy of wortmannin by investigating the effect of this inhibitor on p70S6K. As reported previously, p70S6K is activated in response to PI3K in a GH-dependent manner in 3T3-F442A cells (14). Treatment of the mouse 3T3-F442A fibroblast cell line with GH induced the phosphorylation of p70S6K as determined by Western blotting (Fig. 4A
, right panel). This GH-induced phosphorylation of p70S6K was also detected in human fibroblasts (Fig. 4A
, left panel). Pretreatment of both human fibroblasts and mouse 3T3-F442A cells with wortmannin (100 nM) effectively blocked this GH-dependent phosphorylation of p70S6K (Fig. 4A
), indicating that PI3K was inhibited by wortmannin in human fibroblasts. We next investigated whether wortmannin had an effect on GH induction of MAPK in human fibroblasts. Pretreatment of normal fibroblasts with the PI3K inhibitor, wortmannin, at 100 nM for 15 min had no significant effect on basal MAPK activity but did significantly inhibit the ability of GH to activate MAPK (Fig. 4B
). Thus, in human fibroblasts, GH activation of p70S6K and MAPK occurs, at least partially, through PI3K.

View larger version (29K):
[in this window]
[in a new window]
|
Figure 4. The effect of wortmannin on GH signaling. A, Normal human fibroblasts (left panel) or 3T3-F442A mouse preadipocytes (right panel) were pretreated in the absence or presence of wortmannin for 15 min and then treated with or without 200 ng/ml GH for an additional 15 min. Lysates were analyzed by Western blotting with an anti-p70S6k antibody as described in Materials and Methods. The positions of nonphosphorylated and phosphorylated p70S6K are indicated. B, Normal fibroblasts were pretreated in the absence or presence of wortmannin (W) at 100 nM for 15 min before incubation with media alone (Cont) or 200 ng/ml rhGH for 5 min. Cell extracts were assayed for MAPK activity. Values represent 10 independent experiments and are shown as mean picomoles phosphate (PO4) incorporated per milligram of protein ± SEM. These values are: Cont, 352.5 ± 45.4; GH, 615.2 ± 82.7; wortmannin (W), 259.8 ± 73.5; and wortmannin + GH = 342.3 ± 82.8; P less than 0.05.
|
|
Next we investigated the activation of MAPK in response to GH as well as EGF in the normal and LS fibroblasts. At 200 ng/ml, the GH-induced activation of MAPK was 1.75-fold. However, there was no increase above baseline of MAPK activity in either H1 or the M family of LS fibroblasts (Fig. 5A
). In contrast, EGF induced MAPK activity 8.4-fold in normal fibroblasts (Fig. 5B
). This difference in level of MAPK activation by GH, compared with EGF, was also seen by Western blotting with activation specific MAPK antibody (data not shown). Furthermore, EGF induced MAPK activity to levels comparable with normal in both LS fibroblast lines, indicating that the pathway from the EGF receptor to MAPK is intact in LS fibroblasts, in contrast to the GH signaling pathway.

View larger version (24K):
[in this window]
[in a new window]
|
Figure 5. Activation of MAPK in response to GH or EGF. Normal (N4) or LS (H1 and M) fibroblasts were treated for 5 min with 200 ng/ml GH (A) or 10 min with 10 ng/ml EGF (B) and MAPK activity assayed as described in Materials and Methods. Data are presented as mean FI ± SEM and are as follows: (A): N4, 1.76 ± 0.17 (n = 7 independent experiments); H1, 1.08 ± 0.04 (n = 6); M, 1.09 ± 0.08 (n = 9); (B): N4, 8.4 ± 1.6 (n = 19); H1, 7.0 ± 1.1 (n = 11); M, 10.8 ± 2.3 (n = 12).
|
|
Because the data thus far indicate that the defect in GH signaling in the LS fibroblasts occurs close to the GHR itself and before JAK2 activation, we investigated whether transient transfection of the flhGHR could overcome the defect in GH signaling. We used a transfection system in which the flhGHR and LHRR-luc reporter plasmid were cotransfected into human fibroblasts and GH-induced luciferase activity was measured over a dose response of GH treatment (see Materials and Methods). Because skin fibroblasts express relatively few GHRs (<1000/cell), overexpression of exogenous receptor was necessary to obtain GH response of the LHRR-luc. As shown in Fig. 6A
, there is no detectable induction of LHRR-luc in normal fibroblasts at any GH dose; however, addition of flhGHR increases the sensitivity such that an approximately 4-fold induction of LHRR-luc is seen at 200 ng/ml of GH. Using this same assay system, we also transfected the flhGHR into the two LS fibroblast lines to determine whether exogenous expression could overcome their defect in GH signaling. As shown in Fig. 6B
, transfection of the flhGHR into H1 fibroblasts resulted in a GH-induced activation of LHRR-luc to a maximum of approximately 5-fold at 200 ng/ml GH. In contrast, expression of GHR in M1 fibroblasts did not result in GH-induced activation at any dose, indicating that exogenous GHR cannot overcome the defect in these cells.

View larger version (31K):
[in this window]
[in a new window]
|
Figure 6. Activation of LHRR-luc by exogenously expressed GHR. Normal (A) or LS (B) fibroblasts were transiently cotransfected with a plasmid containing the coding sequence for the flhGHR or empty vector (pcDNA1) and a reporter plasmid containing the STAT5 response element (LHRR) linked to luciferase (luc). Cells were treated for 24 h ± GH and luciferase activity assayed from cell lysates. A, Values are reported as FI ± SEM and are from eight independent experiments. Cells transfected with the empty vector (pcDNA1) showed minimal GH-induction of luciferase: 1.23 ± 0.26, 1.31 ± 0.23, and 1.26 ± 0.24 at 20, 200, and 2000 ng/ml respectively. Cells transfected with the GHR showed increased luciferase activity at all doses: 1.98 ± 0.24, 3.75 ± 1.04, and 2.55 ± 1.10. B, Values are reported as a ratio of FI in luciferase activity with exogenously transfected GH receptor (+GHR) over that without exogenous GH receptor (-GHR). For H1, the average FIs (+GHR/-GHR) from two separate experiments were 2.73 ± 1.38, 5.11 ± 0.02, and 3.44 ± 2.69 (at 20, 200, and 2000 ng/ml), respectively; and for M1 the average FIs (+GHR/-GHR) from three separate experiments were 1.28 ± 0.25, 1.62 ± 0.59, and 1.48 ± 0.50.
|
|
The results shown in Fig. 6
indicate that increased expression of the GHR in H1 cells can overcome the defects in signaling, at least with respect to transcriptional activation of a STAT5 response element. As published previously, the H1 Laron fibroblasts are heterozygous for the D152H mutation (12). This D152H mutation, in the dimerization domain of the GHR, is also present in the unaffected father and an unaffected brother, providing strong evidence that this is not the sole defect responsible for GH insensitivity. To investigate the role of the D152H mutation more directly, we used a 293HEK cell system in which we transfected increasing levels of the D152H form of the GHR, compared with the flhGHR. As shown in Fig. 7
, a ratio of 1:9 (wt:D152H) is required to detect a decrease in GH-stimulated luciferase activity. Even at a 1:4 ratio, well above the 1:1.5 ratio measured in the affected subject, H1 (12), there is no effect on GH-induced transcriptional activation of the STAT5 promoter. Together, these results indicate that another signaling defect besides the D152H mutation plays a role in the GH insensitivity of the H1 fibroblasts.

View larger version (30K):
[in this window]
[in a new window]
|
Figure 7. Effect of D152H mutant on GH signaling by the wild-type GHR. 293HEK cells were transiently transfected with 1, 2.5, or 5 µg of flhGHR alone (WT) or increasing concentrations of the D152H mutant GHR at 4 µg:1 µg, 2.5 µg:2.5 µg, 1 µg:4 µg, and 0.5 µg:4.5 µg, or 5 µg of the D152H mutant alone (D152H). The values are shown as FI (+GHR/-GHR) with each point done in triplicate at 200 ng/ml GH. The values are 5.16, 4.52, 3.45, 4.57, 5.43, 4.71, 2.22, and 0.72, respectively. Similar results were found with 20 and 2000 ng/ml GH.
|
|
 |
Discussion
|
|---|
Nature has provided us with a human model system that allows investigation of the mechanisms required for GH signaling. This model is the GHBP-positive LS. In two families of LS, three members of which we have characterized (H1, M1, M2), GHR defects do not account for the phenotype of GH insensitivity (12). Furthermore, in vitro in human fibroblasts, pathways normally activated by GH are unable to be activated in LS fibroblasts. Our previous work using EMSA demonstrated GH signaling to the STAT pathway in normal human fibroblasts and provided evidence that STAT1/5 was not activated in H1 and weakly activated in family M (13). In the data presented here, we demonstrate that STAT1 and STAT5b are tyrosine phosphorylated in response to both GH and EGF treatment of normal human fibroblasts (Fig. 1
). In contrast, GH does not stimulate the tyrosine phosphorylation of either STAT1 or STAT5b in LS fibroblasts, but EGF does. Thus, signaling to the STAT pathway is abnormal only in response to GH, indicating that the defect is specific to the GHR. The discrepancy between the results from EMSA vs. Western blotting in family M may reflect a difference in the sensitivity of these techniques. However, transcriptional assays, which reflect functional activity of the STAT5 protein, correspond to the Western blotting results and indicate that GH does not activate STAT5 (see below).
GHRs and EGFRs have different activation pathways leading to STAT signaling. That is, the EGFR, itself a tyrosine kinase, is able to directly phosphorylate the STAT proteins and the GH receptor signals through activation of the intracellular tyrosine kinase, JAK2 (21). Investigation of the activation of JAK2 in response to GH in normal and LS fibroblasts demonstrate that although GH can activate JAK2 in normal fibroblasts, it does not activate this kinase in the LS fibroblasts (Fig. 2
). These results point toward the defect in GH signaling being between the GHR and activation of the JAK2 tyrosine kinase. In contrast, EGF-induced tyrosine phosphorylation of the EGFR in LS fibroblasts provides further evidence that the EGFR signaling pathway is intact in these cells.
In addition to the JAK/STAT pathway, we also investigated the MAPK pathway, which has been shown in a number of cell lines to be activated by GH. In cell lines, particularly the mouse preadipocyte cell line, 3T3-F442A, GH activates MAPK through two pathways, one involving Grb2/Shc/Ras/Raf/MEK/MAPK and the other involving signaling through PI3K (27, 28). In the 3T3-F442A cell line, GH activation of PI3K also leads to the activation of the p70S6k. We demonstrate here for the first time that both MAPK and p70S6k are activated by GH in normal human fibroblasts (Figs. 3
and 4
). Studies with wortmannin, a PI3K inhibitor, demonstrate that the GHR-PI3K-MAPK pathway is functional in normal human fibroblasts. In contrast, GH is unable to activate MAPK in the LS fibroblasts, demonstrating a defect in this pathway also. EGF signaling to the MAPK pathway is intact in both normal and LS fibroblasts (Fig. 5
).
Because the defect in GH signaling in LS fibroblasts apparently resides close to the GHR itself, we investigated whether transient transfection of the GHR into these cells could overcome the defect in GH signaling. To assay GH signaling in these cells, we cotransfected the cells with the STAT5 response element upstream of the reporter, LHRR-luc. We found that transfection of the GHR into normal fibroblasts increased the GH response at the LHRR-luc to almost 4-fold over control (Fig. 6
). Cotransfection of the GHR into the H1 fibroblasts also increased the GH response (5-fold). This result demonstrates that excess GHR can overcome the defect in these cells. As discussed previously, H1 has a heterozygous D152H mutation in the dimerization domain of the receptor. However, our in vitro studies in 293HEK cells demonstrated that a 9-fold excess (over wild type) of the D152H-expressing plasmid was needed to inhibit signaling (Fig. 7
). The allelic ratio of wt:D152H in H1 is 40:60 (12), which might suggest minimal effects on GH signaling. However, Esposito et al. (8) have reported that the human form of the D152H receptor is not even expressed as efficiently as the wt GHR, suggesting further that a 40:60 ratio of wt:D152H alleles would not account solely for the GH insensitivity seen. Because GH signaling to STAT5 is restored with transfection of normal GHR, we hypothesize (1) that the defect in H1 must associate with the receptor and can be overcome in the presence of excess normal receptor, and in these circumstances (2) the D152H mutation might contribute to GH insensitivity. In contrast, overexpression of the GHR in the M1 and M2 LS fibroblasts did not restore GH signaling, thus indicating a unique mechanism of inhibition of GH signaling distinct from that seen in H1. Our preliminary studies in which an expression plasmid for JAK2 was transfected into M1 and normal human fibroblasts were inconclusive. We found that expression of JAK2 increased basal LHRR-luc activity in both normal and M1 fibroblasts (average of 2.4-fold). This baseline increase in luciferase activity with JAK2 made it difficult to detect a GH effect. Furthermore, expression of JAK2 also nonspecifically increased luciferase activity through the thymidine kinase promoter. Nevertheless, two separate experiments indicated that although GH was able to increase LHRR-luc activity in JAK2 overexpressing normal fibroblasts (
2-fold above basal), the GH effect was inconsistent in M1 LS fibroblasts (data not shown). Further investigation will require use of a different reporter plasmid.
There are a number of proteins that have recently been identified to be inhibitors of cytokine signaling. These include the phosphatase SHP-1, the suppressor of cytokine signaling (SOCS) family of proteins, and the protein inhibitors of activated STATs (29, 30, 31, 32, 33). Stofega et al. (30) have recently described the SIRP
1, which acts as a negative regulator of GHR/JAK2 signaling. Our future studies will focus on investigation of these proteins as potential candidates for specifically inhibiting GH receptor signaling. For example, both SOCS1 and SOCS3 inhibit GH-mediated transcription, including STAT5 activation (34). Although SOCS1 inhibits the tyrosine kinase activity of the JAK2 tyrosine kinase directly, SOCS3 inhibits JAK2 only when stimulated by the GHR (34, 35). In 3T3-F442A preadipocytes, GH has been shown to regulate SOCS3 mRNA (36). Our preliminary studies (not shown) indicate that neither SOCS1 nor SOCS3 is abnormally expressed or regulated in LS fibroblasts.
In summary, we have not only detailed GH signaling in a normal target cell type, the human fibroblast, but have gained insight into the GH insensitivity present in LS fibroblasts. The defect in signaling appears to be specific for the GHR and lies upstream of the JAK2 kinase. In one of the LS families, this defect can be overcome by expressing exogenously the GHR, indicating that there may exist a simple competitive inhibitor at the GHR. In the other GHBP-positive family, GHR overexpression does not abrogate the GH insensitivity, indicating the presence of another distinct GH signaling defect. These experiments confirm that GH signal transduction defects can account for the Laron syndrome and suggest that the role of GHR-specific inhibitors of signaling should be investigated.
 |
Footnotes
|
|---|
This work was supported in part by NIH Grant DK-48481 and National Science Foundation-funded Center for Biological Timing Grant 8920162 (to C.M.S.).
Abbreviations: EGF, Epidermal growth factor; EGFR, EGF receptor; FBS, fetal bovine serum; FI, fold induction; flhGHR, full-length human GH receptor; GHBP, GH-binding protein; GHR, GH receptor; JAK, Janus kinase; LHRR, lactogenic hormone response region; LHRR-luc, LHRR linked to a luciferase reporter gene; LS, Laron syndrome; p70S6K, phosphorylation of ribosomal protein S6 kinase; PI3K, phosphatidylinositol 3-kinase; PMSF, phenylmethylsulfonylfluoride; rhEGF, recombinant human EGF; rhGH, recombinant human GH; SOCS, suppressor of cytokine signaling; STAT, signal transducer and activator of transcription.
Received August 3, 2001.
Accepted for publication March 20, 2002.
 |
References
|
|---|
-
Laron Z, Pertzelan A, Mannheimer S 1966 Genetic pituitary dwarfism with high serum concentration of growth hormonea new inborn error of metabolism? Isr J Med Sci 2:152155[Medline]
-
Laron Z, Klinger B 1994 Laron syndrome: clinical features, molecular pathology and treatment. Horm Res 42:198202[Medline]
-
Rosenfeld R, Rosenbloom A, Guevara-Aguirre J 1994 Growth hormone (GH) insensitivity due to primary GH deficiency. Endocr Rev 15:369390[Abstract]
-
Clayton PE, Freeth JS, Whatmore AJ, Ayling RM, Norman MR, Silva CM 1999 Signal transduction defects in growth hormone insensitivity. Acta Paediatr Suppl 88:174178; discussion 179[Medline]
-
Rosenbloom AL, Guevara-Aguirre J 1998 Lessons from the genetics of Laron syndrome. Trends Endocrinol Metab 9:276283[Medline]
-
Savage MO, Woods KA, Johnston LB, Postel-Vinay MC, Amselem S, Clark AJ 1999 Defects of the growth hormone receptor and their clinical implications. Growth Hormone IGF Res 9(Suppl A):5761
-
Duquesnoy P, Sobrier M-L, Duriez B, Dastot F, Buchanan C, Savage M, Preece M, Craescu C, Blouquit Y, Goossens M, Amselem S 1994 A single amino acid substitution in the exoplasmic domain of the human growth hormone (GH) receptor confers familial GH resistance (Laron syndrome) with positive GH-binding activity by abolishing receptor homodimerization. EMBO J 13:13861395[Medline]
-
Esposito N, Wojcik J, Chomilier J, Martini JF, Kelly PA, Finidori J, Postel-Vinay MC 1998 The D152H mutation found in growth hormone insensitivity syndrome impairs expression and function of human growth hormone receptor but is silent in rat receptor. J Mol Endocrinol 21:6172[Abstract]
-
Silbergeld A, Dastot F, Klinger B, Kanety H, Eshet R, Amselem S, Laron Z 1997 Intronic mutation in the growth hormone (GH) receptor gene from a girl with Laron syndrome and extremely high serum GH binding protein: extended phenotypic study in a very large pedigree. J Pediatr Endocrinol Metab 10:265274[Medline]
-
Woods K, Fraser N, Postel-Vinay M-C, Savage M, Clark A 1996 A homozygous splice site mutation affecting the intracellular domain of the growth hormone (GH) receptor resulting in Laron syndrome with elevated GH-binding protein. J Clin Endocrinol Metab 81:16861690[Abstract]
-
Laron Z, Klinger B, Eshet R, Kanety H, Karasik A, Silbergeld A 1993 Laron syndrome due to a post-receptor defect: response to IGF-1 treatment. Isr J Med Sci 29:757763[Medline]
-
Freeth J, Ayling R, Whatmore A, Towner P, Price D, Norman M, Clayton P 1997 Human skin fibroblasts as a model of growth hormone (GH) action in GH receptor-positive Larons syndrome. Endocrinology 138:5561[Abstract/Free Full Text]
-
Freeth J, Silva C, Whatmore AJ, Clayton P 1998 Activation of the signal transducers and activators of transcription signalling pathway by growth hormone (GH) in skin fibroblasts from normal and GH binding protein-positive Laron syndrome children. Endocrinology 139:2028[Abstract/Free Full Text]
-
Kilgour E, Gout I, Anderson NG 1996 Requirement for phosphoinositide 3-OH kinase in growth hormone signalling to the mitogen-activated protein kinase and p70s6k pathways. Biochem J 315:517522
-
Laemmli UK 1970 Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680685[CrossRef][Medline]
-
Silva C, Day R, Weber M, Thorner M 1993 Human growth hormone (GH) receptor is characterized as the 134-kilodalton tyrosine-phosphorylated protein activated by GH treatment in IM-9 cells. Endocrinology 133:23072312[Abstract]
-
Silva C, Lu H, Day R 1996 Characterization and cloning of STAT5 from IM-9 cells and its activation by growth hormone. Mol Endocrinol 10:508518[Abstract]
-
Welsh G, Foulstone E, Young S, Tavare J, Proud C 1994 Wortmannin inhibits the effects of insulin and serum on the activities of glycogen synthase kinase-3 and mitogen-activated protein kinase. Biochem J 303:1520
-
Love DW, Whatmore AW, Clayton PE, Silva CM 1998 Growth hormone stimulation of the MAP kinase pathway is cell type specific. Endocrinology 139:19651971[Abstract/Free Full Text]
-
Herrington J, Smit LS, Schwartz J, Carter-Su C 2000 The role of STAT proteins in growth hormone signaling. Oncogene 19:25852597[CrossRef][Medline]
-
Horvath CM 2000 STAT proteins and transcriptional responses to extracellular signals. Trends Biochem Sci 25:496502[CrossRef][Medline]
-
Williams JG 2000 STAT signalling in cell proliferation and in development. Curr Opin Genet Dev 10:503507[CrossRef][Medline]
-
Silva CM, Lu H, Weber MJ, Thorner MO 1994 Differential tyrosine phosphorylation of JAK1, JAK2, and STAT1 by growth hormone and interferon-
in IM-9 cells. J Biol Chem 269:2753227539[Abstract/Free Full Text]
-
Cunningham B, Ultsch M, DeVos A, Mulkerrin M, Clauser K, Wells J 1991 Dimerization of the extracellular domain of the human growth hormone receptor by a single hormone molecule. Science 254:821825[Abstract/Free Full Text]
-
Fuh G, Cunningham B, Fukunaga R, Nagata S, Goeddel D, Wells J 1992 Rational design of potent antagonists to the human growth hormone receptor. Science 256:16771680[Abstract/Free Full Text]
-
Silva C, Weber M, Thorner M 1993 Stimulation of tyrosine phosphorylation in human cells by activation of the growth hormone receptor. Endocrinology 132:101108[Abstract]
-
Anderson N 1992 Growth hormone activates mitogen-activated protein kinase and S6 kinase and promotes intracellular tyrosine phosphorylation in 3T3-F442A preadipocytes. Biochem J 284:649652
-
Anderson NG, Kilgour E 1995 Differential effects of wortmannin on growth hormone dependent signalling pathways in 3T3-F442A cells. Biochem Soc Trans 23:197S
-
Hilton DJ 1999 Negative regulators of cytokine signal transduction. Cell Mol Life Sci 55:15681577[CrossRef][Medline]
-
Stofega MR, Argetsinger LS, Wang H, Ullrich A, Carter-Su C 2000 Negative regulation of growth hormone receptor/JAK2 signaling by signal regulatory protein alpha. J Biol Chem 275:2822228229[Abstract/Free Full Text]
-
Starr R, Willson TA, Viney EM, Murray LJL, Rayner JR, Jenkins BJ, Gonda TJ, Alexander WS, Metcalf D, Nicola NA, Hilton DJ 1997 A family of cytokine-inducible inhibitors of signaling. Nature 387:917928[CrossRef][Medline]
-
Starr R, Hilton DJ 1998 SOCS: suppressors of cytokine signalling. Int J Biochem Cell Biol 30:10811085[CrossRef][Medline]
-
Starr R, Hilton DJ 1999 Negative regulation of the JAK/STAT pathway. Bioessays 21:4752[CrossRef][Medline]
-
Hansen JA, Lindberg K, Hilton DJ, Nielsen JH, Billestrup N 1999 Mechanism of inhibition of growth hormone receptor signaling by suppressor of cytokine signaling proteins. Mol Endocrinol 13:18321843[Abstract/Free Full Text]
-
Nicholson SE, Hilton DJ 1998 The SOCS proteins: a new family of negative regulators of signal transduction. J Leukoc Biol 63:665668[Abstract]
-
Adams TE, Hansen JA, Starr R, Nicola NA, Hilton DJ, Billestrup N 1998 Growth hormone preferentially induces the rapid, transient expression of SOCS-3, a novel inhibitor of cytokine receptor signaling. J Biol Chem 273:12851287[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
M. O Savage, C. Camacho-Hubner, A. David, L. A Metherell, V. Hwa, R. G Rosenfeld, and A. J L Clark
Idiopathic short stature: will genetics influence the choice between GH and IGF-I therapy?
Eur. J. Endocrinol.,
August 1, 2007;
157(suppl_1):
S33 - S37.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. O. L. Jorgensen, N. Jessen, S. B. Pedersen, E. Vestergaard, L. Gormsen, S. A. Lund, and N. Billestrup
GH receptor signaling in skeletal muscle and adipose tissue in human subjects following exposure to an intravenous GH bolus
Am J Physiol Endocrinol Metab,
November 1, 2006;
291(5):
E899 - E905.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Goldshmit, C. E. Walters, H. J. Scott, C. J. Greenhalgh, and A. M. Turnley
SOCS2 Induces Neurite Outgrowth by Regulation of Epidermal Growth Factor Receptor Activation
J. Biol. Chem.,
April 16, 2004;
279(16):
16349 - 16355.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Hwa, B. Little, E. M. Kofoed, and R. G. Rosenfeld
Transcriptional Regulation of Insulin-like Growth Factor-I by Interferon-{gamma} Requires STAT-5b
J. Biol. Chem.,
January 23, 2004;
279(4):
2728 - 2736.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. M. Kofoed, V. Hwa, B. Little, K. A. Woods, C. K. Buckway, J. Tsubaki, K. L. Pratt, L. Bezrodnik, H. Jasper, A. Tepper, et al.
Growth Hormone Insensitivity Associated with a STAT5b Mutation
N. Engl. J. Med.,
September 18, 2003;
349(12):
1139 - 1147.
[Full Text]
[PDF]
|
 |
|