help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Scarpace, P. J.
Right arrow Articles by Tümer, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Scarpace, P. J.
Right arrow Articles by Tümer, N.
Endocrinology Vol. 143, No. 8 3026-3035
Copyright © 2002 by The Endocrine Society


ARTICLE

Leptin-Induced Leptin Resistance Reveals Separate Roles for the Anorexic and Thermogenic Responses in Weight Maintenance

Philip J. Scarpace, Michael Matheny, Yi Zhang, Eugene W. Shek, Victor Prima, Sergei Zolotukhin and Nihal Tümer

Geriatric Research (P.J.S., M.M., E.W.S., N.T.), Education and Clinical Center, Department of Veterans Affairs Medical Center, Gainesville, Florida 32608-1197; and Departments of Pharmacology and Therapeutics (P.J.S., M.M., Y.Z., E.W.S., N.T.) and Molecular Genetics (V.P., S.Z.), University of Florida College of Medicine, Gainesville, Florida 32610

Address all correspondence and requests for reprints to: Philip J. Scarpace, Ph.D., Geriatric Research, Education and Clinical Center (182), Department of Veterans Affairs Medical Center, Gainesville, Florida 32608-1197. E-mail: . scarpace{at}ufl.edu


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The purpose of this study was to determine whether leptin induces leptin resistance by examining the temporal attenuation of the anorexic and energy expenditure responses to leptin. We administered recombinant adeno-associated virus encoding rat leptin cDNA or control viral vector into mildly obese rats for 138 d and compared these results with those from pair-fed rats. We measured food consumption, body weight, oxygen consumption, leptin signal transduction, and brown adipose tissue uncoupling protein 1. The anorexic response attenuated by d 25, whereas the increase in energy expenditure persisted for 83 d before attenuating. Despite attenuation of physiological responses, phosphorylated signal transducer and activator of transcription-3 remained elevated for the duration of the study. The temporal differential attenuation of the anorexic and thermogenic responses allowed us to determine the relative contributions of each response to weight maintenance. The anorexic response predominantly mediated the initial loss of body weight, but only the energy expenditure response was necessary to maintain the reduced weight. This study provides evidence that leptin induces leptin resistance. The leptin resistance was associated with persistent elevation in hypothalamic phosphorylated signal transducer and activator of transcription-3 and was characterized by a rapid attenuation of the anorexic response and slower onset for the attenuation of the energy expenditure response. We propose that both elevated leptin and obesity may be necessary for the development of leptin resistance.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
LEPTIN RESISTANCE IS apparent in obese rodents and humans. Rodents made obese by a high-fat diet have impaired responses to exogenously administered leptin, and this leptin resistance becomes more pronounced with progressive degrees of obesity (1, 2, 3). This form of obesity is accompanied by elevated serum leptin, and that obesity persists despite the elevated leptin, which should promote weight loss (4, 5). Whether the elevated leptin associated with obesity contributes to leptin resistance or is simply secondary to the consequence of obesity is a matter of speculation.

With long-term sustained elevation of leptin following viral mediated leptin gene delivery, there is no evidence of leptin resistance in lean rats. For example, with recombinant adenoviral-mediated leptin gene delivery to lean rats, the suppression in food intake persisted for the 4-wk duration of the experiment (6). Similarly, with recombinant adeno-associated viral mediated leptin (rAAV-leptin) gene delivery to lean rats, the decrease in food intake persisted for the 6-wk examination period in one study (7) and over a 7.5-wk period in our previous study (8). Thus, leptin alone appears not to be sufficient to induce leptin resistance in lean rats. However, we previously reported that following rAAV-leptin gene delivery to aged-obese rats, although there was an initial decrease in food intake, this anorexic response attenuated after 3 wk (8). These data suggest that factors in addition to leptin, such as obesity or age, are necessary for the development of leptin resistance.

Leptin regulates energy homeostasis by both suppressing food intake and increasing energy expenditure (9). Leptin resistance may involve attenuation of either the anorexic or energy expenditure response to leptin. However, most investigations of leptin resistance have focused only on the attenuation of the anorexic response, and few have addressed attenuation of the energy expenditure component. One indicator of an increase in energy expenditure is an induction in uncoupling protein 1 (UCP1) levels in brown adipose tissue (BAT) (10). UCP1 is a unique protein that uncouples mitochondria, allowing high rates of substrate oxidation and heat production without phosphorylation of adenosine 5' diphosphate (10). In our previous study employing rAAV-leptin gene delivery to aged-obese rats, in addition to the attenuation of the anorexic response, there was an initial increase in UCP1 in BAT that reverted to control level by 7.5 wk, suggesting that the energy expenditure response to leptin also attenuated (8). Unfortunately, the initial responses to leptin were impaired in these aged-obese rats, compared with those in lean rats, thus complicating the examination of the leptin-induced leptin resistance (8). In contrast, middle-aged rats display nearly normal physiological responses to leptin even though they are mildly obese. Whether leptin induces leptin resistance in these rats, and if it does, how the anorexic and energy expenditure components of the leptin resistance attenuate over time was one objective of this study.

Weight maintenance is a function of caloric intake vs. energy expenditure, and diets that restrict caloric intake result in weight loss. The challenge is to maintain that weight loss without major lifestyle modification (11). Resumption of normal dietary patterns usually results in an unfortunate and frustrating regain of the lost weight. Procedures that increase energy expenditure while allowing normal caloric intake may be beneficial in maintaining the weight loss initially achieved through diet. The anorexic response of leptin has been the main focus of most studies, and it is generally believed that the anorexic effect is principally responsible for the leptin-induced weight loss. For example, when short-term leptin treatment is compared with animals pair fed to the amount of food the leptin-treated animals consume, there is no greater weight loss in the leptin-treated, compared with the pair-fed, group (3, 12). Leptin increases energy expenditure, at least partially, through a leptin-induced increase in UCP1-mediated thermogenesis in BAT (13, 14). It is not clear whether the leptin-mediated elevation in BAT thermogenesis participates in long-term weight maintenance, and scant information is available on the relative contributions of the anorexic, compared with the energy expenditure, components of the leptin response to weight management following long-term leptin treatment. Gene delivery of rAAV-leptin to mildly obese rats provides an excellent model to address this issue.

There were two goals in the present study. First, to investigate the leptin-induced leptin resistance, we examined the temporal attenuation of the anorexic and energy expenditure responses to leptin in mildly obese rats. Second, we analyzed the relative contributions of the anorexic and thermogenic responses to weight loss and weight maintenance over an extended period. In particular, we determined whether the thermogenic response alone was sufficient to maintain the reduced weight over an extended period. To this end, we administered recombinant adeno-associated virus encoding rat leptin cDNA (rAAV-leptin) or control viral vector into mildly obese rats for 138 d and compared these results with those from rats pair fed to the amount of food consumed by the rAAV-leptin-treated rats. We measured parameters associated with both food intake and energy expenditure, including daily food consumption, body weight, oxygen consumption, cerebrospinal fluid (CSF) and serum leptin, leptin signal transduction, and BAT UCP1 gene expression and protein level.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animals
Mildly obese, 18-month-old male F-344 x Brown Norway rats were obtained from Harlan Sprague Dawley, Inc. (Indianapolis, IN) under contract with the National Institute on Aging. Upon arrival, rats were examined and remained in quarantine for 1 wk. Animals were cared for in accordance with the principles of the Guide to the Care and Use of Experimental Animals. Rats were housed individually with a 12-h light, 12-h dark cycle (0700–1900 h).

Construction of rAAV vector plasmid
Rat leptin cDNA encoded with pTR-ß-ObW, a generous gift of Roger Unger (University of Texas, Southwestern Medical Center, Dallas, TX) (6), under the control of a chicken ß-actin promoter linked to cytomegalovirus enhancer (15). The chicken ß-actin promoter-driven leptin gene was linked to the humanized green fluorescent protein reporter gene (16) within a dicistronic cassette through an internal ribosome entry site for coordinate expression. The woodchuck hepatitis virus posttranscriptional regulatory element was placed downstream of a dicistronic template to enhance the expression of the transgene (17).

Packaging of rAAV vectors
Vectors were packaged, purified, concentrated, and titered as previously described (18). The titer of rAAV-leptin vector used in this study was 8.28 x 1013 physical particles/ml. The ratio of physical-to-infectious particles was 29. A miniadenovirus helper plasmid pDG was used to produce rAAV vectors with no detectable adenovirus or wild-type AAV contamination. The rAAV vectors purified using iodixanol gradient/heparin-affinity chromatography were more than 99% pure, as judged by the PAAG/silver-stained gel electrophoresis (not shown).

rAAV-leptin administration
Rats were administered a single dose (8.5E9 infectious particles/rat in 3 µl) of either control vector or rAAV-leptin by intracerebroventricular injection into the third cerebral ventricle as previously described (8).

Leptin infusion
Some rats were infused with recombinant mouse leptin (15 µg/d) for 7 d into the lateral ventricle by osmotic minipump. A brain infusion cannula (Durect Corp., Cupertino, CA) was stereotaxically placed into the lateral ventricle using the following coordinates, 1.3 mm posterior to bregma, 1.9 mm lateral to the midsagittal suture, and to a depth of 3.5 mm. The brain infusion cannula was anchored to the skull using acrylic dental cement. A catheter tube was connected from the brain infusion cannula to the osmotic minipump flow moderator. A subcutaneous pocket on the dorsal surface was created using blunt dissection and the osmotic minipump (Durect Corp.) was inserted. The incision was closed with sutures, and rats were kept warm until fully recovered.

O2 consumption
O2 consumption was assessed in up to four rats simultaneously with an Oxyscan analyzer (OXS-4, Omnitech Electronics, Columbus, OH) as described previously (19). Flow rates were 2 liters/min with a 30-sec sampling time at 5-min intervals. The rats were placed to the chamber for 90 min with the O2 consumption values for the last 30 min used in the calculations. Food was not available. Results were expressed as mass adjusted consumption (milliliter per minute-1 per kilogram0.67) and as oxygen consumption per rat (milliliter per minute-1).

Tissue harvesting and preparation
Rats were killed by cervical dislocation less than 85 mg/kg pentobarbital anesthetic. Blood samples were collected by heart puncture, and serum was harvested by a 10-min centrifugation in serum separator tubes. The circulatory system was perfused with 20 ml cold saline, and inguinal, perirenal, and retroperitoneal white adipose tissues as well as BAT and hypothalamus were excised. The hypothalamus was removed by making an incision medial to piriform lobes, caudal to the optic chiasm and anterior to the cerebral crus to a depth of 2–3 mm. For Western analysis, the hypothalamus and BAT were sonicated briefly in 0.3 ml 10 mM Tris-HCl (pH 6.8), 2% sodium dodecyl sulfate, and 0.08 µg/ml okadaic acid. Protease inhibitors, 1 mM phenylmethylsulfonyl fluoride, 0.1 mM benzamidine, and 2 µM leupeptin were also present. Homogenates were immediately boiled for 2 min, cooled on ice, and stored frozen at -70 C. Protein was determined using the DC protein assay kit (Bio-Rad Laboratories, Inc., Hercules, CA). BAT samples were filtered through a 0.45-micron syringe filter (Whatman, Clifton, NJ) to remove lipid particles before protein measurements.

Signal transducer and activator of transcription-3 (STAT3) and phospho-STAT3 assay
Immunoreactive STAT3 and phosphorylated STAT3 were determined with a PhosphoPlus STAT3 (tyrosine 705) antibody kit (New England Biolabs, Beverly, MA). Hypothalamic samples (40 µg) prepared as described above were separated on an SDS-PAGE gel and electrotransferred to nitrocellulose membrane. Immunoreactivity was assessed on separate membranes with antibodies specific to STAT3 (phosphorylated and unphosphorylated) and antibodies specific to tyrosine 705 phosphorylated STAT3. Immunoreactivity is visualized by enhanced chemiluminescent detection (Amersham Life Sciences, Piscataway, NJ) and quantified by video densitometry (Bio-Rad Laboratories, Inc.).

UCP1 protein
Immunoreactive UCP1 in BAT homogenates (20 µg) was determined as described for STAT3, except an antibody specific to rat UCP1 (Linco Research, Inc., St. Charles, MO) was used.

Leptin RIA
Serum leptin levels were measured with a rat leptin RIA kit (Linco Research, Inc.). CSF leptin levels and, in some cases, serum leptin levels were measured using a modified rodent leptin ELISA kit (Crystal Chem, Chicago, IL).

UCP1 and suppressor of cytokine signaling 3 (SOCS3) mRNA levels
Total cellular RNA was extracted using a modification of the method of Chomczynski and Sacchi (20). The integrity of the isolated RNA was verified using agarose gels (1%) stained with ethidium bromide. The RNA was quantified by spectrophotometric absorption at 260 nm using multiple dilutions of each sample. The UCP1 probe, a full-length cDNA clone obtained from Leslie Kozak (Pennington Research Center, Baton Rouge, LA) (21), and SOCS3 cDNA, provided by Christian Bjorbaek (Harvard, Boston, MA) (22), were labeled using a random primer kit (Prime-a-Gene, Promega Corp., Madison, WI). For dot blot analysis, multiple concentrations of the RNA were immobilized on nylon membranes using a dot blot apparatus (Bio-Rad Laboratories, Inc.). The membranes were baked at 80 C for 2 h. The baked membranes were prehybridized in 10 ml Quikhyb (Stratagene, La Jolla, CA) for 20 min, followed by hybridization in the presence of a labeled probe and 100 µg denatured salmon sperm DNA. After hybridization for 2 h at 65 C, the membranes were washed and exposed to a phosphor imaging screen for 48 h. The latent image was scanned using a STORM PhosphorImager and analyzed by ImageQuant Software (Molecular Dynamics, Inc., Sunnyvale, CA).

RT-PCR
Leptin transgene expression was identified by relative quantitative RT-PCR using a QuantumRNA 18S internal standards kit (Ambion, Inc., Austin, TX). Total RNA (3 µg) was treated with RNase-free DNase using a DNA-free kit (Ambion, Inc.) and first-strand cDNA synthesis generated from 1 µg RNA in a 20-µl volume using random primers (Life Technologies, Inc., Carlsbad, CA) containing 200 U of Moloney murine leukemia virus reverse transcriptase (Life Technologies, Inc.). Relative PCR was performed by multiplexing leptin primers (rAAV derived, 5'GGCTCTGACTGACCGCGTTA, native leptin 5' CTGCCAGGGTCTGGTCCATC), and 18s primers and coamplifying for 24 cycles. Linearity for the leptin amplicon was determined to be 20–28 cycles. The optimum ratio of 18s primer to competitor was 1:9. PCR was performed at 61 C annealing temperature for 60 sec and 72 C elongation temperature for 120 sec. The PCR product was electrophoresed on a 5% acrylamide gel and stained with SYBR green (Molecular Probes, Inc., Eugene, OR.) Gels were scanned using a STORM fluorescent imager and digitized data analyzed with ImageQuant Software (Molecular Dynamics, Inc.).

Statistical analysis
Data were analyzed by one-way or two-way ANOVA. When the main effect was significant, a post hoc test (either Tukey-Kramer or Scheffé’s S) was applied to determine individual differences between means. A value of P < 0.05 was considered significant.

Experimental design
Experiment 1.
This experiment consisted of three groups of rats: control, administered control vector (n = 5); pair-fed, administered control vector (n = 10); and rAAV-leptin, administered rAAV-leptin vector (n = 14). Control and rAAV-leptin rats were allowed access to food ad libitum, whereas pair-fed rats were pair fed to the amount of food consumed by the leptin-treated rats. The pair-fed rats began the experiment 1 d later than the rAAV-leptin rats. The amount of food consumed by the leptin-treated group was then provided to the pair-fed group once a day in the evening. Food consumption and body weight were recorded daily to weekly, and whole-body oxygen consumption was assessed periodically over 138 d at which time the rats were killed. Some rAAV-leptin (n = 5) and pair-fed (n = 5) rats were killed at d 10.

Experiment 2.
A second group of rats were administered control vector (n = 10) or rAAV-leptin vector (n = 5) for 138 d. At the end of this period, control vector-treated rats were infused with artificial cerebrospinal fluid (ACSF, n = 5) or recombinant mouse leptin (n = 5), 15 µg/d into the lateral ventricle by minipump for 7 d. The rAAV-leptin vector-administered rats were also administered recombinant mouse leptin in an identical manner. Rats were allowed access to food ad libitum, and food consumption and body weight were recorded daily for 7 d.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Food consumption
Following rAAV-leptin administration, food consumption gradually decreased and became significantly different from control rats by d 5. The reduction in food intake reached a nadir at d 10, amounting to a 30% decrease, compared with rats administered control vector (Fig. 1Go, top). Starting at d 11, the anorexic response began to wane, and food consumption gradually increased over the next 14 d, until by d 25, there was no longer a difference between rAAV-leptin and control rats (Fig. 1Go, top).



View larger version (23K):
[in this window]
[in a new window]
 
Figure 1. Daily food consumption (top), whole-body oxygen consumption (middle), and body mass (bottom) in rats following administration of rAAV-leptin (squares), control vector (closed circles, top and bottom only), and rats administered control vector and pair-fed to the amount of food the rAAV-leptin-treated rats consumed (triangles, middle and bottom only). The rAAV-leptin or control vector was administered at d 0, and rats were killed 138 d later. Top, Values represent the mean of five control and nine rAAV-leptin-treated rats. Representative SE bars are provided for every third day. The bracket indicates the period between d 5 and d 24 in which the food consumption differs between control and rAAV-leptin-treated rats (P < 0.0001 by ANOVA with repeated measures). Middle, Oxygen consumption was assessed 7, 21, 57, and 120 d after vector delivery as indicated by arrows. The first two values represent mean ± SE of 14 rAAV-leptin-treated and 10 pair-fed rats for preexperimental day and d 7. Some pair-fed and rAAV-leptin rats were killed at d 10. Values at d 21, d 57, and d 120 represent mean ± SE of nine rAAV-leptin-treated and five pair-fed rats. P = 0.0004 for difference between rAAV-leptin and pair-fed rats by one-way ANOVA with repeated measures. *, P = 0.025 (d 7), P = 0.003 (d 21), and P = 0.006 (d 57) for difference between rAAV-leptin and pair-fed rats at individual days. Bottom, Values represent the mean of five control, five pair-fed, and nine rAAV-leptin-treated rats. Representative SE bars are provided for every third day. Left arrow (d 27) represents the day that the anorexic response attenuated, after which rats in all three experimental groups consumed the same amount of food. Right arrow (d 83) represents the day that energy expenditure may have attenuated. The rAAV-leptin-treated rats were significantly different from control rats beginning at d 18 and from pair-fed rats beginning at d 34 (P < 0.0001 by ANOVA with repeated measures).

 
Energy expenditure
Whole-body oxygen consumption was assessed before the administration of vectors and at d 7, 21, 57, and 120 after rAAV-leptin or control vector administration. Oxygen consumption was significantly elevated at d 7, 21, and 57 in the rAAV-leptin-treated rats, compared with rats receiving the control vector and pair-fed to the amount of food the rAAV-leptin-treated rats consumed (Fig. 1Go, middle). The difference was most pronounced at 21 d, became smaller at 57 d, and by 120 d there was no longer a difference in oxygen consumption between the rAAV-leptin and pair-fed control rats (Fig. 1Go, middle). Because body weight is less at d 57 and d 120 in rAAV-leptin, compared with the pair-fed group, we also calculated oxygen consumption per rat rather than adjusted to lean body weight. The results remained the same. There were significant increases in oxygen consumption in the rAAV-leptin, compared with the pair-fed, rats at d 7 (7.49 ± 0.16 vs. 6.86 ± 0.15 ml/min per rat, P = 0.01), d 21 (7.27 ± 0.16 vs. 6.36 ± 0.19, P = 0.001), and d 57 (7.06 ± 0.08 vs. 6.65 ± 0.16, P = 0.029) but again no difference at d 120 (6.90 ± 0.14 vs. 7.07 ± 0.19, P = 0.48).

Body weight
All three experimental groups, rAAV-leptin, pair fed, and control, experienced an initial loss in body weight, presumably because of the surgical procedure necessary to administer the vectors. After this period, beginning at d 10, the control rats steadily gained weight over the remainder of the study (Fig. 1Go, bottom). Over the first 27 d, body weight in the rAAV-leptin and pair-fed groups decreased in parallel. When the anorexic response attenuated at d 25 (Fig. 1Go, top), both the rAAV-leptin and the pair-fed groups ceased losing weight (Fig. 1Go, bottom, first arrow). At this point, the pair-fed group began to regain the lost body weight, and by the end of the experiment, the pair-fed rats weighed the same as the control animals. In contrast, after the anorexic response attenuated, the rAAV-leptin group gained little weight between d 27 and d 83 (Fig 1,Go bottom, from first to second arrow). During this period, the weight gain in the rAAV-leptin-treated rats was much less than pair-fed rats, even though the food intake was identical in both the rAAV-leptin and the pair-fed rats after d 27. Moreover, after d 83, at which time there may no longer be elevated energy expenditure, the rAAV-leptin group appeared to have an accelerated weight gain (Fig 1Go, bottom, second arrow).

UCP1 in BAT
Previous data indicated that rAAV-leptin results in an increase in UCP1 protein levels in BAT that may contribute to the increase in energy expenditure following leptin gene delivery (8). We examined BAT UCP1 mRNA and UCP1 protein levels at 10 and 138 d after leptin gene delivery. At d 10, during the period when energy expenditure was elevated, as indicated by augmented oxygen consumption (Fig 1Go, middle), there was a 3-fold increase in UCP1 gene expression and a nearly 2-fold increase in UCP1 protein level in BAT from rAAV-leptin, compared with pair-fed, rats (Fig. 2Go). In contrast, at d 138, when energy expenditure was no longer elevated (Fig. 1Go, middle), there were no differences in either UCP1 gene expression or UCP1 protein levels in BAT among rAAV-leptin, pair-fed, or control group rats (Fig. 2Go).



View larger version (34K):
[in this window]
[in a new window]
 
Figure 2. UCP1 mRNA (top) and UCP1 protein levels (bottom) in BAT at 10 d and 138 d in rats administered the control vector (solid bars), the control vector and pair-fed to the amount of food the rAAV-leptin-treated rats consumed (wide hatched bars), and the rAAV- leptin vector (narrow hatched bars). No control rats were killed at d 10. Values represent the mean ± SE of five pair-fed and five rAAV-leptin (d 10) or five control, five pair-fed, and nine rAAV- leptin-treated (d 138) rats. UCP1 mRNA levels are expressed in arbitrary units per mocrogram RNA. Levels of UCP1 mRNA and UCP1 protein in 10-d pair-fed were set to 100 and SE adjusted proportionally. *, P = 0.013 (UCP1 mRNA) and P = 0.049 (UCP1 protein) for difference between rAAV-leptin and pair-fed rats at d 10.

 
Leptin mRNA expression in the hypothalamus and leptin levels in CSF
To verify that the attenuation of the anorexic and thermogenic responses were not simply caused by silencing of the leptin transgene expression, leptin mRNA was examined in the hypothalamus by relative RT-PCR using a sense primer specific to a region of transgene that is not present in native rat leptin and an antisense primer specific for leptin. By this method, transgene leptin mRNA was identified in all rAAV-leptin-treated rats at 10 and 138 d and was not identified in any of the control-vector-administered rats (Fig. 3Go, top). Leptin transgene was quantified by the ratio of the leptin amplicon relative to the 18S internal standard. By this method the relative amount of transgene leptin mRNA was unchanged between d 10 and d 138 (Fig. 3Go, bottom).



View larger version (28K):
[in this window]
[in a new window]
 
Figure 3. Leptin mRNA in the hypothalamus identified by relative RT-PCR using a sense primer specific for a region of the transgene that is not present in native leptin mRNA and an antisense primer specific for rat leptin. Top, Representative gel of the relative RT-PCR product for the leptin amplicon (upper band) and 18S internal standard (lower band) from three control (C), three rAAV-leptin rats treated for 10 d (10), and three rAAV-leptin rats treated for 138 d (138). Leptin mRNA was identified in all rAAV-leptin-treated rats but in none of the control-vector administered rats. Bottom, Leptin transgene was quantified by the ratio of the leptin amplicon relative to the 18S internal standard, and this ratio was not different between rAAV-leptin treatment for 10 or 138 d. Values represent the mean ± SE of five rats per group.

 
The expression of the leptin transgene resulted in a nearly 40% elevation in leptin levels in the CSF in rAAV-leptin compared with control vector-treated (combined control and pair-fed) rats (138 ± 9.1, n = 5 vs. 94.9 ± 5.5 pg/ml, n = 6, P = 0.002). Because central rAAV-leptin gene delivery results in a decrease in adiposity, endogenous peripheral circulating leptin levels are diminished in the rAAV-leptin, compared with either the control or pair-fed, rats at d 138 (14.7 ± 0.9 ng/ml, control; 16.4 ± 1.2, pair fed; 9.8 ± 1.3, rAAV-leptin, P = 0.0059 for difference with rAAV-leptin). Thus, despite the decrease in peripheral serum leptin, central rAAV-leptin gene delivery increased CSF leptin levels.

Leptin signal transduction in the hypothalamus
The transient nature of the rAAV-leptin-induced anorexic and thermogenic responses prompted us to examine leptin signal transduction during a time when food consumption was diminished and energy expenditure was elevated (d 10) and when neither were different from controls (d 138). The tyrosine phosphorylation of STAT3 was determined in hypothalamic lysates by specific immunoreactivity of phosphorylated STAT3 (P-STAT3). At d 10, there was a 2-fold increase in P-STAT3 in the rAAV-leptin, compared with the pair-fed, rats (Fig. 4Go, top). Similarly, at d 138, there was also nearly a 2-fold increase in P-STAT3 levels in the rAAV-leptin-treated, compared with either control or pair-fed, rats (Fig. 4Go, top). Total STAT3 immunoreactivity (sum of phosphorylated and unphosphorylated STAT3) was unchanged at both d 10 and d 138 (data not shown).



View larger version (34K):
[in this window]
[in a new window]
 
Figure 4. STAT3 phosphorylation identified by P-STAT3 immunoreactivity in the hypothalamus (top) and SOCS3 mRNA levels in the hypothalamus (bottom) in rats administered control vector (solid bars), and pair-fed to the amount of food the rAAV-leptin-treated rats consumed (wide hatched bars) and rAAV-leptin vector (narrow hatched bars). No control rats were killed at d 10. Values represent the mean ± SE of five pair-fed and five rAAV-leptin (d 10) or five control, five pair-fed, and nine rAAV-leptin-treated (d 138) rats. Levels of P-STAT3 in pair-fed at d 10 and control at d 138 were set to 100 and SE adjusted proportionally. Level of SOCS3 mRNA in 10-d pair-fed was set to 100 and SE adjusted proportionally. *, P = 0.0047 (P-STAT3) and P < 0.0001 (SOCS3) for difference with treatment by one-way ANOVA. P < 0.01 for difference between rAAV-leptin-treated and either pair fed or control rats by post hoc analysis.

 
Another indicator of leptin signal transduction is the leptin-induced up-regulation of SOCS3 mRNA levels. Similar to the observations with respect to P-STAT3 levels, SOCS3 mRNA levels were elevated at d 10 in the rAAV-leptin, compared with the pair-fed, rats and remained elevated at d 138 in the rAAV-leptin, compared with either the pair-fed or control, rats (Fig. 4Go, bottom).

Exogenous administration of leptin
To determine whether the rAAV-leptin-treated rats with attenuated leptin responses are resistant to exogenous leptin, recombinant mouse leptin (15 µg/d) was infused into the lateral ventricle for 7 d in rats pretreated with either rAAV-leptin or control vector for 138 d. These rats were also compared with 138-d control vector-treated rats administered ACSF. As expected, in the rats pretreated with only control vector, food intake and body mass decreased following the 7-d infusion with recombinant leptin, compared with the rats infused with ACSF (Fig. 5Go). In contrast, in the rats pretreated with rAAV-leptin for 138 ds, food intake and body mass were unchanged, compared with the rats infused with ACSF (Fig. 5Go).



View larger version (21K):
[in this window]
[in a new window]
 
Figure 5. Daily food consumption (top), and change in body mass (bottom) following a 7-d minipump infusion into the lateral ventricle with either ACSF (open symbols) or recombinant mouse leptin (solid symbols), in rats that were pretreated with control vector (circles) or rAAV-leptin (squares) for 138 d. Values represent the mean ± SE of five rats per group. P < 0.0001 (food consumption or body mass) for difference between control/leptin and control/ACSF by one-way ANOVA with repeated measures between d 4 and d 7.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
It is well documented that diet-induced obesity in rodents results in leptin resistance (2, 3, 23). Moreover, even in the absence of dietary manipulation, rats gradually become obese over time (age-related obesity) and also develop leptin resistance (12, 24, 25). Both diet-induced and age-related obesity is associated with elevated leptin levels. Whether these elevated leptin levels contribute to leptin resistance or are simply secondary to obesity is unknown. Regardless, the presence of leptin resistance limits the use of leptin for the treatment of obesity, and elucidation of the mechanism of leptin resistance is an important key to understanding obesity.

In the present study, we provide evidence that leptin itself can induce leptin resistance in a mildly obese rat model that initially displays normal physiological responses to leptin. Both the anorexic and energy expenditure responses to leptin wane over time following rAAV-leptin treatment. The failure of the rAAV-leptin-treated rats to respond to exogenous recombinant leptin further confirms this leptin-induced leptin resistance. Moreover, the attenuation of the anorexic and energy expenditure responses to leptin develop at different times following leptin treatment. There is rapid attenuation of the anorexic response and slower onset for the attenuation of the energy expenditure response.

Existing data from most investigations using lean rats demonstrate sustained physiological responses to chronic leptin treatment (6, 7, 8), indicating that leptin alone is insufficient to induce leptin resistance in the absence of obesity. In the present study, together with our previous study (8), we examined the development of leptin resistance following long-term leptin gene therapy in three groups of rats of increasing obesity, 3-month-old lean (previous study), 18-month-old mildly obese (present study), and 26-month-old obese (previous study). Lean rats administered rAAV-leptin did not develop leptin resistance over a 46-d period. There was a sustained anorexic response, a reduction in body fat to near zero levels, and an unabated increase in leptin signal transduction. Energy expenditure over time was not assessed in these lean rats, but the thermogenic capacity of BAT, indicated by expression of UCP1, increased over time (8). In the mildly obese rats (the present study), the anorexic and energy expenditure responses attenuated at 25 and 83 d, respectively. In the aged-obese rats, the anorexic response attenuated by d 20, and the thermogenic response reverted to control level before d 46 (8).

These data suggest that the onset of leptin-induced leptin resistance is accelerated by the extent of the obesity, at least in rats. The role of obesity in leptin-induced leptin resistance appears to be different in lean mice. According to Halaas et al. (3), the leptin-mediated anorexic response attenuated 8 d after central infusion of leptin in lean mice, and the increase in energy expenditure attenuated after 2 wk. Similarly, in a transgenic mouse model overexpressing leptin, these lean mice were responsive to leptin at 6–9 wk, but those responses completely attenuated by 36 wk (26). There are several possible explanations for the differences between rats and mice. The smaller stature and limited stored caloric reserves of lean mice may exacerbate the wasting by leptin and may trigger a desensitization to leptin as defense against nutritional deprivation that is different from the obesity-related attenuation of the leptin responses observed in rats. Another possible explanation is that mice are more sensitive to leptin, and thus these studies employed a higher effective biological dose of leptin, compared with the studies in rats. The latter would suggest that suprapharmacological doses of leptin alone might be sufficient to induce leptin resistance in lean animals.

Collectively, these studies, together with the current data, support the notion that leptin, obesity, and perhaps age all contribute to the development of leptin resistance in rats. We further suggest that the extent of the obesity directly influences the time to the onset of leptin resistance. Without obesity, it is not certain whether leptin resistance will develop, but if it does, a longer period of time or higher level of leptin may be necessary. The factor or factors in an obese animal that contributes to development of leptin resistance are unknown. It is possible that these factors may be related to aging rather to obesity or to both.

We previously reported that a single administration of leptin increased hypothalamic phosphorylated STAT3 levels that remained elevated as long as serum leptin was elevated (27). Similarly, both in our previous study in lean and aged-obese rats (8) and in the present study in middle-aged mildly obese rats, there was a sustained elevation of CSF leptin levels that were associated with a persistent elevation in phosphorylated STAT3 levels. These data suggest that the leptin-induced leptin resistance likely occurs downstream of the leptin receptor, perhaps because of impaired regulation of any of the several neuropeptides that mediate leptin action. For example, we previously reported that the regulation of proopiomelanocortin and neuropeptide Y mRNA levels is impaired in leptin-resistant rats (8, 12). The present study also assessed the level of SOCS3, a putative negative regulator of STAT3 phosphorylation. This signal molecule may inhibit the Janus kinase-mediated phosphorylation of STAT3 and is usually up-regulated in response to leptin receptor activation (22). We found that SOCS3 mRNA levels remained elevated over the course of the 138 d of leptin gene therapy, and the elevated SOCS3 did not prevent the sustained induction of STAT3 phosphorylation. One possible explanation for this observation is that leptin, along with many other ligands for the so-called gp130 receptor family such as IL-6, IL-11, oncostatin M, leukemia inhibitory factor, and ciliary neurotrophic factor share a common Janus kinase-STAT signaling pathway that promotes phosphorylation of STAT3 (22, 28, 29) and perhaps induces SOCS3. Thus, prolonged leptin treatment may change the levels of other gp130-type receptor ligands, such that the elevated P-STAT3 and SOCS3 levels are a summation of the combined effects from these ligands rather than solely from leptin.

One component of the leptin response is an increase in energy expenditure, and this increase correlates with elevated levels of UCP1 and thermogenesis in BAT (10, 13). Whether the increase in energy expenditure contributes to the leptin-induced weight loss is controversial. When the anorexic component is removed by controlling for food intake through pair feeding, the increase in energy expenditure because of leptin becomes apparent. In the present study, during the period when energy expenditure was elevated, UCP1 protein levels were augmented in rAAV-leptin, compared with pair-fed, rats (d 10). Conversely, UCP1 protein levels were no longer elevated during the period when energy expenditure returned to baseline (d 138). Normally, in response to reduced food consumption, there is a shift toward whole-body energy conservation. The leptin-evoked increase in energy expenditure counteracts the normal energy conservation because of reduced food intake, thus maximizing the weight-reducing effects of the leptin-mediated decrease in food intake. The implication is that food reduction primarily accounts for the leptin-mediated weight loss, and the role of increased energy expenditure is merely supportive. However, the present study provides evidence for a more important role for increased energy expenditure in weight maintenance.

This contribution was revealed by examination of the body weight data. Over the first 24 d, the rAAV-leptin and pair-fed rats consumed less food than the control rats. Both groups of rats lost the same amount of weight, indicating that the anorexic effect of leptin dominates and thus accounts for all of the decrease in body weight. Then from d 25 to d 83, the rAAV-leptin, pair-fed, and control rats all consumed the same amount of food, but energy expenditure was elevated only in the rAAV-leptin rats. During this period, the pair-fed rats regained the lost weight, whereas the rAAV-leptin rats maintained their body weight at the reduced level. Thus, a stimulated increase in energy expenditure alone maintained the reduced weight even when food intake returned to the preexperimental level. Lastly, the leptin-induced increase in energy expenditure attenuated sometime between d 57 and d 120. At d 83, the slope of the body weight curve began to increase in the rAAV-leptin rats, indicative of accelerated body weight gain. Most likely, this is the point in time when the energy expenditure attenuated, and without the increase in energy expenditure, the rats could no longer maintain the lower body weight and started to regain weight. These data suggest that the anorexic response predominantly mediates the initial leptin-induced weight loss. However, continuation of the anorexic response is not crucial to maintain the reduced weight as long as there is a sustained increase in energy expenditure.

In conclusion, in the presence of mild obesity, leptin can induce leptin resistance. Our previous and current findings support the notion that the development of leptin resistance is a function of elevated leptin, obesity, and perhaps age and that the resistance develops more rapidly in rats with greater obesity. The leptin resistance is accompanied by persistent elevation in hypothalamic P-STAT3 and SOCS3 and is characterized by a rapid attenuation of the anorexic response and a slower onset for the attenuation of the energy expenditure response. Both responses contributed to the regulation of body weight by leptin. The anorexic response predominantly mediates the initial loss of body weight, but only the energy expenditure response is necessary to maintain the reduced weight, suggesting that energy expenditure has an important role in long-term weight management.


    Acknowledgments
 


    Footnotes
 
This work was supported by the Medical Research Service of the Department of Veterans Affairs and National Institute on Aging Grant AG-17047.

Abbreviations: ACSF, Artificial cerebrospinal fluid; BAT, brown adipose tissue; CSF, cerebrospinal fluid; P-STAT3, phosphorylated STAT3; rAAV-leptin, recombinant adeno-associated viral mediated leptin; SOCS3, suppressor of cytokine signaling 3; STAT3, signal transducer and activator of transcription-3; UCP1, uncoupling protein 1.

Received January 22, 2002.

Accepted for publication April 23, 2002.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Caro JF, Kolaczynski JW, Nycem MR, Ohannesian JP, Opentanova I, Goldman WH, Lynn RB, Zhang PL, Sinha MK, Considine RV 1996 Decreased cerebrospinal-fluid/serum leptin ratio in obesity: a possible mechanism for leptin resistance. Lancet 348:159–161[CrossRef][Medline]
  2. Widdowson PS, Upton R, Buckingham R, Arch J, Williams G 1997 Inhibition of food response to intracerebroventricular injection of leptin is attenuated in rats with diet-induced obesity. Diabetes 46:1782–1785[Abstract]
  3. Halaas JL, Boozer C, Blair-West J, Fidahusein N, Denton DA, Friedman JM 1997 Physiological response to long-term peripheral and central leptin infusion in lean and obese mice. Proc Natl Acad Sci USA 94:8878–8883[Abstract/Free Full Text]
  4. Considine RV, Sinha MK, Heiman ML, Kriauciunas A, Stephens TW, Nyce MR, Ohannesian JP, Marco CC, McKee LJ, Bauer TL, Carol JF 1996 Serum immunoreactive-leptin concentrations in normal-weight and obese humans. N Engl J Med 334:292–295[Abstract/Free Full Text]
  5. Frederich RC, Hamann A, Anderson S, Lollmann B, Lowell BB, Flier JS 1995 Leptin levels reflect body lipid content in mice: evidence for diet-induced resistance to leptin action. Nat Med 1:1311–1314[CrossRef][Medline]
  6. Chen G, Koyama K, Yuanm X, Lee Y, Zhou YT, O’Doherty R, Newgard CB, Unger RH 1996 Disappearance of body fat in normal rats induced by adenovirus-mediated leptin gene therapy. Proc Natl Acad Sci USA 93:14795–14799[Abstract/Free Full Text]
  7. Dhillon H, Kalra SP, Kalra PS 2001 Dose-dependent effects of central leptin gene therapy on genes that regulate body weight and appetite in the hypothalamus. Mol Ther 2:139–145
  8. Scarpace PJ, Matheny M, Zhang Y, Tümer N, Frase CD, Shek EW, Hong B, Prima V, Zolotukhin S 2002 Central leptin gene delivery evokes persistent leptin signal transduction in young and aged-obese rats but physiological responses become attenuated over time in aged-obese rats. Neuropharmacology 42:549–562
  9. Ahima RS, Flier JS 2000 Leptin. Annu Rev Physiol 62:413–437[CrossRef][Medline]
  10. Lowell BB, Spiegelman BM 2000 Towards a molecular understanding of adaptive thermogenesis. Nature 404:652–660[Medline]
  11. Blundell JE, Gillett A 2001 Control of food intake in the obese. Obes Res 9(Suppl 4):263S–270S
  12. Scarpace PJ, Matheny M, Moore RL, Tümer N 2000 Impaired leptin responsiveness in aged rats. Diabetes 49:431–435[Abstract]
  13. Scarpace PJ, Matheny M, Pollock BH, Tümer N 1997 Leptin increases uncoupling protein expression and energy expenditure. Am J Physiol 273:E226–E230
  14. Scarpace PJ, Matheny M 1998 Leptin induction of UCP1 is dependent on sympathetic Innervation. Am J Physiol 275:E259–E264
  15. Miyazaki J, Takaki S, Araki K, Tashiro F, Tominaga A, Takatsu K, Yamamura K 1989 Expression vector system based on the chicken ß-actin promoter directs efficient production of interleukin-5. Gene 79:269–277[CrossRef][Medline]
  16. Klein RL, Meyer EM, Peel AL, Zolotukhin S, Meyers C, Muzyczka N, King MA 1998 Neuron-specific transduction in the rat septohippocampal or nigrostriatal pathway by recombinant adeno-associated virus vectors. Exp Neurol 150:183–194[CrossRef][Medline]
  17. Loeb JE, Cordier WS, Harris ME, Weitzman MD, Hope TJ 1999 Enhanced expression of transgenes from adeno-associated virus vectors with the woodchuck hepatitis virus posttranscriptional regulatory element: implications for gene therapy. Hum Genet Ther 10:2295–2305
  18. Zolotukhin S, Byrne BJ, Mason E, Zolotukhin I, Potter M, Chesnut K, Summerford C, Samulski RJ, Muzyczka N 1999 Recombinant adeno-associated virus purification using novel methods improves infectious titer and yield. Gene Ther 6:973–985[CrossRef][Medline]
  19. Scarpace PJ, Matheny M, Borst SE 1992 Thermogenesis and mitochondrial GDP binding with age in response to the novel agonist CGP-12177A. Am J Physiol 262:E185–E190
  20. Chomczynski P, Sacchi N 1987 Single-step method of RNA isolation by acid guanidinium thiocyanate-phenolchloroform extraction. Anal Biochem 162:156–159[Medline]
  21. Kozak LP, Britton JH, Kozak UC, Wells JM 1998 The mitochondrial uncoupling protein gene. J Biol Chem 263:12272–12277
  22. Bjorbaek C, El-Haschimi K, Frantz JD, Flier JS 1999 The role of SOCS-3 in leptin signaling and leptin resistance. J Biol Chem 274:30059–30065[Abstract/Free Full Text]
  23. Van Heek M, Compton DS, France CF, Tedesco RP, Fawzi AB, Graziano MP, Sybertz EJ, Strader CD, Davis Jr HR 1997 Diet-induced obese mice develop peripheral, but not central, resistance to leptin. J Clin Invest 99:385–390[Medline]
  24. Shek EW, Scarpace PJ 2000 Resistance to the anorexic and thermogenic effects of centrally administered leptin in obese aged rats. Regul Pept 92:65–72[CrossRef][Medline]
  25. Scarpace PJ, Matheny M, Tümer N 2001 Hypothalamic leptin resistance is associated with impaired leptin signal transduction. Neuroscience 104:1111–1117[CrossRef][Medline]
  26. Qiu J, Ogus S, Lu R, Chehab FF 2001 Transgenic mice overexpressing leptin accumulate adipose mass at an older, but not younger, age. Endocrinology 142:348–358[Abstract/Free Full Text]
  27. Scarpace PJ, Matheny M, Shek EW 2000 Impaired leptin signal transduction with age-related obesity. Neuropharmacology 39:1872–1879[CrossRef][Medline]
  28. Heinrich PC, Behrmann I, Muller-Newen G, Schaper F, Graeve L 1998 Interleulin-6-type cytokine signaling through the gp130/Jak/STAT pathway. Biochem J 334:297–314
  29. Heim MH 1999 The Jak-STAT pathway: cytokine signaling from the receptor to the nucleus. J Recept Signal Transduct Res 19:75–120[Medline]



This article has been cited by other articles:


Home page
DiabetesHome page
A. Shapiro, M. Matheny, Y. Zhang, N. Tumer, K.-Y. Cheng, E. Rogrigues, S. Zolotukhin, and P. J. Scarpace
Synergy Between Leptin Therapy and a Seemingly Negligible Amount of Voluntary Wheel Running Prevents Progression of Dietary Obesity in Leptin-Resistant Rats
Diabetes, March 1, 2008; 57(3): 614 - 622.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
E. Krol and J. R Speakman
Regulation of body mass and adiposity in the field vole, Microtus agrestis: a model of leptin resistance
J. Endocrinol., February 1, 2007; 192(2): 271 - 278.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
P. J. Scarpace, M. Matheny, Y. Zhang, K.-Y. Cheng, and N. Tumer
Leptin Antagonist Reveals an Uncoupling between Leptin Receptor Signal Transducer and Activator of Transcription 3 Signaling and Metabolic Responses with Central Leptin Resistance
J. Pharmacol. Exp. Ther., February 1, 2007; 320(2): 706 - 712.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
C. Schulz, K. Paulus, and H. Lehnert
Central Nervous and Metabolic Effects of Intranasally Applied Leptin
Endocrinology, June 1, 2004; 145(6): 2696 - 2701.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. Sahu
Minireview: A Hypothalamic Role in Energy Balance with Special Emphasis on Leptin
Endocrinology, June 1, 2004; 145(6): 2613 - 2620.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
V. Prima, M. Tennant, O. S. Gorbatyuk, N. Muzyczka, P. J. Scarpace, and S. Zolotukhin
Differential Modulation of Energy Balance by Leptin, Ciliary Neurotrophic Factor, and Leukemia Inhibitory Factor Gene Delivery: Microarray Deoxyribonucleic Acid-Chip Analysis of Gene Expression
Endocrinology, April 1, 2004; 145(4): 2035 - 2045.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
D. V. Tortoriello, J. McMinn, and S. C. Chua
Dietary-Induced Obesity and Hypothalamic Infertility in Female DBA/2J Mice
Endocrinology, March 1, 2004; 145(3): 1238 - 1247.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
B. CANNON and J. NEDERGAARD
Brown Adipose Tissue: Function and Physiological Significance
Physiol Rev, January 1, 2004; 84(1): 277 - 359.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. Shklyaev, G. Aslanidi, M. Tennant, V. Prima, E. Kohlbrenner, V. Kroutov, M. Campbell-Thompson, J. Crawford, E. W. Shek, P. J. Scarpace, et al.
Sustained peripheral expression of transgene adiponectin offsets the development of diet-induced obesity in rats
PNAS, November 25, 2003; 100(24): 14217 - 14222.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
R. Pal and A. Sahu
Leptin Signaling in the Hypothalamus during Chronic Central Leptin Infusion
Endocrinology, September 1, 2003; 144(9): 3789 - 3798.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
W. I. Sivitz, S. M. Wayson, M. L. Bayless, L. F. Larson, C. Sinkey, R. S. Bar, and W. G. Haynes
Leptin and Body Fat in Type 2 Diabetes and Monodrug Therapy
J. Clin. Endocrinol. Metab., April 1, 2003; 88(4): 1543 - 1553.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Scarpace, P. J.
Right arrow Articles by Tümer, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Scarpace, P. J.
Right arrow Articles by Tümer, N.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals