| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLE |
Geriatric Research (P.J.S., M.M., E.W.S., N.T.), Education and Clinical Center, Department of Veterans Affairs Medical Center, Gainesville, Florida 32608-1197; and Departments of Pharmacology and Therapeutics (P.J.S., M.M., Y.Z., E.W.S., N.T.) and Molecular Genetics (V.P., S.Z.), University of Florida College of Medicine, Gainesville, Florida 32610
Address all correspondence and requests for reprints to: Philip J. Scarpace, Ph.D., Geriatric Research, Education and Clinical Center (182), Department of Veterans Affairs Medical Center, Gainesville, Florida 32608-1197. E-mail: . scarpace{at}ufl.edu
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
With long-term sustained elevation of leptin following viral mediated leptin gene delivery, there is no evidence of leptin resistance in lean rats. For example, with recombinant adenoviral-mediated leptin gene delivery to lean rats, the suppression in food intake persisted for the 4-wk duration of the experiment (6). Similarly, with recombinant adeno-associated viral mediated leptin (rAAV-leptin) gene delivery to lean rats, the decrease in food intake persisted for the 6-wk examination period in one study (7) and over a 7.5-wk period in our previous study (8). Thus, leptin alone appears not to be sufficient to induce leptin resistance in lean rats. However, we previously reported that following rAAV-leptin gene delivery to aged-obese rats, although there was an initial decrease in food intake, this anorexic response attenuated after 3 wk (8). These data suggest that factors in addition to leptin, such as obesity or age, are necessary for the development of leptin resistance.
Leptin regulates energy homeostasis by both suppressing food intake and increasing energy expenditure (9). Leptin resistance may involve attenuation of either the anorexic or energy expenditure response to leptin. However, most investigations of leptin resistance have focused only on the attenuation of the anorexic response, and few have addressed attenuation of the energy expenditure component. One indicator of an increase in energy expenditure is an induction in uncoupling protein 1 (UCP1) levels in brown adipose tissue (BAT) (10). UCP1 is a unique protein that uncouples mitochondria, allowing high rates of substrate oxidation and heat production without phosphorylation of adenosine 5' diphosphate (10). In our previous study employing rAAV-leptin gene delivery to aged-obese rats, in addition to the attenuation of the anorexic response, there was an initial increase in UCP1 in BAT that reverted to control level by 7.5 wk, suggesting that the energy expenditure response to leptin also attenuated (8). Unfortunately, the initial responses to leptin were impaired in these aged-obese rats, compared with those in lean rats, thus complicating the examination of the leptin-induced leptin resistance (8). In contrast, middle-aged rats display nearly normal physiological responses to leptin even though they are mildly obese. Whether leptin induces leptin resistance in these rats, and if it does, how the anorexic and energy expenditure components of the leptin resistance attenuate over time was one objective of this study.
Weight maintenance is a function of caloric intake vs. energy expenditure, and diets that restrict caloric intake result in weight loss. The challenge is to maintain that weight loss without major lifestyle modification (11). Resumption of normal dietary patterns usually results in an unfortunate and frustrating regain of the lost weight. Procedures that increase energy expenditure while allowing normal caloric intake may be beneficial in maintaining the weight loss initially achieved through diet. The anorexic response of leptin has been the main focus of most studies, and it is generally believed that the anorexic effect is principally responsible for the leptin-induced weight loss. For example, when short-term leptin treatment is compared with animals pair fed to the amount of food the leptin-treated animals consume, there is no greater weight loss in the leptin-treated, compared with the pair-fed, group (3, 12). Leptin increases energy expenditure, at least partially, through a leptin-induced increase in UCP1-mediated thermogenesis in BAT (13, 14). It is not clear whether the leptin-mediated elevation in BAT thermogenesis participates in long-term weight maintenance, and scant information is available on the relative contributions of the anorexic, compared with the energy expenditure, components of the leptin response to weight management following long-term leptin treatment. Gene delivery of rAAV-leptin to mildly obese rats provides an excellent model to address this issue.
There were two goals in the present study. First, to investigate the leptin-induced leptin resistance, we examined the temporal attenuation of the anorexic and energy expenditure responses to leptin in mildly obese rats. Second, we analyzed the relative contributions of the anorexic and thermogenic responses to weight loss and weight maintenance over an extended period. In particular, we determined whether the thermogenic response alone was sufficient to maintain the reduced weight over an extended period. To this end, we administered recombinant adeno-associated virus encoding rat leptin cDNA (rAAV-leptin) or control viral vector into mildly obese rats for 138 d and compared these results with those from rats pair fed to the amount of food consumed by the rAAV-leptin-treated rats. We measured parameters associated with both food intake and energy expenditure, including daily food consumption, body weight, oxygen consumption, cerebrospinal fluid (CSF) and serum leptin, leptin signal transduction, and BAT UCP1 gene expression and protein level.
| Materials and Methods |
|---|
|
|
|---|
Construction of rAAV vector plasmid
Rat leptin cDNA encoded with pTR-ß-ObW, a generous gift of Roger Unger (University of Texas, Southwestern Medical Center, Dallas, TX) (6), under the control of a chicken ß-actin promoter linked to cytomegalovirus enhancer (15). The chicken ß-actin promoter-driven leptin gene was linked to the humanized green fluorescent protein reporter gene (16) within a dicistronic cassette through an internal ribosome entry site for coordinate expression. The woodchuck hepatitis virus posttranscriptional regulatory element was placed downstream of a dicistronic template to enhance the expression of the transgene (17).
Packaging of rAAV vectors
Vectors were packaged, purified, concentrated, and titered as previously described (18). The titer of rAAV-leptin vector used in this study was 8.28 x 1013 physical particles/ml. The ratio of physical-to-infectious particles was 29. A miniadenovirus helper plasmid pDG was used to produce rAAV vectors with no detectable adenovirus or wild-type AAV contamination. The rAAV vectors purified using iodixanol gradient/heparin-affinity chromatography were more than 99% pure, as judged by the PAAG/silver-stained gel electrophoresis (not shown).
rAAV-leptin administration
Rats were administered a single dose (8.5E9 infectious particles/rat in 3 µl) of either control vector or rAAV-leptin by intracerebroventricular injection into the third cerebral ventricle as previously described (8).
Leptin infusion
Some rats were infused with recombinant mouse leptin (15 µg/d) for 7 d into the lateral ventricle by osmotic minipump. A brain infusion cannula (Durect Corp., Cupertino, CA) was stereotaxically placed into the lateral ventricle using the following coordinates, 1.3 mm posterior to bregma, 1.9 mm lateral to the midsagittal suture, and to a depth of 3.5 mm. The brain infusion cannula was anchored to the skull using acrylic dental cement. A catheter tube was connected from the brain infusion cannula to the osmotic minipump flow moderator. A subcutaneous pocket on the dorsal surface was created using blunt dissection and the osmotic minipump (Durect Corp.) was inserted. The incision was closed with sutures, and rats were kept warm until fully recovered.
O2 consumption
O2 consumption was assessed in up to four rats simultaneously with an Oxyscan analyzer (OXS-4, Omnitech Electronics, Columbus, OH) as described previously (19). Flow rates were 2 liters/min with a 30-sec sampling time at 5-min intervals. The rats were placed to the chamber for 90 min with the O2 consumption values for the last 30 min used in the calculations. Food was not available. Results were expressed as mass adjusted consumption (milliliter per minute-1 per kilogram0.67) and as oxygen consumption per rat (milliliter per minute-1).
Tissue harvesting and preparation
Rats were killed by cervical dislocation less than 85 mg/kg pentobarbital anesthetic. Blood samples were collected by heart puncture, and serum was harvested by a 10-min centrifugation in serum separator tubes. The circulatory system was perfused with 20 ml cold saline, and inguinal, perirenal, and retroperitoneal white adipose tissues as well as BAT and hypothalamus were excised. The hypothalamus was removed by making an incision medial to piriform lobes, caudal to the optic chiasm and anterior to the cerebral crus to a depth of 23 mm. For Western analysis, the hypothalamus and BAT were sonicated briefly in 0.3 ml 10 mM Tris-HCl (pH 6.8), 2% sodium dodecyl sulfate, and 0.08 µg/ml okadaic acid. Protease inhibitors, 1 mM phenylmethylsulfonyl fluoride, 0.1 mM benzamidine, and 2 µM leupeptin were also present. Homogenates were immediately boiled for 2 min, cooled on ice, and stored frozen at -70 C. Protein was determined using the DC protein assay kit (Bio-Rad Laboratories, Inc., Hercules, CA). BAT samples were filtered through a 0.45-micron syringe filter (Whatman, Clifton, NJ) to remove lipid particles before protein measurements.
Signal transducer and activator of transcription-3 (STAT3) and phospho-STAT3 assay
Immunoreactive STAT3 and phosphorylated STAT3 were determined with a PhosphoPlus STAT3 (tyrosine 705) antibody kit (New England Biolabs, Beverly, MA). Hypothalamic samples (40 µg) prepared as described above were separated on an SDS-PAGE gel and electrotransferred to nitrocellulose membrane. Immunoreactivity was assessed on separate membranes with antibodies specific to STAT3 (phosphorylated and unphosphorylated) and antibodies specific to tyrosine 705 phosphorylated STAT3. Immunoreactivity is visualized by enhanced chemiluminescent detection (Amersham Life Sciences, Piscataway, NJ) and quantified by video densitometry (Bio-Rad Laboratories, Inc.).
UCP1 protein
Immunoreactive UCP1 in BAT homogenates (20 µg) was determined as described for STAT3, except an antibody specific to rat UCP1 (Linco Research, Inc., St. Charles, MO) was used.
Leptin RIA
Serum leptin levels were measured with a rat leptin RIA kit (Linco Research, Inc.). CSF leptin levels and, in some cases, serum leptin levels were measured using a modified rodent leptin ELISA kit (Crystal Chem, Chicago, IL).
UCP1 and suppressor of cytokine signaling 3 (SOCS3) mRNA levels
Total cellular RNA was extracted using a modification of the method of Chomczynski and Sacchi (20). The integrity of the isolated RNA was verified using agarose gels (1%) stained with ethidium bromide. The RNA was quantified by spectrophotometric absorption at 260 nm using multiple dilutions of each sample. The UCP1 probe, a full-length cDNA clone obtained from Leslie Kozak (Pennington Research Center, Baton Rouge, LA) (21), and SOCS3 cDNA, provided by Christian Bjorbaek (Harvard, Boston, MA) (22), were labeled using a random primer kit (Prime-a-Gene, Promega Corp., Madison, WI). For dot blot analysis, multiple concentrations of the RNA were immobilized on nylon membranes using a dot blot apparatus (Bio-Rad Laboratories, Inc.). The membranes were baked at 80 C for 2 h. The baked membranes were prehybridized in 10 ml Quikhyb (Stratagene, La Jolla, CA) for 20 min, followed by hybridization in the presence of a labeled probe and 100 µg denatured salmon sperm DNA. After hybridization for 2 h at 65 C, the membranes were washed and exposed to a phosphor imaging screen for 48 h. The latent image was scanned using a STORM PhosphorImager and analyzed by ImageQuant Software (Molecular Dynamics, Inc., Sunnyvale, CA).
RT-PCR
Leptin transgene expression was identified by relative quantitative RT-PCR using a QuantumRNA 18S internal standards kit (Ambion, Inc., Austin, TX). Total RNA (3 µg) was treated with RNase-free DNase using a DNA-free kit (Ambion, Inc.) and first-strand cDNA synthesis generated from 1 µg RNA in a 20-µl volume using random primers (Life Technologies, Inc., Carlsbad, CA) containing 200 U of Moloney murine leukemia virus reverse transcriptase (Life Technologies, Inc.). Relative PCR was performed by multiplexing leptin primers (rAAV derived, 5'GGCTCTGACTGACCGCGTTA, native leptin 5' CTGCCAGGGTCTGGTCCATC), and 18s primers and coamplifying for 24 cycles. Linearity for the leptin amplicon was determined to be 2028 cycles. The optimum ratio of 18s primer to competitor was 1:9. PCR was performed at 61 C annealing temperature for 60 sec and 72 C elongation temperature for 120 sec. The PCR product was electrophoresed on a 5% acrylamide gel and stained with SYBR green (Molecular Probes, Inc., Eugene, OR.) Gels were scanned using a STORM fluorescent imager and digitized data analyzed with ImageQuant Software (Molecular Dynamics, Inc.).
Statistical analysis
Data were analyzed by one-way or two-way ANOVA. When the main effect was significant, a post hoc test (either Tukey-Kramer or Scheffés S) was applied to determine individual differences between means. A value of P < 0.05 was considered significant.
Experimental design
Experiment 1.
This experiment consisted of three groups of rats: control, administered control vector (n = 5); pair-fed, administered control vector (n = 10); and rAAV-leptin, administered rAAV-leptin vector (n = 14). Control and rAAV-leptin rats were allowed access to food ad libitum, whereas pair-fed rats were pair fed to the amount of food consumed by the leptin-treated rats. The pair-fed rats began the experiment 1 d later than the rAAV-leptin rats. The amount of food consumed by the leptin-treated group was then provided to the pair-fed group once a day in the evening. Food consumption and body weight were recorded daily to weekly, and whole-body oxygen consumption was assessed periodically over 138 d at which time the rats were killed. Some rAAV-leptin (n = 5) and pair-fed (n = 5) rats were killed at d 10.
Experiment 2.
A second group of rats were administered control vector (n = 10) or rAAV-leptin vector (n = 5) for 138 d. At the end of this period, control vector-treated rats were infused with artificial cerebrospinal fluid (ACSF, n = 5) or recombinant mouse leptin (n = 5), 15 µg/d into the lateral ventricle by minipump for 7 d. The rAAV-leptin vector-administered rats were also administered recombinant mouse leptin in an identical manner. Rats were allowed access to food ad libitum, and food consumption and body weight were recorded daily for 7 d.
| Results |
|---|
|
|
|---|
|
Body weight
All three experimental groups, rAAV-leptin, pair fed, and control, experienced an initial loss in body weight, presumably because of the surgical procedure necessary to administer the vectors. After this period, beginning at d 10, the control rats steadily gained weight over the remainder of the study (Fig. 1
, bottom). Over the first 27 d, body weight in the rAAV-leptin and pair-fed groups decreased in parallel. When the anorexic response attenuated at d 25 (Fig. 1
, top), both the rAAV-leptin and the pair-fed groups ceased losing weight (Fig. 1
, bottom, first arrow). At this point, the pair-fed group began to regain the lost body weight, and by the end of the experiment, the pair-fed rats weighed the same as the control animals. In contrast, after the anorexic response attenuated, the rAAV-leptin group gained little weight between d 27 and d 83 (Fig 1,
bottom, from first to second arrow). During this period, the weight gain in the rAAV-leptin-treated rats was much less than pair-fed rats, even though the food intake was identical in both the rAAV-leptin and the pair-fed rats after d 27. Moreover, after d 83, at which time there may no longer be elevated energy expenditure, the rAAV-leptin group appeared to have an accelerated weight gain (Fig 1
, bottom, second arrow).
UCP1 in BAT
Previous data indicated that rAAV-leptin results in an increase in UCP1 protein levels in BAT that may contribute to the increase in energy expenditure following leptin gene delivery (8). We examined BAT UCP1 mRNA and UCP1 protein levels at 10 and 138 d after leptin gene delivery. At d 10, during the period when energy expenditure was elevated, as indicated by augmented oxygen consumption (Fig 1
, middle), there was a 3-fold increase in UCP1 gene expression and a nearly 2-fold increase in UCP1 protein level in BAT from rAAV-leptin, compared with pair-fed, rats (Fig. 2
). In contrast, at d 138, when energy expenditure was no longer elevated (Fig. 1
, middle), there were no differences in either UCP1 gene expression or UCP1 protein levels in BAT among rAAV-leptin, pair-fed, or control group rats (Fig. 2
).
|
|
Leptin signal transduction in the hypothalamus
The transient nature of the rAAV-leptin-induced anorexic and thermogenic responses prompted us to examine leptin signal transduction during a time when food consumption was diminished and energy expenditure was elevated (d 10) and when neither were different from controls (d 138). The tyrosine phosphorylation of STAT3 was determined in hypothalamic lysates by specific immunoreactivity of phosphorylated STAT3 (P-STAT3). At d 10, there was a 2-fold increase in P-STAT3 in the rAAV-leptin, compared with the pair-fed, rats (Fig. 4
, top). Similarly, at d 138, there was also nearly a 2-fold increase in P-STAT3 levels in the rAAV-leptin-treated, compared with either control or pair-fed, rats (Fig. 4
, top). Total STAT3 immunoreactivity (sum of phosphorylated and unphosphorylated STAT3) was unchanged at both d 10 and d 138 (data not shown).
|
Exogenous administration of leptin
To determine whether the rAAV-leptin-treated rats with attenuated leptin responses are resistant to exogenous leptin, recombinant mouse leptin (15 µg/d) was infused into the lateral ventricle for 7 d in rats pretreated with either rAAV-leptin or control vector for 138 d. These rats were also compared with 138-d control vector-treated rats administered ACSF. As expected, in the rats pretreated with only control vector, food intake and body mass decreased following the 7-d infusion with recombinant leptin, compared with the rats infused with ACSF (Fig. 5
). In contrast, in the rats pretreated with rAAV-leptin for 138 ds, food intake and body mass were unchanged, compared with the rats infused with ACSF (Fig. 5
).
|
| Discussion |
|---|
|
|
|---|
In the present study, we provide evidence that leptin itself can induce leptin resistance in a mildly obese rat model that initially displays normal physiological responses to leptin. Both the anorexic and energy expenditure responses to leptin wane over time following rAAV-leptin treatment. The failure of the rAAV-leptin-treated rats to respond to exogenous recombinant leptin further confirms this leptin-induced leptin resistance. Moreover, the attenuation of the anorexic and energy expenditure responses to leptin develop at different times following leptin treatment. There is rapid attenuation of the anorexic response and slower onset for the attenuation of the energy expenditure response.
Existing data from most investigations using lean rats demonstrate sustained physiological responses to chronic leptin treatment (6, 7, 8), indicating that leptin alone is insufficient to induce leptin resistance in the absence of obesity. In the present study, together with our previous study (8), we examined the development of leptin resistance following long-term leptin gene therapy in three groups of rats of increasing obesity, 3-month-old lean (previous study), 18-month-old mildly obese (present study), and 26-month-old obese (previous study). Lean rats administered rAAV-leptin did not develop leptin resistance over a 46-d period. There was a sustained anorexic response, a reduction in body fat to near zero levels, and an unabated increase in leptin signal transduction. Energy expenditure over time was not assessed in these lean rats, but the thermogenic capacity of BAT, indicated by expression of UCP1, increased over time (8). In the mildly obese rats (the present study), the anorexic and energy expenditure responses attenuated at 25 and 83 d, respectively. In the aged-obese rats, the anorexic response attenuated by d 20, and the thermogenic response reverted to control level before d 46 (8).
These data suggest that the onset of leptin-induced leptin resistance is accelerated by the extent of the obesity, at least in rats. The role of obesity in leptin-induced leptin resistance appears to be different in lean mice. According to Halaas et al. (3), the leptin-mediated anorexic response attenuated 8 d after central infusion of leptin in lean mice, and the increase in energy expenditure attenuated after 2 wk. Similarly, in a transgenic mouse model overexpressing leptin, these lean mice were responsive to leptin at 69 wk, but those responses completely attenuated by 36 wk (26). There are several possible explanations for the differences between rats and mice. The smaller stature and limited stored caloric reserves of lean mice may exacerbate the wasting by leptin and may trigger a desensitization to leptin as defense against nutritional deprivation that is different from the obesity-related attenuation of the leptin responses observed in rats. Another possible explanation is that mice are more sensitive to leptin, and thus these studies employed a higher effective biological dose of leptin, compared with the studies in rats. The latter would suggest that suprapharmacological doses of leptin alone might be sufficient to induce leptin resistance in lean animals.
Collectively, these studies, together with the current data, support the notion that leptin, obesity, and perhaps age all contribute to the development of leptin resistance in rats. We further suggest that the extent of the obesity directly influences the time to the onset of leptin resistance. Without obesity, it is not certain whether leptin resistance will develop, but if it does, a longer period of time or higher level of leptin may be necessary. The factor or factors in an obese animal that contributes to development of leptin resistance are unknown. It is possible that these factors may be related to aging rather to obesity or to both.
We previously reported that a single administration of leptin increased hypothalamic phosphorylated STAT3 levels that remained elevated as long as serum leptin was elevated (27). Similarly, both in our previous study in lean and aged-obese rats (8) and in the present study in middle-aged mildly obese rats, there was a sustained elevation of CSF leptin levels that were associated with a persistent elevation in phosphorylated STAT3 levels. These data suggest that the leptin-induced leptin resistance likely occurs downstream of the leptin receptor, perhaps because of impaired regulation of any of the several neuropeptides that mediate leptin action. For example, we previously reported that the regulation of proopiomelanocortin and neuropeptide Y mRNA levels is impaired in leptin-resistant rats (8, 12). The present study also assessed the level of SOCS3, a putative negative regulator of STAT3 phosphorylation. This signal molecule may inhibit the Janus kinase-mediated phosphorylation of STAT3 and is usually up-regulated in response to leptin receptor activation (22). We found that SOCS3 mRNA levels remained elevated over the course of the 138 d of leptin gene therapy, and the elevated SOCS3 did not prevent the sustained induction of STAT3 phosphorylation. One possible explanation for this observation is that leptin, along with many other ligands for the so-called gp130 receptor family such as IL-6, IL-11, oncostatin M, leukemia inhibitory factor, and ciliary neurotrophic factor share a common Janus kinase-STAT signaling pathway that promotes phosphorylation of STAT3 (22, 28, 29) and perhaps induces SOCS3. Thus, prolonged leptin treatment may change the levels of other gp130-type receptor ligands, such that the elevated P-STAT3 and SOCS3 levels are a summation of the combined effects from these ligands rather than solely from leptin.
One component of the leptin response is an increase in energy expenditure, and this increase correlates with elevated levels of UCP1 and thermogenesis in BAT (10, 13). Whether the increase in energy expenditure contributes to the leptin-induced weight loss is controversial. When the anorexic component is removed by controlling for food intake through pair feeding, the increase in energy expenditure because of leptin becomes apparent. In the present study, during the period when energy expenditure was elevated, UCP1 protein levels were augmented in rAAV-leptin, compared with pair-fed, rats (d 10). Conversely, UCP1 protein levels were no longer elevated during the period when energy expenditure returned to baseline (d 138). Normally, in response to reduced food consumption, there is a shift toward whole-body energy conservation. The leptin-evoked increase in energy expenditure counteracts the normal energy conservation because of reduced food intake, thus maximizing the weight-reducing effects of the leptin-mediated decrease in food intake. The implication is that food reduction primarily accounts for the leptin-mediated weight loss, and the role of increased energy expenditure is merely supportive. However, the present study provides evidence for a more important role for increased energy expenditure in weight maintenance.
This contribution was revealed by examination of the body weight data. Over the first 24 d, the rAAV-leptin and pair-fed rats consumed less food than the control rats. Both groups of rats lost the same amount of weight, indicating that the anorexic effect of leptin dominates and thus accounts for all of the decrease in body weight. Then from d 25 to d 83, the rAAV-leptin, pair-fed, and control rats all consumed the same amount of food, but energy expenditure was elevated only in the rAAV-leptin rats. During this period, the pair-fed rats regained the lost weight, whereas the rAAV-leptin rats maintained their body weight at the reduced level. Thus, a stimulated increase in energy expenditure alone maintained the reduced weight even when food intake returned to the preexperimental level. Lastly, the leptin-induced increase in energy expenditure attenuated sometime between d 57 and d 120. At d 83, the slope of the body weight curve began to increase in the rAAV-leptin rats, indicative of accelerated body weight gain. Most likely, this is the point in time when the energy expenditure attenuated, and without the increase in energy expenditure, the rats could no longer maintain the lower body weight and started to regain weight. These data suggest that the anorexic response predominantly mediates the initial leptin-induced weight loss. However, continuation of the anorexic response is not crucial to maintain the reduced weight as long as there is a sustained increase in energy expenditure.
In conclusion, in the presence of mild obesity, leptin can induce leptin resistance. Our previous and current findings support the notion that the development of leptin resistance is a function of elevated leptin, obesity, and perhaps age and that the resistance develops more rapidly in rats with greater obesity. The leptin resistance is accompanied by persistent elevation in hypothalamic P-STAT3 and SOCS3 and is characterized by a rapid attenuation of the anorexic response and a slower onset for the attenuation of the energy expenditure response. Both responses contributed to the regulation of body weight by leptin. The anorexic response predominantly mediates the initial loss of body weight, but only the energy expenditure response is necessary to maintain the reduced weight, suggesting that energy expenditure has an important role in long-term weight management.
| Acknowledgments |
|---|
| Footnotes |
|---|
Abbreviations: ACSF, Artificial cerebrospinal fluid; BAT, brown adipose tissue; CSF, cerebrospinal fluid; P-STAT3, phosphorylated STAT3; rAAV-leptin, recombinant adeno-associated viral mediated leptin; SOCS3, suppressor of cytokine signaling 3; STAT3, signal transducer and activator of transcription-3; UCP1, uncoupling protein 1.
Received January 22, 2002.
Accepted for publication April 23, 2002.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
G.-B. Tang, J.-G. Cui, and D.-H. Wang Role of hypoleptinemia during cold adaptation in Brandt's voles (Lasiopodomys brandtii) Am J Physiol Regulatory Integrative Comp Physiol, November 1, 2009; 297(5): R1293 - R1301. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Matheny, Y. Zhang, A. Shapiro, N. Tumer, and P. J. Scarpace Central overexpression of leptin antagonist reduces wheel running and underscores importance of endogenous leptin receptor activity in energy homeostasis Am J Physiol Regulatory Integrative Comp Physiol, November 1, 2009; 297(5): R1254 - R1261. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. J. Scarpace and Y. Zhang Leptin resistance: a prediposing factor for diet-induced obesity Am J Physiol Regulatory Integrative Comp Physiol, March 1, 2009; 296(3): R493 - R500. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. L. White, A. Whittington, M. J. Barnes, Z. Wang, G. A. Bray, and C. D. Morrison HF diets increase hypothalamic PTP1B and induce leptin resistance through both leptin-dependent and -independent mechanisms Am J Physiol Endocrinol Metab, February 1, 2009; 296(2): E291 - E299. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. R. Vasselli Fructose-induced leptin resistance: discovery of an unsuspected form of the phenomenon and its significance. Focus on "Fructose-induced leptin resistance exacerbates weight gain in response to subsequent high-fat feeding," by Shapiro et al. Am J Physiol Regulatory Integrative Comp Physiol, November 1, 2008; 295(5): R1365 - R1369. [Full Text] [PDF] |
||||
![]() |
M. K. Judge, J. Zhang, N. Tumer, C. Carter, M. J. Daniels, and P. J. Scarpace Prolonged hyperphagia with high-fat feeding contributes to exacerbated weight gain in rats with adult-onset obesity Am J Physiol Regulatory Integrative Comp Physiol, September 1, 2008; 295(3): R773 - R780. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Shapiro, M. Matheny, Y. Zhang, N. Tumer, K.-Y. Cheng, E. Rogrigues, S. Zolotukhin, and P. J. Scarpace Synergy Between Leptin Therapy and a Seemingly Negligible Amount of Voluntary Wheel Running Prevents Progression of Dietary Obesity in Leptin-Resistant Rats Diabetes, March 1, 2008; 57(3): 614 - 622. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Krol and J. R Speakman Regulation of body mass and adiposity in the field vole, Microtus agrestis: a model of leptin resistance J. Endocrinol., February 1, 2007; 192(2): 271 - 278. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. J. Scarpace, M. Matheny, Y. Zhang, K.-Y. Cheng, and N. Tumer Leptin Antagonist Reveals an Uncoupling between Leptin Receptor Signal Transducer and Activator of Transcription 3 Signaling and Metabolic Responses with Central Leptin Resistance J. Pharmacol. Exp. Ther., February 1, 2007; 320(2): 706 - 712. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Schulz, K. Paulus, and H. Lehnert Central Nervous and Metabolic Effects of Intranasally Applied Leptin Endocrinology, June 1, 2004; 145(6): 2696 - 2701. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Sahu Minireview: A Hypothalamic Role in Energy Balance with Special Emphasis on Leptin Endocrinology, June 1, 2004; 145(6): 2613 - 2620. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Prima, M. Tennant, O. S. Gorbatyuk, N. Muzyczka, P. J. Scarpace, and S. Zolotukhin Differential Modulation of Energy Balance by Leptin, Ciliary Neurotrophic Factor, and Leukemia Inhibitory Factor Gene Delivery: Microarray Deoxyribonucleic Acid-Chip Analysis of Gene Expression Endocrinology, April 1, 2004; 145(4): 2035 - 2045. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. V. Tortoriello, J. McMinn, and S. C. Chua Dietary-Induced Obesity and Hypothalamic Infertility in Female DBA/2J Mice Endocrinology, March 1, 2004; 145(3): 1238 - 1247. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. CANNON and J. NEDERGAARD Brown Adipose Tissue: Function and Physiological Significance Physiol Rev, January 1, 2004; 84(1): 277 - 359. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Shklyaev, G. Aslanidi, M. Tennant, V. Prima, E. Kohlbrenner, V. Kroutov, M. Campbell-Thompson, J. Crawford, E. W. Shek, P. J. Scarpace, et al. Sustained peripheral expression of transgene adiponectin offsets the development of diet-induced obesity in rats PNAS, November 25, 2003; 100(24): 14217 - 14222. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Pal and A. Sahu Leptin Signaling in the Hypothalamus during Chronic Central Leptin Infusion Endocrinology, September 1, 2003; 144(9): 3789 - 3798. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. I. Sivitz, S. M. Wayson, M. L. Bayless, L. F. Larson, C. Sinkey, R. S. Bar, and W. G. Haynes Leptin and Body Fat in Type 2 Diabetes and Monodrug Therapy J. Clin. Endocrinol. Metab., April 1, 2003; 88(4): 1543 - 1553. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |