| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLE |
Section of Neurobiology, Physiology, and Behavior, University of California (J.D.F.), Davis, California 95616-8519; and Laboratory of Molecular Genetics, Department of Biology, Nagoya University (A.K.), Chikusa, Nagoya 464-8602, Japan
Address all correspondence and requests for reprints to: J. David Furlow, Ph.D., Section of Neurobiology, Physiology, and Behavior, University of California, One Shields Avenue, Davis, California 95616-8519. E-mail: jdfurlow{at}ucdavis.edu.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Amphibian metamorphosis presents an excellent opportunity to study TH regulation of gene expression cascades. One advantage to studying TH control of transcription in Xenopus is the large collection of well characterized TH response genes that are activated with varying kinetics, including a set of clear direct response genes. These response genes were isolated using a gene expression screen (9) to isolate cDNAs from genes regulated by TH in a number of metamorphosing tissues (10, 11, 12, 13, 14). In this paper we provide evidence that a direct and rapid TH response gene is the Xenopus homolog of rat and human basic transcription element-binding protein 1 (BTEB1), a zinc finger transcription factor that is related to SP1. BTEB1 was originally identified as a factor regulating the expression of cytochrome P450 genes in the rat liver (15). Interestingly, TH regulates BTEB1 expression during mammalian brain development (16). In addition, BTEB1 appears to work in concert with the progesterone receptor in progesterone regulation of the porcine uteroferrin gene (17, 18). Here, we demonstrate that Xenopus BTEB1 (xBTEB1) has similar biochemical properties to mammalian BTEB1. xBTEB1 is duplicated in the Xenopus genome, and both copies are similarly up-regulated by TH. We used a modified EMSA to screen large amounts of genomic DNA for thyroid hormone response elements. We found a potent consensus TRE in both duplicated xBTEB1 genes. In the case of amphibian metamorphosis, direct transcriptional up- regulation of rapidly responding genes such as the transcription factor xBTEB1 through a strong TRE probably results in the regulation of downstream genes and the resultant dramatic tissue-specific morphological changes.
| Materials and Methods |
|---|
|
|
|---|
Isolation of cDNA and genomic clones
A random primed and an oligo(deoxythymidine)-primed cDNA library (3) were screened using a short cDNA fragment encoding xBTEB1 that was isolated from the original subtractive hybridization of tadpole tail RNA (9). Other cDNA clones were prepared by RT-PCR using specific primers. Both strands of DNA were sequenced to minimize sequence errors using the PRISM 310 Genetic Analyzer (PE Applied Biosystems, Foster City, CA) and dye terminator reagents according to the manufacturers instructions. A
genomic library was constructed from homozygous diploid X. laevis genomic DNA (gift from Keith Joho and Donald Brown, Carnegie Institution of Washington, Baltimore, MD) and screened with a fragment of the full-length xBTEB1 cDNA from the 5' end to the SacI site at +750 bp as described previously (8).
Northern analyses and primer extension
Total RNA was extracted with guanidinium isothiocyanate and purified by CsCl gradient centrifugation or TRIzol reagent (Invitrogen) and analyzed by Northern blotting as described previously (8). DNA probes were radiolabeled with [
-32P]deoxy-CTP (NEN Life Science Products, Boston, MA) by random priming. For the modified primer extension assay (20), RNA was reverse transcribed with gene-specific primers, then the cDNAs were electrophoresed through a 2.8% formalin agarose gel made of 2.1% NuSieve GTG and 0.7% Seakem GTG agarose (FMC Bio Products) and transferred to nylon membranes. The blots were hybridized with a double-stranded DNA-radiolabeled probe synthesized by PCR including [
-32P]deoxy-CTP (NEN Life Science Products), using xBTEB1A primers at the 5' end of the longest cDNA and the RT primer.
EMSAs
Full-length synthetic xBTEB1, xTR
, xTRß, xRXR
, or xRXRß mRNAs were translated in vitro as described previously (8). For reverse gel shift assays, [35S]methionine (Amersham Biotech, Piscataway, NJ) was included in the translation mix for xTR
and xTRß. A GST fusion protein containing the full-length xBTEB1 was made in Escherichia coli and purified by binding to glutathione beads (Sigma). Tail nuclear extracts were prepared by homogenizing tails (from tadpoles treated with or without 100 nM T3 for 48 h) in 10 mM Tris-Cl, 1 mM dithiothreitol, and a protease inhibitor cocktail (Roche Molecular Biochemicals, Indianapolis, IN) with a Tekmar Tissumizer (Tekmar-Dohrmann, Mason, OH). Homogenates were centrifuged at 500 x g, and the pellets were resuspended in 0.2 vol in homogenization buffer with a Dounce homogenizer (Kontes Co., Vineland, NJ). An equal volume of homogenization buffer containing 0.8 M KCl was added gradually with additional homogenization. The extract was centrifuged at 14,000 x g for 15 min at 4 C. Brain whole-cell extracts were prepared as described above but without the Tissumizer homogenization and low speed centrifugation steps. Extracts were snap-frozen in liquid nitrogen and stored at -80 C before use.
Both reverse and standard gel shift assays were performed as described previously (8). The sequences for the BTEB1 binding experiments of one strand (5' to 3') of oligonucleotides are as follows: GAGAAGGAGGCGTGGCCAAC (20 mer) for BTE, ATCGGGGCGGGGCTTC (16 mer) for Sp1, and CAGTTGATGAGTCAGCCGGAA (21 mer) for the random oligonucleotide. Bold letters indicate the putative BTEB1-binding sites. The oligonucleotides used for the TR gel shift and transient transfection experiments are as follows: ACGTTCAGGGAAGGTCATCTGAGGTCACAGCTTA for the DR+4 TRE, ACGTTCAGGGAAGTTCATCTGAGGACACAGCTTA for the xBTEB1 TRE, ACGTTCAGGGAACTTCATCTGAGAACACAGCTTA for the xBTEB1 mTRE (the nucleotides changed from wild-type are underlined), ACGTTCAGGGAAGTTCA-GGGTAGGACACAGCTTA for the xBTEB1 TRE (GGGT spacer), AGCTTGGGTTA-AGTAAGGTGAATGCTCAGCCTCATTTGAACTCTG for the TH/bZIP TREs, and AGCTTTAAGTTCAGGCTCAGGTCATGACCTGAGA for the palindromic TRE. Bold letters indicate the TRE half-sites. Relative binding affinity was determined as previously described (21) by exposing the dried gels to a Storm PhosphorImager (Molecular Dynamics, Inc., Sunnyvale, CA) and quantitating the amount of shifted xBTEB1 TRE remaining at each competitor concentration. For the gel-shift assays with nuclear extracts, some samples were incubated with 1 µl preimmune, xTRa-specific, or pan-xTR isotype-specific antiserum (22) in the binding reaction before electrophoresis.
Transient transfection assays
Wild-type or mutated TRE oligonucleotides were cloned into the unique HindIII site in the
MTV-luciferase vector (8). The orientation and number of inserts were verified by sequencing. xBTEB1A genomic clones were prepared by PCR using Pfu polymerase (Stratagene, La Jolla, CA) and were subcloned into the multiple cloning site of the pGL-2 Basic vector (Promega Corp., Madison, WI). Plasmids for transfection were purified using QIAGEN (Chatsworth, CA) midiprep kits. For transient transfection assays, 0.1 µg each of the reporter, the indicated amount of expression plasmids, and 0.1 µg pCS2-ß-galactosidase vector (gift from David Turner, Fred Hutchinson Cancer Research Center, Seattle, WA) were cotransfected with 4 µl Lipofectamine reagent (Invitrogen) for cells in six-well culture plates (35-mm diameter) as described previously (8). Cells were replenished with culture medium after 1 d, cultured for 2 d with or without 100 nM T3, then assayed for luciferase and ß-galactosidase activities (8).
| Results |
|---|
|
|
|---|
|
|
Both in vitro translated xBTEB1 (33 kDa) and a purified GST-xBTEB1 fusion protein (59 kDa) expressed in bacteria bind to the BTE sequence in gel-shift assays (Fig. 2B
). The protein binds with highest affinity to the BTE element, with lower affinity to the related Sp1 element, and not at all to an unrelated element. We next tested the ability of xBTEB1 to regulate transcription of a BTE-containing reporter gene (Fig. 2C
). We constructed luciferase reporter plasmids with one or five BTE sites inserted into a minimal promoter. The BTE elements function as a strong enhancer in Xenopus kidney (XLA) cells in a dose-dependent manner. Cotransfection of an expression plasmid containing xBTEB1 downstream of the human cytomegalovirus promoter strongly inhibits luciferase expression. This apparent repressor activity by xBTEB1 was also observed in other Xenopus cell lines: XTC, XL-177, XL-58, and XLF (data not shown).
Genomic organization of the duplicated xBTEB1 genes
An xBTEB1 cDNA probe was hybridized against homozygous diploid genomic DNA from a clonal X. laevis line. The line was made by fertilization with irradiated sperm and suppression of the first mitotic cleavage (25). The use of homozygous diploid genomic DNA eliminated the possibility of extra bands resulting from restriction site polymorphisms that may exist in out-bred, wild-type genomic DNA. The band patterns (Fig. 3A
) confirmed that there are two copies of each gene per haploid complement of DNA. Genomic DNA corresponding to each xBTEB1 duplicate gene was cloned from a homozygous diploid X. laevis genomic library. Two overlapping clones from one gene (xBTEB1A) and a single clone representing the duplicated gene (xBTEB1B) were identified by sequencing their exons and restriction mapping (Fig. 3B
). Exon 1 contains the entire 543-bp 5'UTR and coding sequence through the first zinc finger. Exon 2 encodes the final two zinc fingers, the rest of the coding sequence, and at least some of the 3'UTR including consensus A2UA3 polyadenylation signals. The 5' and 3' splice junctions fit the consensus sequences for eukaryotic genes (data not shown).
|
Isolation of high affinity TR-binding sites in xBTEB1 genes
To investigate TH-induced regulation of xBTEB1 genes, we used a reverse gel shift to map high affinity genomic binding sites in both duplicated genes (8, 26). Gel-shift assays using RsaI-digested xBTEB1 genomic clones mixed with [35S]xTR
with and without xRXR
are shown in Fig. 4
. In the absence of added xRXR
at 50 mM KCl, multiple faint bands were observed in all lanes. However, when cold xRXR
was added to the reaction, only one or two strong bands were detected, which were specific to the genomic inserts. A single band was seen in all clones that corresponded to a cryptic TR/RXR-binding site in
DNA. A further increase in specificity was observed when the reactions were carried out under more stringent DNA binding conditions using 150 mM KCl (Fig. 4A
, right panels). Under these conditions there was no detectable binding with xTR
alone, and there was a significant reduction in the amount of the shifted band derived from the
vector. The upper band (site 2) in the xBTEB1 genomic clones was reduced, but site 1 was not. This was best demonstrated in the
clone xBTEB1 A-1 at high KCl and limiting TR concentrations, where site 1 competed for binding of both the
site and site 2 in the same reaction.
|
Sequence conservation of regulatory elements in the two xBTEB1 genes
Two copies of genes such as xBTEB1A and -B that were regulated identically should have conserved regulatory elements surrounded by diverged DNA. Subclone 10, containing the highest affinity TR/RXR-binding site, lies within a 250-bp region of almost complete sequence conservation, which then diverges significantly on either side (Fig. 5A
). A DNA fragment of subclone 10 that lacks 35 bp at its 3' end does not bind to the TR/RXR heterodimer (data not shown). This region contains a DR+4 that is very close to the known TRE consensus binding sequences (Fig. 5B
). The proximal promoter region of the xBTEB1 genes is also strongly conserved (Fig. 5A
). The two promoters are about 90% identical for approximately 200 bp upstream of the cluster of start sites. Two Xenopus direct TH response gene promoters, xBTEB1 and xTRß, have now been sequenced. Both genes lack a TATA box and instead contain an initiator-like sequence near the major mapped start sites (27). In addition, a C/T-rich sequence with homology to the upstream promoter element described in the xTRß promoter is found in both xBTEB1 promoters upstream of the initiator-like sequence (27) (data not shown).
|
X. laevis TRs bind directly to the xBTEB1 TRE
To verify that TRs can bind to the xBTEB1 TRE directly, standard gel-shift assays were performed using cold in vitro translation products or endogenous TRs from tissue extracts. Using in vitro translated receptors, a specific shifted band was observed only when xTR
and xRXR
were both added to the reaction (Fig. 6A
). No binding was observed to a mutated version of the TRE that contains a 1-bp change in each half-site. Quantitative competitive binding assays with the individual TREs were used to assess the relative binding affinities of various TRE sequences (Fig. 6B
). The strongest binding TRE was a perfect direct repeat of AGGTCA separated by four nucleotides (using the xBTEB1 spacer sequence). The binding affinity of the wild-type xBTEB1 TRE was similar to the perfect repeat (3-fold reduced), whereas the combined TH/bZIP TRE1 and TRE2 oligonucleotide was 8-fold reduced from the xBTEB1 element. No differences were found using xTR
or xTRß or using either xRXR
or xRXRß as the heterodimer partner (data not shown).
|
did not alter the gel shift pattern. Instead, an antiserum that recognizes both xTRß and xTR
supershifted the complex from T3-treated tails, identifying xTRß as the major component in the T3-induced complex. By contrast, extracts from control and T3-treated tadpole brains bound xBTEB1 TRE almost equally. No specific binding to the mutated TRE was detected. This time, most of the specific complex was supershifted in both treated and untreated extracts with the xTR
-specific antisera. Both treated and untreated complexes were again shifted by the pan-isotype-specific xTR antiserum. These results demonstrate that endogenous TRs bind tightly and specifically to the xBTEB1 TRE. In addition, we show that xTRß is the predominant TR isotype in extracts from T3-treated tails. xTR
is constitutively expressed in the brain, and although xTRß induced by T3, it is to an apparently lesser extent than in the tail.
Behavior of the xBTEB1 TRE in transient transfection assays
We next tested whether xBTEB1 TRE could confer TH responsiveness on the transcription of a reporter gene as assayed by transient transfection in cultured Xenopus cells. The X. laevis cell line XLA up-regulates a subset of the tadpole tail TH response genes including xTRß and xBTEB1 in response to 100 nM T3 (data not shown). Various natural and synthetic TREs were cloned into a minimal promoter driving the expression of the firefly luciferase gene (Fig. 7A
). TH weakly induced the parent vector; however, the single xBTEB1 TRE permited repression without TH and strong TH induction of this reporter. Mutation of 1 bp in each half-site of the xBTEB1 TRE (BTEB1 Mut) completely prevented induction of the reporter. Activation of the native X. laevis xBTEB1 TRE was greater than that of other TRE sequences, including a synthetic DR+4 perfect repeat, a TRE with the same half-sites as the xBTEB1 element but with the spacer changed to GGGT, and an inverted palindromic TRE (TREpal; Fig. 7A
). Cotransfection of TR
or TRß expression vectors in XTC cells had a modest effect on the fold activation of the xBTEB1 TRE and the coupled Xenopus TH/bZIP TREs, causing further repression in the absence of hormone and stronger activation in the presence of hormone (Fig. 7B
).
|
2-fold) was less when using endogenous sequences compared with the xBTEB1 TRE fused to a minimal promoter. The xTRß wild-type promoter with its strong TRE was also similarly 2-fold regulated in a transient transfection assays (data not shown) (7, 30). Full regulation of the xBTEB1 promoter may require proper chromatin assembly, as has been demonstrated for the xTRß promoter (31, 32, 33, 34), or additional genomic sequences not included in these constructs. Modestly stronger regulation of the xBTEB1A TRE region and proximal promoter was achieved in XTC cells with either cotransfected xTR
or -ß expression vectors (data not shown).
|
| Discussion |
|---|
|
|
|---|
In situ hybridization analysis showed that xBTEB1 is highly expressed in the developing epidermis, as well as satellite cells between muscle, spinal cord, and proliferating ventricles of the brain (38, 39). Given the particularly high level of expression in adult skin and muscle as well (data not shown), xBTEB1 may function to initiate and/or maintain postembryonic skin and muscle differentiation. A key common regulator of keratin gene expression in both mammals and amphibians is the transcription factor activating protein-2 (AP-2). Mammalian BTEB1, in turn, trans-activates the AP-2 gene (40). AP-2 is up-regulated by TH in Xenopus skin (41) and binds to an adult keratin promoter; however, the Xenopus AP-2 promoter has not yet been cloned. In terms of BTEB1 as a transcriptional repressor, TH down-regulates four coordinately expressed larval epidermal genes (42). These genes were the only down-regulated genes isolated in a subtractive hybridization screen for TH-regulated genes in the tail (9); therefore, these genes are attractive candidates as BTEB1 targets. Finally, BTEB1 is also up-regulated by TH around the time of birth in the mammalian brain and has been suggested to play a role in neurite outgrowth (16). A common function for xBTEB1 in Xenopus and mammalian brain development remains to be investigated.
The three known BTEB1 mRNAs (rat, human, and X. laevis) have relatively long 5'UTRs that contain multiple short open reading frames preceding the authentic start codon. Such 5'UTRs reduce the rate of translation of BTEB1 (43) as well as mRNAs in general (44). BTEB1 is translated in neural derived cells, but not in HeLa cells (43). A compilation of the UTRs of eukaryotic mRNAs shows that 5'UTRs greater than 100 bp containing start and stop signals in phase are uncommon (45). However, at least two other X. laevis genes encoding TH-inducible transcription factors as well as TR
and TRß mRNAs have similar mRNA structures (46). The frequency with which we observed these relatively unusual features in mRNAs up-regulated by TH during metamorphosis suggests that they might share some common translational control mechanism.
xBTEB1 is the most rapidly responding gene identified to date in TH-treated tadpole tissues (10). We demonstrate here that the gene has a single TRE that is 6.5 kb upstream from the transcription start site that is completely conserved in both sequence and position between the two duplicated xBTEB1 genes. This TRE can influence the transcription of a reporter gene in a transient transcription assay that does not require the high level of TR provided by cotransfection of a plasmid that synthesizes excess TR. The distant position of xBTEB1 TRE is not unprecedented. For example, the rat Hr gene has its TRE 9 kb from the start site of transcription (29). The location of the xBTEB1 TRE far from its promoter, presumably within a conserved enhancer element, is not required for rapid kinetics, because the X. laevis TRß gene has a consensus TRE 264 bp downstream from the start site of transcription (7, 34). Despite the difference in the genomic positions of their TREs, two genes with the earliest kinetics, xBTEB1 and TRß, share some common features in addition to their nearly identical TRE sequences. Both have TATA-less promoters and an initiator-like sequence. In addition, there are several SP-1 sites within each promoter as well as an alternating polypurine/polypyrimidine stretch (mostly T/A in TRß, G/T in xBTEB1). Although the kinetics of up-regulation and the TRE sequences of the xBTEB1 and xTRß genes are highly similar, differences in their spatial expression patterns exist. For example, in the tail, xTRß expression is higher than xBTEB1 in cells surrounding the notochord and fibroblasts underneath the skin, where late-responding protease genes are primarily induced (39). Therefore, xBTEB may not be a major regulator of these genes. Consistent with this view, stable overexpression of xBTEB1 in a Xenopus cell line does not result in altered regulation of late tail response genes such as the matrix metalloproteinase collagenase-3 or the intracellular protease pepE (data not shown).
Both duplicated xBTEB1 genes have a DR+4 TRE configuration, a result predictable from earlier studies using synthetic TREs. In addition, the 4-base spacer residues between the half-sites are strongly conserved, including T residues at spacer positions 1 and 3 in the xBTEB1, xTRß, and rat Hr gene TREs. Using in vitro binding site selection to derive a consensus element, an extended octamer with TA residues preceding the AGGTCA hexamer was found to be optimal for TR
binding (28). The 3' half-site of the TRE that is presumed to bind TR in the TR/RXR heterodimeric complex is also identical in the xBTEB1, TRß, and rat Hr elements (AGGACA). We found that changing the spacer region to GGGT negatively influences both repression and activation of TRE. Keeping the spacer the same, but changing the half-sites to a perfect repeat of AGGTCA, increases the binding affinity of the TR/RXR heterodimer, but creates a weaker TRE in transfection assays. We found that genes with more delayed kinetics of mRNA accumulation tend to have lower affinity and more complex TRE half-site arrangements, as exemplified by the TH/bZIP TREs (8). In these cases, lower binding affinity may be due to divergence of the 3' half-site that binds TR, especially in TH/bZIP TRE2. The sequence comparisons in Fig. 5B
lead to the conclusion that both spacer residues and the second TRE half-site play an important role in binding and transcriptional activity, whereas the first, presumably RXR-bound, half-site appears more flexible. The nature of the complex at TREs in vivo in both the presence and absence of hormone remains an important question in the nuclear receptor field. Homodimeric mammalian TRs appear to associate more efficiently with corepressor proteins in vitro (47), yet in our analysis TR homodimers form poorly on the xBTEB1 TRE in vitro under physiological salt concentrations. This observation leads us to speculate that TR/RXR heterodimers are the key constituents of this TRE complex in vivo.
In summary, we have characterized the xBTEB1 expression profile, determined its biochemical relatedness to mammalian BTEB1, and placed it at the top of a TH-induced gene expression cascade due to its strong consensus TRE. These studies represent an important step in our understanding of the evolutionary conservation of the TH signaling pathway. Identification of key regulatory elements in TH-responsive genes in this important vertebrate model sets the stage for detailed analysis of the protein complexes that assemble on TREs throughout embryogenesis into adulthood. Our results also suggest that BTEB1 is an important player in hormone-induced gene expression cascades in all vertebrates.
| Acknowledgments |
|---|
MTV-luciferase was a gift from K. Umesono and R. M. Evans. Finally, we thank our colleagues who provided editorial advice on the manuscript. | Footnotes |
|---|
Abbreviations: AP-2, Activating protein-2; BTE, basic transcription element; BTEB1, basic transcription element-binding protein 1; Hr, hairless; polyA+, polyadenylated; RXR, retinoid X receptor; TH, thyroid hormone; TRE, thyroid hormone response element; TR, thyroid hormone receptor; UTR, untranslated region; xBTEB1, Xenopus homolog of basic transcription element binding protein 1; xRXR, Xenopus homolog of retinoid X receptor.
Received February 1, 2002.
Accepted for publication May 17, 2002.
| References |
|---|
|
|
|---|
and ß thyroid hormone receptors. Proc Natl Acad Sci USA 87:70907094
and ß during embryogenesis and metamorphosis in Xenopus laevis. J Biol Chem 269:2445924465
-helical motif mediates the interaction of Sp1-like transcriptional repressors with the corepressor mSin3A. Mol Cell Biol 21:50415049
1 with high affinity. J Biol Chem 268:1939219397
I(I) collagen gene expression in rat hepatic stellate cells. Mol Cell Biol 20:28182826
promoter by BTEB-1 and AP-2rep, a novel wt-1/egr-related zinc finger repressor. Mol Cell Biol 19:194204
and ß thyroid hormone receptors. Proc Natl Acad Sci USA 87:70907094This article has been cited by other articles:
![]() |
B. Das, R. A. Heimeier, D. R. Buchholz, and Y.-B. Shi Identification of Direct Thyroid Hormone Response Genes Reveals the Earliest Gene Regulation Programs during Frog Metamorphosis J. Biol. Chem., December 4, 2009; 284(49): 34167 - 34178. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. J. Denver and K. E. Williamson Identification of a Thyroid Hormone Response Element in the Mouse Kruppel-Like Factor 9 Gene to Explain Its Postnatal Expression in the Brain Endocrinology, August 1, 2009; 150(8): 3935 - 3943. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. C Lema, J. T Dickey, I. R Schultz, and P. Swanson Thyroid hormone regulation of mRNAs encoding thyrotropin {beta}-subunit, glycoprotein {alpha}-subunit, and thyroid hormone receptors {alpha} and {beta} in brain, pituitary gland, liver, and gonads of an adult teleost, Pimephales promelas J. Endocrinol., July 1, 2009; 202(1): 43 - 54. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. M. Bonett, F. Hu, P. Bagamasbad, and R. J. Denver Stressor and Glucocorticoid-Dependent Induction of the Immediate Early Gene Kruppel-Like Factor 9: Implications for Neural Development and Plasticity Endocrinology, April 1, 2009; 150(4): 1757 - 1765. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Bagamasbad, K. L. Howdeshell, L. M. Sachs, B. A. Demeneix, and R. J. Denver A Role for Basic Transcription Element-binding Protein 1 (BTEB1) in the Autoinduction of Thyroid Hormone Receptor J. Biol. Chem., January 25, 2008; 283(4): 2275 - 2285. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. R. Buchholz, B. D. Paul, and Y.-B. Shi Gene-specific Changes in Promoter Occupancy by Thyroid Hormone Receptor during Frog Metamorphosis: IMPLICATIONS FOR DEVELOPMENTAL GENE REGULATION J. Biol. Chem., December 16, 2005; 280(50): 41222 - 41228. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. C. Moeller, A. M. Dumitrescu, and S. Refetoff Cytosolic Action of Thyroid Hormone Leads to Induction of Hypoxia-Inducible Factor-1{alpha} and Glycolytic Genes Mol. Endocrinol., December 1, 2005; 19(12): 2955 - 2963. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. C. Moeller, A. M. Dumitrescu, R. L. Walker, P. S. Meltzer, and S. Refetoff Thyroid Hormone Responsive Genes in Cultured Human Fibroblasts J. Clin. Endocrinol. Metab., February 1, 2005; 90(2): 936 - 943. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. S. Malo, W. Zhang, F. Alkhoury, P. Pushpakaran, M. A. Abedrapo, M. Mozumder, E. Fleming, A. Siddique, J. W. Henderson, and R. A. Hodin Thyroid Hormone Positively Regulates the Enterocyte Differentiation Marker Intestinal Alkaline Phosphatase Gene via an Atypical Response Element Mol. Endocrinol., August 1, 2004; 18(8): 1941 - 1962. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D. Furlow, H. Y. Yang, M. Hsu, W. Lim, D. J. Ermio, G. Chiellini, and T. S. Scanlan Induction of Larval Tissue Resorption in Xenopus laevis Tadpoles by the Thyroid Hormone Receptor Agonist GC-1 J. Biol. Chem., June 18, 2004; 279(25): 26555 - 26562. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Luria and J. D. Furlow Spatiotemporal retinoid-X receptor activation detected in live vertebrate embryos PNAS, June 15, 2004; 101(24): 8987 - 8992. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. C. Helbing, K. Werry, D. Crump, D. Domanski, N. Veldhoen, and C. M. Bailey Expression Profiles of Novel Thyroid Hormone-Responsive Genes and Proteins in the Tail of Xenopus laevis Tadpoles Undergoing Precocious Metamorphosis Mol. Endocrinol., July 1, 2003; 17(7): 1395 - 1409. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |