help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sooy, K.
Right arrow Articles by Demay, M. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sooy, K.
Right arrow Articles by Demay, M. B.
Endocrinology Vol. 143, No. 9 3370-3375
Copyright © 2002 by The Endocrine Society


ARTICLE

Transcriptional Repression of the Rat Osteocalcin Gene by {delta}EF1

Karen Sooy and Marie B. Demay

Endocrine Unit, Massachusetts General Hospital and Harvard Medical School, Boston, Massachusetts 02114

Address all correspondence and requests for reprints to: Marie B. Demay, Wellman 501, Massachusetts General Hospital, 50 Blossom Street, Boston, Massachusetts 02114. E-mail: demay{at}helix.mgh.harvard.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Intron I of the rat osteocalcin gene contains silencer elements that suppress osteocalcin-reporter fusion gene transcription. The consensus sequence for the transcription factor {delta}EF1 is homologous to two pyrimidine-rich repeats in intron 1 that contribute to silencing of osteocalcin-reporter fusion genes. To assess if overexpression of {delta}EF1 augments transcriptional repression by these sequences, the intron 1 sequences (wtS) were placed upstream to the native rat osteocalcin promoter fused to a luciferase reporter gene (-306-OCluc). Coexpression of the wtS-(-306-OCluc) fusion gene with {delta}EF1 decreased luciferase activity 30% relative to cotransfection with empty vector. Repression was abolished by point mutations in the putative {delta}EF1 motifs, mS-(-306-OCluc).

To determine whether {delta}EF1 binds to these DNA sequences, gel retardation assays were performed using oligonucleotides containing the putative osteocalcin {delta}EF1 motifs and a classical {delta}EF1 motif, as radiolabeled probes. A comigrating DNA-protein complex generated by these probes was recognized by an antibody directed against {delta}EF1 and competed for by excess unlabeled wild-type oligonucleotides. Oligonucleotides with mutations in the osteocalcin sequences, which abolish suppression, and in the {delta}EF1 consensus site, that abolishes binding to {delta}EF1, were unable to compete for the formation of this complex. Overexpression of {delta}EF1 in ROS 17/2.8 cells led to an 84% decrease in osteocalcin mRNA levels relative to cells transfected with empty vector, confirming that {delta}EF1 suppresses expression of the endogenous osteocalcin gene.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
OSTEOCALCIN IS A GENE that is expressed by mature osteoblasts and odontoblasts. It is the second most abundant bone matrix protein after collagen. Although osteocalcin is a marker of mature osteoblasts and regulation of its expression provides a model for examining the tissue-specific expression of bone cell genes, how it contributes to the regulation of skeletal homeostasis remains unclear (1). The development of the osteocalcin knockout mouse demonstrated that osteocalcin plays a negative role in bone formation by acting to limit bone formation without effects on resorption or mineralization (2). This suggests that factors that repress transcription of the osteocalcin gene may lead to increased bone formation.

Several factors have been noted to regulate osteocalcin gene transcription, including 1,25-dihydroxyvitamin D3 (3), and the mammalian homolog of the Drosophila runt protein, CBFA1 (4). Homeodomain proteins such as Msx-2 and Dlx-5 have also been shown to play a role in osteocalcin gene regulation, by decreasing osteocalcin reporter gene expression (5, 6, 7). The transcription factor YY1 has also been found to repress 1,25-dihydroxyvitamin D3 induced transcription of the rat osteocalcin gene by interfering with the binding of the vitamin D receptor to its response element and the transcription factor TFIIB (8). Glucocorticoids (9, 10) and TNF{alpha} (11) have also been shown to repress osteocalcin gene transcription.

Previous studies have identified unique silencer elements that contribute to the regulation of osteocalcin gene transcription (12, 13). In particular, sequences in the first intron of the rat osteocalcin gene have been shown to suppress the activity of osteocalcin-chloramphenicol acetyl transferase fusion genes in the osteoblastic cell lines ROS 17/2.8 and UMR 106. Intron 1 of the rat osteocalcin gene contains two copies of a pyrimidine-rich CCTCCT motif, located at +106 to +111 and +135 to +140. Mutation of one or both of these motifs leads to impaired suppression of osteocalcin fusion genes in ROS 17/2.8 cells, indicating that these motifs interact with a transcription factor that contributes to the regulation of osteocalcin gene expression (14).

A search of the transcription factor database Transfac identified several putative transcription factor consensus sequences in intron 1 of the osteocalcin gene. The consensus sequence for one of these factors, {delta}EF1, was highly homologous to the two pyrimidine-rich motifs in intron 1. Because of this high degree of homology and the known repressive effects of {delta}EF1 on type I and type II collagen gene expression (15, 16), we examined the effects of {delta}EF1 on osteocalcin gene expression.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell culture and transfections
ROS 17/2.8 cells were maintained in Ham’s F-12 medium with L-glutamine supplemented with 10% fetal bovine serum (Life Technologies, Inc., Gaithersburg, MD), penicillin, and streptomycin. Transfections were carried out by calcium phosphate precipitation in six-well plates as previously described (3). COS 7 cells were grown in DMEM supplemented with 10% fetal bovine serum, penicillin, and streptomycin. Transfections were performed by diethylaminoethyl dextran. Osteocalcin-luciferase fusion genes, -306-OCluc, which contains the minimal promoter from –306 to +29 subcloned into the SacI-XhoI sites of pGL3basic (Promega Corp., Madison, WI); wtS-(-306-OCluc), which contains the sequence of intron 1 from +101 to +142 placed upstream of the minimal promoter at the SacI site; and mS-(-306-OCluc), which contains mutations in the CCTCCT motifs in the +101 to +142 sequence (14) were cotransfected with Renilla luciferase under the control of the SV40 promoter (pRL-SV40) into ROS 17/2.8 cells and with pRL-thymidine kinase into COS 7 cells along with either pCMV (empty vector) or pCMVX-{delta}EF1 (a gift from Dr. W. E. Horton, Jr., Northeast Ohio Universities College of Medicine, Rootstown, OH). In ROS 17/2.8 cells, 1.25 µg of OC-Luc plasmid was transfected per well along with 2 µg of either pCMV or pCMVX{delta}EF per well. In COS 7 cells, 10 µg of OC-Luc plasmid was transfected per well along with 0.5 µg of either pCMV or pCMVX{delta}EF per well. Dual luciferase assays were carried out using the Stop and Glo dual luciferase system (Promega Corp.).

For stable transfections, cells were plated in 10-cm tissue culture dishes. Selection with geneticin (Life Technologies, Inc.) was started 48 h post transfection and continued for 14 d. Two pools of clones containing 50 clones from each of {delta}EF1 and empty vector transfected cells were isolated and used for further studies.

Gel retardation assays
Oligonucleotides were synthesized corresponding to the sequences of interest, with GATC overhangs (Integrated DNA Technologies, Coralville, IA). Double-stranded oligonucleotides were labeled with {alpha}32P-deoxy-ATP by filling in recessed ends with the large fragment of DNA polymerase I. [Sense strand of oligonucleotide sequences used:

wild-type osteocalcin suppressor (wtOCS)=GATCTGCCCTCCTGGTTCATTGCCCTCCTGTTCAT,

mutant osteocalcin suppressor (mOCS)=GATCTGCATGCATGGTTCATTGCATGCATGGTTCAT,

wt{delta}EF1=GATCGTAATCTGGGCCACCTGCCTGGGAGGA,

m{delta}EF1=GATCGTAATCTGGGCAAAATGCCTGGGAGGA.] Nuclear extracts were prepared as previously described (17). Nuclear extracts from ROS 17/2.8 cells (4 µg) were incubated for 20 min at room temperature in 10 µl of {delta}EF1 binding buffer (18) containing 2 µg of poly(dA-dT)-poly(dA-dT) (Amersham Pharmacia Biotech, Piscataway, NJ). Then, 10- or 100-fold molar excess of nonlabeled competitor was added per reaction and incubated for an additional 20 min at room temperature. Alternatively, 1 µl of polyclonal anti-{delta}EF1 antibody (a gift from Dr. Yujiro Higashi, Osaka University, Osaka, Japan) or antirabbit IgG (negative control) was added to reactions without competitor and incubated for 20 min. One nanogram of labeled probe was then added per reaction, incubated for an additional 20 min and the complexes were resolved through 4% polyacrylamide gels containing 22 mM Tris-borate (pH 8.0) and 0.5 mM EDTA at 4 C. The gels were dried and exposed to film overnight.

Northern analyses
Northern analysis was performed using RNA isolated from pooled clones of stably transfected ROS 17/2.8 cells between passages 2 and 6. Total RNA was prepared using Tri reagent (Sigma, St. Louis, MO) following the manufacturer’s specifications. RNA was fractionated on 1% agarose gels and blotted overnight onto Biotrans nylon membranes (ICN Biochemicals, Aurora, OH) using standard techniques (19). Hybridization was performed using random primed labeled cDNA probes and UltraHyb hybridization buffer (Ambion, Inc., Austin, TX) or QuikHyb (Stratagene, Cedar Creek, TX). A cDNA probe for GAPDH was used to correct for differences in the amount of RNA loaded per lane.

Densitometric analysis
Densitometry was performed using the spot densitometry program on the {alpha} Imager 2200 Documentation and Analysis System (Alpha Innotech Corp., San Leandro, CA).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
ROS 17/2.8 cells have properties of mature osteoblasts and express several osteoblast markers, including osteocalcin and type I collagen (20). Therefore, this cell line was used to examine the effects of the transcriptional repressor {delta}EF1 on osteocalcin gene expression. To identify a potential role for {delta}EF1 in regulating osteocalcin gene expression, the fusion gene containing the sequence of intron 1 from +101 to +142, including both putative {delta}EF1 binding sites, was placed upstream of the native promoter (-306 to +29) fused to a luciferase reporter [wtS-(-306-OCluc)]. When placed upstream of -306-OCluc, and transfected into ROS 17/2.8 cells, these sequences repress osteocalcin-luciferase activity by 44.4 + 1.5% in the forward orientation and 31.4 + 6% in the reverse orientation (14). Mutations in the putative {delta}EF1 consensus sequences, mS-(-306-OCluc), abolished this repression (14).

Cotransfection of the {delta}EF1 expression vector with the osteocalcin promoter-luciferase gene (-306-OCluc) did not affect luciferase activity relative to empty vector control (EV) in ROS 17/2.8 cells (Fig. 1Go). However, when {delta}EF1 was coexpressed with the wtS-(-306-OCluc) construct, there was a 31 ± 2.5% decrease in luciferase activity relative to wtS-(-306-OCluc) cotransfected with EV. In contrast, there was no significant effect on luciferase activity observed when {delta}EF1 was coexpressed with the mS-(-306-OCluc) fusion gene. These data indicate that the pyrimidine-rich motifs are important for {delta}EF1-mediated repression of osteocalcin fusion gene expression. A 15% reduction in luciferase activity was noted when a luciferase fusion gene containing the sequence from –1750 to +147 was coexpressed in transient transfection assays with {delta}EF1 in ROS 17/2.8 cells. However, this fusion gene contains numerous other response elements, including a TTTCTTT motif that has been shown to dramatically suppress osteocalcin reporter gene activity (21). We, therefore, focused our analysis on the isolated CCTCCT motifs to specifically evaluate the ability of {delta}EF1 to mediate transcriptional repression by these sequences.



View larger version (13K):
[in this window]
[in a new window]
 
Figure 1. Repression of osteocalcin expression by {delta}EF1 in ROS 17/2.8 cells. Plasmids used are indicated on the x-axis. Firefly luciferase activity, corrected for cotransfected Renilla luciferase activity (y-axis) is expressed relative to empty vector, which is normalized to a value of one in each case. All values were obtained from at least three separate transfections performed using at least two different plasmid preparations. EV, Empty vector (pCMV); {delta}EF1, pCMVX{delta}EF. *, P < 0.0005.

 
To address whether the effects of {delta}EF1 on transcriptional repression on osteocalcin luciferase fusion genes require interactions with osteoblast-specific transcription factors, COS 7 cells were also used for cotransfection studies. A 26 ± 4% decrease in luciferase activity was detected when wtS-(-306-OCluc) was coexpressed with {delta}EF1, relative to control cotransfection (EV) (Fig. 2Go). There was no significant effect observed on luciferase activity when mS-(-306-OCluc) was cotransfected with {delta}EF1, nor was there an effect when the promoter construct lacking the sequences from the first intron (-306-OCluc) was coexpressed with {delta}EF1. These results indicate that {delta}EF1 can mediate its repressive effects through the pyrimidine-rich motifs in the absence of osteoblast-specific factors.



View larger version (13K):
[in this window]
[in a new window]
 
Figure 2. Repression of osteocalcin expression by {delta}EF1 in COS 7 cells. Plasmids used are indicated on the x-axis. Firefly luciferase activity, corrected for cotransfected Renilla luciferase activity (y-axis) is expressed relative to empty vector, which is normalized to a value of one. All values were obtained from at least three separate transfections performed using at least two different plasmid preparations. EV, Empty vector (pCMV); {delta}EF1, pCMVX{delta}EF. *, P < 0.0005.

 
To determine whether {delta}EF1 binds directly to these pyrimidine-rich motifs, gel retardation assays were performed. Because {delta}EF1 has been shown to bind to the immunoglobulin {kappa} enhancer element with high affinity, this sequence (wt{delta}EF) was used as a control oligonucleotide for {delta}EF1 binding in the gel shift assays. An oligonucleotide containing mutations in the {delta}EF1 consensus sequence that has previously been shown to be unable to bind to {delta}EF1 (m{delta}EF1) was used as a negative control (18). When the sequences from +101 to +142 were used as a radiolabeled probe (wtOCS), several DNA-protein complexes were identified in nuclear extracts from ROS 17/2.8 cells (Fig. 3Go, A and B). Addition of a polyclonal antibody raised against {delta}EF1 competed for the formation of a specific DNA-protein complex (arrow, Fig. 3AGo) (lane 2). A nonspecific IgG from the same species did not affect the formation of this complex (lane 3). This same complex was competed for by excess unlabeled wtOCS and wt{delta}EF oligonucleotides (Fig. 3BGo, lanes 2 and 3, and 6 and 7). Oligonucleotides containing mutations in the putative osteocalcin {delta}EF1 motifs (mOCS) (lanes 4 and 5) and in the {delta}EF binding site (m{delta}EF) (lanes 8 and 9) were unable to compete for the formation of this complex.



View larger version (56K):
[in this window]
[in a new window]
 
Figure 3. A, {delta}EF1 binds to the pyrimidine-rich motifs in intron 1 of the rat osteocalcin gene. Double-stranded oligonucleotides containing the two putative {delta}EF1 consensus sequences in intron 1 of the rat osteocalcin gene (A, lanes 1–3; B) or a {delta}EF1 consensus sequence (A, lanes 4–6; C) were used as radiolabeled probes (wtOCS and wt{delta}EF1) with nuclear extracts from ROS 17/2.8 cells. Competition was performed using 10- and 100-fold molar excess of unlabeled double stranded olignucleotides. A, Lane 1, wtOCS probe control; lane 2, {delta}EF1 antibody; lane 3, control IgG; lane 4, wt{delta}EF1 probe control; lane 5, {delta}EF1 antibody; lane 6, control IgG. B, wtOCS probe. Lane 1, wtOCS probe control; lanes 2 and 3, 10- and 100-fold excess unlabeled wtOCS; lanes 4 and 5, 10- and 100-fold excess unlabeled mOCS; lanes 6 and 7, 10- and 100-fold excess unlabeled wt{delta}EF1; lanes 8 and 9, 10- and 100-fold excess unlabeled m{delta}EF1. C, wt{delta}EF1 probe. Lane 10, wt{delta}EF1 probe control; lanes 11 and 12, 10- and 100-fold excess unlabeled wtOCS; lanes 13 and 14, 10- and 100-fold excess unlabeled mOCS; lanes 15 and 16, 10- and 100-fold excess unlabeled wt{delta}EF1; lanes 17 and 18, 10- and 100-fold excess unlabeled m{delta}EF1.

 
When the wt{delta}EF oligonucleotide was used as a radiolabeled probe, numerous complexes comigrating with those observed using the wtOCS probe were formed (Fig. 3AGo, lane 4). The polyclonal antibody directed against {delta}EF1 similarly interfered with the formation of the specific DNA-protein complex indicated by the arrow (lane 5). Complex formation was not affected by the addition of nonspecific IgG (lane 6). Unlabeled 10- and 100-fold molar excess wtOCS (Fig. 3CGo, lanes 11 and 12) was able to compete for the formation of this complex, whereas the mOCS oligonucleotide was not (lanes 13 and 14). As expected, the same wild-type {delta}EF1 consensus site oligonucleotide competed for the formation of this complex (lanes 15 and 16), whereas the mutant oligonucleotide did not (lanes 17 and 18). Gel shift assays performed using nuclear extracts isolated from ROS 17/2.8 cells stably overexpressing {delta}EF1 showed identical antibody recognition and competition with the wtOCs and {delta}EF probes (data not shown). Mutant probes failed to generate comigrating bands or complexes competed for by the wild-type oligonucleotides.

To determine whether overexpression of {delta}EF1 suppresses the expression of the endogenous osteocalcin gene, ROS 17/2.8 cells were stably transfected with either empty vector or the {delta}EF1 expression vector. After selection with geneticin for 14 d, 2 pools of 50 clones from each of the empty vector and {delta}EF1 transfected cells were used for further studies. RNA was isolated from cells between passages 2 and 6. Northern analyses demonstrated a 5.65 ± 0.21-fold increase in {delta}EF1 mRNA levels in the pooled clones transfected with the {delta}EF1 expression vector relative to the low levels of endogenous {delta}EF1 in the pooled empty vector transfected clones (Fig. 4Go, A and B). The {delta}EF1 overexpressing clones also demonstrated an 84 ± 5% decrease in endogenous osteocalcin mRNA levels compared with those clones stably transfected with empty vector. These data confirm that the repression of osteocalcin-luciferase fusion gene expression by {delta}EF1 in the transient gene expression assays reflects the actions of {delta}EF1 on transcription of the endogenous osteocalcin gene.



View larger version (30K):
[in this window]
[in a new window]
 
Figure 4. A, Northern analysis of ROS 17/2.8 cells stably transfected with either EV or {delta}EF1. Fifteen micrograms of total RNA were probed with cDNA probes for osteoblast genes. RNA levels were normalized by probing with a cDNA probe for GAPDH. Data are representative of two independent experiments performed with pools of fifty clones. Representative Northern blots for {delta}EF1 and osteocalcin are shown in A. Densitometric quantitation of signal intensities, corrected for GAPDH are shown in B. Numbers ± SD indicate relative expression of the indicated mRNA in {delta}EF1 transfected pools vs. EV transfected pools.

 
Computerized homology searches (BestFit; University of Wisconsin) also revealed putative {delta}EF1 motifs in other osteoblast genes, notably type I collagen, osteopontin, alkaline phosphatase and the PTH/PTHrP receptor. To determine if {delta}EF1 also regulated these genes, northern analyses were performed using RNA isolated from the pooled clones stably transfected with either {delta}EF1 or empty vector. RNA from cells overexpressing {delta}EF1 demonstrated a 21 ± 2% decrease in type I collagen RNA expression relative to cells transfected with empty vector (Fig. 4BGo). This result was consistent with those obtained by Terraz et al. (15), who observed a 35% decrease in type I collagen mRNA in ROS 17/2.8 cells overexpressing {delta}EF1. We also observed a 45 ± 3%-fold decrease in alkaline phosphatase mRNA levels in cells overexpressing {delta}EF1 relative to cells transfected with the empty vector (Fig. 4BGo). No changes in the levels of mRNA encoding either the PTH/PTHrP receptor (Fig. 4BGo) or osteopontin were observed (data not shown).


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
{delta}-Crystallin enhancer factor 1, {delta}EF1, is a 124-kDa DNA binding protein that consists of a central homeodomain and two sets of seven Kruppel-type zinc fingers at the N and C termini (22, 23, 24). A vertebrate homolog of the Drosophila protein zfh-1, {delta}EF1 is a widely distributed repressor of transcription that was found to preferentially bind to the sequence (C/T)(A/T)C(C/G)T in the {delta}-crystallin enhancer (22). Although {delta}EF1 was initially characterized in studies of the lens-specific regulation of the avian gene encoding {delta}-crystallin, its broad tissue distribution suggests that {delta}EF1 plays a more global role in the regulation of genes in several tissues (25). {delta}EF1 mRNA has been detected in all murine tissues examined (26) and is expressed as early as embryonic d 9.5 in the limb bud of the mouse (27).

Engineering of the {delta}EF1 knockout mouse demonstrated an important role for {delta}EF1 in skeletal morphogenesis. Mice lacking {delta}EF1 exhibited a variety of skeletal defects, including cleft palate, shortened mandible, shortening and broadening of long bones, fusion of joints, as well as fusion of the carpal and tarsal bones and hypoplasia of intervertebral discs (27). In addition to its role in skeletal development, {delta}EF1 was also found to be essential for normal T cell and thymus development, with mutant mice having 1% of the total lymphocyte number of wild-type mice (26).

Studies examining the role of {delta}EF1 on skeletal genes demonstrated that this transcription factor negatively regulates the Coll2a1 gene in chick sternal chondrocytes (16). These cells express minimal levels of {delta}EF1 mRNA and abundant type II collagen. Treatment of these cells with the growth factors basic fibroblast growth factor and TGFß results in an increase in {delta}EF1 mRNA expression paralleled by a decrease in Coll2aI mRNA. These data suggested that {delta}EF1 might suppress chondrocyte specific genes in the limb bud before the onset of chondrogenesis (16).

Recent studies have demonstrated that {delta}EF1 is able to repress type 1 collagen ({alpha}1–1 col) gene expression in ROS 17/2.8 cells (15). A 123-bp repressor element, collagen-inhibitory element-1, located 14 kb upstream of the transcriptional start site of the type I collagen gene, consists of three copies of a 41-bp repeat, each of which contain a {delta}EF1 consensus sequence. Point mutations in these motifs abolished both binding of {delta}EF1 to this element and repression by {delta}EF1. Another {delta}EF1/Zfh-1 family member, Smad interacting protein-1, has been shown to repress bone morphogenic protein-2-induced alkaline phosphatase activity in C2C12 cells (28). Our studies demonstrate that {delta}EF1, in addition to its effects on osteocalcin gene expression, is able to repress both alkaline phosphatase and {alpha}1–1col mRNA levels in ROS 17/2.8 cells.

Previous studies have identified unique silencer elements in the first exon and intron of the rat osteocalcin gene that contribute to gene regulation. A sequence from +24 to +151, containing part of the coding region of the first exon along with the 5' region of the first intron, was shown to significantly decrease transcription of osteocalcin fusion genes in both the native context and in an orientation-dependent manner when located 3' to the chloramphenicol acetyl transferase reporter gene (12, 13). Mutation of another sequence, TTTCTTT, located at +118 to +124, between the two CCTCCT motifs examined in this study, markedly impaired silencing by sequences in the first intron, suggesting the factor that interacts with this motif may be a key regulator in osteocalcin gene expression (21). These studies, and those reported herein, demonstrate the importance of intronic sequences in the regulation of osteocalcin gene expression.

The repressive effect of {delta}EF1 on osteocalcin, alkaline phosphatase, and collagen gene expression points to an important role for this transcription factor in the regulation of bone formation. The dramatic suppression of the endogenous osteocalcin mRNA by {delta}EF1 relative to the modest suppression of the wtS-(-306-OCluc) fusion gene, likely reflects functional interactions of this transcription factor with numerous other putative {delta}EF1 motifs in the 5' regulatory region of the osteocalcin gene. Like the intronic {delta}EF1 motifs, these motifs are present in the human and rat osteocalcin genes. In the mouse limb bud, {delta}EF1 is expressed at high levels at embryonic d 9.5 and gradually decreases, being undetectable at the time of condensation of mesenchymal cells that give rise to the cartilaginous mold (27). Following this stage, expression of osteoblast genes including alkaline phosphatase (embryonic d 13.5), type I collagen (embryonic d 14.0), and osteocalcin (embryonic d 18) is observed, suggesting that the decrease in {delta}EF1 expression may lead to derepression of these genes. Our data, examining the effects of {delta}EF1 on the levels of mRNAs encoding these genes, suggest that {delta}EF1 acts to suppress or limit the osteoblast phenotype. This may occur at one of several stages. {delta}EF1 may act to attenuate osteoblast differentiation, reflected by decreased expression of osteoblast genes, including type I collagen, alkaline phosphatase and osteocalcin. However, because {delta}EF1 represses expression of these genes in ROS 17/2.8 cells, a model of mature osteoblasts, the principal skeletal effects of this transcription factor, after skeletal morphogenesis, may be in the postproliferative osteoblast. {delta}EF1 may play a role in suppressing matrix synthesis by lining osteoblasts and/or osteocytes. Alternatively, transcriptional repression of the genes encoding the two most abundant bone matrix proteins, type I collagen and osteocalcin, may reflect a key role for {delta}EF1 in limiting matrix formation during bone remodeling. Due to the perinatal lethality of the {delta}EF1 knockout mice, the role of this transcription factor in skeletal maturation and remodeling remain unclear. However, the suppression of osteocalcin, type I collagen, and alkaline phosphatase gene expression by {delta}EF1 and other family members suggest that this family of transcription factors may play a key role in skeletal homeostasis.


    Acknowledgments
 


    Footnotes
 
This work was supported by Grants F32 DK-10136-02 (to K.S.) and DK-36597 (to M.B.D.) from the National Institutes of Health.

Abbreviations: CMV, Cytomegalovirus; EV, empty vector; mOCS, mutant osteocalcin suppressor; wtOCS, wild-type osteocalcin suppressor.

Received December 26, 2001.

Accepted for publication May 7, 2002.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Hauschka PV, Lian JB, Cole DEC, Gundberg CM 1989 Osteocalcin and matrix gla protein: vitamin K dependent proteins in bone. Physiol Rev 69:990–1047[Free Full Text]
  2. Ducy P, Desbois C, Boyce B, Pinero G, Story B, Dunstan C, Smith E, Bonadio J, Goldstein S, Gundberg C, Bradley A, Karsenty G 1996 Increased bone formation in osteocalcin deficient mice. Nature 382:448–452[CrossRef][Medline]
  3. Demay MB, Roth DA, Kronenberg HM 1989 Regions of the rat osteocalcin gene which mediate the effect of 1,25-dihydroxyvitamin D3 on gene transcription. J Biol Chem 264:2279–2282[Abstract/Free Full Text]
  4. Geoffroy V, Ducy P, Karsenty G 1995 A PEBP2a/AML1 related factor increases osteocalcin promoter activity through its binding to an osteoblast-specific cis-acting element. J Biol Chem 270:30973–30979[Abstract/Free Full Text]
  5. Towler DA, Rutledge SJ, Rodan GA 1994 Msx-2/Hox8.1: a transcriptional regulator of the rat osteocalcin promoter. Mol Endocrinol 8:1484–1493[Abstract/Free Full Text]
  6. Hoffmann HM, Catron KM, van Wijnen AJ, McCabe LR, Lian JB, Stein GS, Stein JL 1994 Transcriptional control of the tissue-specific developmentally regulated osteocalcin gene requires a binding motif for the Msx family of homeodomain proteins. Proc Natl Acad Sci USA 91:12887–12891[Abstract/Free Full Text]
  7. Ryoo HM, Hoffmann HM, Beumer T, Frenkel B, Towler DA, Stein GS, Stein JL, van Wijnen AJ, Lian JB 1997 Stage specific expression of Dlx5 during osteoblast differentiation: involvement in regulation of osteocalcin gene expression. Mol Endocrinol 11:1681–1694[Abstract/Free Full Text]
  8. Guo B, Aslam F, van Wijnen AJ, Roberts SG, Frenkel B, Green MR, DeLuca H, Lian JB, Stein GS, Stein JL 1997 YY1 regulates vitamin D receptor/retinoid X receptor mediated transactivation of the vitamin D responsive osteocalcin gene. Proc Natl Acad Sci USA 94:121–126[Abstract/Free Full Text]
  9. Morrison N, Eisman J 1993 Role of the negative glucocorticoid regulatory element in glucocorticoid repression of the human osteocalcin promoter. J Bone Miner Res 8:969–975[Medline]
  10. Aslam F, Shalhoub V, van Wijnen AJ, Banerjee C, Bortell R, Shakoori AR, Litwack G, Stein JL, Stein GS, Lian JB 1995 Contributions of distal and proximal promoter elements to glucocorticoid regulation of osteocalcin gene transcription. Mol Endocrinol 9:679–690[Abstract/Free Full Text]
  11. Nanes MS, Kuno H, Demay MB, Kurian M, Hendy GN, DeLuca HF, Titus L, Rubin J 1994 A single upstream element confers responsiveness to 1, 25(OH)2D3 and tumor necrosis factor-{alpha} in the rat osteocalcin gene. Endocrinology 134:1113–1120[Abstract/Free Full Text]
  12. Frenkel B, Mijnes J, Aronow MA, Zambetti G, Banerjee C, Stein JL, Lian JB, Stein GS 1993 Position and orientation selective silencer in protein coding sequences of the rat osteocalcin gene. Biochemistry 32:13636–13643[CrossRef][Medline]
  13. Frenkel B, Montecino M, Stein JL, Lian JB, Stein GS 1994. A complete intragenic silencer domain exhibits negative and positive transcriptional control of the bone-specific osteocalcin gene: promoter and cell type requirements. Proc Natl Acad Sci USA 91:10923–10927
  14. Kearns AE, Goto K, Gianakakos G, Lippman W, Demay MB 1999 Transcriptional repression of the rat osteocalcin gene: role of two intronic CCTCCT motifs. Endocrinology 140:4120–4126[Abstract/Free Full Text]
  15. Terraz C, Toman D, Delauche M, Ronco P, Rossert J 2001 {delta}EF1 binds to a far-upstream sequence of the mouse pro-{alpha}1(I) collagen gene and represses its expression in osteoblasts. J Biol Chem 276:37011–37019[Abstract/Free Full Text]
  16. Murray D, Precht P, Balakir R, Horton Jr WE 2000 The transcription factor {delta}EF1 is inversely expressed with type II collagen mRNA and can repress Col2a1 promoter activity in transfected chondrocytes. J Biol Chem 275:3610–3618[Abstract/Free Full Text]
  17. Dignam JD, Lebovitz RM, Roeder RG 1983 Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res 11:1475–1489[Abstract/Free Full Text]
  18. Sekido R, Murai K, Funahashi J, Kamachi Y, Fujisawa-Sehara A, Nabeshima Y, Kondoh H 1994 The {delta} crystallin enhancer-binding protein {delta}EF1 is a repressor of E2 box mediated gene activation. Mol Cell Biol 14:5692–5700[Abstract/Free Full Text]
  19. Sambrook J, Fritsch EF, Maniatis T 1989 Molecular cloning: a laboratory manual. 2nd ed. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press
  20. Majeska RJ, Rodan SB, Rodan GA 1980 Parathyroid hormone-responsive clonal cell lines from a rat osteosarcoma. Endocrinology 107:1494–1503[Abstract/Free Full Text]
  21. Goto K, Heymont JL, Klein-Nulend J, Kronenberg HM, Demay MB 1996 Identification of an osteoblastic silencer element in the first intron of the rat osteocalcin gene. Biochemistry 35:11005–11011[CrossRef][Medline]
  22. Funahashi J, Kamachi Y, Goto K, Kondoh H 1991 Identification of nuclear factor {delta}EF1 and its binding site essential for lens-specific activity of the {delta}1-crystallin enhancer. Nucleic Acids Res 19:3543–3547[Abstract/Free Full Text]
  23. Funahashi J, Sekido R, Murai K, Kamachi Y, Kondoh H 1993 {delta}-crystallin enhancer binding protein {delta}EF1 is a zinc finger-homeodomain protein implicated in postgastrulation embryogenesis. Development 119:433–446[Abstract]
  24. Sekido R, Takagi T, Okanami M, Moribe H, Yamamura M, Higashi Y, Kondoh H 1996 Organization of the gene encoding transcriptional repressor {delta}EF1 and cross-species conservation of its domains. Gene 173:227–232[CrossRef][Medline]
  25. Kamachi Y, Kondoh H 1993 Overlapping positive and negative regulatory elements determine lens-specific activation of the {delta}1-crystallin enhancer. Mol Cell Biol 13:5206–5215[Abstract/Free Full Text]
  26. Higashi Y, Moribe H, Takagi T, Sekido R, Kawakami K, Kikutani H, Kondoh H 1997 Impairment of T cell development in {delta}EF1 mutant mice. J Exp Med 185:1467–1479[Abstract/Free Full Text]
  27. Takagi T, Moribe H, Kondoh H, Higashi Y 1998 {delta}EF1, a zinc finger and homeodomain transcription factor, is required for skeleton patterning in multiple lineages. Development 125:21–31[Abstract]
  28. Tylzanowski P, Verschueren K, Huylebroeck D, Luyten FP 2001 Smad-interacting protein 1 is a repressor of liver/bone/kidney alkaline phosphatase transcription in bone morphogenetic-protein induced osteogenic differentiation of C2C12 cells. J Biol Chem 276:40001–40007[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
CJASNHome page
M. Kato, L. Arce, and R. Natarajan
MicroRNAs and Their Role in Progressive Kidney Diseases
Clin. J. Am. Soc. Nephrol., July 1, 2009; 4(7): 1255 - 1266.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
M. Ponticos, T. Partridge, C. M. Black, D. J. Abraham, and G. Bou-Gharios
Regulation of Collagen Type I in Vascular Smooth Muscle Cells by Competition between Nkx2.5 and {delta}EF1/ZEB1
Mol. Cell. Biol., July 15, 2004; 24(14): 6151 - 6161.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sooy, K.
Right arrow Articles by Demay, M. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sooy, K.
Right arrow Articles by Demay, M. B.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals