| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLE |
EF1
Endocrine Unit, Massachusetts General Hospital and Harvard Medical School, Boston, Massachusetts 02114
Address all correspondence and requests for reprints to: Marie B. Demay, Wellman 501, Massachusetts General Hospital, 50 Blossom Street, Boston, Massachusetts 02114. E-mail: demay{at}helix.mgh.harvard.edu.
| Abstract |
|---|
|
|
|---|
EF1 is homologous to two pyrimidine-rich repeats in intron 1 that contribute to silencing of osteocalcin-reporter fusion genes. To assess if overexpression of
EF1 augments transcriptional repression by these sequences, the intron 1 sequences (wtS) were placed upstream to the native rat osteocalcin promoter fused to a luciferase reporter gene (-306-OCluc). Coexpression of the wtS-(-306-OCluc) fusion gene with
EF1 decreased luciferase activity 30% relative to cotransfection with empty vector. Repression was abolished by point mutations in the putative
EF1 motifs, mS-(-306-OCluc).
To determine whether
EF1 binds to these DNA sequences, gel retardation assays were performed using oligonucleotides containing the putative osteocalcin
EF1 motifs and a classical
EF1 motif, as radiolabeled probes. A comigrating DNA-protein complex generated by these probes was recognized by an antibody directed against
EF1 and competed for by excess unlabeled wild-type oligonucleotides. Oligonucleotides with mutations in the osteocalcin sequences, which abolish suppression, and in the
EF1 consensus site, that abolishes binding to
EF1, were unable to compete for the formation of this complex. Overexpression of
EF1 in ROS 17/2.8 cells led to an 84% decrease in osteocalcin mRNA levels relative to cells transfected with empty vector, confirming that
EF1 suppresses expression of the endogenous osteocalcin gene.
| Introduction |
|---|
|
|
|---|
Several factors have been noted to regulate osteocalcin gene transcription, including 1,25-dihydroxyvitamin D3 (3), and the mammalian homolog of the Drosophila runt protein, CBFA1 (4). Homeodomain proteins such as Msx-2 and Dlx-5 have also been shown to play a role in osteocalcin gene regulation, by decreasing osteocalcin reporter gene expression (5, 6, 7). The transcription factor YY1 has also been found to repress 1,25-dihydroxyvitamin D3 induced transcription of the rat osteocalcin gene by interfering with the binding of the vitamin D receptor to its response element and the transcription factor TFIIB (8). Glucocorticoids (9, 10) and TNF
(11) have also been shown to repress osteocalcin gene transcription.
Previous studies have identified unique silencer elements that contribute to the regulation of osteocalcin gene transcription (12, 13). In particular, sequences in the first intron of the rat osteocalcin gene have been shown to suppress the activity of osteocalcin-chloramphenicol acetyl transferase fusion genes in the osteoblastic cell lines ROS 17/2.8 and UMR 106. Intron 1 of the rat osteocalcin gene contains two copies of a pyrimidine-rich CCTCCT motif, located at +106 to +111 and +135 to +140. Mutation of one or both of these motifs leads to impaired suppression of osteocalcin fusion genes in ROS 17/2.8 cells, indicating that these motifs interact with a transcription factor that contributes to the regulation of osteocalcin gene expression (14).
A search of the transcription factor database Transfac identified several putative transcription factor consensus sequences in intron 1 of the osteocalcin gene. The consensus sequence for one of these factors,
EF1, was highly homologous to the two pyrimidine-rich motifs in intron 1. Because of this high degree of homology and the known repressive effects of
EF1 on type I and type II collagen gene expression (15, 16), we examined the effects of
EF1 on osteocalcin gene expression.
| Materials and Methods |
|---|
|
|
|---|
EF1 (a gift from Dr. W. E. Horton, Jr., Northeast Ohio Universities College of Medicine, Rootstown, OH). In ROS 17/2.8 cells, 1.25 µg of OC-Luc plasmid was transfected per well along with 2 µg of either pCMV or pCMVX
EF per well. In COS 7 cells, 10 µg of OC-Luc plasmid was transfected per well along with 0.5 µg of either pCMV or pCMVX
EF per well. Dual luciferase assays were carried out using the Stop and Glo dual luciferase system (Promega Corp.).
For stable transfections, cells were plated in 10-cm tissue culture dishes. Selection with geneticin (Life Technologies, Inc.) was started 48 h post transfection and continued for 14 d. Two pools of clones containing 50 clones from each of
EF1 and empty vector transfected cells were isolated and used for further studies.
Gel retardation assays
Oligonucleotides were synthesized corresponding to the sequences of interest, with GATC overhangs (Integrated DNA Technologies, Coralville, IA). Double-stranded oligonucleotides were labeled with
32P-deoxy-ATP by filling in recessed ends with the large fragment of DNA polymerase I. [Sense strand of oligonucleotide sequences used:
wild-type osteocalcin suppressor (wtOCS)=GATCTGCCCTCCTGGTTCATTGCCCTCCTGTTCAT,
mutant osteocalcin suppressor (mOCS)=GATCTGCATGCATGGTTCATTGCATGCATGGTTCAT,
wt
EF1=GATCGTAATCTGGGCCACCTGCCTGGGAGGA,
m
EF1=GATCGTAATCTGGGCAAAATGCCTGGGAGGA.] Nuclear extracts were prepared as previously described (17). Nuclear extracts from ROS 17/2.8 cells (4 µg) were incubated for 20 min at room temperature in 10 µl of
EF1 binding buffer (18) containing 2 µg of poly(dA-dT)-poly(dA-dT) (Amersham Pharmacia Biotech, Piscataway, NJ). Then, 10- or 100-fold molar excess of nonlabeled competitor was added per reaction and incubated for an additional 20 min at room temperature. Alternatively, 1 µl of polyclonal anti-
EF1 antibody (a gift from Dr. Yujiro Higashi, Osaka University, Osaka, Japan) or antirabbit IgG (negative control) was added to reactions without competitor and incubated for 20 min. One nanogram of labeled probe was then added per reaction, incubated for an additional 20 min and the complexes were resolved through 4% polyacrylamide gels containing 22 mM Tris-borate (pH 8.0) and 0.5 mM EDTA at 4 C. The gels were dried and exposed to film overnight.
Northern analyses
Northern analysis was performed using RNA isolated from pooled clones of stably transfected ROS 17/2.8 cells between passages 2 and 6. Total RNA was prepared using Tri reagent (Sigma, St. Louis, MO) following the manufacturers specifications. RNA was fractionated on 1% agarose gels and blotted overnight onto Biotrans nylon membranes (ICN Biochemicals, Aurora, OH) using standard techniques (19). Hybridization was performed using random primed labeled cDNA probes and UltraHyb hybridization buffer (Ambion, Inc., Austin, TX) or QuikHyb (Stratagene, Cedar Creek, TX). A cDNA probe for GAPDH was used to correct for differences in the amount of RNA loaded per lane.
Densitometric analysis
Densitometry was performed using the spot densitometry program on the
Imager 2200 Documentation and Analysis System (Alpha Innotech Corp., San Leandro, CA).
| Results |
|---|
|
|
|---|
EF1 on osteocalcin gene expression. To identify a potential role for
EF1 in regulating osteocalcin gene expression, the fusion gene containing the sequence of intron 1 from +101 to +142, including both putative
EF1 binding sites, was placed upstream of the native promoter (-306 to +29) fused to a luciferase reporter [wtS-(-306-OCluc)]. When placed upstream of -306-OCluc, and transfected into ROS 17/2.8 cells, these sequences repress osteocalcin-luciferase activity by 44.4 + 1.5% in the forward orientation and 31.4 + 6% in the reverse orientation (14). Mutations in the putative
EF1 consensus sequences, mS-(-306-OCluc), abolished this repression (14).
Cotransfection of the
EF1 expression vector with the osteocalcin promoter-luciferase gene (-306-OCluc) did not affect luciferase activity relative to empty vector control (EV) in ROS 17/2.8 cells (Fig. 1
). However, when
EF1 was coexpressed with the wtS-(-306-OCluc) construct, there was a 31 ± 2.5% decrease in luciferase activity relative to wtS-(-306-OCluc) cotransfected with EV. In contrast, there was no significant effect on luciferase activity observed when
EF1 was coexpressed with the mS-(-306-OCluc) fusion gene. These data indicate that the pyrimidine-rich motifs are important for
EF1-mediated repression of osteocalcin fusion gene expression. A 15% reduction in luciferase activity was noted when a luciferase fusion gene containing the sequence from 1750 to +147 was coexpressed in transient transfection assays with
EF1 in ROS 17/2.8 cells. However, this fusion gene contains numerous other response elements, including a TTTCTTT motif that has been shown to dramatically suppress osteocalcin reporter gene activity (21). We, therefore, focused our analysis on the isolated CCTCCT motifs to specifically evaluate the ability of
EF1 to mediate transcriptional repression by these sequences.
|
EF1 on transcriptional repression on osteocalcin luciferase fusion genes require interactions with osteoblast-specific transcription factors, COS 7 cells were also used for cotransfection studies. A 26 ± 4% decrease in luciferase activity was detected when wtS-(-306-OCluc) was coexpressed with
EF1, relative to control cotransfection (EV) (Fig. 2
EF1, nor was there an effect when the promoter construct lacking the sequences from the first intron (-306-OCluc) was coexpressed with
EF1. These results indicate that
EF1 can mediate its repressive effects through the pyrimidine-rich motifs in the absence of osteoblast-specific factors.
|
EF1 binds directly to these pyrimidine-rich motifs, gel retardation assays were performed. Because
EF1 has been shown to bind to the immunoglobulin
enhancer element with high affinity, this sequence (wt
EF) was used as a control oligonucleotide for
EF1 binding in the gel shift assays. An oligonucleotide containing mutations in the
EF1 consensus sequence that has previously been shown to be unable to bind to
EF1 (m
EF1) was used as a negative control (18). When the sequences from +101 to +142 were used as a radiolabeled probe (wtOCS), several DNA-protein complexes were identified in nuclear extracts from ROS 17/2.8 cells (Fig. 3
EF1 competed for the formation of a specific DNA-protein complex (arrow, Fig. 3A
EF oligonucleotides (Fig. 3B
EF1 motifs (mOCS) (lanes 4 and 5) and in the
EF binding site (m
EF) (lanes 8 and 9) were unable to compete for the formation of this complex.
|
EF oligonucleotide was used as a radiolabeled probe, numerous complexes comigrating with those observed using the wtOCS probe were formed (Fig. 3A
EF1 similarly interfered with the formation of the specific DNA-protein complex indicated by the arrow (lane 5). Complex formation was not affected by the addition of nonspecific IgG (lane 6). Unlabeled 10- and 100-fold molar excess wtOCS (Fig. 3C
EF1 consensus site oligonucleotide competed for the formation of this complex (lanes 15 and 16), whereas the mutant oligonucleotide did not (lanes 17 and 18). Gel shift assays performed using nuclear extracts isolated from ROS 17/2.8 cells stably overexpressing
EF1 showed identical antibody recognition and competition with the wtOCs and
EF probes (data not shown). Mutant probes failed to generate comigrating bands or complexes competed for by the wild-type oligonucleotides.
To determine whether overexpression of
EF1 suppresses the expression of the endogenous osteocalcin gene, ROS 17/2.8 cells were stably transfected with either empty vector or the
EF1 expression vector. After selection with geneticin for 14 d, 2 pools of 50 clones from each of the empty vector and
EF1 transfected cells were used for further studies. RNA was isolated from cells between passages 2 and 6. Northern analyses demonstrated a 5.65 ± 0.21-fold increase in
EF1 mRNA levels in the pooled clones transfected with the
EF1 expression vector relative to the low levels of endogenous
EF1 in the pooled empty vector transfected clones (Fig. 4
, A and B). The
EF1 overexpressing clones also demonstrated an 84 ± 5% decrease in endogenous osteocalcin mRNA levels compared with those clones stably transfected with empty vector. These data confirm that the repression of osteocalcin-luciferase fusion gene expression by
EF1 in the transient gene expression assays reflects the actions of
EF1 on transcription of the endogenous osteocalcin gene.
|
EF1 motifs in other osteoblast genes, notably type I collagen, osteopontin, alkaline phosphatase and the PTH/PTHrP receptor. To determine if
EF1 also regulated these genes, northern analyses were performed using RNA isolated from the pooled clones stably transfected with either
EF1 or empty vector. RNA from cells overexpressing
EF1 demonstrated a 21 ± 2% decrease in type I collagen RNA expression relative to cells transfected with empty vector (Fig. 4B
EF1. We also observed a 45 ± 3%-fold decrease in alkaline phosphatase mRNA levels in cells overexpressing
EF1 relative to cells transfected with the empty vector (Fig. 4B| Discussion |
|---|
|
|
|---|
-Crystallin enhancer factor 1,
EF1, is a 124-kDa DNA binding protein that consists of a central homeodomain and two sets of seven Kruppel-type zinc fingers at the N and C termini (22, 23, 24). A vertebrate homolog of the Drosophila protein zfh-1,
EF1 is a widely distributed repressor of transcription that was found to preferentially bind to the sequence (C/T)(A/T)C(C/G)T in the
-crystallin enhancer (22). Although
EF1 was initially characterized in studies of the lens-specific regulation of the avian gene encoding
-crystallin, its broad tissue distribution suggests that
EF1 plays a more global role in the regulation of genes in several tissues (25).
EF1 mRNA has been detected in all murine tissues examined (26) and is expressed as early as embryonic d 9.5 in the limb bud of the mouse (27).
Engineering of the
EF1 knockout mouse demonstrated an important role for
EF1 in skeletal morphogenesis. Mice lacking
EF1 exhibited a variety of skeletal defects, including cleft palate, shortened mandible, shortening and broadening of long bones, fusion of joints, as well as fusion of the carpal and tarsal bones and hypoplasia of intervertebral discs (27). In addition to its role in skeletal development,
EF1 was also found to be essential for normal T cell and thymus development, with mutant mice having 1% of the total lymphocyte number of wild-type mice (26).
Studies examining the role of
EF1 on skeletal genes demonstrated that this transcription factor negatively regulates the Coll2a1 gene in chick sternal chondrocytes (16). These cells express minimal levels of
EF1 mRNA and abundant type II collagen. Treatment of these cells with the growth factors basic fibroblast growth factor and TGFß results in an increase in
EF1 mRNA expression paralleled by a decrease in Coll2aI mRNA. These data suggested that
EF1 might suppress chondrocyte specific genes in the limb bud before the onset of chondrogenesis (16).
Recent studies have demonstrated that
EF1 is able to repress type 1 collagen (
11 col) gene expression in ROS 17/2.8 cells (15). A 123-bp repressor element, collagen-inhibitory element-1, located 14 kb upstream of the transcriptional start site of the type I collagen gene, consists of three copies of a 41-bp repeat, each of which contain a
EF1 consensus sequence. Point mutations in these motifs abolished both binding of
EF1 to this element and repression by
EF1. Another
EF1/Zfh-1 family member, Smad interacting protein-1, has been shown to repress bone morphogenic protein-2-induced alkaline phosphatase activity in C2C12 cells (28). Our studies demonstrate that
EF1, in addition to its effects on osteocalcin gene expression, is able to repress both alkaline phosphatase and
11col mRNA levels in ROS 17/2.8 cells.
Previous studies have identified unique silencer elements in the first exon and intron of the rat osteocalcin gene that contribute to gene regulation. A sequence from +24 to +151, containing part of the coding region of the first exon along with the 5' region of the first intron, was shown to significantly decrease transcription of osteocalcin fusion genes in both the native context and in an orientation-dependent manner when located 3' to the chloramphenicol acetyl transferase reporter gene (12, 13). Mutation of another sequence, TTTCTTT, located at +118 to +124, between the two CCTCCT motifs examined in this study, markedly impaired silencing by sequences in the first intron, suggesting the factor that interacts with this motif may be a key regulator in osteocalcin gene expression (21). These studies, and those reported herein, demonstrate the importance of intronic sequences in the regulation of osteocalcin gene expression.
The repressive effect of
EF1 on osteocalcin, alkaline phosphatase, and collagen gene expression points to an important role for this transcription factor in the regulation of bone formation. The dramatic suppression of the endogenous osteocalcin mRNA by
EF1 relative to the modest suppression of the wtS-(-306-OCluc) fusion gene, likely reflects functional interactions of this transcription factor with numerous other putative
EF1 motifs in the 5' regulatory region of the osteocalcin gene. Like the intronic
EF1 motifs, these motifs are present in the human and rat osteocalcin genes. In the mouse limb bud,
EF1 is expressed at high levels at embryonic d 9.5 and gradually decreases, being undetectable at the time of condensation of mesenchymal cells that give rise to the cartilaginous mold (27). Following this stage, expression of osteoblast genes including alkaline phosphatase (embryonic d 13.5), type I collagen (embryonic d 14.0), and osteocalcin (embryonic d 18) is observed, suggesting that the decrease in
EF1 expression may lead to derepression of these genes. Our data, examining the effects of
EF1 on the levels of mRNAs encoding these genes, suggest that
EF1 acts to suppress or limit the osteoblast phenotype. This may occur at one of several stages.
EF1 may act to attenuate osteoblast differentiation, reflected by decreased expression of osteoblast genes, including type I collagen, alkaline phosphatase and osteocalcin. However, because
EF1 represses expression of these genes in ROS 17/2.8 cells, a model of mature osteoblasts, the principal skeletal effects of this transcription factor, after skeletal morphogenesis, may be in the postproliferative osteoblast.
EF1 may play a role in suppressing matrix synthesis by lining osteoblasts and/or osteocytes. Alternatively, transcriptional repression of the genes encoding the two most abundant bone matrix proteins, type I collagen and osteocalcin, may reflect a key role for
EF1 in limiting matrix formation during bone remodeling. Due to the perinatal lethality of the
EF1 knockout mice, the role of this transcription factor in skeletal maturation and remodeling remain unclear. However, the suppression of osteocalcin, type I collagen, and alkaline phosphatase gene expression by
EF1 and other family members suggest that this family of transcription factors may play a key role in skeletal homeostasis.
| Acknowledgments |
|---|
| Footnotes |
|---|
Abbreviations: CMV, Cytomegalovirus; EV, empty vector; mOCS, mutant osteocalcin suppressor; wtOCS, wild-type osteocalcin suppressor.
Received December 26, 2001.
Accepted for publication May 7, 2002.
| References |
|---|
|
|
|---|
in the rat osteocalcin gene. Endocrinology 134:11131120
EF1 binds to a far-upstream sequence of the mouse pro-
1(I) collagen gene and represses its expression in osteoblasts. J Biol Chem 276:3701137019
EF1 is inversely expressed with type II collagen mRNA and can repress Col2a1 promoter activity in transfected chondrocytes. J Biol Chem 275:36103618
crystallin enhancer-binding protein
EF1 is a repressor of E2 box mediated gene activation. Mol Cell Biol 14:56925700
EF1 and its binding site essential for lens-specific activity of the
1-crystallin enhancer. Nucleic Acids Res 19:35433547
-crystallin enhancer binding protein
EF1 is a zinc finger-homeodomain protein implicated in postgastrulation embryogenesis. Development 119:433446[Abstract]
EF1 and cross-species conservation of its domains. Gene 173:227232[CrossRef][Medline]
1-crystallin enhancer. Mol Cell Biol 13:52065215
EF1 mutant mice. J Exp Med 185:14671479
EF1, a zinc finger and homeodomain transcription factor, is required for skeleton patterning in multiple lineages. Development 125:2131[Abstract]
This article has been cited by other articles:
![]() |
M. Ponticos, T. Partridge, C. M. Black, D. J. Abraham, and G. Bou-Gharios Regulation of Collagen Type I in Vascular Smooth Muscle Cells by Competition between Nkx2.5 and {delta}EF1/ZEB1 Mol. Cell. Biol., July 15, 2004; 24(14): 6151 - 6161. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |