help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Brand, H.
Right arrow Articles by Reid, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Brand, H.
Right arrow Articles by Reid, G.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*Nucleotide
*UniGene
*Substance via MeSH
Endocrinology Vol. 143, No. 9 3397-3404
Copyright © 2002 by The Endocrine Society

ARTICLE

A Novel Promoter Is Involved in the Expression of Estrogen Receptor {alpha} in Human Testis and Epididymis

Heike Brand, Martin Kos, Stefanie Denger, Gilles Flouriot, Jörg Gromoll, Frank Gannon and George Reid

European Molecular Biology Laboratory (H.B., M.K., S.D., F.G., G.R.), D-69117 Heidelberg, Germany; Equipe d’Endocrinologie Moleculaire de la Reproduction (G.F.), Unité Mixte de Recherche Centre National de la Recherche Scientifique 6026, Université de Rennes I, 35042 Rennes Cedex, France; and Institute of Reproductive Medicine (J.G.), D-48120 Münster, Germany

Address all correspondence and requests for reprints to: George Reid, European Molecular Biology Laboratory, Meyerhofstrasse I, Heidelberg D-69117, Germany. E-mail: reid{at}embl-heidelberg.de.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The role of estrogens in the development and physiology of the male reproductive tract remains provocative, with a growing body of evidence suggesting that estrogens are able to influence normal testis development and physiology, through their classical receptors, estrogen receptor (ER)-{alpha} and ER-ß. We describe the identification and characterization of a new promoter that is involved in the expression of ER-{alpha} in the epididymis and in testis. This promoter lies on chromosome 6q25.1, approximately 16 kb upstream of the first coding exon of ER-{alpha}. Sequence analysis indicates that this promoter has a conventional TATA box and GC box but no upstream CAAT sequence. Alternative splicing results in at least two species of mRNA encoding ER-{alpha} being synthesized from this promoter. Transcription profiling of human tissues shows that, among those tested, this promoter is predominantly active only in testis and epididymal tissues. Transient transfection assays using this new promoter in a number of cell lines indicate that the region we have identified functions as a promoter and that tissue-specific regulation is likely to be dependent on inhibitory sequences greater than 1 kb upstream of the transcription start site.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
ANDROGENS, PRIMARILY TESTOSTERONE and dihydrotestosterone, are the major class of steroid hormones that develop and maintain male reproductive physiology. In consequence, lack of androgen receptor, for example, results in a feminized, pseudohermaphrodite phenotype and invariably results in infertility. However, initial development of the testis, which is required for subsequent masculinization, does not require the involvement of androgens (1, 2).

The role of estrogen and estrogen receptors (ERs) in the development and maintenance of the male reproductive tract remains provocative and unclear. To date, two nuclear ERs have been described, ER-{alpha} (3) and ER-ß (4). Mice deficient in aromatase, the enzyme responsible for the formation of estrogens, although initially fertile, develop progressive Leydig cell abnormalities later in life with concomitant impairment in spermatogenesis (5). Aromatase-deficient male humans may have oligozoospermia and immotile spermatozoa (6, 7). The discovery and phenotypic evaluation of a man with a null mutation in his ER-{alpha} genes (8) who has apparently normal testes and normal sperm density but decreased viability of his spermatozoa, in conjunction with the targeted disruption of ER-{alpha} and ER-ß in the mouse (9, 10), all suggest that estrogens can have a selective biological effect on the male reproductive system.

The predominant ER within the human male testis is likely to be ER-ß (11), which is expressed in spermatogonia, spermatocytes and early developing spermatids. These authors were not able to detect ER-{alpha} expression in testis. ER-{alpha} is present in noncilliated epithelial cells in the efferent ductules and in the epithelial cells of the epididymis (12), although again ER-{alpha} was not detected within the testis. Both ER-{alpha} protein and mRNA have been detected in spermatozoa. Immunocytochemistry located ER-{alpha} to the tail of spermatozoa, suggesting a direct involvement of this receptor in an estrogen-mediated, rapid, nongenomic sensing that spermatozoa are present within the female reproductive tract (13).

Moreover, ERs may be responsive not only to estrogens but also to other chemically diverse compounds, in particular to some androgens, phytoestrogens, and to environmental estrogens, which have all been demonstrated to have some estrogenic activity (14).

The generation of ER-{alpha} transcripts in humans is complex and subject to the activity of several distinct promoters (15). At present, a total of six human ER-{alpha} promoters are known, and these generate transcripts that differ in their 5'-untranslated regions (UTRs) (15, 16, 17). The 5' exon associated with individual promoters are then spliced to a common splice acceptor site located at position +163 bp relative to the transcription start site generated by the most proximal ER-{alpha} promoter (15, 16, 17, 18, 19, 20, 21).

Alternative promoter usage may account for the differential expression of ER-{alpha} in a wide variety of tissues, which, in addition to testis, is present in reproductive tissues such as ovary and uterus (18) and in mammary gland (19). ER-{alpha} is also expressed in the pituitary and central nervous system (20), bone (21, 22), vascular tissue (23), liver (18), and adipose tissue (24). The plethora of alternative promoters may not only act to determine the tissue distribution of ER-{alpha}, but also to regulate the abundance of receptor within cell types (25). This level widely varies, for example, from relatively high levels in breast carcinoma cell lines (26), lower levels of expression in the female reproductive tract (27), to even lower expression in bone (21).

We examined the promoter usage involved in the expression of ER-{alpha} in testis to confirm that mRNA encoding ER-{alpha} was indeed present in testis and to determine if this occurred in a tissue-specific way. The products obtained by primer extension analysis of testis mRNA using a primer from the coding sequence of ER-{alpha} were found to be of a different size compared with the products obtained from uterus and from MCF-7 cells. Cloning and sequence analysis of these products indicated that the 5' end of ER-{alpha} transcripts in human testis did not correspond to any known ER-{alpha} promoter activity. Further, S1 nuclease protection analysis confirmed that these novel transcripts were expressed in testis. RT-PCR of defined tissues isolated from the male reproductive tract indicates that this promoter is active in testis and in epididymal tissue but not in prostate. The genomic location of this testis/epididymis specific promoter was located approximately 16 kb from the common splice site at position +163 relative to the originally described transcriptional start site (3).


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Human tissues/organs
The testis material was obtained from a 69-yr-old man who underwent surgery for prostatic carcinoma. There is no information available on his fertility status or on his hormone levels, and he was not treated with antiandrogens before surgery. Epididymis was obtained from a 73-yr-old patient, who also had prostatic carcinoma and who was also not treated with antiandrogens before surgery. Again, his fertility and hormone status are not known. The epididymis was carefully dissected from the testis, according to Yeung et al. (1991 and 1993, Refs. 28 and 29 , respectively) with the scissors rinsed as appropriate during this procedure to avoid contamination between tissues that were cut into the different parts of the epididymis. The separation from caput and corpus was made between sampling sites 1 and 2, the corpus extended to just beyond sampling site 4, and the cauda included region 5. Human testis, uterus, and prostate RNA was obtained from CLONTECH Laboratories, Inc. (Palo Alto, CA).

Primer extension
Primer extension was performed by an improved RACE technique, entitled PEETA, as described previously (30). In essence, total RNA was either isolated from cells using TRIzol (Invitrogen, Carlsbad, CA) or, in the case of testis RNA, purchased from CLONTECH Laboratories, Inc. A PCR product, encompassing the initiating AUG of human ER-{alpha} p66 to residue 126, was amplified from pHEO (31) using biotin-atgaccatgaccctccacaccaaagcatctggg as a forward primer and gctggccgtggggctgcaggaa as a reverse primer. This product was bound to magnetic beads coated with streptavadin (Dynal, Oslo, Norway) and the noncoding strand removed by alkaline denaturation. An internal extension primer (tctgaccgtagacctgcgc, Fig. 1Go) was annealed to the biotinylated strand which was then used as a template for the generation of a highly radiolabeled primer. This primer was released from the streptavadin beads by alkaline treatment and hybridized to 30 µg of total RNA. This primed template was extended by 50 U of Expand reverse transcriptase (Roche Molecular Biochemicals, Mannheim, Germany), the products denatured and resolved on an 8% denaturing polyacrylamide/urea gel.



View larger version (8K):
[in this window]
[in a new window]
  		Figure 1. Schematic representation of the location of primers used in the specific amplification of the ER-{alpha} mRNA arising from testis promoter activity. The relative position of the radiolabeled primer used in the initial primer extension analysis is also shown.

 
S1 analysis
Single-stranded DNA probes for S1 nuclease protection analysis (32), encompassing from their 5' end, 100 bp of vector-derived sequence, promoter-specific exon sequence [either A (62 bp), T1+T2 (340 bp) or T1 (86 bp)] and 295 bp of human ER-{alpha} sequence downstream of +163 splice acceptor site (see Fig. 3Go) were generated from constructs made in the pCR2.1 cloning vector (Invitrogen). Briefly, biotinylated M13 forward primer (biotin-ctggccgtcgttttac) was used in conjunction with an ER-{alpha} reverse primer, ctcacaggaccagactccataatggta, to amplify each specific probe from the appropriate template. The product was bound to streptavidin-coated magnetic beads (Dynal) and the nonbiotinylated strand removed by alkaline denaturation. An internal primer, tctgaccgtagacctgcgc, was annealed to the immobilized strand and extended with T7 DNA polymerase in the presence of [{alpha}-32P]-deoxy-CTP (Amersham Pharmacia Bioetech, Little Chalfont, Buckinghamshire, UK). The resulting probe was eluted from the beads by alkaline denaturation, purified from a denaturing gel and 105 cpm hybridized overnight at 55 C with 30 µg of total RNA. S1 nuclease digestion was then carried out as described by Ausubel et al. (33). Protected fragments were detected by autoradiography following resolution on an 8% denaturing polyacrylamide gel.



View larger version (20K):
[in this window]
[in a new window]
  		Figure 3. The structure of the two testis-specific ER-{alpha} mRNA splice variants (T1 and T1+T2) are shown in Fig. 2AGo. The 87-bp exon associated with the testis promoter transcription start site is present in both forms of the testis ER-{alpha} mRNA. However, this exon can be alternatively spliced to either the T2 exon or directly to the first coding exon of ER-{alpha}. The genomic organization of the ER-{alpha} T promoter is illustrated in Fig. 2BGo. The T promoter lies approximately 16 kb upstream of the common splice acceptor site in the first coding exon of the ER-{alpha} gene and is associated with the T1 exon, which is separated from the T2 exon by an intron 100 bp in size. Alternative splicing results in the T2 exon either being present or skipped in ER-{alpha} mRNA resulting from T promoter usage. Readily identifiable core promoter elements of the testis ER-{alpha} promoter are shown in Fig. 2CGo. Also shown is the major transcription start site identified by the initial primer extension analysis of testis RNA.

 
Tissue culture and transfections
All cell lines were maintained in DMEM (Invitrogen) containing 10% fetal bovine serum (Invitrogen) at 37 C with 5% CO2. Charcoal dextran-stripped serum was used at 2.5% concentration in phenol red-free DMEM when required. Promoter constructs were generated by PCR using a single reverse primer in conjunction with several forward primers to generate fragments of the testis promoter 250 bp, 750 bp, 1 kb, and 2 kb in size. The sequence of the reverse primer used was cgcgct agccaggcaagagagctcgtgaaagag and the forward primers were gcgggtacctccacactcattctattcacatcttttg (250 bp), gcgggtaccgtgccatttaatatctggggacctc (750 bp), cgcggtaccccaaagtggtgggccagagttctc (1 kb), and cgcggtaccaagatatgttcactttcctggctg (2 kb). The amplified products were directionally cloned as KpnI/NheI fragments into pGL2 basic (Promega, Southampton, UK). Cultured cells, in 6-cm2 dishes, were transfected with 5 µg of testis/epididymis promoter construct and 0.25 µg of a Renilla luciferase expressing plasmid using the CaPO4 method (34). Cells were plated at densities such that about 80% confluency was achieved at the assay endpoint. Cells were allowed to attach overnight, changed to either 10% fetal calf serum (FCS) containing media, stripped media or stripped media supplemented with estradiol (E2) for 24 h after which fresh media was again added for a further 24 h. The cells were then transfected with DNA and assayed for luciferase after a further 72 h.

Promoter specific RT-PCR
RNA was isolated from human uterus, distal cauda, proximal corpus, caput and whole testis using TRIzol (Invitrogen) as described by the manufacturer. An outline of the nested PCR, along with the location of the primer used in the primer extension protocol, is detailed in Fig. 1Go. Total RNA was then primed using a primer (P3) complementary to the mRNA sequence located in the 3' UTR of the ER-{alpha} gene (GATTATCTGAACCGTGTGGGAGCCAGGGAG) and reverse transcribed using MuLV reverse transcriptase (Roche Molecular Biochemicals) according to the first strand synthesis protocol given by the manufacturer. A nested PCR protocol was necessary to consistently obtain the 2.0-kb testis promoter specific product from these samples. One microgram of reverse transcribed mRNA was used as a target in a 50-µl first-round PCR with the RT primer P3 described above and a testis promoter specific forward primer P1 (TTGCCTGCCGCCATGTAAGAA). A second-round PCR amplification was then carried out on 1 µl of the first-round PCR using the reverse primer P4 (CTCTCAGACTGTGGCAGGGAAACC) in conjunction with an inner testis promoter specific primer P2 (GCGCCTTTGCTCTTCCTTT). Products were then resolved on a 1.2% agarose gel.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
A radiolabeled primer encompassing the initiating AUG of the ER-{alpha} open reading frame to nucleotide +225 was used in a primer extension protocol with total RNA isolated from MCF-7 cells and from testis, prostate and uterine tissue. Yeast tRNA was used as a control for specificity. Extended products were obtained with each human derived total RNA (Fig. 1Go). The major product in MCF-7 cells, representing around 70% of the total extended products, was subsequently found, following cloning and sequence analysis, to result from utilization of the A promoter. In contrast, many extended products were obtained with uterine RNA, indicating that, as previously demonstrated (17), multiple promoters contribute to the pool of ER-{alpha} mRNA in this tissue. The major mRNA species in uterus however are derived from A and C promoter activity. Prostate predominantly expressed mRNA species resulting from the A and C promoters, albeit with ER-{alpha} mRNA levels in this tissue at around 50-fold less abundance than in uterus or in MCF-7 cells. More interestingly, two novel extended products were observed with testis RNA, again at a relatively low abundance compared with ER-{alpha} transcripts present in uterus or in MCF-7 cells. These products, along with the major bands subsequently found to be the product of A and C promoter usage in uterus, were excised, poly dC tailed, amplified, cloned, and sequenced, as previously described (30).

Sequence analysis of the longer testis extension product (237 bp of unique sequence 5' to the common splice acceptor site) and the shorter testis extension product (87 bp of unique sequence 5' to the common splice acceptor site) indicated that the 5' region of these mRNAs had no similarity to any previously known ER-{alpha} gene products. Further, the shorter sequence was present at the 5' end of the long extension product, suggesting that the longer testis sequence arises through incomplete or alternative splicing during the generation of these mRNA species (Fig. 2AGo). This was confirmed by amplifying a PCR product from human genomic DNA using a forward primer derived from the short testis sequence in conjunction with a reverse primer from the unique part of the longer sequence. The resulting product, following cloning and sequencing, demonstrated that there are two 5' noncoding exons that can be present in ER-{alpha} mRNA resulting from testis promoter activity. The exon adjacent to the testis promoter is named as T1 with the longer, alternatively spliced exon named T2. T1 and T2 are separated from each other by a short (101 bp) intron.



View larger version (65K):
[in this window]
[in a new window]
  		Figure 2. Primer extension of RNA isolated from MCF-7 cells (an ER positive breast carcinoma cell line), testis, prostate, and uterus gave rise to specific extended products. Those marked with an asterisk were excised, tailed, amplified by PCR, cloned, and sequenced as previously described (30 ). This analysis identified the "A" and "C" promoters that have been previously characterized. These proximal promoters were active in all tissues tested; however, two novel sequences were isolated from testis RNA. Untreated probe and probe hybridized with yeast tRNA served as negative controls.

 
A blast search of the human genome using either T2 or T1 as query sequence identified a contig, 67346 bp in size (EMBL accession no. AL356311) located at 6q25.1–26 of chromosome six. Complete homology between both query sequences and part of this contig occurs on the minus strand between positions 10134 to 10049 (T1 exon) and positions 9948 to 9769 (T2 exon). Contig AL356311 also contains the first coding exon of ER-{alpha} and the four previously identified ER-{alpha} promoters located within a 4-kb region 5' to initiating ATG of exon 1. The genomic sequence confirms that the T1 and T2 exons are separated by a 101-bp intron. A schematic representation of the testis promoter within the genomic context of ER-{alpha} is shown in Fig. 2BGo. The major core promoter elements of the ER-{alpha} testis promoter, determined using weighted matrices as defined by Bucher (35), are shown in Fig. 2CGo. Although a CAAT box was not present in the ER-{alpha} testis promoter, a GC box, with the potential to bind the general transcription factor Sp1 and a TATA box, directing recruitment of RNA polymerase II to the promoter, are present in this sequence with very high homology to their respective consensus sequence elements. The major transcription start site, defined experimentally by the initial primer extension analysis, is positioned 23 nucleotides downstream from the TATA box. Numerous potential transcription factor binding sites were detected by computer analysis of the ER-{alpha} testis promoter (36). The relevant sequence, including 100 bp of the promoter sequence, exon T1, the 101-bp intron and exon T2, are available in the EMBL Nucleotide Sequence Database under accession no. AJ421639.

The tissue-specific utilization of the testis promoter was then evaluated using a highly sensitive modified S1 nuclease protection assay (32). Three probes (Fig. 3AGo), encompassing the A, T2, and T1 5'UTRs were used to specifically detect ER-{alpha} mRNA species derived from A and testis promoter activity. The A promoter contributed to the pool of ER-{alpha} mRNAs present in MCF-7 cells and in all of the tissues (testis, prostate, and ovary) examined. However, expression of the testis promoter, evaluated for both splice variants, demonstrates that this promoter is most active in testis. In contrast, expression is weak in prostate with no detectable expression found in MCF-7 cells (Fig. 3BGo). Surprisingly, two specific protected bands, of similar intensity, were obtained with the T1 + T2 probe. As we had limited amounts of defined tissue from the male reproductive tract, nested RT-PCR was used to evaluate testis promoter utilization in human distal cauda, proximal corpus, caput epididymis, testis, and in uterus. We were able to amplify a 2.0-kb product corresponding to full-length ER-{alpha} in all tissues apart from uterus (data not shown).

Testis/epididymis ER-{alpha} promoter constructs of 2, 1 kb, and 750 and 250 bp were then generated from genomic DNA using a series of primers designed upstream of the +1 transcription start site as defined by the initial primer extension experiments. These promoters were cloned into pGL-2 basic, a promoter-less luciferase expression vector. The resulting constructs were then transfected into HeLa and HepG2 cells and luciferase levels determined 72 h after transfection. The basal activity of the parental vector pGL-2 was evaluated and all experiments were corrected for transfection efficiency using a Renilla luciferase-expressing plasmid, driven from the cytomegalovirus immediate early promoter, as an internal transfection control. Experiments were performed in triplicate and results are presented as a mean with SD. The series of testis/epididymis promoters clearly function well in both cell lines (Figs. 4Go and 5Go), with the 1-kb promoter construct around 1000-fold more active than the empty reporter construct in HeLa cells and the 250-bp construct approximately 400-fold more active than parental vector in HepG2 cells. Promoter activity in cells growing in media supplemented with 10% FCS was consistently around 5- to 10-fold higher than cells grown in media containing dextran/charcoal stripped FCS. The addition of E2 or dihydroxytestosterone to media containing charcoal/dextran-stripped serum failed to restore promoter activity. Clearly, some other soluble factor(s), removed during dextran/charcoal treatment of FCS, is able to induce a strong response from the ER-{alpha} testis/epididymis promoter. Elements located between +1 kb to +2 kb of the testis/epididymis promoter have an inhibitory effect on activity in both HeLa and HepG2 cells. In HepG2 cells most of the core promoter activity resides in the first 250 nucleotides upstream from the transcription start site, whereas in HeLa cells promoter activity decreases with size up to 1 kb of the transcription start site.



View larger version (69K):
[in this window]
[in a new window]
  		Figure 4. The tissue-specific expression of the testis promoter was evaluated by S1 analysis. Probes were designed that detect individual ER-{alpha} mRNA 5' UTRs as shown in Fig. 3AGo. Vector-derived sequence was included to discriminate between undigested probe and protected fragments. A total of 295 nucleotides of sequence downstream from the common splice acceptor site at +163 was also included in the probe to detect the total amount of ER-{alpha} mRNA present in the sample. Figure 3BGo demonstrates that, whereas the "A" promoter is used in every tissue evaluated, expression of the testis promoter is most active in testis.

 


View larger version (17K):
[in this window]
[in a new window]
  		Figure 5. Transient transfection analysis of the T core promoter using sequences 250 bp, 750 bp, 1 kb, and 2 kb in size was performed in HeLa cells (an endometrial carcinoma cell line) (Fig. 4AGo) and in HepG2 cells (a liver carcinoma cell line) (Fig. 4BGo). In HeLa cells, the shorter promoters function well but this activity is considerably reduced when charcoal-stripped media, even when supplemented with E2, is used. The 2-kb promoter is much less active than the shorter forms. These promoters are also active in HepG2 cells, but the reduction in activity with length is less pronounced than in HeLa cells.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
Primer extension analysis, using a highly sensitive protocol (30) was used to determine if an unidentified promoter was involved in the expression of ER-{alpha} in testis. Unlike nuclease protection assays or RT-PCR, techniques that have been previously employed to detect ER-{alpha} mRNA in testis, primer extension does not rely on having complete prior knowledge of the nucleic acid sequence under investigation. The primer used was entirely 3' to the common splice acceptor used by every ER-{alpha} promoter that has been identified to date, thereby increasing the likelihood of detecting novel transcripts. Two extended products, of sizes different from those arising from promoters used in MCF-7 cells, prostate or uterus, were present at low abundance. These were excised, tailed, amplified by PCR, cloned, and sequenced. The 5' UTRs of the two testis products had not been previously identified and were likely to arise from the activity of novel promoters. Of note is that a third extended product was obtained with testis RNA and was found to result from "A" promoter activity, the promoter that lies most proximal to the first coding exon of the ER-{alpha} gene. It may be useful to analyze additional tissues with this procedure, in particular, pituitary, brain, and smooth muscle, where ER-{alpha} is believed to play a significant role in normal physiology or in pathology and where additional promoters to those already described may have a role in the tissue-specific expression of ER-{alpha} mRNA.

Sequence analysis revealed that both novel testis transcripts were likely to result from a single promoter followed by alternative, or incomplete splicing of the resulting precursor mRNA, as the longer extended product contained an additional 237 bp between the unique 5' UTR present in the shorter product and the splice site present in the first coding exon of the ER-{alpha} gene (see Fig. 2Go). This is reminiscent of exon F1 in the mouse ER-{alpha} gene, which can alternatively splice to a common splice acceptor site located at position +119 in the first coding exon or to exon F2, located between exon F1 and the first coding exon (37). As with all other ER-{alpha} promoters described to date, the 5' UTR region resulting from testis/epididymis promoter activity splices to the common splice site at position +163. However, other splicing options within the human ER-{alpha} gene also available, as for example, human exon F can either splice to +163 or can skip coding exon 1 and splice to the beginning of coding exon 2, resulting in a transcript that expresses a truncated ER-{alpha} isoform, 46-kDa in size (38).

The genomic location of the novel testis 5' UTRs could be placed on a contig (67,346 bp in size) from chromosome 6, which also contained the first coding exon and the proximal promoter cluster of the ER-{alpha} gene. This further strengthens our suggestion that we have discovered a new promoter for the expression of ER-{alpha} mRNA. The testis promoter lies between four adjacent promoters that are found within a 2-kb region immediately upstream of the initial coding exon and very distal promoters (16) that are located between 89.3 kb and 134.3 kb upstream of the testis promoter (15). It is clear that, between the promoter region (151 kb; Ref. 15) and the region containing the coding exons (140 kb; Ref. 39), the ER-{alpha} gene encompasses a sizable genetic unit that may contain further promoters and alternative coding exons. It is possible that some ER-{alpha} promoters require to be separated from each other by a significant distance so that epigenetic events involved in either the activation or suppression of individual promoters during differentiation apply to a single promoter and do not affect other promoters, as chromosome condensation associated with epigenetic silencing usually extends over a minimum of several kilobase pairs (40).

Nuclease protection assays using probes designed to detect ER-{alpha} mRNA variants with 5' UTR sequences corresponding to exon A, T1, and T2 screened against a limited panel of RNA isolated from human tissues indicated that the T promoter gives rise to significant ER-{alpha} mRNA in testis with weak expression seen in uterus, in prostate, or in MCF-7 cells. Two protected bands of similar intensity were obtained with the T1 + T2 S1 probe, indicating that two mRNA species, differing in the length of their 5' UTR, result from testis promoter activity. The size of the lower species indicates that the shorter product contains all of exon T2. It is not possible from our analysis to know if additional sequence, specifically the 101-bp intron between exons T1 and T2, can be present in an ER-{alpha} transcript arising from testis promoter activity in addition to the species where exon T1 is directly spliced to position +164. If this were the case, it implies that three mRNA variants result from the testis promoter, namely a long form consisting of exon T1, the 100-bp intron and exon T2 then spliced to the common splice acceptor site at +163; a splice variant where the 100 intron is not present and a short splice variant where exon T1 is spliced directly to +163. We further examined testis promoter utilization within the male reproductive tract using RNA prepared from microdissected human distal cauda, proximal corpus, and caput epididymis and testis. Although there was insufficient RNA to perform an S1 nuclease protection assay with these samples, we were able to amplify by nested RT-PCR a 2.0-kb product encompassing the testis promoter specific 5'UTR to exon 8 of the ER-{alpha} gene. No product was obtained with mRNA prepared from uterus (data not shown). We provide evidence that mRNA encoding ER-{alpha} is present within the testis and epididymis. There is considerable debate as to the level of ER-{alpha} protein found within the testis, although ER-{alpha} has been detected in the epididymis (12). There are six initiation codons before the initiation codon used in the translation of the ER-{alpha} open reading frame, suggesting that translational control may provide another regulatory point in the expression of ER-{alpha} from mRNA transcripts arising from the testis/epididymis promoter.

The data obtained with PEETA, S1 nuclease protection assays and RT-PCR strongly indicate that the T promoter is a tissue-specific promoter responsive to factors produced only in testis and epididymal tissue. These observations contrast with the strong activity observed in transient transfections of the core T promoter in the cell types tested (HeLa and HepG2, Fig. 4Go; NTERA, MCF-7 and Cos cells, data not shown). Further, the activity of the T promoter was around 10-fold higher than the proximal A promoter or the distal F promoter in HeLa and HepG2 cells grown in complete media (data not shown). The activity of the testis/epididymis promoter was severely impaired when sequences upstream of approximately -1 kb were included in the promoter, indicating that repressor elements in this distal promoter region interact with transcription factors to suppress promoter activity. Also, epigenetic effects in vivo, such as DNA methylation and chromatin condensation, could inhibit promoter expression when present in chromatin, and this may act to preclude promoter activity in cell types other than testis and epididymis.

In conclusion, we have identified and partially characterized a novel ER-{alpha} promoter that is used in the expression of ER-{alpha} in testis and in the epididymis. This observation provides further support for the hypothesis that estrogens, through the classical ER-{alpha} receptor, play a role in the male reproductive tract.


   Acknowledgments
 
T. G. Cooper, Institute of Reproductive Medicine, is acknowledged for providing human epididymal material.


   Footnotes
 
This work was partially supported by European Community grant number QLK6-1999-0218. J.G. is grateful to the German Research Foundation (FOR 197/3-1) for their support.

Abbreviations: E2, Estradiol; ER, estrogen receptor; FCS, fetal calf serum; UTR, untranslated region.

Received July 23, 2001.

Accepted for publication May 6, 2002.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Simpson JL, Rebar RW 1995 Normal and Abnormal sexual differentiation and development. In: Becker KL, ed. Principles and practice of endocrinology and metabolism. Philadelphia: Lippincott; 788–850
  2. Hughes IA, Ahmed SF 1999 Disorders of sexual development and their long term consequences. In: O’Brian PMS, Wheeler T, Barker DJP, eds. Fetal programming: influences on development and diseases in later life. London: Royal Collage of Obstetricians and Gyneacologists Press; 157–173
  3. Green S, Walter P, Kumar V, Krust A, Bornert JM, Argos P, Chambon P 1986 Human oestrogen receptor cDNA: sequence, expression and homology to v-erb-A. Nature 320:134–139[CrossRef][Medline]
  4. Kuiper GG, Enmark E, Pelto-Huikko M, Nilsson S, Gustafsson JA 1996 Cloning of a novel receptor expressed in rat prostate and ovary. Proc Natl Acad Sci USA 93:5925–5930[Abstract/Free Full Text]
  5. Robertson KM, O’Donnell L, Jones ME, Meachem SJ, Boon WC, Fisher CR, Graves KH, McLachlan RI, Simpson ER 1999 Impairment of spermatogenesis in mice lacking a functional aromatase (cyp 19) gene. Proc Natl Acad Sci USA 96:7986–7991[Abstract/Free Full Text]
  6. Morishima A, Grumbach MM, Simpson ER, Fisher C, Qin K 1995 Aromatase deficiency in male and female siblings caused by a novel mutation and the physiological role of estrogens. J Clin Endocrinol Metab 80:3689–3698[Abstract]
  7. Carani C, Qin K, Simoni M, Faustini-Fustini M, Serpente S, Boyd J, Korach KS, Simpson ER 1997 Effect of testosterone and estradiol in a man with aromatase deficiency. N Engl J Med 337:91–95[Free Full Text]
  8. Smith EP, Boyd J, Frank GR, Takahashi H, Cohen RM, Specker B, Williams TC, Lubahn DB, Korach KS 1994 Estrogen resistance caused by a mutation in the estrogen-receptor gene in a man. N Engl J Med 331:1056–1061[Abstract/Free Full Text]
  9. Couse JF, Korach KS 1999 Estrogen receptor null mice: what have we learned and where will they lead us? Endocr Rev 20:358–417[Abstract/Free Full Text]
  10. Dupont S, Krust A, Gansmuller A, Dierich A, Chambon P, Mark M 2000 Effect of single and compound knockouts of estrogen receptors {alpha} (ER{alpha}) and ß (ERß) on mouse reproductive phenotypes. Development 127:4277–4291[Abstract]
  11. Makinen S, Makela S, Weihua Z, Warner M, Rosenlund B, Salmi S, Hovatta O, Gustafsson JK 2001 Localization of oestrogen receptors {alpha} and ß in human testis. Mol Hum Reprod 7:497–503[Abstract/Free Full Text]
  12. Saunders PT, Sharpe RM, Williams K, Macpherson S, Urquart H, Irvine DS, Millar MR 2001 Differential expression of oestrogen receptor {alpha} and ß proteins in the testes and male reproductive system of human and non-human primates. Mol Hum Reprod 7:227–236[Abstract/Free Full Text]
  13. Durkee TJ, Mueller M, Zinaman M 1998 Identification of estrogen receptor protein and messenger ribonucleic acid in human spermatozoa. Am J Obstet Gynecol 178:1288–1297[CrossRef][Medline]
  14. Korach KS, Migliaccio S, Davis VL 1995 Principles of pharmacology. Basic concepts and clinical applications. New York: Chapmann and Hall
  15. Kos M, Reid G, Denger S, Gannon F 2001 Minireview: genomic organization of the human ER{alpha} gene promoter region. Mol Endocrinol 15:2057–2063[Abstract/Free Full Text]
  16. Thompson DA, McPherson LA, Carmeci C, deConinck EC, Weigel RJ 1997 Identification of two estrogen receptor transcripts with novel 5' exons isolated from a MCF7 cDNA library. J Steroid Biochem Mol Biol 62:143–153[CrossRef][Medline]
  17. Flouriot G, Griffin C, Kenealy M, Sonntag-Buck V, Gannon F 1998 Differentially expressed messenger RNA isoforms of the human estrogen receptor-{alpha} gene are generated by alternative splicing and promoter usage. Mol Endocrinol 12:1939–1954[Abstract/Free Full Text]
  18. Shupnik MA, Gordon MS, Chin WW 1989 Tissue-specific regulation of rat estrogen receptor mRNAs. Mol Endocrinol 3:660–665[Abstract]
  19. Revelli A, Pacchioni D, Cassoni P, Bussolati G, Massobrio M 1996 In situ hybridization study of messenger RNA for estrogen receptor and immunohistochemical detection of estrogen and progesterone receptors in the human ovary. Gynecol Endocrinol 10:177–186[Medline]
  20. Simerly RB, Young BJ 1991 Regulation of estrogen receptor messenger ribonucleic acid in rat hypothalamus by sex steroid hormones. Mol Endocrinol 5:424–432[Abstract]
  21. Eriksen EF, Colvard DS, Berg NJ, Graham ML, Mann KG, Spelsberg TC, Riggs BL 1988 Evidence of estrogen receptors in normal human osteoblast-like cells. Science 241:84–86[Abstract/Free Full Text]
  22. Oursler MJ, Osdoby P, Pyfferoen J, Riggs BL, Spelsberg TC 1991 Avian osteoclasts as estrogen target cells. Proc Natl Acad Sci USA 88:6613–6617[Abstract/Free Full Text]
  23. Bayard F, Clamens S, Meggetto F, Blaes N, Delsol G, Faye JC 1995 Estrogen synthesis, estrogen metabolism, and functional estrogen receptors in rat arterial smooth muscle cells in culture. Endocrinology 136:1523–1529[Abstract]
  24. Mizutani T, Nishikawa Y, Adachi H, Enomoto T, Ikegami H, Kurachi H, Nomura T, Miyake A 1994 Identification of estrogen receptor in human adipose tissue and adipocytes. J Clin Endocrinol Metab 78:950–954[Abstract]
  25. Grandien K, Backdahl M, Ljunggren O, Gustafsson JA, Berkenstam A 1995 Estrogen target tissue determines alternative promoter utilization of the human estrogen receptor gene in osteoblasts and tumor cell lines. Endocrinology 136:2223–2229[Abstract]
  26. Horwitz KB, Costlow ME, McGuire WL 1975 MCF-7; a human breast cancer cell line with estrogen, androgen, progesterone and glucocorticoid receptors. Steroids 26:785–795[CrossRef][Medline]
  27. Spelsberg TC, Graham ML, Berg NJ, Umehara T, Riehl E, Coulam CB, Ingle JN 1987 A nuclear binding assay to assess the biological activity of steroid receptors in isolated animal and human tissues. Endocrinology 121:631–644[Abstract]
  28. Yeung CH, Cooper TG, Bergmann M, Schulze H 1991 Organization of tubules in the human caput epididymidis and the ultrastructure of their epithelia. Am J Anat 191:261–279[CrossRef][Medline]
  29. Yeung CH, Cooper TG, Oberpenning F, Schulze H, Nieschlag E 1993 Changes in movement characteristics of human spermatozoa along the length of the epididymis. Biol Reprod 49:274–280[Abstract]
  30. Flouriot G, Brand H, Gannon F 1999 Identification of differentially expressed 5'-end mRNA variants by an improved RACE technique (PEETA). Nucleic Acids Res 27:e8(i–iv)
  31. Green S, Issemann I, Sheer E 1988 A versatile in vivo and in vitro eukaryotic expression vector for protein engineering. Nucleic Acids Res 16:369[Free Full Text]
  32. Flouriot G, Nestor P, Kenealy MR, Pope C, Gannon F 1996 An S1 nuclease mapping method for detection of low abundance transcripts. Anal Biochem 237:159–161[CrossRef][Medline]
  33. Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K, eds. 1989 Current protocols in molecular biology. Hoboken, NJ: John Wiley and Sons; 4.6.1–4.6.13
  34. Graham FL, Van der Eb AJ 1973 A new technique for the assay of infectivity of human adenovirus 5 DNA. Virology 52:456–467[CrossRef][Medline]
  35. Bucher P 1990 Weight matrix descriptions of four eukaryotic RNA polymerase II promoter elements derived from 502 unrelated promoter sequences. J Mol Biol 212:563–578[CrossRef][Medline]
  36. Wingender E, Chen X, Hehl R, Karas H, Liebich I, Matys V, Meinhardt T, Pruss M, Reuter I, Schacherer F 2000 TRANSFAC: an integrated system for gene expression regulation. Nucleic Acids Res 28:316–319[Abstract/Free Full Text]
  37. Kos M, O’Brien S, Flouriot G, Gannon F 2000 Tissue-specific expression of multiple mRNA variants of the mouse estrogen receptor {alpha} gene. FEBS Lett 477:15–20[CrossRef][Medline]
  38. Flouriot G, Brand H, Denger S, Metivier R, Kos M, Reid G, Sonntag-Buck V, Gannon F 2000 Identification of a new isoform of the human estrogen receptor-{alpha} (hER-{alpha}) that is encoded by distinct transcripts and that is able to repress hER-{alpha} activation function 1. EMBO J 19:4688–4700[CrossRef][Medline]
  39. Ponglikitmongkol M, Green S, Chambon P 1988 Genomic organization of the human oestrogen receptor gene. EMBO J 7:3385–3388[Medline]
  40. Rice JC, Allis CD 2001 Histone methylation versus histone acetylation: new insights into epigenetic regulation. Curr Opin Cell Biol 13:263–273[CrossRef][Medline]



This article has been cited by other articles:


Home page
 J Mol EndocrinolHome page
M. Longo, B. Peruzzi, D. Fortunati, V. De Luca, S. Denger, G. Caselli, S. Migliaccio, and A. Teti
Modulation of human estrogen receptor {alpha} F promoter by a protein kinase C/c-Src-dependent mechanism in osteoblast-like cells
J. Mol. Endocrinol., December 1, 2006; 37(3): 489 - 502.
[Abstract] [Full Text] [PDF]

Home page
 Endocr. Rev.Home page
M. H. Herynk and S. A. W. Fuqua
Estrogen Receptor Mutations in Human Disease
Endocr. Rev., December 1, 2004; 25(6): 869 - 898.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
M. Kos, S. Denger, G. Reid, and F. Gannon
Upstream Open Reading Frames Regulate the Translation of the Multiple mRNA Variants of the Estrogen Receptor alpha
J. Biol. Chem., September 27, 2002; 277(40): 37131 - 37138.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Brand, H.
Right arrow Articles by Reid, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Brand, H.
Right arrow Articles by Reid, G.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*Nucleotide
*UniGene
*Substance via MeSH

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals