| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLE |
in Human Testis and Epididymis
European Molecular Biology Laboratory (H.B., M.K., S.D., F.G., G.R.), D-69117 Heidelberg, Germany; Equipe dEndocrinologie Moleculaire de la Reproduction (G.F.), Unité Mixte de Recherche Centre National de la Recherche Scientifique 6026, Université de Rennes I, 35042 Rennes Cedex, France; and Institute of Reproductive Medicine (J.G.), D-48120 Münster, Germany
Address all correspondence and requests for reprints to: George Reid, European Molecular Biology Laboratory, Meyerhofstrasse I, Heidelberg D-69117, Germany. E-mail: reid{at}embl-heidelberg.de.
| Abstract |
|---|
|
|
|---|
and ER-ß. We describe the identification and characterization of a new promoter that is involved in the expression of ER-
in the epididymis and in testis. This promoter lies on chromosome 6q25.1, approximately 16 kb upstream of the first coding exon of ER-
. Sequence analysis indicates that this promoter has a conventional TATA box and GC box but no upstream CAAT sequence. Alternative splicing results in at least two species of mRNA encoding ER-
being synthesized from this promoter. Transcription profiling of human tissues shows that, among those tested, this promoter is predominantly active only in testis and epididymal tissues. Transient transfection assays using this new promoter in a number of cell lines indicate that the region we have identified functions as a promoter and that tissue-specific regulation is likely to be dependent on inhibitory sequences greater than 1 kb upstream of the transcription start site. | Introduction |
|---|
|
|
|---|
The role of estrogen and estrogen receptors (ERs) in the development and maintenance of the male reproductive tract remains provocative and unclear. To date, two nuclear ERs have been described, ER-
(3) and ER-ß (4). Mice deficient in aromatase, the enzyme responsible for the formation of estrogens, although initially fertile, develop progressive Leydig cell abnormalities later in life with concomitant impairment in spermatogenesis (5). Aromatase-deficient male humans may have oligozoospermia and immotile spermatozoa (6, 7). The discovery and phenotypic evaluation of a man with a null mutation in his ER-
genes (8) who has apparently normal testes and normal sperm density but decreased viability of his spermatozoa, in conjunction with the targeted disruption of ER-
and ER-ß in the mouse (9, 10), all suggest that estrogens can have a selective biological effect on the male reproductive system.
The predominant ER within the human male testis is likely to be ER-ß (11), which is expressed in spermatogonia, spermatocytes and early developing spermatids. These authors were not able to detect ER-
expression in testis. ER-
is present in noncilliated epithelial cells in the efferent ductules and in the epithelial cells of the epididymis (12), although again ER-
was not detected within the testis. Both ER-
protein and mRNA have been detected in spermatozoa. Immunocytochemistry located ER-
to the tail of spermatozoa, suggesting a direct involvement of this receptor in an estrogen-mediated, rapid, nongenomic sensing that spermatozoa are present within the female reproductive tract (13).
Moreover, ERs may be responsive not only to estrogens but also to other chemically diverse compounds, in particular to some androgens, phytoestrogens, and to environmental estrogens, which have all been demonstrated to have some estrogenic activity (14).
The generation of ER-
transcripts in humans is complex and subject to the activity of several distinct promoters (15). At present, a total of six human ER-
promoters are known, and these generate transcripts that differ in their 5'-untranslated regions (UTRs) (15, 16, 17). The 5' exon associated with individual promoters are then spliced to a common splice acceptor site located at position +163 bp relative to the transcription start site generated by the most proximal ER-
promoter (15, 16, 17, 18, 19, 20, 21).
Alternative promoter usage may account for the differential expression of ER-
in a wide variety of tissues, which, in addition to testis, is present in reproductive tissues such as ovary and uterus (18) and in mammary gland (19). ER-
is also expressed in the pituitary and central nervous system (20), bone (21, 22), vascular tissue (23), liver (18), and adipose tissue (24). The plethora of alternative promoters may not only act to determine the tissue distribution of ER-
, but also to regulate the abundance of receptor within cell types (25). This level widely varies, for example, from relatively high levels in breast carcinoma cell lines (26), lower levels of expression in the female reproductive tract (27), to even lower expression in bone (21).
We examined the promoter usage involved in the expression of ER-
in testis to confirm that mRNA encoding ER-
was indeed present in testis and to determine if this occurred in a tissue-specific way. The products obtained by primer extension analysis of testis mRNA using a primer from the coding sequence of ER-
were found to be of a different size compared with the products obtained from uterus and from MCF-7 cells. Cloning and sequence analysis of these products indicated that the 5' end of ER-
transcripts in human testis did not correspond to any known ER-
promoter activity. Further, S1 nuclease protection analysis confirmed that these novel transcripts were expressed in testis. RT-PCR of defined tissues isolated from the male reproductive tract indicates that this promoter is active in testis and in epididymal tissue but not in prostate. The genomic location of this testis/epididymis specific promoter was located approximately 16 kb from the common splice site at position +163 relative to the originally described transcriptional start site (3).
| Materials and Methods |
|---|
|
|
|---|
Primer extension
Primer extension was performed by an improved RACE technique, entitled PEETA, as described previously (30). In essence, total RNA was either isolated from cells using TRIzol (Invitrogen, Carlsbad, CA) or, in the case of testis RNA, purchased from CLONTECH Laboratories, Inc. A PCR product, encompassing the initiating AUG of human ER-
p66 to residue 126, was amplified from pHEO (31) using biotin-atgaccatgaccctccacaccaaagcatctggg as a forward primer and gctggccgtggggctgcaggaa as a reverse primer. This product was bound to magnetic beads coated with streptavadin (Dynal, Oslo, Norway) and the noncoding strand removed by alkaline denaturation. An internal extension primer (tctgaccgtagacctgcgc, Fig. 1
) was annealed to the biotinylated strand which was then used as a template for the generation of a highly radiolabeled primer. This primer was released from the streptavadin beads by alkaline treatment and hybridized to 30 µg of total RNA. This primed template was extended by 50 U of Expand reverse transcriptase (Roche Molecular Biochemicals, Mannheim, Germany), the products denatured and resolved on an 8% denaturing polyacrylamide/urea gel.
|
sequence downstream of +163 splice acceptor site (see Fig. 3
reverse primer, ctcacaggaccagactccataatggta, to amplify each specific probe from the appropriate template. The product was bound to streptavidin-coated magnetic beads (Dynal) and the nonbiotinylated strand removed by alkaline denaturation. An internal primer, tctgaccgtagacctgcgc, was annealed to the immobilized strand and extended with T7 DNA polymerase in the presence of [
-32P]-deoxy-CTP (Amersham Pharmacia Bioetech, Little Chalfont, Buckinghamshire, UK). The resulting probe was eluted from the beads by alkaline denaturation, purified from a denaturing gel and 105 cpm hybridized overnight at 55 C with 30 µg of total RNA. S1 nuclease digestion was then carried out as described by Ausubel et al. (33). Protected fragments were detected by autoradiography following resolution on an 8% denaturing polyacrylamide gel.
|
Promoter specific RT-PCR
RNA was isolated from human uterus, distal cauda, proximal corpus, caput and whole testis using TRIzol (Invitrogen) as described by the manufacturer. An outline of the nested PCR, along with the location of the primer used in the primer extension protocol, is detailed in Fig. 1
. Total RNA was then primed using a primer (P3) complementary to the mRNA sequence located in the 3' UTR of the ER-
gene (GATTATCTGAACCGTGTGGGAGCCAGGGAG) and reverse transcribed using MuLV reverse transcriptase (Roche Molecular Biochemicals) according to the first strand synthesis protocol given by the manufacturer. A nested PCR protocol was necessary to consistently obtain the 2.0-kb testis promoter specific product from these samples. One microgram of reverse transcribed mRNA was used as a target in a 50-µl first-round PCR with the RT primer P3 described above and a testis promoter specific forward primer P1 (TTGCCTGCCGCCATGTAAGAA). A second-round PCR amplification was then carried out on 1 µl of the first-round PCR using the reverse primer P4 (CTCTCAGACTGTGGCAGGGAAACC) in conjunction with an inner testis promoter specific primer P2 (GCGCCTTTGCTCTTCCTTT). Products were then resolved on a 1.2% agarose gel.
| Results |
|---|
|
|
|---|
open reading frame to nucleotide +225 was used in a primer extension protocol with total RNA isolated from MCF-7 cells and from testis, prostate and uterine tissue. Yeast tRNA was used as a control for specificity. Extended products were obtained with each human derived total RNA (Fig. 1
mRNA in this tissue. The major mRNA species in uterus however are derived from A and C promoter activity. Prostate predominantly expressed mRNA species resulting from the A and C promoters, albeit with ER-
mRNA levels in this tissue at around 50-fold less abundance than in uterus or in MCF-7 cells. More interestingly, two novel extended products were observed with testis RNA, again at a relatively low abundance compared with ER-
transcripts present in uterus or in MCF-7 cells. These products, along with the major bands subsequently found to be the product of A and C promoter usage in uterus, were excised, poly dC tailed, amplified, cloned, and sequenced, as previously described (30).
Sequence analysis of the longer testis extension product (237 bp of unique sequence 5' to the common splice acceptor site) and the shorter testis extension product (87 bp of unique sequence 5' to the common splice acceptor site) indicated that the 5' region of these mRNAs had no similarity to any previously known ER-
gene products. Further, the shorter sequence was present at the 5' end of the long extension product, suggesting that the longer testis sequence arises through incomplete or alternative splicing during the generation of these mRNA species (Fig. 2A
). This was confirmed by amplifying a PCR product from human genomic DNA using a forward primer derived from the short testis sequence in conjunction with a reverse primer from the unique part of the longer sequence. The resulting product, following cloning and sequencing, demonstrated that there are two 5' noncoding exons that can be present in ER-
mRNA resulting from testis promoter activity. The exon adjacent to the testis promoter is named as T1 with the longer, alternatively spliced exon named T2. T1 and T2 are separated from each other by a short (101 bp) intron.
|
and the four previously identified ER-
promoters located within a 4-kb region 5' to initiating ATG of exon 1. The genomic sequence confirms that the T1 and T2 exons are separated by a 101-bp intron. A schematic representation of the testis promoter within the genomic context of ER-
is shown in Fig. 2B
testis promoter, determined using weighted matrices as defined by Bucher (35), are shown in Fig. 2C
testis promoter, a GC box, with the potential to bind the general transcription factor Sp1 and a TATA box, directing recruitment of RNA polymerase II to the promoter, are present in this sequence with very high homology to their respective consensus sequence elements. The major transcription start site, defined experimentally by the initial primer extension analysis, is positioned 23 nucleotides downstream from the TATA box. Numerous potential transcription factor binding sites were detected by computer analysis of the ER-
testis promoter (36). The relevant sequence, including 100 bp of the promoter sequence, exon T1, the 101-bp intron and exon T2, are available in the EMBL Nucleotide Sequence Database under accession no. AJ421639.
The tissue-specific utilization of the testis promoter was then evaluated using a highly sensitive modified S1 nuclease protection assay (32). Three probes (Fig. 3A
), encompassing the A, T2, and T1 5'UTRs were used to specifically detect ER-
mRNA species derived from A and testis promoter activity. The A promoter contributed to the pool of ER-
mRNAs present in MCF-7 cells and in all of the tissues (testis, prostate, and ovary) examined. However, expression of the testis promoter, evaluated for both splice variants, demonstrates that this promoter is most active in testis. In contrast, expression is weak in prostate with no detectable expression found in MCF-7 cells (Fig. 3B
). Surprisingly, two specific protected bands, of similar intensity, were obtained with the T1 + T2 probe. As we had limited amounts of defined tissue from the male reproductive tract, nested RT-PCR was used to evaluate testis promoter utilization in human distal cauda, proximal corpus, caput epididymis, testis, and in uterus. We were able to amplify a 2.0-kb product corresponding to full-length ER-
in all tissues apart from uterus (data not shown).
Testis/epididymis ER-
promoter constructs of 2, 1 kb, and 750 and 250 bp were then generated from genomic DNA using a series of primers designed upstream of the +1 transcription start site as defined by the initial primer extension experiments. These promoters were cloned into pGL-2 basic, a promoter-less luciferase expression vector. The resulting constructs were then transfected into HeLa and HepG2 cells and luciferase levels determined 72 h after transfection. The basal activity of the parental vector pGL-2 was evaluated and all experiments were corrected for transfection efficiency using a Renilla luciferase-expressing plasmid, driven from the cytomegalovirus immediate early promoter, as an internal transfection control. Experiments were performed in triplicate and results are presented as a mean with SD. The series of testis/epididymis promoters clearly function well in both cell lines (Figs. 4
and 5
), with the 1-kb promoter construct around 1000-fold more active than the empty reporter construct in HeLa cells and the 250-bp construct approximately 400-fold more active than parental vector in HepG2 cells. Promoter activity in cells growing in media supplemented with 10% FCS was consistently around 5- to 10-fold higher than cells grown in media containing dextran/charcoal stripped FCS. The addition of E2 or dihydroxytestosterone to media containing charcoal/dextran-stripped serum failed to restore promoter activity. Clearly, some other soluble factor(s), removed during dextran/charcoal treatment of FCS, is able to induce a strong response from the ER-
testis/epididymis promoter. Elements located between +1 kb to +2 kb of the testis/epididymis promoter have an inhibitory effect on activity in both HeLa and HepG2 cells. In HepG2 cells most of the core promoter activity resides in the first 250 nucleotides upstream from the transcription start site, whereas in HeLa cells promoter activity decreases with size up to 1 kb of the transcription start site.
|
|
| Discussion |
|---|
|
|
|---|
in testis. Unlike nuclease protection assays or RT-PCR, techniques that have been previously employed to detect ER-
mRNA in testis, primer extension does not rely on having complete prior knowledge of the nucleic acid sequence under investigation. The primer used was entirely 3' to the common splice acceptor used by every ER-
promoter that has been identified to date, thereby increasing the likelihood of detecting novel transcripts. Two extended products, of sizes different from those arising from promoters used in MCF-7 cells, prostate or uterus, were present at low abundance. These were excised, tailed, amplified by PCR, cloned, and sequenced. The 5' UTRs of the two testis products had not been previously identified and were likely to arise from the activity of novel promoters. Of note is that a third extended product was obtained with testis RNA and was found to result from "A" promoter activity, the promoter that lies most proximal to the first coding exon of the ER-
gene. It may be useful to analyze additional tissues with this procedure, in particular, pituitary, brain, and smooth muscle, where ER-
is believed to play a significant role in normal physiology or in pathology and where additional promoters to those already described may have a role in the tissue-specific expression of ER-
mRNA.
Sequence analysis revealed that both novel testis transcripts were likely to result from a single promoter followed by alternative, or incomplete splicing of the resulting precursor mRNA, as the longer extended product contained an additional 237 bp between the unique 5' UTR present in the shorter product and the splice site present in the first coding exon of the ER-
gene (see Fig. 2
). This is reminiscent of exon F1 in the mouse ER-
gene, which can alternatively splice to a common splice acceptor site located at position +119 in the first coding exon or to exon F2, located between exon F1 and the first coding exon (37). As with all other ER-
promoters described to date, the 5' UTR region resulting from testis/epididymis promoter activity splices to the common splice site at position +163. However, other splicing options within the human ER-
gene also available, as for example, human exon F can either splice to +163 or can skip coding exon 1 and splice to the beginning of coding exon 2, resulting in a transcript that expresses a truncated ER-
isoform, 46-kDa in size (38).
The genomic location of the novel testis 5' UTRs could be placed on a contig (67,346 bp in size) from chromosome 6, which also contained the first coding exon and the proximal promoter cluster of the ER-
gene. This further strengthens our suggestion that we have discovered a new promoter for the expression of ER-
mRNA. The testis promoter lies between four adjacent promoters that are found within a 2-kb region immediately upstream of the initial coding exon and very distal promoters (16) that are located between 89.3 kb and 134.3 kb upstream of the testis promoter (15). It is clear that, between the promoter region (151 kb; Ref. 15) and the region containing the coding exons (140 kb; Ref. 39), the ER-
gene encompasses a sizable genetic unit that may contain further promoters and alternative coding exons. It is possible that some ER-
promoters require to be separated from each other by a significant distance so that epigenetic events involved in either the activation or suppression of individual promoters during differentiation apply to a single promoter and do not affect other promoters, as chromosome condensation associated with epigenetic silencing usually extends over a minimum of several kilobase pairs (40).
Nuclease protection assays using probes designed to detect ER-
mRNA variants with 5' UTR sequences corresponding to exon A, T1, and T2 screened against a limited panel of RNA isolated from human tissues indicated that the T promoter gives rise to significant ER-
mRNA in testis with weak expression seen in uterus, in prostate, or in MCF-7 cells. Two protected bands of similar intensity were obtained with the T1 + T2 S1 probe, indicating that two mRNA species, differing in the length of their 5' UTR, result from testis promoter activity. The size of the lower species indicates that the shorter product contains all of exon T2. It is not possible from our analysis to know if additional sequence, specifically the 101-bp intron between exons T1 and T2, can be present in an ER-
transcript arising from testis promoter activity in addition to the species where exon T1 is directly spliced to position +164. If this were the case, it implies that three mRNA variants result from the testis promoter, namely a long form consisting of exon T1, the 100-bp intron and exon T2 then spliced to the common splice acceptor site at +163; a splice variant where the 100 intron is not present and a short splice variant where exon T1 is spliced directly to +163. We further examined testis promoter utilization within the male reproductive tract using RNA prepared from microdissected human distal cauda, proximal corpus, and caput epididymis and testis. Although there was insufficient RNA to perform an S1 nuclease protection assay with these samples, we were able to amplify by nested RT-PCR a 2.0-kb product encompassing the testis promoter specific 5'UTR to exon 8 of the ER-
gene. No product was obtained with mRNA prepared from uterus (data not shown). We provide evidence that mRNA encoding ER-
is present within the testis and epididymis. There is considerable debate as to the level of ER-
protein found within the testis, although ER-
has been detected in the epididymis (12). There are six initiation codons before the initiation codon used in the translation of the ER-
open reading frame, suggesting that translational control may provide another regulatory point in the expression of ER-
from mRNA transcripts arising from the testis/epididymis promoter.
The data obtained with PEETA, S1 nuclease protection assays and RT-PCR strongly indicate that the T promoter is a tissue-specific promoter responsive to factors produced only in testis and epididymal tissue. These observations contrast with the strong activity observed in transient transfections of the core T promoter in the cell types tested (HeLa and HepG2, Fig. 4
; NTERA, MCF-7 and Cos cells, data not shown). Further, the activity of the T promoter was around 10-fold higher than the proximal A promoter or the distal F promoter in HeLa and HepG2 cells grown in complete media (data not shown). The activity of the testis/epididymis promoter was severely impaired when sequences upstream of approximately -1 kb were included in the promoter, indicating that repressor elements in this distal promoter region interact with transcription factors to suppress promoter activity. Also, epigenetic effects in vivo, such as DNA methylation and chromatin condensation, could inhibit promoter expression when present in chromatin, and this may act to preclude promoter activity in cell types other than testis and epididymis.
In conclusion, we have identified and partially characterized a novel ER-
promoter that is used in the expression of ER-
in testis and in the epididymis. This observation provides further support for the hypothesis that estrogens, through the classical ER-
receptor, play a role in the male reproductive tract.
| Acknowledgments |
|---|
| Footnotes |
|---|
Abbreviations: E2, Estradiol; ER, estrogen receptor; FCS, fetal calf serum; UTR, untranslated region.
Received July 23, 2001.
Accepted for publication May 6, 2002.
| References |
|---|
|
|
|---|
(ER
) and ß (ERß) on mouse reproductive phenotypes. Development 127:42774291[Abstract]
and ß in human testis. Mol Hum Reprod 7:497503
and ß proteins in the testes and male reproductive system of human and non-human primates. Mol Hum Reprod 7:227236
gene promoter region. Mol Endocrinol 15:20572063
gene are generated by alternative splicing and promoter usage. Mol Endocrinol 12:19391954
gene. FEBS Lett 477:1520[CrossRef][Medline]
(hER-
) that is encoded by distinct transcripts and that is able to repress hER-
activation function 1. EMBO J 19:46884700[CrossRef][Medline]
This article has been cited by other articles:
![]() |
M. Longo, B. Peruzzi, D. Fortunati, V. De Luca, S. Denger, G. Caselli, S. Migliaccio, and A. Teti Modulation of human estrogen receptor {alpha} F promoter by a protein kinase C/c-Src-dependent mechanism in osteoblast-like cells J. Mol. Endocrinol., December 1, 2006; 37(3): 489 - 502. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. H. Herynk and S. A. W. Fuqua Estrogen Receptor Mutations in Human Disease Endocr. Rev., December 1, 2004; 25(6): 869 - 898. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kos, S. Denger, G. Reid, and F. Gannon Upstream Open Reading Frames Regulate the Translation of the Multiple mRNA Variants of the Estrogen Receptor alpha J. Biol. Chem., September 27, 2002; 277(40): 37131 - 37138. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |