| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLE |
Department of Vascular Surgery (C.Y., C.F., S.W., Y.L.), The First Affiliated Hospital of Sun Yat-sen University, Sun Yat-sen University, Guangzhou, Guangdong 510075, China; and University of Pittsburgh Cancer Institute and Department of Pathology (C.Y., C.F., X.L., M.L.), University of Pittsburgh School Medicine, Pittsburgh, Pennsylvania 15213
Address all correspondence and requests for reprints to: 200 Lothrop Street, Biomedical Science Tower, Room W955, University of Pittsburgh Cancer Institute, Pittsburgh, Pennsylvania 15213. E-mail: mengfeng{at}pitt.edu.
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Antiangiogenesis represents a novel and promising approach to cancer therapy. Tumor growth and metastasis depend on blood supply and blood vessel formation (1, 2). Angiogenic factors produced by tumor cells, including vascular endothelial growth factor (VEGF), fibroblast growth factors, and angiopoietins, promote tumor angiogenesis, a process by which neovessels are formed from preexisting host vasculature (2, 3). A large number of studies have shown that antiangiogenic therapy inhibits tumor progression in vivo (4, 5). In thyroid cancer, up-regulated angiogenesis and expression of angiogenic factors have been reported. Expression of VEGF has been shown in cultured DTC cells as well as clinical DTC samples (6, 7, 8, 9). Although the clinical significance of VEGF in DTC patients is yet to be clarified, a number of previous reports demonstrated that the expression of VEGF in DTC might be related to disease prognosis (10, 11, 12) and that downmodulation of VEGF inhibited DTC growth in vivo (13, 14). Serum VEGF level was found elevated in metastatic DTC patients (9). These studies suggest that the vascularization in thyroid cancers might be an effective target for novel therapeutic approaches and that DTC might represent an ideal model for development of effective antiangiogenic therapy.
Endostatin is an antiangiogenic factor isolated from hemangioendothelioma cells as a carboxyl-terminal segment of collagen XVIII (15). Although the mechanism through which endostatin suppresses angiogenesis in a tumor-specific manner generally remains unclear, it has been shown that endostatin induced endothelial cell apoptosis and inhibited endothelial migration. Several potential molecular targets of endostatin have been postulated by previous studies (16, 17, 18). Numerous reports from our laboratory and others showed that recombinant endostatin significantly inhibited tumor growth as well as metastasis when injected sc into tumor-bearing animals (19, 20, 21, 22, 23, 24, 25). Gene therapy approaches have also been explored to deliver endostatin treatment for experimental tumors. Endostatin gene transfer and expression mediated by viral or nonviral vectors have been shown to lead to tumor suppression and prolonged animal survival (26, 27, 28, 29, 30, 31, 32).
The antiangiogenic and antitumor effects of endostatin have not been tested in thyroid cancer models. Here we report an in vivo study that used recombinant endostatin as well as an endostatin gene therapy approach to treat follicular thyroid carcinoma (FTC) xenograft. In DTC, FTC has a higher tendency to metastasize than papillary thyroid carcinoma. Our results suggest that both endostatin protein and endostatin gene therapy were effective in suppressing the growth of xenografted FTC-133 FTC in athymic mice.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Plasmids and bacteria
Plasmid expressing murine endostatin with a histidine tag (pTB01#4) was a kind gift from Dr. Judah Folkman (Harvard Medical School, Boston, MA) (15). The expression of endostatin is driven by isopropyl-1-thio-ß-D-galactopyranoside-inducible T7lac promoter elements. The bacteria strain used for endostatin expression is the BL21 (DE3) pLysS strain (Promega Corp., Madison, WI).
Recombinant endostatin
An expression and purification procedure for recombinant endostatin from Escherichia coli has been described previously (19). Briefly, BL21(DE3)pLysS bacterial cells transformed with pTB01#4 were plated on a Kan+LB plate (10 g/liter tryptone, 5 g/liter yeast extract, 10 g/liter NaCl, and 50 mg/liter kanamycin). Colonies inoculated into 20-ml LB medium containing 50 mg/liter kanamycin were cultured at 37 C overnight. The culture was then transferred to 1-liter LB and cultured at 37 C until OD600 reached 0.8. Isopropyl-1-thio-ß-D-galactopyranoside was added to the culture at a final concentration of 0.3 mM to induce the expression of endostatin. After culturing in a 37 C shaker for another 3-h period, a bacteria pellet was collected with low-speed centrifugation, followed by lysis with 8 M urea. The lysate was then applied to a Ni2-NTA-column (QIAGEN, Valencia, CA). After washing with 8 M urea containing 10 mM imidazole, endostatin was eluted with 250 mM imidazole-containing 8 M urea. Finally, the endostatin product was dialyzed against 1x PBS (molecular weight cut-off 6000–8000) at 4 C for 8 h. During the dialysis, the purified protein precipitates to form insoluble recombinant endostatin, aliquoted, and stored at -20 C. The dialysis product was subject to endotoxin level determination (Limulu Amebocyte Lysate Progent/plus, BioWhittaker, Inc., Walkersville, MD). Quantification of the endostatin protein before dialysis was by the protein dye method (Bio-Rad Laboratories, Inc., Hercules, CA) as described by the manufacturer.
Construction of endostatin-expressing retroviral vector
Endostatin gene was amplified from plasmid pTB01#4 using PCR method catalyzed with the Deep Vent DNA polymerase according to instruction provided by the manufacturer (New England Biolabs, Inc., Beverly, MA). The sequences of the upstream sense primer and the downstream antisense primer are as follows: TGGCTAGCTCATACTCATCAGG and GCGGATCCTATTTGGAGA, respectively. The signal peptide of BM-40, an extracellular matrix protein, was used for secretion of endostatin (35). The coding sequence of this signal peptide was constructed by annealing two synthesized oligonucleotides: sense strand-AATTCATGAGGGCCTGGATCTTCTTTCTCCTTTGCCTGGCCGGGAGGGCTCTGGCAGCCCCTCAGCAAGAAGCG; antisense strand-GATCCGCTTCTTGCTGAGGGGCTGCCAGAGCCCTCCCGGCCAGGCAAAGGAGAAAGAAGATCCAGGCCCTCATG (GenBank accession no. Y00755). The PCR-amplified endostatin product was digested with EcoRI and NheI restriction enzymes and ligated to the annealed double-stranded BM-40 signal sequence. The resultant ligate was then further ligated to the large fragment of EcoRI + BamHI digested plasmid pFB-Neo-LacZ, a retroviral vector plasmid (Stratagene, Cedar Creek, CA) (Fig. 1
). After sequence verification, the resultant plasmid pFB-BmEndo-Neo was then transfected to packaging cell line CRIP (34), using Lipofectamine 2000 liposome (Invitrogen) by following the manufacturer’s manual. Then, 800 µg/ml G418 (Invitrogen) was added to the CRIP cells after transfection to select for cells (CRIP-BmEndo) that stably produce recombinant retroviral particles.
|
RT-PCR confirmation of gene expression of transduced endostatin in FTC-BmEndo cells
Total cellular RNA was isolated from FTC-BmEndo and parental FTC-133 cells with RNAZol reagent, respectively, according to a standard method following the manufacturer’s instruction (Biotecx Laboratories, Houston, TX). RT-PCR amplification used an upstream sense primer specific for the BM-40 signal sequence (GCGAATTCATGAGGGCCTGGATC) and a downstream antisense primer directed against the 3'-end of endostatin gene (GCGGATCCTATTTGGAGA). These primers should detect only transcripts derived from the transduced endostatin gene containing the BM-40 signal sequence but not those from the endogenous collagen XVIII. RNAs of FTC-BmEndo and FTC-133 cells were subjected to RT-PCR, respectively, using the One-Step RT-PCR kit (Invitrogen) according to the manufacturer’s manual.
In vivo animal studies
To test the effect of recombinant endostatin on the growth of FTC xenograft, 1 x 106 FTC-133 cells were inoculated sc at a dorsal site on 4- to 6-wk-old female nude mice 
/ (Taconic, Germantown, NY). When the tumor nodules reached 5 mm in diameter, mice were randomly assigned to treatment groups (PBS alone and endostatin). There were five mice in each treatment group. Endostatin was injected sc distal to the tumor inoculation site (20 mg/kg·d). Tumors were measured with calipers, and tumor volumes were calculated (tumor volume = length x width2 x 0.52). Each data point was presented as mean volume ± SE. The mice were killed when tumors reached 2.0 cm in diameter or became ulcerated per the protocol approved by the University of Pittsburgh Institutional Animal Care and Use Committee, and the tumors were resected. The inhibition rate of endostatin (20 mg/kg·d) at the experiment end point was calculated as 100% x (mean of control tumor volumes - mean of endostatin-treated tumor volumes)/mean of control tumor volumes.
To test the in vivo growth of FTC-133 cells that were engineered to secrete endostatin (FTC-BmEndo), 1 x 106 FTC-BmEndo cells and FTC-133 cells were inoculated sc on two groups of nude mice, respectively, with five mice in each group. Tumor volumes were measured and presented as mean volume ± SE.
In vitro growth rates of FTC-133 or FTC-BmEndo cells
FTC-133 and FTC-BmEndo cells were inoculated in 6-well plates at a density of 0.05 x 106/well and cultured at 37 C. At the 24th, 48th, and 72nd hours of culture, cells were trypsinized, stained with Trypan Blue dye, and counted under microscope. The cell count at each time point was determined as the mean of triplicate wells.
Immunohistochemistry analysis for microvessel formation
Tumor specimens were fixed and frozen in tissue freezing medium (Triangle Biomedical Sciences, Durham, NC). Five-micrometer cryosections were cut and stained with hematoxylin-eosin for histopathological analysis. To analyze the microvessel formation in tumors, sections were stained with antiendostatin polyclonal antibody (Calbiochem, La Jolla, CA) or anti-CD31 rabbit monoclonal antibody (DAKO Corp., Carpinteria, CA) and subsequently with the avidin-biotin complex method. Positively vascular endothelial cells stained brown and were visualized and imaged using a digital camera attached to a microscope (Olympus Corp., Melville, NY). The microvessel density (MVD) was determined according to methods described previously (19, 36). Briefly, regions of highest vessel density (hot spot regions) were scanned at low magnification (x40–100) and counted at high magnification (x200). Three such fields were examined in each tumor section, and the mean MVD value was recorded. Any endothelial cell or endothelial cell cluster that was clearly separated from adjacent microvessels was considered a single, countable microvessel.
Detection of endostatin and VEGF in serum
Blood samples were collected from animals from the tail vein and refrigerated at 4 C overnight before centrifugation at 10,000 x g for 10 min. The supernatants (serum) were subjected to ELISA assays for mouse endostatin (Cytimmune Science, MD) and human VEGF (R&D Systems, Minneapolis, MN), respectively. The endostatin ELISA kit is specific for murine endostatin. Its cross-reactivity with human endostatin is less than 5%. The VEGF ELISA kit is exclusively for the detection of human VEGF with no cross-reaction with the murine counterpart. ELISA assays were performed by following the protocols specified for detection of serum endostatin and serum VEGF, respectively, provided by the manufacturers. Quantification of endostatin and VEGF were determined according to standard curves obtained with the provided standard endostatin or VEGF reagents.
Statistical analysis
For in vivo experiments and immunohistochemistry evaluation, tumor volumes were presented as mean ± SE. The t test was used to examine the statistical significance of the differences between groups (two-tailed). The level of significance was set at P less than 0.05.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
). No obvious toxicity, such as loss of weight, change in food/water intake, or changes in general behavior, was observed.
|
). Because the primers used were specific for the BM-40 signal sequence and endostatin, endogenous collagen XVIII or endostatin transcripts should not be amplified. The result of the RT-PCR demonstrated a strong endostatin band derived from the FTC-BmEndo RNA, as opposed to the negative amplification from RNA of parental FTC-133 cells, suggesting that the transduced endostatin gene was efficiently transcribed in a form fused to the BM-40 signal peptide sequence, which was designed to direct the secretion of endostatin polypeptide.
|
In vitro growth of endostatin-expressing FTC-133 cells
To test whether endostatin transduction and expression could affect the growth of FTC-133 cells in vitro, growth rates of both FTC-BmEndo cells and parental FTC-133 cells were determined (Fig. 4). The results exhibited the same growth rates of both cell lines, suggesting the transduction procedure as well as expression of endostatin did not change the in vitro growth of FTC-133 cells.
|
) suggested that endostatin inhibited the growth of FTC-133 xenografts. This inhibitory effect of endostatin was similar to the observation made with recombinant endostatin described above, further supporting that endostatin antiangiogenic therapy was effective in treating experimental FTC.
|
and Fig. 6). Such an antiangiogenic effect was associated with the presence of large amount of endostatin in resected tumor tissues, as immnunostained by antiendostatin antibodies. We found that all FTC-BmEndo tumor sections were full of positively stained endostatin signals, whereas the parental control exhibited no endostatin expression. Representative immunostaining results for endostatin are also presented in Fig. 6. These results strongly suggest that the suppression of FTC-BmEndo tumor growth was closely associated with high-level expression of endostatin within the tumor and its potent angiostatic effects.
|
|
, although the circulating level of endostatin in the FTC-BmEndo tumor-bearing mice was numerically higher than that in the FTC-133 tumor-bearing mice, the difference was not statistically significant (P = 0.367). The endostatin levels in the nude mice before injection of FTC tumor cells were 103 ± 30.50 ng/ml and was not significantly different from those in the FTC133-bearing mice.
We also assessed the level of VEGF in the sera of tumor-bearing mice. As shown in Table 1, the serum concentration of VEGF in mice-bearing FTC-BmEndo was dramatically reduced, compared with that in the FTC-133 tumor-bearing mice. The difference was statistically significant. In addition, such a reduction in VEGF concentration was associated with the difference of tumor volume in two groups of mice.
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
In this study, the antitumor effects of endostatin were tested by two different approaches, namely systemic injection of recombinant endostatin protein and endostatin gene transfer into FTC cells. In the recombinant protein experiment, daily injection of 20 mg/kg endostatin resulted in a significant inhibition on the growth of xenografted FTC-133 tumors by 84%. This result suggests that recombinant endostatin is effective and safe in treating FTC.
By engineering the FTC-133 cells with a retroviral vector, we have established a stable FTC-133 cell line (FTC-BmEndo) that permanently overexpresses secretable endostatin. When implanted in nude mice, the FTC-BmEndo tumor exhibited a lower growth rate than that of the parental FTC-133 tumors. Immunohistochemical staining confirmed the expression of a high level of endostatin within the FTC-BmEndo tumors and a reduced vascular microvessel density. When cultured in vitro, the FTC-BmEndo cells and the parental FTC-133 cells revealed equal growth rates, suggesting that the tumor growth inhibition resulted from the antiangiogenic activity of endostatin rather than a change in the proliferation of transduced FTC cells. This gene transfer experiment reproduced the antiangiogenic and antitumor effects of endostatin on FTC tumors. In the last several years, the antiangiogenic and antitumor effects of endostatin have been shown in a variety of tumor models. In vivo approaches used to deliver endostatin therapy include bolus injection of recombinant protein, intraperitoneal osmotic pump delivery of recombinant protein, gene therapy mediated by adenoviral or retroviral vector, and gene delivery by engineered mammalian cells (26, 27, 28, 29, 30, 31, 32). Recent evidence showed that continuous endostatin administration might provide a more efficient antitumor effect, indicating that a sustained in vivo appearance of endostatin protein might be important for its therapeutic efficacy (39). If this holds true, gene therapy approaches might have the advantage of administering continuous endostatin therapy. In fact, a number of animal studies indicated that endostatin gene therapy using viral or cell vehicles could lead to significant inhibition of tumor angiogenesis and progression (26, 27, 28, 29, 30, 31, 32). The data reported here confirm that the presence of endostatin in thyroid tumor tissues suppresses tumor growth and tumor angiogenesis.
Interestingly, the animals that bore FTC-BmEndo tumors did not exhibit significantly higher levels of endostatin in their sera than the FTC-133 tumor-bearing mice. By contrast, robust endostatin expression was found locally in the FTC-BmEndo tumors by immunohistochemistry analysis, compared with the lack of endostatin staining in the FTC-133 tumors. This notion is consistent with a previous study in which a profound antiangiogenic effect of endostatin was achieved but the serum level of endostatin remained low (31). That study, together with our current observation, implicates that an optimal delivery of endostatin in a bioactive form to the tumor microenvironment in which endostatin can act on its target might be key to the therapeutic effects. It is of note that some recent studies had experienced challenges in replicating the antitumor effects of endostatin in vivo despite the high level of endostatin in blood (40, 41). Although the causes of such difficulties remain obscure, several factors might impact the therapeutic efficacy of the endostatin therapy. First, it is well established that different tumors have distinct angiogenic profiles and might respond differentially to antiangiogenic therapies. Second, tumor vascular endothelia in different individuals, organs, tissues, and tumor locations could reveal heterogeneous angiogenic phenotypes (42, 43). Third, the dependence of tumor growth on angiogenesis might vary with the genetic alterations in oncogenes and/or tumor suppressor genes. A recent study showed that p53 null colon cancer exhibited resistance to therapy with anti-VEGF receptor antibody (44). Finally, lack of elucidated mechanisms of the actions of many angiogenesis inhibitors, including endostatin, makes it difficult to develop optimal drug delivery strategies and administration doses and schedules. As mentioned previously, an appropriate presence and optimal action of endostatin within the tumor microenvironment might be crucial to the therapeutic efficacy. Nonetheless, very few in vivo studies with endostatin reported thus far attempted to measure the endostatin in tumor tissues, which might be more important than examining the systemic level of endostatin, according to our study. Further understanding of the molecular mechanism of endostatin should facilitate the application of this potent antiangiogenic agent in cancer therapy.
Also noteworthy is that the systemic level of VEGF in FTC-BmEndo tumor-bearing mice was dramatically reduced, compared with that in mice bearing the FTC-133 tumors. The ELISA method used in our study was specific for human VEGF; therefore, the potential interference of host VEGF (mouse) could be ruled out. Thus far, there has been no evidence that endostatin could down-regulate the expression of VEGF in tumor cells, and our data demonstrated that endostatin did not inhibit the production of VEGF in tumor cells (data not shown). Because tumor cells are the only source of human VEGF in this model, it is more likely that the reduction in circulatory VEGF levels was a result of a reduced tumor burden caused by the antitumor effect of endostatin. Previous studies have shown that VEGF might be an important regulator for the development of vascularization in thyroid cancers (6, 7, 8, 9, 10, 11, 12, 13, 14). Consistent with this postulation, we found a correlation between tumor sizes and the VEGF levels. It remains unclear whether the serum VEGF level could be used as a prognostic marker in FTC. Thus, it will be of great interest to extend our observation and to investigate the significance of VEGF level in evaluating the progress of FTC and the anti-FTC efficacy of antiangiogenic therapies.
In summary, we have demonstrated the effects of endostatin on FTC angiogenesis and growth. Our results suggest that tumor angiogenesis could be a promising addition to the conventional targets of FTC therapy. It will be of great interest to study whether this novel therapeutic modality is effective in inhibiting FTC metastasis, and this will be a subject of future investigation in the laboratory.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
Abbreviations: DTC, Differentiated thyroid carcinoma; FTC, follicular thyroid carcinoma; FTC-BmEndo, FTC-133 cells that were engineered to secrete endostatin; MVD, microvessel density; VEGF, vascular endothelial growth factor.
Received April 23, 2002.
Accepted for publication May 24, 2002.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  S. Hoffmann, A. Wunderlich, S. Lingelbach, P. B. Musholt, T. J. Musholt, R. von Wasielewski, and A. Zielke Expression and Secretion of Endostatin in Thyroid Cancer Ann. Surg. Oncol., December 1, 2008; 15(12): 3601 - 3608. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M M Muresan, P Olivier, J Leclere, F Sirveaux, L Brunaud, M Klein, R Zarnegar, and G Weryha Bone metastases from differentiated thyroid carcinoma Endocr. Relat. Cancer, March 1, 2008; 15(1): 37 - 49. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Lyshchik, R. Moses, S. L. Barnes, T. Higashi, R. Asato, M. I. Miga, J. C. Gore, and A. C. Fleischer Quantitative Analysis of Tumor Vascularity in Benign and Malignant Solid Thyroid Nodules J. Ultrasound Med., June 1, 2007; 26(6): 837 - 846. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. N. Younes, Y. D. Yazici, S. Kim, S. A. Jasser, A. K. El-Naggar, and J. N. Myers Dual Epidermal Growth Factor Receptor and Vascular Endothelial Growth Factor Receptor Inhibition with NVP-AEE788 for the Treatment of Aggressive Follicular Thyroid Cancer. Clin. Cancer Res., June 1, 2006; 12(11): 3425 - 3434. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. De Nicola, J. Szejnfeld, A. F. Logullo, A. M. B. Wolosker, L. R. M. F. Souza, and V. Chiferi Jr Flow Pattern and Vascular Resistive Index as Predictors of Malignancy Risk in Thyroid Follicular Neoplasms J. Ultrasound Med., July 1, 2005; 24(7): 897 - 904. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. N. Younes, O. G. Yigitbasi, Y. W. Park, S.-J. Kim, S. A. Jasser, V. S. Hawthorne, Y. D. Yazici, M. Mandal, B. N. Bekele, C. D. Bucana, et al. Antivascular Therapy of Human Follicular Thyroid Cancer Experimental Bone Metastasis by Blockade of Epidermal Growth Factor Receptor and Vascular Growth Factor Receptor Phosphorylation Cancer Res., June 1, 2005; 65(11): 4716 - 4727. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Ye, C. Feng, S. Wang, K. Z. Q. Wang, N. Huang, X. Liu, Y. Lin, and M. Li sFlt-1 Gene Therapy of Follicular Thyroid Carcinoma Endocrinology, February 1, 2004; 145(2): 817 - 822. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. L. Davies, J. D. Ramsden, H. Cocks, P. F. Searle, J. C. Watkinson, H. Ueno, A. Logan, J. A. Franklyn, V. Mautner, and M. C. Eggo Adenovirus-Mediated Expression of Dominant Negative Fibroblast Growth Factor (FGF) Receptor 1 in Thyroid Cells Blocks FGF Effects and Reduces Goitrogenesis in Mice J. Clin. Endocrinol. Metab., September 1, 2003; 88(9): 4472 - 4480. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
