help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ye, C.
Right arrow Articles by Li, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ye, C.
Right arrow Articles by Li, M.
Endocrinology Vol. 143, No. 9 3522-3528
Copyright © 2002 by The Endocrine Society


ARTICLE

Antiangiogenic and Antitumor Effects of Endostatin on Follicular Thyroid Carcinoma

Caisheng Ye, Chong Feng, Shenming Wang, Xiaoning Liu, Yongjie Lin and Mengfeng Li

Department of Vascular Surgery (C.Y., C.F., S.W., Y.L.), The First Affiliated Hospital of Sun Yat-sen University, Sun Yat-sen University, Guangzhou, Guangdong 510075, China; and University of Pittsburgh Cancer Institute and Department of Pathology (C.Y., C.F., X.L., M.L.), University of Pittsburgh School Medicine, Pittsburgh, Pennsylvania 15213

Address all correspondence and requests for reprints to: 200 Lothrop Street, Biomedical Science Tower, Room W955, University of Pittsburgh Cancer Institute, Pittsburgh, Pennsylvania 15213. E-mail: mengfeng{at}pitt.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Tumor growth and metastasis depend on blood supply and blood vessel formation. Angiogenesis, therefore, represents a promising target for cancer therapy. Endostatin is one of the most potent antiangiogenic factors and has been shown to effectively inhibit angiogenesis and tumor growth in a variety of in vivo models. In this study, we tested the effects of endostatin on xenografted human follicular thyroid carcinoma (FTC) in nude mice. Our result demonstrated that recombinant endostatin significantly inhibited the growth of FTC xenografts. Furthermore, we established an endostatin-expressing FTC cell line (FTC-BmEndo) using retrovirus-mediated gene transfer approach. We found that the in vivo growth of FTC-BmEndo cells was significantly inhibited, compared with the parental FTC cells, whereas both lines grew at the same rate in vitro. High-level expression of endostatin within the FTC-BmEndo tumors was evidenced by immunohistochemical staining, paralleled with a reduced microvessel density. The systemic level of vascular endothelial growth factor was significantly lower in mice bearing the FTC-BmEndo tumors than in those bearing parental FTC tumors. By using two different approaches, namely the recombinant endostatin protein and the gene therapy strategy, our study demonstrated that endostatin could be effective in suppressing the growth of human FTC in immunodeficient mice.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
FOLLICULAR AND PAPILLARY thyroid carcinoma is referred to as differentiated thyroid carcinoma (DTC). Although DTC is usually curable, management of invasive and metastatic DTC remains challenging. Metastases are the major cause of death in DTC patients because of the lack of success in treating multiple metastases by surgical approaches. Such a challenge is most often encountered in elderly patients. Chemotherapy and radiotherapy might benefit some of these patients but do not represent a cure.

Antiangiogenesis represents a novel and promising approach to cancer therapy. Tumor growth and metastasis depend on blood supply and blood vessel formation (1, 2). Angiogenic factors produced by tumor cells, including vascular endothelial growth factor (VEGF), fibroblast growth factors, and angiopoietins, promote tumor angiogenesis, a process by which neovessels are formed from preexisting host vasculature (2, 3). A large number of studies have shown that antiangiogenic therapy inhibits tumor progression in vivo (4, 5). In thyroid cancer, up-regulated angiogenesis and expression of angiogenic factors have been reported. Expression of VEGF has been shown in cultured DTC cells as well as clinical DTC samples (6, 7, 8, 9). Although the clinical significance of VEGF in DTC patients is yet to be clarified, a number of previous reports demonstrated that the expression of VEGF in DTC might be related to disease prognosis (10, 11, 12) and that downmodulation of VEGF inhibited DTC growth in vivo (13, 14). Serum VEGF level was found elevated in metastatic DTC patients (9). These studies suggest that the vascularization in thyroid cancers might be an effective target for novel therapeutic approaches and that DTC might represent an ideal model for development of effective antiangiogenic therapy.

Endostatin is an antiangiogenic factor isolated from hemangioendothelioma cells as a carboxyl-terminal segment of collagen XVIII (15). Although the mechanism through which endostatin suppresses angiogenesis in a tumor-specific manner generally remains unclear, it has been shown that endostatin induced endothelial cell apoptosis and inhibited endothelial migration. Several potential molecular targets of endostatin have been postulated by previous studies (16, 17, 18). Numerous reports from our laboratory and others showed that recombinant endostatin significantly inhibited tumor growth as well as metastasis when injected sc into tumor-bearing animals (19, 20, 21, 22, 23, 24, 25). Gene therapy approaches have also been explored to deliver endostatin treatment for experimental tumors. Endostatin gene transfer and expression mediated by viral or nonviral vectors have been shown to lead to tumor suppression and prolonged animal survival (26, 27, 28, 29, 30, 31, 32).

The antiangiogenic and antitumor effects of endostatin have not been tested in thyroid cancer models. Here we report an in vivo study that used recombinant endostatin as well as an endostatin gene therapy approach to treat follicular thyroid carcinoma (FTC) xenograft. In DTC, FTC has a higher tendency to metastasize than papillary thyroid carcinoma. Our results suggest that both endostatin protein and endostatin gene therapy were effective in suppressing the growth of xenografted FTC-133 FTC in athymic mice.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell lines
FTC cell line FTC-133 was originally isolated from the primary FTC of a patient by Goretzki et al. (33) and kindly given by Dr. Michael J. Demeure (Medical College of Wisconsin, Milwaukee, WI). Amphotropic retrovirus packaging cell line CRIP was given by Dr. Richard C. Mulligan (Harvard Medical School, Boston, MA) and used in this study to make for endostatin-expressing recombination retrovirus infectious to human cells (34). Both FTC-133 and CRIP cells were grown in DMEM supplemented with L-glutamine (12.5 mg/liter), 10% fetal bovine serum, penicillin-streptomycin (10,000 U/ml), and Fungizone (250 mg/ml) (Invitrogen, Carlsbad, CA).

Plasmids and bacteria
Plasmid expressing murine endostatin with a histidine tag (pTB01#4) was a kind gift from Dr. Judah Folkman (Harvard Medical School, Boston, MA) (15). The expression of endostatin is driven by isopropyl-1-thio-ß-D-galactopyranoside-inducible T7lac promoter elements. The bacteria strain used for endostatin expression is the BL21 (DE3) pLysS strain (Promega Corp., Madison, WI).

Recombinant endostatin
An expression and purification procedure for recombinant endostatin from Escherichia coli has been described previously (19). Briefly, BL21(DE3)pLysS bacterial cells transformed with pTB01#4 were plated on a Kan+LB plate (10 g/liter tryptone, 5 g/liter yeast extract, 10 g/liter NaCl, and 50 mg/liter kanamycin). Colonies inoculated into 20-ml LB medium containing 50 mg/liter kanamycin were cultured at 37 C overnight. The culture was then transferred to 1-liter LB and cultured at 37 C until OD600 reached 0.8. Isopropyl-1-thio-ß-D-galactopyranoside was added to the culture at a final concentration of 0.3 mM to induce the expression of endostatin. After culturing in a 37 C shaker for another 3-h period, a bacteria pellet was collected with low-speed centrifugation, followed by lysis with 8 M urea. The lysate was then applied to a Ni2-NTA-column (QIAGEN, Valencia, CA). After washing with 8 M urea containing 10 mM imidazole, endostatin was eluted with 250 mM imidazole-containing 8 M urea. Finally, the endostatin product was dialyzed against 1x PBS (molecular weight cut-off 6000–8000) at 4 C for 8 h. During the dialysis, the purified protein precipitates to form insoluble recombinant endostatin, aliquoted, and stored at -20 C. The dialysis product was subject to endotoxin level determination (Limulu Amebocyte Lysate Progent/plus, BioWhittaker, Inc., Walkersville, MD). Quantification of the endostatin protein before dialysis was by the protein dye method (Bio-Rad Laboratories, Inc., Hercules, CA) as described by the manufacturer.

Construction of endostatin-expressing retroviral vector
Endostatin gene was amplified from plasmid pTB01#4 using PCR method catalyzed with the Deep Vent DNA polymerase according to instruction provided by the manufacturer (New England Biolabs, Inc., Beverly, MA). The sequences of the upstream sense primer and the downstream antisense primer are as follows: TGGCTAGCTCATACTCATCAGG and GCGGATCCTATTTGGAGA, respectively. The signal peptide of BM-40, an extracellular matrix protein, was used for secretion of endostatin (35). The coding sequence of this signal peptide was constructed by annealing two synthesized oligonucleotides: sense strand-AATTCATGAGGGCCTGGATCTTCTTTCTCCTTTGCCTGGCCGGGAGGGCTCTGGCAGCCCCTCAGCAAGAAGCG; antisense strand-GATCCGCTTCTTGCTGAGGGGCTGCCAGAGCCCTCCCGGCCAGGCAAAGGAGAAAGAAGATCCAGGCCCTCATG (GenBank accession no. Y00755). The PCR-amplified endostatin product was digested with EcoRI and NheI restriction enzymes and ligated to the annealed double-stranded BM-40 signal sequence. The resultant ligate was then further ligated to the large fragment of EcoRI + BamHI digested plasmid pFB-Neo-LacZ, a retroviral vector plasmid (Stratagene, Cedar Creek, CA) (Fig. 1Go). After sequence verification, the resultant plasmid pFB-BmEndo-Neo was then transfected to packaging cell line CRIP (34), using Lipofectamine 2000 liposome (Invitrogen) by following the manufacturer’s manual. Then, 800 µg/ml G418 (Invitrogen) was added to the CRIP cells after transfection to select for cells (CRIP-BmEndo) that stably produce recombinant retroviral particles.



View larger version (11K):
[in this window]
[in a new window]
 
Figure 1. Map of plasmid pFB-Bm-Endo. Expression vector pFB-BmEndo-Neo was constructed by ligating annealed double-stranded coding sequence (Signal-P) of the BM-40 signal peptide and NheI+ BamHI digested endostatin sequence to the pFB-Neo backbone, which was obtained by cutting pFB-lacZ-Neo with EcoRI and BamHI.

 
Transduction of FTC-133 cells with endostatin gene and secretion of endostatin
Supernatant taken from the selected G418-resistant CRIP cells was used to infect FTC-133 cells by incubating at 37 C for 4 h with gentle rocking. Subsequently, the infecting medium was replaced with DMEM with 10% FCS, and 800 µg/ml G418 was added to the culture. G418-resistant cells were selected by this manner to form a cell line (FTC-BmEndo) that should stably secrete endostatin. To determine the concentration of endostatin in the culture supernatant of FTC-BmEndo cells, fresh medium was added to the cells with 80% confluence and incubated with the cells at 37 C for 12 h. Conditioned medium was taken from 12 h-cultured FTC-BmEndo and subjected to an endostatin ELISA assay with a commercial kit (CytImmune, College Park, MD).

RT-PCR confirmation of gene expression of transduced endostatin in FTC-BmEndo cells
Total cellular RNA was isolated from FTC-BmEndo and parental FTC-133 cells with RNAZol reagent, respectively, according to a standard method following the manufacturer’s instruction (Biotecx Laboratories, Houston, TX). RT-PCR amplification used an upstream sense primer specific for the BM-40 signal sequence (GCGAATTCATGAGGGCCTGGATC) and a downstream antisense primer directed against the 3'-end of endostatin gene (GCGGATCCTATTTGGAGA). These primers should detect only transcripts derived from the transduced endostatin gene containing the BM-40 signal sequence but not those from the endogenous collagen XVIII. RNAs of FTC-BmEndo and FTC-133 cells were subjected to RT-PCR, respectively, using the One-Step RT-PCR kit (Invitrogen) according to the manufacturer’s manual.

In vivo animal studies
To test the effect of recombinant endostatin on the growth of FTC xenograft, 1 x 106 FTC-133 cells were inoculated sc at a dorsal site on 4- to 6-wk-old female nude mice {nu}/{nu} (Taconic, Germantown, NY). When the tumor nodules reached 5 mm in diameter, mice were randomly assigned to treatment groups (PBS alone and endostatin). There were five mice in each treatment group. Endostatin was injected sc distal to the tumor inoculation site (20 mg/kg·d). Tumors were measured with calipers, and tumor volumes were calculated (tumor volume = length x width2 x 0.52). Each data point was presented as mean volume ± SE. The mice were killed when tumors reached 2.0 cm in diameter or became ulcerated per the protocol approved by the University of Pittsburgh Institutional Animal Care and Use Committee, and the tumors were resected. The inhibition rate of endostatin (20 mg/kg·d) at the experiment end point was calculated as 100% x (mean of control tumor volumes - mean of endostatin-treated tumor volumes)/mean of control tumor volumes.

To test the in vivo growth of FTC-133 cells that were engineered to secrete endostatin (FTC-BmEndo), 1 x 106 FTC-BmEndo cells and FTC-133 cells were inoculated sc on two groups of nude mice, respectively, with five mice in each group. Tumor volumes were measured and presented as mean volume ± SE.

In vitro growth rates of FTC-133 or FTC-BmEndo cells
FTC-133 and FTC-BmEndo cells were inoculated in 6-well plates at a density of 0.05 x 106/well and cultured at 37 C. At the 24th, 48th, and 72nd hours of culture, cells were trypsinized, stained with Trypan Blue dye, and counted under microscope. The cell count at each time point was determined as the mean of triplicate wells.

Immunohistochemistry analysis for microvessel formation
Tumor specimens were fixed and frozen in tissue freezing medium (Triangle Biomedical Sciences, Durham, NC). Five-micrometer cryosections were cut and stained with hematoxylin-eosin for histopathological analysis. To analyze the microvessel formation in tumors, sections were stained with antiendostatin polyclonal antibody (Calbiochem, La Jolla, CA) or anti-CD31 rabbit monoclonal antibody (DAKO Corp., Carpinteria, CA) and subsequently with the avidin-biotin complex method. Positively vascular endothelial cells stained brown and were visualized and imaged using a digital camera attached to a microscope (Olympus Corp., Melville, NY). The microvessel density (MVD) was determined according to methods described previously (19, 36). Briefly, regions of highest vessel density (hot spot regions) were scanned at low magnification (x40–100) and counted at high magnification (x200). Three such fields were examined in each tumor section, and the mean MVD value was recorded. Any endothelial cell or endothelial cell cluster that was clearly separated from adjacent microvessels was considered a single, countable microvessel.

Detection of endostatin and VEGF in serum
Blood samples were collected from animals from the tail vein and refrigerated at 4 C overnight before centrifugation at 10,000 x g for 10 min. The supernatants (serum) were subjected to ELISA assays for mouse endostatin (Cytimmune Science, MD) and human VEGF (R&D Systems, Minneapolis, MN), respectively. The endostatin ELISA kit is specific for murine endostatin. Its cross-reactivity with human endostatin is less than 5%. The VEGF ELISA kit is exclusively for the detection of human VEGF with no cross-reaction with the murine counterpart. ELISA assays were performed by following the protocols specified for detection of serum endostatin and serum VEGF, respectively, provided by the manufacturers. Quantification of endostatin and VEGF were determined according to standard curves obtained with the provided standard endostatin or VEGF reagents.

Statistical analysis
For in vivo experiments and immunohistochemistry evaluation, tumor volumes were presented as mean ± SE. The t test was used to examine the statistical significance of the differences between groups (two-tailed). The level of significance was set at P less than 0.05.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The antiangiogenic and antitumor effects of recombinant endostatin on FTC xenograft
To test whether endostatin inhibits the growth of thyroid tumor, the human FTC xenograft model was used in this study. When the FTC-133 tumor-bearing nude mice were treated with recombinant endostatin (sc, 20 mg/kg·d), the growth of FTC-133 tumors were significantly inhibited by 84% after 18 d of treatment, compared with the PBS control (Fig. 2Go). No obvious toxicity, such as loss of weight, change in food/water intake, or changes in general behavior, was observed.



View larger version (13K):
[in this window]
[in a new window]
 
Figure 2. Antitumor effect of recombinant endostatin on FTC-133 xenografts. One million FTC-133 cells were inoculated in nude mice sc. When tumors grew to 5 mm in diameter (usually 7–10 d after tumor cell implantation), PBS or endostatin (20 mg/kg·d) was injected sc at a distal site, respectively. Five mice were used per group. Mice were killed when tumors reached 2.0 cm in diameter or became ulcerated. Tumors were measured as length x width2 x 0.52 and presented as mean ± SE. *, P < 0.05.

 
Expression of endostatin in endostatin gene-transduced FTC cells
By using a retroviral transduction approach, FTC-133 cells were engineered to form the FTC-BmEndo line that expresses secretable endostatin. The RT-PCR method was used to confirm the transcription of the introduced endostatin gene (Fig. 3Go). Because the primers used were specific for the BM-40 signal sequence and endostatin, endogenous collagen XVIII or endostatin transcripts should not be amplified. The result of the RT-PCR demonstrated a strong endostatin band derived from the FTC-BmEndo RNA, as opposed to the negative amplification from RNA of parental FTC-133 cells, suggesting that the transduced endostatin gene was efficiently transcribed in a form fused to the BM-40 signal peptide sequence, which was designed to direct the secretion of endostatin polypeptide.



View larger version (97K):
[in this window]
[in a new window]
 
Figure 3. Confirmation of endostatin expression in FTC-BmEndo cells. RT-PCR was performed with primers and conditions described in text. Lane 1, DNA molecular weight marker; lane 2, FTC-BmEndo RNA; lane 3, FTC-133 RNA.

 
To assess the capacity of FTC-BmEndo cells to secrete endostatin, we used an ELISA method to determine the concentration of endostatin in the conditioned medium from 12-h cultured FTC-BmEndo cells. The result showed that the FTC-BmEndo cells secreted endostatin to the culture medium at a rate of 146.5 ng/million cells per 12 h, whereas no endostatin was detectable in the conditioned medium taken from parental FTC-133 cells.

In vitro growth of endostatin-expressing FTC-133 cells
To test whether endostatin transduction and expression could affect the growth of FTC-133 cells in vitro, growth rates of both FTC-BmEndo cells and parental FTC-133 cells were determined (Fig. 4Go). The results exhibited the same growth rates of both cell lines, suggesting the transduction procedure as well as expression of endostatin did not change the in vitro growth of FTC-133 cells.



View larger version (9K):
[in this window]
[in a new window]
 
Figure 4. Comparative in vitro growth rates of FTC-133 and FTC-BmEndo cells. FTC-133 and FTC-BmEndo cells were inoculated in 6-well plates at a density of 0.05 x 106/well and cultured at 37 C, respectively. At the 24th, 48th, and 72nd hour of culture, cells were trypsinized, stained with Trypan Blue dye, and counted under microscope. Cell count at each time point was determined as the mean of triplicate wells.

 
In vivo growth of FTC-133 cells expressing endostatin
The effect of endostatin on the FTC-133 tumors was tested by comparing the in vivo growth of parental FTC-133 tumors and FTC-133 tumors expressing endostatin. The result of this experiment (Fig. 5Go) suggested that endostatin inhibited the growth of FTC-133 xenografts. This inhibitory effect of endostatin was similar to the observation made with recombinant endostatin described above, further supporting that endostatin antiangiogenic therapy was effective in treating experimental FTC.



View larger version (11K):
[in this window]
[in a new window]
 
Figure 5. In vivo growth of FTC-133 tumor vs. FTC-BmEndo tumor. One million FTC-133 or FTC-Endo cells were inoculated in nude mice sc. Tumor growth was monitored by measuring the tumor volumes as width2 x length x 0.52 (mm3). Tumor volumes are presented as mean ± SE. Five mice were used per group. Mouse was killed when the implanted tumor reached 2 cm in dimension or became ulcerated. Two-tailed, unpaired t test was used to calculate for P values. *, P < 0.05.

 
Further immunohistochemistry analysis was performed to determine the angiogenic status of FTC-BmEndo tumor by immunostaining the endothelial marker CD31 (PE-CAM). The results revealed a significant reduction of the number of endothelial cells recruited to the FTC-BmEndo tumors, compared with the parental FTC-133 tumors, shown by a quantitative MVD analysis (Table 1Go and Fig. 6Go). Such an antiangiogenic effect was associated with the presence of large amount of endostatin in resected tumor tissues, as immnunostained by antiendostatin antibodies. We found that all FTC-BmEndo tumor sections were full of positively stained endostatin signals, whereas the parental control exhibited no endostatin expression. Representative immunostaining results for endostatin are also presented in Fig. 6Go. These results strongly suggest that the suppression of FTC-BmEndo tumor growth was closely associated with high-level expression of endostatin within the tumor and its potent angiostatic effects.


View this table:
[in this window]
[in a new window]
 
Table 1. Serum levels of endostatin and VEGF in tumor-bearing animals and intratumoral microvessel densities

 


View larger version (126K):
[in this window]
[in a new window]
 
Figure 6. Immunohistochemical analysis of FTC-133 tumors (A and C) and FTC-BmEndo (B and D). Antiendostatin antibody was used to examine the intratumoral expression of endostatin (A and B), which is present as yellow stains. Anti-CD31 antibody was used to stain endothelial cells, shown as brown color (C and D) (x200).

 
Systemic levels of endostatin and VEGF in endostatin gene therapy
To test whether endostatin expressed by FTC-BmEndo is released to circulation, we examined the systemic levels of endostatin in tumor-bearing mice. At the experimental end point, the concentration of endostatin in the serum of mice bearing FTC-BmEndo or the parental FTC-133 tumors was 178.8 ± 71.9 ng/ml and 120 ± 28.3 ng/ml, respectively. As shown in Table 1Go, although the circulating level of endostatin in the FTC-BmEndo tumor-bearing mice was numerically higher than that in the FTC-133 tumor-bearing mice, the difference was not statistically significant (P = 0.367). The endostatin levels in the nude mice before injection of FTC tumor cells were 103 ± 30.50 ng/ml and was not significantly different from those in the FTC133-bearing mice.

We also assessed the level of VEGF in the sera of tumor-bearing mice. As shown in Table 1Go, the serum concentration of VEGF in mice-bearing FTC-BmEndo was dramatically reduced, compared with that in the FTC-133 tumor-bearing mice. The difference was statistically significant. In addition, such a reduction in VEGF concentration was associated with the difference of tumor volume in two groups of mice.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
This study demonstrates that endostatin significantly inhibits the growth of human FTC-133 thyroid tumors in immunodeficient mice. Immunohistochemistry analysis suggests that such an inhibitory effect is associated with a suppression of tumor vascularization. Although various antiangiogenic agents including anti-VEGF antibody, thrombospondin-1, and TNP-470 were previously tested and shown to be effective in thyroid tumor cancer models (14, 37, 38), our study represents the first report of the therapeutic effects of endostatin on thyroid cancers.

In this study, the antitumor effects of endostatin were tested by two different approaches, namely systemic injection of recombinant endostatin protein and endostatin gene transfer into FTC cells. In the recombinant protein experiment, daily injection of 20 mg/kg endostatin resulted in a significant inhibition on the growth of xenografted FTC-133 tumors by 84%. This result suggests that recombinant endostatin is effective and safe in treating FTC.

By engineering the FTC-133 cells with a retroviral vector, we have established a stable FTC-133 cell line (FTC-BmEndo) that permanently overexpresses secretable endostatin. When implanted in nude mice, the FTC-BmEndo tumor exhibited a lower growth rate than that of the parental FTC-133 tumors. Immunohistochemical staining confirmed the expression of a high level of endostatin within the FTC-BmEndo tumors and a reduced vascular microvessel density. When cultured in vitro, the FTC-BmEndo cells and the parental FTC-133 cells revealed equal growth rates, suggesting that the tumor growth inhibition resulted from the antiangiogenic activity of endostatin rather than a change in the proliferation of transduced FTC cells. This gene transfer experiment reproduced the antiangiogenic and antitumor effects of endostatin on FTC tumors. In the last several years, the antiangiogenic and antitumor effects of endostatin have been shown in a variety of tumor models. In vivo approaches used to deliver endostatin therapy include bolus injection of recombinant protein, intraperitoneal osmotic pump delivery of recombinant protein, gene therapy mediated by adenoviral or retroviral vector, and gene delivery by engineered mammalian cells (26, 27, 28, 29, 30, 31, 32). Recent evidence showed that continuous endostatin administration might provide a more efficient antitumor effect, indicating that a sustained in vivo appearance of endostatin protein might be important for its therapeutic efficacy (39). If this holds true, gene therapy approaches might have the advantage of administering continuous endostatin therapy. In fact, a number of animal studies indicated that endostatin gene therapy using viral or cell vehicles could lead to significant inhibition of tumor angiogenesis and progression (26, 27, 28, 29, 30, 31, 32). The data reported here confirm that the presence of endostatin in thyroid tumor tissues suppresses tumor growth and tumor angiogenesis.

Interestingly, the animals that bore FTC-BmEndo tumors did not exhibit significantly higher levels of endostatin in their sera than the FTC-133 tumor-bearing mice. By contrast, robust endostatin expression was found locally in the FTC-BmEndo tumors by immunohistochemistry analysis, compared with the lack of endostatin staining in the FTC-133 tumors. This notion is consistent with a previous study in which a profound antiangiogenic effect of endostatin was achieved but the serum level of endostatin remained low (31). That study, together with our current observation, implicates that an optimal delivery of endostatin in a bioactive form to the tumor microenvironment in which endostatin can act on its target might be key to the therapeutic effects. It is of note that some recent studies had experienced challenges in replicating the antitumor effects of endostatin in vivo despite the high level of endostatin in blood (40, 41). Although the causes of such difficulties remain obscure, several factors might impact the therapeutic efficacy of the endostatin therapy. First, it is well established that different tumors have distinct angiogenic profiles and might respond differentially to antiangiogenic therapies. Second, tumor vascular endothelia in different individuals, organs, tissues, and tumor locations could reveal heterogeneous angiogenic phenotypes (42, 43). Third, the dependence of tumor growth on angiogenesis might vary with the genetic alterations in oncogenes and/or tumor suppressor genes. A recent study showed that p53 null colon cancer exhibited resistance to therapy with anti-VEGF receptor antibody (44). Finally, lack of elucidated mechanisms of the actions of many angiogenesis inhibitors, including endostatin, makes it difficult to develop optimal drug delivery strategies and administration doses and schedules. As mentioned previously, an appropriate presence and optimal action of endostatin within the tumor microenvironment might be crucial to the therapeutic efficacy. Nonetheless, very few in vivo studies with endostatin reported thus far attempted to measure the endostatin in tumor tissues, which might be more important than examining the systemic level of endostatin, according to our study. Further understanding of the molecular mechanism of endostatin should facilitate the application of this potent antiangiogenic agent in cancer therapy.

Also noteworthy is that the systemic level of VEGF in FTC-BmEndo tumor-bearing mice was dramatically reduced, compared with that in mice bearing the FTC-133 tumors. The ELISA method used in our study was specific for human VEGF; therefore, the potential interference of host VEGF (mouse) could be ruled out. Thus far, there has been no evidence that endostatin could down-regulate the expression of VEGF in tumor cells, and our data demonstrated that endostatin did not inhibit the production of VEGF in tumor cells (data not shown). Because tumor cells are the only source of human VEGF in this model, it is more likely that the reduction in circulatory VEGF levels was a result of a reduced tumor burden caused by the antitumor effect of endostatin. Previous studies have shown that VEGF might be an important regulator for the development of vascularization in thyroid cancers (6, 7, 8, 9, 10, 11, 12, 13, 14). Consistent with this postulation, we found a correlation between tumor sizes and the VEGF levels. It remains unclear whether the serum VEGF level could be used as a prognostic marker in FTC. Thus, it will be of great interest to extend our observation and to investigate the significance of VEGF level in evaluating the progress of FTC and the anti-FTC efficacy of antiangiogenic therapies.

In summary, we have demonstrated the effects of endostatin on FTC angiogenesis and growth. Our results suggest that tumor angiogenesis could be a promising addition to the conventional targets of FTC therapy. It will be of great interest to study whether this novel therapeutic modality is effective in inhibiting FTC metastasis, and this will be a subject of future investigation in the laboratory.


    Acknowledgments
 


    Footnotes
 
This work was supported in part by NIH Grant 5P60DE13059 and ACS Grant IRG-60-002-39.

Abbreviations: DTC, Differentiated thyroid carcinoma; FTC, follicular thyroid carcinoma; FTC-BmEndo, FTC-133 cells that were engineered to secrete endostatin; MVD, microvessel density; VEGF, vascular endothelial growth factor.

Received April 23, 2002.

Accepted for publication May 24, 2002.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Folkman J 1971 Tumor angiogenesis: therapeutic implications. N Engl J Med 285:1182–1186
  2. Folkman J 1990 What is the evidence that tumors are angiogenesis dependent? J Natl Cancer Inst 82:4–6[Free Full Text]
  3. Yancopoulos GD, Davis S, Gale NW, Rudge JS, Wiegand SJ, Holash J 2000 Vascular-specific growth factors and blood vessel formation. Nature 407:242–248[CrossRef][Medline]
  4. Cao Y 2001 Endogenous angiogenesis inhibitors and their therapeutic implications. Int J Biochem Cell Biol 33:357–369[CrossRef][Medline]
  5. Folkman J 1995 Seminars in Medicine of the Beth Israel Hospital, Boston. Clinical applications of research on angiogenesis. N Engl J Med 333:1757–1763[Free Full Text]
  6. Itoh K, Fukuda K, Matsuzaki T, Takao S, Ohyama M 1989 Human endothelial cell growth factors derived from thyroid anaplastic cell carcinoma. Laryngoscope 99:533–537[Medline]
  7. Katoh R, Miyagi E, Kawaoi A, Hemmi A, Komiyama A, Oyama T, Shibuya M 1999 Expression of vascular endothelial growth factor (VEGF) in human thyroid neoplasms. Hum Pathol 30:891–897[CrossRef][Medline]
  8. Klein M, Picard E, Vignaud JM, Marie B, Bresler L, Toussaint B, Weryha G, Duprez A, Leclere J 1999 Vascular endothelial growth factor gene and protein: strong expression in thyroiditis and thyroid carcinoma. J Endocrinol 161:41–49[Abstract]
  9. Tuttle RM, Fleisher M, Francis GL, Robbins RJ 2002 Serum vascular endothelial growth factor levels are elevated in metastatic differentiated thyroid cancer but not increased by short-term TSH stimulation. J Clin Endocrinol Metab 87:1737–1742[Abstract/Free Full Text]
  10. Bunone G, Vigneri P, Mariani L, Buto S, Collini P, Pilotti S, Pierotti MA, Bongarzone I 1999 Expression of angiogenesis stimulators and inhibitors in human thyroid tumors and correlation with clinical pathological features. Am J Pathol 155:1967–1976[Abstract/Free Full Text]
  11. Ishiwata T, Iino Y, Takei H, Oyama T, Morishita Y 1998 Tumor angiogenesis as an independent prognostic indicator in human papillary thyroid carcinoma. Oncol Rep 5:1343–1348[Medline]
  12. Segal K, Shpitzer T, Feinmesser M, Stern Y, Feinmesser R 1996 Angiogenesis in follicular tumors of the thyroid. J Surg Oncol 63:95–98[CrossRef][Medline]
  13. Belletti B, Ferraro P, Arra C, Baldassarre G, Bruni P, Staibano S, De Rosa G, Salvatore G, Fusco A, Persico MG, Viglietto G 1999 Modulation of in vivo growth of thyroid tumor-derived cell lines by sense and antisense vascular endothelial growth factor gene. Oncogene 18:4860–4869[CrossRef][Medline]
  14. Soh EY, Eigelberger MS, Kim KJ, Wong MG, Young DM, Clark OH, Duh QY 2000 Neutralizing vascular endothelial growth factor activity inhibits thyroid cancer growth in vivo. Surgery 128:1059–1065; discussion 1065–1066[CrossRef][Medline]
  15. O’Reilly MS, Boehm T, Shing Y, Fukai N, Vasios G, Lane WS, Flynn E, Birkhead JR, Olsen BR, Folkman J 1997 Endostatin: an endogenous inhibitor of angiogenesis and tumor growth. Cell 88:277–285[CrossRef][Medline]
  16. MacDonald NJ, Shivers WY, Narum DL, Plum SM, Wingard JN, Fuhrmann SR, Liang H, Holland-Linn J, Chen DH, Sim BK 2001 Endostatin binds tropomyosin. A potential modulator of the antitumor activity of endostatin. J Biol Chem 276:25190–25196[Abstract/Free Full Text]
  17. Karumanchi SA, Jha V, Ramchandran R, Karihaloo A, Tsiokas L, Chan B, Dhanabal M, Hanai JI, Venkataraman G, Shriver Z, Keiser N, Kalluri R, Zeng H, Mukhopadhyay D, Chen RL, Lander AD, Hagihara K, Yamaguchi Y, Sasisekharan R, Cantley L, Sukhatme VP 2001 Cell surface glypicans are low-affinity endostatin receptors. Mol Cell 7:811–822[CrossRef][Medline]
  18. Dixelius J, Larsson H, Sasaki T, Holmqvist K, Lu L, Engstrom A, Timpl R, Welsh M, Claesson-Welsh L 2000 Endostatin-induced tyrosine kinase signaling through the Shb adaptor protein regulates endothelial cell apoptosis. Blood 95:3403–3411[Abstract/Free Full Text]
  19. Li M, Huang X, Zhu Z, Wong M, Watkins S, Zhao Q, Herberman R, Gorelik E 2001 Immune response against 3LL Lewis lung carcinoma potentiates the therapeutic efficacy of endostatin. J Immunother 24:472–481
  20. Huang X, Wong MK, Zhao Q, Zhu Z, Wang KZ, Huang N, Ye C, Gorelik E, Li M 2001 Soluble recombinant endostatin purified from Escherichia coli: antiangiogenic activity and antitumor effect. Cancer Res 61:478–481[Abstract/Free Full Text]
  21. Boehle AS, Kurdow R, Schulze M, Kliche U, Sipos B, Soondrum K, Ebrahimnejad A, Dohrmann P, Kalthoff H, Henne-Bruns D, Neumaier M 2001 Human endostatin inhibits growth of human non-small-cell lung cancer in a murine xenotransplant model. Int J Cancer 94:420–428[CrossRef][Medline]
  22. Berger AC, Feldman AL, Gnant MF, Kruger EA, Sim BK, Hewitt S, Figg WD, Alexander HR, Libutti S 2000 The angiogenesis inhibitor, endostatin, does not affect murine cutaneous wound healing. J Surg Res 91:26–31[CrossRef][Medline]
  23. Sasaki T, Larsson H, Kreuger J, Salmivirta M, Claesson-Welsh L, Lindahl U, Hohenester E, Timpl R 1999 Structural basis and potential role of heparin/heparan sulfate binding to the angiogenesis inhibitor endostatin. EMBO J 18:6240–6248[CrossRef][Medline]
  24. Yamaguchi N, Anand-Apte B, Lee M, Sasaki T, Fukai N, Shapiro R, Que I, Lowik C, Timpl R, Olsen BR 1999 Endostatin inhibits VEGF-induced endothelial cell migration and tumor growth independently of zinc binding. EMBO J 18:4414–4423[CrossRef][Medline]
  25. Dhanabal M, Ramchandran R, Waterman MJ, Lu H, Knebelmann B, Segal M, Sukhatme VP 1999 Endostatin induces endothelial cell apoptosis. J Biol Chem 274:11721–11726[Abstract/Free Full Text]
  26. Chen QR, Kumar D, Stass SA, Mixson AJ 1999 Liposomes complexed to plasmids encoding angiostatin and endostatin inhibit breast cancer in nude mice. Cancer Res 59:3308–3312[Abstract/Free Full Text]
  27. Blezinger P, Wang J, Gondo M, Quezada A, Mehrens D, French M, Singhal A, Sullivan S, Rolland A, Ralston R, Min W 1999 Systemic inhibition of tumor growth and tumor metastases by intramuscular administration of the endostatin gene. Nat Biotechnol 17:343–348[CrossRef][Medline]
  28. Sauter BV, Martinet O, Zhang WJ, Mandeli J, Woo SL 2000 Adenovirus-mediated gene transfer of endostatin in vivo results in high level of transgene expression and inhibition of tumor growth and metastases. Proc Natl Acad Sci USA 97:4802–4807[Abstract/Free Full Text]
  29. Szary J, Szala S 2001 Intra-tumoral administration of naked plasmid DNA encoding mouse endostatin inhibits renal carcinoma growth. Int J Cancer 91:835–839[CrossRef][Medline]
  30. Kuo CJ, Farnebo F, Yu EY, Christofferson R, Swearingen RA, Carter R, von Recum HA, Yuan J, Kamihara J, Flynn E, D’Amato R, Folkman J, Mulligan RC 2001 Comparative evaluation of the antitumor activity of antiangiogenic proteins delivered by gene transfer. Proc Natl Acad Sci USA 98:4605–4610[Abstract/Free Full Text]
  31. Feldman AL, Alexander HR, Hewitt SM, Lorang D, Thiruvathukal CE, Turner EM, Libutti SK 2001 Effect of retroviral endostatin gene transfer on subcutaneous and intraperitoneal growth of murine tumors. J Natl Cancer Inst 93:1014–1020[Abstract/Free Full Text]
  32. Yamanaka R, Zullo SA, Ramsey J, Onodera M, Tanaka R, Blaese M, Xanthopoulos KG 2001 Induction of therapeutic antitumor antiangiogenesis by intratumoral injection of genetically engineered endostatin-producing Semliki Forest virus. Cancer Gene Ther 8:796–802[CrossRef][Medline]
  33. Goretzki PE, Frilling A, Simon D, Roeher HD 1990 Growth regulation of normal thyroids and thyroid tumors in man. Recent Results Cancer Res 118:48–63[Medline]
  34. Danos O, Mulligan RC 1988 Safe and efficient generation of recombinant retroviruses with amphotropic and ecotropic host ranges. Proc Natl Acad Sci USA 85:6460–6464[Abstract/Free Full Text]
  35. Lankat-Buttgereit B, Mann K, Deutzmann R, Timpl R, Krieg T 1988 Cloning and complete amino acid sequences of human and murine basement membrane protein BM-40 (SPARC, osteonectin). FEBS Lett 236:352–356[CrossRef][Medline]
  36. Weidner N, Semple JP, Welch WR, Folkman J 1991 Tumor angiogenesis and metastasis—correlation in invasive breast carcinoma. N Engl J Med 324:1–8[Abstract]
  37. Nagayama Y, Shigematsu K, Namba H, Zeki K, Yamashita S, Niwa M 2000 Inhibition of angiogenesis and tumorigenesis, and induction of dormancy by p53 in a p53-null thyroid carcinoma cell line in vivo. Anticancer Res 20:2723–2728[Medline]
  38. Hama Y, Shimizu T, Hosaka S, Sugenoya A, Usuda N 1997 Therapeutic efficacy of the angiogenesis inhibitor O-(chloroacetyl-carbamoyl) fumagillol (TNP-470; AGM-1470) for human anaplastic thyroid carcinoma in nude mice. Exp Toxicol Pathol 49:239–247[Medline]
  39. Kisker O, Becker CM, Prox D, Fannon M, D’Amato R, Flynn E, Fogler WE, Sim BK, Allred EN, Pirie-Shepherd SR, Folkman J 2001 Continuous administration of endostatin by intraperitoneally implanted osmotic pump improves the efficacy and potency of therapy in a mouse xenograft tumor model. Cancer Res 61:7669–7674[Abstract/Free Full Text]
  40. Eisterer W, Jiang X, Bachelot T, Pawliuk R, Abramovich C, Leboulch P, Hogge D, Eaves C 2002 Unfulfilled promise of endostatin in a gene therapy-xenotransplant model of human acute lymphocytic leukemia. Mol Ther 5:352–359[CrossRef][Medline]
  41. Pawliuk R, Bachelot T, Zurkiya O, Eriksson A, Cao Y, Leboulch P 2002 Continuous intravascular secretion of endostatin in mice from transduced hematopoietic stem cells. Mol Ther 5:345–351[CrossRef][Medline]
  42. Fidler IJ 2001 Angiogenic heterogeneity: regulation of neoplastic angiogenesis by the organ microenvironment. J Natl Cancer Inst 93:1040–1041[Free Full Text]
  43. Achilles EG, Fernandez A, Allred EN, Kisker O, Udagawa T, Beecken WD, Flynn E, Folkman J 2001 Heterogeneity of angiogenic activity in a human liposarcoma: a proposed mechanism for "no take" of human tumors in mice. J Natl Cancer Inst 93:1075–1081[Abstract/Free Full Text]
  44. Yu JL, Rak JW, Coomber BL, Hicklin DJ, Kerbel RS 2002 Effect of p53 status on tumor response to antiangiogenic therapy. Science 295:1526–1528[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Endocr Relat CancerHome page
M M Muresan, P Olivier, J Leclere, F Sirveaux, L Brunaud, M Klein, R Zarnegar, and G Weryha
Bone metastases from differentiated thyroid carcinoma
Endocr. Relat. Cancer, March 1, 2008; 15(1): 37 - 49.
[Abstract] [Full Text] [PDF]


Home page
J Ultrasound MedHome page
A. Lyshchik, R. Moses, S. L. Barnes, T. Higashi, R. Asato, M. I. Miga, J. C. Gore, and A. C. Fleischer
Quantitative Analysis of Tumor Vascularity in Benign and Malignant Solid Thyroid Nodules
J. Ultrasound Med., June 1, 2007; 26(6): 837 - 846.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
M. N. Younes, Y. D. Yazici, S. Kim, S. A. Jasser, A. K. El-Naggar, and J. N. Myers
Dual Epidermal Growth Factor Receptor and Vascular Endothelial Growth Factor Receptor Inhibition with NVP-AEE788 for the Treatment of Aggressive Follicular Thyroid Cancer.
Clin. Cancer Res., June 1, 2006; 12(11): 3425 - 3434.
[Abstract] [Full Text] [PDF]


Home page
J Ultrasound MedHome page
H. De Nicola, J. Szejnfeld, A. F. Logullo, A. M. B. Wolosker, L. R. M. F. Souza, and V. Chiferi Jr
Flow Pattern and Vascular Resistive Index as Predictors of Malignancy Risk in Thyroid Follicular Neoplasms
J. Ultrasound Med., July 1, 2005; 24(7): 897 - 904.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. N. Younes, O. G. Yigitbasi, Y. W. Park, S.-J. Kim, S. A. Jasser, V. S. Hawthorne, Y. D. Yazici, M. Mandal, B. N. Bekele, C. D. Bucana, et al.
Antivascular Therapy of Human Follicular Thyroid Cancer Experimental Bone Metastasis by Blockade of Epidermal Growth Factor Receptor and Vascular Growth Factor Receptor Phosphorylation
Cancer Res., June 1, 2005; 65(11): 4716 - 4727.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
C. Ye, C. Feng, S. Wang, K. Z. Q. Wang, N. Huang, X. Liu, Y. Lin, and M. Li
sFlt-1 Gene Therapy of Follicular Thyroid Carcinoma
Endocrinology, February 1, 2004; 145(2): 817 - 822.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
E. L. Davies, J. D. Ramsden, H. Cocks, P. F. Searle, J. C. Watkinson, H. Ueno, A. Logan, J. A. Franklyn, V. Mautner, and M. C. Eggo
Adenovirus-Mediated Expression of Dominant Negative Fibroblast Growth Factor (FGF) Receptor 1 in Thyroid Cells Blocks FGF Effects and Reduces Goitrogenesis in Mice
J. Clin. Endocrinol. Metab., September 1, 2003; 88(9): 4472 - 4480.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ye, C.
Right arrow Articles by Li, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ye, C.
Right arrow Articles by Li, M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals