help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bonnelye, E.
Right arrow Articles by Aubin, J. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bonnelye, E.
Right arrow Articles by Aubin, J. E.
Endocrinology Vol. 143, No. 9 3658-3670
Copyright © 2002 by The Endocrine Society


ARTICLE

Estrogen Receptor-Related Receptor {alpha} Impinges on the Estrogen Axis in Bone: Potential Function in Osteoporosis

Edith Bonnelye, Vanessa Kung, Catherine Laplace, Deborah L. Galson and Jane E. Aubin

Department of Anatomy and Cell Biology (E.B., V.K., J.E.A.), University of Toronto, Toronto, Ontario M5S 1A8, Canada; and The New England Baptist Bone and Joint Institute (C.L., D.L.G.), Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, Massachusetts 02115

Address all correspondence and requests for reprints to: Dr. Jane E. Aubin, Department of Anatomy and Cell Biology, Faculty of Medicine, University of Toronto, Room 6255, Medical Sciences Building, 1 King’s College Circle, Toronto, Ontario M5S 1A8, Canada. E-mail: jane.aubin{at}utoronto.ca.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The orphan nuclear estrogen receptor-related receptor {alpha} (ERR{alpha}) is expressed by osteoblastic cells and plays a functional role in osteoprogenitor proliferation and differentiation. To dissect further the role of ERR{alpha} in bone, we investigated the effects of estrogen (E2) on ERR{alpha} both in vitro and in vivo. Chronic treatment of fetal rat calvaria cells with E2-stimulated bone nodule formation and up-regulated ERR{alpha} mRNA expression at early (10 h and d 8) but not later times in culture, suggesting a link between ERR{alpha} and E2 during osteoprogenitor proliferation. ERR{alpha} mRNA levels were significantly lower in ovariectomized adult rat bones vs. those of sham-operated rats early (1 d and 1 wk) post surgery, but levels returned to control levels thereafter. ERR{alpha} is also expressed in osteoclasts (tartrate-resistant acid phosphatase + multinucleated cells) in vivo and in vitro (RAW 264.7 cells) and ovariectomization lowered the OPG/receptor activator of nuclear factor {kappa}B ligand expression ratio. Down-regulation of ERR{alpha} expression via antisense treatment of rat calvaria cells not only inhibited osteogenesis but also increased adipocyte colony formation and changed the OPG/receptor activator of nuclear factor {kappa}B ligand ratio. These data suggest that ERR{alpha} is regulated by estrogen in bone in which it may play a functional role at several levels (osteoblasts, adipocytes, and osteoclasts) in E2 deficiency diseases such as osteoporosis.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
NUCLEAR RECEPTORS ARE transcription factors involved in various physiological regulatory processes. The superfamily to which nuclear receptors belong comprises both ligand-dependent molecules such as the steroid hormone, thyroid hormone, retinoic acid, and vitamin D receptors and an increasing number of so-called orphan receptors for which no ligand has yet been determined (1, 2, 3). Similar to the classic ligand-dependent receptors, the orphan receptors display the same structural organization and contain the two more conserved domains: the DNA-binding domain (domain C) and the ligand-binding domain (domain E), but it is not yet known whether they have ligands that await identification or whether they act in a constitutive manner.

Two orphan receptors, estrogen receptor-related receptor (ERR) {alpha} and ERRß (4), NR3B1 and NR3B2, respectively, according to the Nuclear Receptors Nomenclature Committee, 1999 (5), are closely related to the estrogen receptors (ERs) {alpha} and ß (6, 7), NR3A1 and NR3A2, respectively. ERR{alpha} and ERRß were identified by low-stringency screening of cDNA libraries with a probe encompassing the DNA-binding domain of the human ER. Recently, a third ERR, ERR3 or ERR{gamma}, was identified by yeast two-hybrid screening with the glucocorticoid receptor-interacting protein 1 as bait (8). The DNA-binding domain region of ERRs and ERs is highly conserved; however, the other parts of the proteins share very little homology (4, 8). Sequence alignment of ERR{alpha} and the ERs, for example, reveals a high similarity (68%) in the 66 amino acids of the DNA-binding domain but only a moderate similarity (36%) in the ligand-binding E domain, which may explain the fact that ERR{alpha} does not bind estrogen. Although agonists of the ERRs have not yet been identified, the pesticides chlordane and toxaphene (9), the synthetic estrogen diethylstilbestrol (10), and the selective ER modulator 4-hydroxytamoxifen (11) have been suggested to be potential ligands for ERR{alpha} and ERR{gamma}, respectively, and all act as antagonists. ERR{alpha} has been identified as a regulator of fat metabolism (12, 13) as well as a regulator of the human aromatase gene in breast, in which it is hypothesized to be critical for normal breast development (14, 15). Yang et al. (16) and Zhang and Teng (17) also showed that ERR{alpha} modulates the activating effect of estrogens on the lactoferrin promoter and suggested that ERR{alpha} may interact with ERs through protein-protein interaction.

Postmenopausal osteoporosis is a condition caused primarily by the severe decrease of serum estrogen levels after cessation of ovarian function. The absence of estrogen results in an increase in bone turnover (18) and a negative bone-remodeling balance, leading to bone loss and an increased fracture risk. The decrease in bone volume is accompanied by an increase in marrow adipose tissue (19, 20) and it has been suggested that the increase in the number of adipocytes is due to a shift in production of adipocytes vs. osteoblasts from common bipotential precursors in the marrow cavity (21). A positive effect of estrogens on bone homeostasis has been documented in postmenopausal osteoporosis (18, 22) in which bone loss can be reversed by administration of natural or synthetic estrogens. Although the bone-preserving effect of estrogen replacement is indisputable, the molecular and cellular mechanism(s) mediating this effect remain unclear. ERs are expressed in osteoblasts (18, 23, 24), and estrogens have been found to elicit effects ranging from modulation of gene expression to regulation of proliferation in this cell type (18). In contrast, mice lacking a functional ER{alpha} or ERß have only minor skeletal abnormalities (25, 26), suggesting that other isoforms of ERs (27) or mechanisms or receptors might be important during skeletal development. Given its homology to the ERs and the evidence that it may interact with ER{alpha} and modify estrogen effects on at least some genes, we hypothesized that ERR{alpha} may intervene in the signals induced by estrogen in bone. It has been shown, for example, that ERR{alpha} positively regulates the osteopontin gene (28, 29), an extracellular matrix molecule secreted by osteoblasts and thought to play a critical role in bone resorption (30, 31). More recently, we have found that ERR{alpha} plays a functional role in osteoprogenitor cell proliferation and differentiation at least in vitro and that these processes are exquisitely sensitive to changes in ERR{alpha} levels, with both up-regulation and down-regulation of the developmental sequence seen when ERR{alpha} is respectively up-regulated or down-regulated (32). In addition, ERR{alpha} is coexpressed with ERs in osteoblasts and therefore may modulate expression of common target genes in these cells (33).

Given these observations, it seemed important to determine whether ERR{alpha} impinges on the estrogen axis in bone. We report here that ERR{alpha} expression is increased by estrogen in a differentiation stage-specific manner in fetal rat calvaria (RC) cells in vitro and decreased after ovariectomy of rats, a well-established model of postmenopausal osteoporosis. We also found that down-regulation of ERR{alpha} expression via antisense (AS) treatment in RC cells, not only inhibited osteogenesis as reported previously (32) but also increased formation of adipocyte colonies and expression of adipocyte-associated markers, peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}), lipoprotein lipase (LPL), CCAATT enhancer-binding protein (c/EBP{alpha}), and the fatty acid-binding protein (aP2). Finally, we show that ERR{alpha} is expressed not only by osteoblasts but also by osteoclasts in vivo and by monocytic cells and through all developmental stages of osteoclasts differentiation in vitro. These data support the hypothesis that ERR{alpha} is regulated by estrogen in bone in which it may play a functional role at several levels (osteoblast, adipocyte, and osteoclast lineage cells) in estrogen-dependent diseases such as osteoporosis.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell culture
Osteoblasts.
Cells were enzymatically isolated from the calvaria of 21-d Wistar rat fetuses that were killed by cervical dislocation; animal use and all procedures were approved by the University of Toronto Animal Care Committee. Cells obtained from the last four of five sequential digestion steps, populations II–V (34), were plated in T-75 flasks in {alpha}MEM containing 15% heat-inactivated fetal bovine serum (Flow Laboratories, McLean, VA) and antibiotics comprising 100 µg/ml penicillin G (Sigma, St. Louis, MO), 50 µg/ml gentamicin (Sigma), and 0.3 µg/ml Fungizone (Flow Laboratories). After a 24-h incubation, attached cells were washed with PBS to remove nonviable cells and other debris and then collected by trypsinization using 0.01% trypsin in citrate saline. Aliquots were counted with a Coulter counter (Coulter Electronics, Hialeah, FL), and the remaining cells were resuspended in the standard medium described above but lacking phenol red. The resuspended cells were plated into 100-mm tissue culture dishes at 105 cells/dish and in 24-well plates at 104 cells/well. After 24-h incubation, medium was changed and supplemented with 50 µg/ml ascorbic acid, 10 mM sodium ß-glycerophosphate, and with or without vehicle (ethanol at 0.01%), 17ß estradiol (E2) (10-8 to 10-11 M, Sigma), or ICI 182,780 (10-9 M, Tocris). For studies of E2 effects at early times after plating (10 h), 2% fetal calf serum (FCS) was used; 15% was used in all other experiments as indicated. Medium was changed every 2 d. All dishes were incubated at 37 C in a humidified atmosphere in a 95% air/5% CO2 incubator.

Osteoclasts.
RAW 264.7 (number TIB-71, American Type Culture Collection, Manassas, VA) were used to generate osteoclast-like cell using RANKL (receptor activator of nuclear factor {kappa}B ligand). Cells were plated overnight at a density of 2 x 104 cells/well in a 6-well plate in DMEM (Life Technologies, Inc., Rockville, MD) and 1% FCS. The next day the medium was changed to DMEM supplemented with 10% FCS and 30 ng/ml RANKL (Amgen, Inc., Thousand Oaks, CA). After 24 h, the medium was replaced by DMEM, pH 7.2 [13.53 g DMEM (Sigma), 0.78 g sodium bicarbonate (Sigma), 10% FCS, and 30 ng/ml RANKL (Amgen, Inc.)]. For each sample, cells were fixed and stained for tartrate-resistant acid phosphatase (TRAP) or lysed for RNA extraction.

AS and sense (S) oligonucleotide treatment
RC cells were plated in 24-well plates at 104 cells/well. AS oligonucleotide inhibition of ERR{alpha} expression was accomplished with a 20-base phosphorothioate-modified oligonucleotide, localized to the A/B domain (32). Control dishes were treated with the complementary S oligonucleotide or no oligonucleotide. Briefly, oligonucleotide concentrations we found previously not to be toxic (0.5 µM to 2 µM) were added directly to cells during the differentiation phase (d 5, the end of proliferation, to d 11) in standard medium as above supplemented with 50 µg/ml ascorbic acid, 10 mM sodium ß-glycerophosphate, and 10-8 M dexamethasone. Medium was changed every 2 d, and fresh oligonucleotides were added at each change. At d 15, cultures were terminated and mRNA was collected from some, and others were used for quantification of bone nodules and adipocyte colony formation.

Bone nodule and adipocyte colony quantification
For quantification of bone nodule and adipocyte colony formation, dishes or wells were fixed and stained by the Von Kossa technique (bone) or Sudan IV (adipocytes), and bone nodules and adipocyte colonies were counted on a grid (34, 35). Results are plotted as the mean number of nodules or adipocyte colonies ± SD of three wells for controls and each concentration of AS or S primers; results are representative of three independent experiments.

TRAP staining
Paraffin sections were deparaffinized in xylene, rehydrated (through 100%, 95%, and 70% ethanol and water), and washed twice with 1x PBS; cultured cells were fixed in 10% formalin for 10 min and then washed twice with 1x PBS. Fixed cells or sections were then incubated for 30 min and 1 h, respectively, at 37 C with freshly prepared TRAP staining solution [1 mg/ml naphthol AS MX phosphate (N-4875, Sigma)], 1% N,N,dimethylformamide (D-8654, Sigma), 0.6 mg/ml fast red TR (F-6760, Sigma), 2 mg/ml sodium tartrate (S-8640, Sigma) in 0.1M acetate buffer, pH 5.9.

Ovariectomized rats
Four-month-old female Wistar rats, either ovariectomized (OVX) or sham-operated (Sham), were kept under standard laboratory conditions for up to 4 wk. Animals were killed and the uteri weighed to ensure efficacy of the OVX surgery. Femurs were removed and samples for immunocytochemistry were processed and embedded in paraffin after fixing in 4% paraformaldehyde in PBS and decalcification for 2 wk. Total cellular RNA was prepared with Trizol reagent (Life Technologies, Inc.) from parallel femoral samples (collected at 1 d, 1 wk, 2 wk, and 4 wk after OVX) from which bone marrow had been rapidly flushed and bones had been snap-frozen in liquid nitrogen.

RT-PCR
Aliquots of total cellular RNA (1.5–5 µg) extracted with Trizol reagent (Life Technologies, Inc.) from RC and RAW 264.7 cells, and sham and OVX femurs were reverse transcribed using oligo dT and a first-strand synthesis kit (SuperScript II, Life Technologies, Inc.). PCR was performed with primers specific for ERR{alpha}, osteoblast-associated markers [osteocalcin (OCN), bone sialoprotein (BSP), and alkaline phosphatase (ALP); primers as in Ref. 32 ], adipocyte-associated markers (PPAR{gamma}, LPL, aP2, c/EBP{alpha}; primers below), osteoclast-associated markers (TRAP, cathepsin K; primers below), other molecules [osteoprotegerin (OPG), RANKL; primers below] markers, and the housekeeping gene ribosomal proteins L32 or glyceraldehyde 3-phosphate dehydrogenase (GAPDH). The PCR mixture contained cDNA (1 µl), 1 µl deoxynucleotide triphosphate mix (10 mM), 10x PCR buffer, Q solution, 25 pmol primers, and 5 U Taq polymerase (QIAGEN, Valencia, CA). PCR was done for 25 cycles (94 C for 1 min, 55 C for 1 min, 72 C for 1 min, and a final elongation step of 7 min at 72 C) for OCN, BSP, ALP, and PPAR{gamma}; 22 cycles for L32 and ERR{alpha}; 30 cycles and 32 cycles for OPG and c/EBP{alpha}, respectively; 37 cycles (with annealing temperatures of 57 C) for RANKL; and 30 cycles (95 C for 30 sec, 60 C for 30 sec) for TRAP, cathepsin K, and GAPDH. Nested PCR or reamplification was required to visualize LPL (20 cycles and 13 cycles for first and second PCR, respectively, with annealing temperatures of 56 C) and aP2 (25 cycles for both PCR steps with annealing temperature of 55 C). The primers used were: PPAR{gamma} upstream, GCG GAG ATC TCC AGT GAT ATC; PPAR{gamma} downstream, TCA GCG ACT GGG ACT TTT CT; aP2 upstream, AAT TTG TAC TCT AAG; aP2 downstream, GTA ATC ATC GAA GTT TTC AC; LPL upstream, GTC TGA CCA ACA AGA AGG TC; LPL downstream, CAC TTA AGC TTC ATC ATC AG; LPL downstream (nested), GAG AAA TCT CGA AGG CCT GGT TG; c/EBP{alpha} upstream, CTT GCA GTT CCA GAT CGC AC; c/EBP{alpha} downstream, CAA CTC CAA CAC CTT CTG CTG; OPG upstream, TTG TGT GAC AAA TGT GCT CC; OPG downstream, GAC GTC TCA CCT GAG AAG; RANKL upstream, GTG GTC TGC AGC ATC GCT CTG; RANKL downstream, CGC TGG GCC ACA TCC AAC C; GAPDH upstream, TTCGACAGTCAGCCGCATCTTCTT; GAPDH downstream, CAGGCGCCCAATACGACCAAATC; TRAP upstream, AGCAGCCAAGGAGGACTACGTT; TRAP downstream, TCGTTGATGTCGCACAGAGG; cathepsin K upstream, TTAATTTGGGAGAAAAACCT; cathepsin K downstream, AGCCGCCTCCACAGCCATAAT.

The identity of all the PCR products was confirmed by sequencing the bands and comparison with published sequences (NCBI; BLAST search). Amplified bands were quantified by densitometric analysis and the results plotted represent the mean ± SD of triplicate determinations of one experiment, but similar results were seen in three independent experiments.

Immunohistochemistry
Immunolabeling of femurs was done essentially as described previously (36, 37). Paraffin sections were deparaffinized in xylene, rehydrated (through 100%, 95%, and 70% ethanol and water), rinsed in PBS, and then incubated for 1 h at room temperature with 10% normal serum in PBS. After rinsing in PBS, sections were incubated for 3 h at room temperature with a 1/50 dilution of anti-ERR{alpha} (32); 10% normal serum in PBS was used as negative control. Sections were then rinsed in PBS and incubated for 1 h at room temperature with secondary antibody CY-3-conjugated antirabbit (1/300 final dilution, Jackson ImmunoResearch Laboratories, Inc., West Grove, PA). After rinsing, samples were mounted in Moviol (Hoechst Ltd., Montréal, Québec, Canada) and observed by epifluorescence microscopy on a Zeiss photomicroscope III (Zeiss, Oberkochen, Germany). For photography and printing, equal exposure times were used for specifically labeled and control cultures.

Western blots
Total protein was extracted from RC cells at d 8 according to standard methods (38) and run on 7.5% SDS-PAGE gels, and Western blots were prepared in a semidry system. Immunoblotting was performed with a 1/60 dilution of anti-ERR{alpha} (32); blots were incubated overnight at room temperature and binding was detected using horseradish peroxidase-conjugated goat antirabbit antibodies (1/3000, Bio-Rad Laboratories, Inc., Hercules, CA) and chemiluminescence.

Statistical analysis
Results for PCR analysis and quantification of bone nodule and adipocyte colony number (AS/S experiments) were expressed as mean ± SD and analyzed statistically by ANOVA followed by post hoc t tests; statistical significance was taken as P < 0.05.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
ERR{alpha} expression and osteoblast differentiation are stimulated by estrogen in RC cell cultures
As well established, primary fetal RC cells undergo a proliferation-differentiation sequence when grown under appropriate conditions in vitro (39). For example, under the culture conditions used here (standard RC differentiation medium but lacking phenol red), expression of mRNA for early osteoblast markers (ALP, BSP) peaked by d 8–11, but late markers (OCN) were detectable only by d 11 and beyond (Fig. 1Go). To determine whether ERR{alpha} expression is regulated by estrogen over this developmental sequence, we treated these same cultures with different concentrations of E2. Treatment through proliferation and up to early differentiation phase significantly stimulated ERR{alpha} mRNA expression [50% at 10-10 M after 10 h (Fig. 2AGo); 40% at 10-8, 10-10, and 10-11 M, and 60% at 10-9 M at d 8 (Fig. 2BGo); and similarly at d 6 (not shown)], but treatment through later differentiation stages (d 11, 18) did not (Fig. 2CGo). Moreover, consistent with our previous observation that up-regulation of ERR{alpha} stimulates differentiation and bone nodule formation in RC cultures (32), the number of bone nodules formed was slightly (10%) but significantly increased by E2 (10-9 M) treatment, an effect blocked by ICI 182,780 (10-9 M) treatment (Fig. 3AGo). The 10-9 M ICI 182,780 also blocked the E2-stimulated increase in ERR{alpha} mRNA expression observed at 10 h (not shown) and d 8 (Fig. 3BGo) and the E2-stimulated increase in ERR{alpha} protein production at d 8 (Fig. 3CGo), suggesting that the increase in nodule formation and ERR{alpha} expression are mediated through ERs in RC cell cultures.



View larger version (28K):
[in this window]
[in a new window]
 
Figure 1. Osteoblast developmental stages were confirmed in differentiating RC cell cultures by semiquantitative RT-PCR assessment of mRNA levels of three osteoblast markers (ALP and BSP, relatively early markers of osteoblast development, and OCN, a marker of osteoblast maturation). RC cells were cultured in phenol red free medium under standard differentiation conditions (Materials and Methods). ALP, BSP, and OCN band intensities were normalized against that of the housekeeping gene ribosomal protein L32.

 


View larger version (37K):
[in this window]
[in a new window]
 
Figure 2. Semiquantitative RT-PCR with ERR{alpha}-specific primers was used to assess expression of ERR{alpha} over the proliferation-differentiation time course in RC cells cultured as in Fig. 1Go but in the presence (+E2) or absence (VEH) of E2 (10-8 to 10-11 M). E2 increased ERR{alpha} expression levels after 10 h (A) and at confluence (d 8) stages (B) but not during early nodule formation (d 11) and matrix mineralization (d 18) stages (C). ERR{alpha} band intensities were normalized against that of the housekeeping gene ribosomal protein L32. Results represent the mean ± SD for triplicate determinations for one experiment (t test, *, P < 0.05; **, P < 0.01; ***, P < 0.001, E2-treated vs. VEH). Similar results were seen in three independent experiments.

 


View larger version (26K):
[in this window]
[in a new window]
 
Figure 3. Estrogen treatment increased the number of bone nodules formed in RC cultures grown as in Fig. 2Go, an effect blocked by 10-9 M ICI 182,780 (A). Semiquantitative RT-PCR and Western blotting showed that ERR{alpha} mRNA levels (B) and protein levels (C), respectively, were increased by E2 (10-9 M, d 8) treatment, an effect also blocked by 10-9 M ICI 182,780 (t test, *, P < 0.05; **, P < 0.01; ***, P < 0.001, E2-treated vs. VEH or E2-treated vs. E2+ ICI 182,780). Similar results were seen in three independent experiments.

 
ERR{alpha} expression is decreased in bones of ovariectomized rats
The regulation of ERR{alpha} expression by E2 in RC cell cultures prompted us to ask whether similar regulation can be seen in vivo. To address this question, we used mRNA extracted from femurs of OVX rats, a model known to mimic the bone changes seen in postmenopausal osteoporosis. Visual inspection (Fig. 4AGoGo) and weights of the uteri dissected 4 wk after surgery showed the efficacy of surgery, with marked hypoplasia of OVX (0.16 g) vs. sham (0.8 g) uteri. Semiquantitative RT-PCR of RNA from femurs (from which bone marrow had been flushed) of animals at different times after surgery revealed that ERR{alpha} expression was significantly decreased 1 d and 1 wk after OVX but had rebounded to levels in sham-operated animals thereafter (Fig. 4BGoGo), consistent with the presence of abundant ERR{alpha} protein in osteocytes and active osteoblasts along bone surfaces in both OVX- and sham-operated animals at these later time points (Fig. 4CGoGo). Assessment of expression of mRNA for osteoblast-associated markers, as well as regulators of osteoclast formation OPG and RANKL (40, 41, 42), in the same samples showed that BSP, but not OCN, expression was markedly decreased early after OVX but also returned to control levels at late times (Fig. 4GoGo, D and E). Notably, RANKL and OPG expression were respectively increased and decreased at the earlier but not later time points after OVX (Fig. 4GoGo, D and E).



View larger version (31K):
[in this window]
[in a new window]
 
Figure 4. ERR{alpha} mRNA expression levels were assessed by RT-PCR in RNA samples extracted from femurs (from which bone marrow had been flushed) of OVX or sham-operated (Sh) rats. The mRNA was extracted at d 1, 1 wk, 2 wk, and 4 wk after surgery. Marked uterine hypoplasia is obvious in OVX but not sham rats 4 wk after surgery (A). ERR{alpha} mRNA is down-regulated in OVX rats at d 1 and 1 wk but not later (B). In parallel, ERR{alpha} protein expression was assessed by immunohistochemistry in femoral sections of OVX and sham-operated rats 4 wk after surgery. ERR{alpha} protein is highly expressed in osteoblasts and osteocytes, shown in the secondary ossification zone (C, panels a and c) and in the cortical bone (C, panels b and d), in sham (panels a and b) and OVX (panels c anc d), respectively (C). The negative secondary antibody control (incubation without rabbit anti-ERR{alpha} antibody) is also shown (C, panel e). Bar, 200 µm. For comparison, mRNA levels for four bone markers, BSP, OCN, OPG, and RANKL, were assessed by PCR in the same samples (D and E). ERR{alpha}, BSP, OCN, OPG, and RANKL band intensities were normalized against that of the ribosomal probe L32. Results represent the mean ± SD for triplicate determination for one experiment (t test, *, P < 0.05; **, P < 0.01; ***, P < 0.001 OVX-treated vs. sham). Similar results were seen in three independent experiments.

 


View larger version (60K):
[in this window]
[in a new window]
 
Figure 4A. C–E Continued.

 
ERR{alpha} is expressed not only in osteoblasts but also in osteoclasts in vivo and in vitro
Immunohistochemistry of femoral sections from OVX rats revealed abundant expression of ERR{alpha} protein not only in osteoblasts and osteocytes but also in the numerous osteoclasts present at 4 wk after OVX (Fig. 5AGo, panel a). For comparison TRAP+ staining is shown on a serial section to confirm the osteoclastic nature of the cells expressing ERR{alpha} (Fig. 5AGo, panel b). To assess further ERR {alpha} mRNA expression by osteoclast lineage cells, RNA was extracted at various culture times from RAW cells, a monocyte-macrophage cell line that differentiates into osteoclasts after treatment by RANKL (43). ERR{alpha} mRNA is clearly expressed in RAW cell cultures at all times from the monocyte stage (d 1) to mature osteoclast stage (d 6) (Fig. 5BGo); expression levels tended to increase, although not significantly, as osteoclasts developed. For comparison, mRNA levels of two osteoclast markers, TRAP and cathepsin K, are shown in the same samples (Fig. 5CGo), and the TRAP staining of the RAW cells at d 3 (mononuclear cells) and at d 5 (polynucleated cells) (Fig. 5DGo) is also shown. Although it remains to be determined whether ERR{alpha} may play a cell autonomous role in osteoclast differentiation, given ERR{alpha} expression in osteoblasts (Fig. 4GoGo, C and E, and Ref. 32), we next asked whether ERR{alpha} may be involved in osteoblast-mediated osteoclast development. To address this, RANKL and OPG mRNA expression levels were assessed by RT-PCR in RNA samples extracted from RC cell cultures treated with ERR{alpha}-AS oligonucleotides from d 5 (after cells had reached confluence and proliferation was decreased) to d 11, a treatment regimen we have found previously to block effectively ERR{alpha} expression while concomitantly inhibiting osteoblast development and osteoblast-associated marker (e.g. BSP, OCN) expression (32). Both RANKL and OPG expression were significantly increased in ERR{alpha} AS-treated RC cells, compared with control or S-treated cultures (Fig. 5EGo), although in repeat experiments the increase in RANKL was usually higher than the increase in OPG, which would suggest that reduction in ERR{alpha} in vitro decreases the OPG/RANKL ratio.



View larger version (44K):
[in this window]
[in a new window]
 
Figure 5. Immunolabeling for ERR{alpha} in sections of femoral bone from OVX rats 4 wk after surgery. ERR{alpha} intensely labels large multinucleated cells (A, panel a) that are stained for TRAP in a serial section (A, panel b) identifying these cells as osteoclasts; the negative control (incubation with secondary antibody without rabbit anti-ERR{alpha} primary antibody) is also shown (A, panel c). Semiquantitative RT-PCR with ERR{alpha}-specific primers was used to assess expression of ERR{alpha} in the mouse osteoclast precursor cell line RAW 264.7 at various time points of differentiation (d 0: uninduced; d 1 to d 6: RAW264.7 cells after 1–6 d of treatment with RANKL) (B). For comparison, mRNA levels for two osteoclast markers, cathepsin K and TRAP, were assessed by PCR in the same samples (C) and TRAP+ staining of RAW cells at d 3 (mononuclear cells) and d 5 (polynuclear cells) is also shown (D). RC cells were untreated (Ct) or treated with ERR{alpha} AS or S oligonucleotides at 1 µM from d 5 (after cells had reached confluence and proliferation was decreased) to d 11 (nodules forming); total RNA was extracted from wells at d 15 (bone mineralized nodules) and RT-PCR was performed on triplicate samples by using primers specific for OPG and RANKL (E). Results represent the mean ± SD for triplicate determinations of one experiment (t test, *, P < 0.05, **, P < 0.01 AS vs. S); similar results were seen in three independent experiments. Bar, 200 µm (A).

 
Down-regulation of ERR{alpha} increases adipogenesis and adipocyte colony formation in RC cell cultures
As outlined earlier, in osteoporosis, decreased osteogenesis is accompanied by increased marrow adipogenesis, an observation that has led to the suggestion that adipocyte recruitment is favored over osteoblast recruitment from common precursors in this condition. We next asked whether adipocyte formation is altered concomitant with changes in osteogenesis and RANKL/OPG expression when ERR{alpha} levels are dysregulated. To address this question, we treated RC cells with ERR{alpha} AS, S, or scrambled (Sc) oligonucleotides and double-stained the wells at d 15 with von Kossa (black: mineralized bone nodules) and sudan IV (red lipid droplets: adipocyte colonies); double staining allowed simultaneous quantification of bone and adipocyte colonies in the same wells. Consistent with what we reported recently (44), ERR{alpha} AS (Fig. 6AGo, panels b and d) but not S (Fig. 6AGo, panels a and c) or Sc oligonucleotides dose-dependently inhibited bone nodule formation (von Kossa, black staining) when RC cells were treated from d 5 to d 11 (Fig. 6CGo). Interestingly, we also observed a concomitant increase in adipocyte colony formation (Sudan IV, red staining) in the same AS-treated but not control-treated cultures (Fig. 6Go, A and B). For example, in 2 µM AS-treated cultures, an almost complete inhibition of mineralized bone nodule formation was seen concomitant with a significant increase (53%) in adipocyte colony number (Fig. 6Go, A–C). Consistent with this observation, expression of several key markers of adipocyte differentiation (LPL, c/EBP{alpha}, PPAR{gamma}, and AP2) was increased (Fig. 6Go, D and E). S and Sc oligonucleotides had a nonspecific nondose-dependent effect on adipocyte and bone colony formation (Fig. 6Go, B and C).



View larger version (39K):
[in this window]
[in a new window]
 
Figure 6. RC cells were untreated (Ct) or treated with ERR{alpha} AS, Sc, or S oligonucleotides at 0.5, 1, and 2 µM from d 5 (cells had reached confluence and proliferation was decreased) to d 11 (nodules were forming); cultures were fixed on d 15 and double stained for lipid droplets (Sudan IV; red staining) and for mineralized bone nodules (von Kossa staining; black staining) (A). Inhibition of ERR{alpha} protein synthesis resulted in an increase in adipocyte colonies (A, panel a vs. b, panel c vs. d) and (B) and a concomitant decrease in the number of bone nodules (A, panel a vs. b, and c vs. d) and (C). Data are expressed as the mean number of nodules/well or adipocyte colonies/well ± SD of triplicate wells (t test, *, P < 0.05, **, P < 0.01 AS vs. S or Sc) and are representative of three independent experiments (B and C). Total RNA was extracted from parallel wells at d 15 and RT-PCR performed on triplicate samples by using primers specific for adipocyte markers (LPL, c/EBP{alpha}, PPAR{gamma}, and AP2) (D). Adipocyte marker PCR products were normalized to L32 PCR product. Results represent the mean ± SD for triplicate determinations of one experiment (t test, *, P < 0.05, **, P < 0.01 AS vs. S) (E); similar results were seen in three independent experiments. Original magnifications, x10 (panels a and b) and x30 (panels c and d). Bar, 1 mm (A, panels a–d).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Our findings show that ERR{alpha} expression is regulated by estrogen in osteoblastic RC cells in vitro and bones in vivo, with both osteoblast and osteoclast lineage cells expressing this nuclear receptor. Moreover, inhibition of ERR{alpha} expression during the differentiation phase of RC cell cultures with phosphorothioate-modified AS oligonucleotides not only inhibits osteoblast development but also increases the expression of key regulators of osteoclastogenesis, RANKL and OPG and concomitantly increases adipocyte differentiation and the expression of adipocyte-associated markers. Taken together, the data suggest that ERR{alpha} impinges on the estrogen axis in bone in which it may play roles in osteoclastogenesis and the shift away from marrow osteogenesis and toward adipogenesis associated with osteoporosis and age-related osteopenia.

ERR{alpha} and the estrogen axis in osteoporosis
We have found that ERR{alpha} expression is regulated by estrogen in osteoblasts and bone. Specifically, ERR{alpha} expression is increased early during proliferative stages in RC cells in vitro after treatment with E2 at physiological concentrations and decreased early in vivo in femurs isolated from ovariectomized vs. sham-operated rats. It is important to note that these changes in ERR{alpha} expression in vivo reflect changes in expression by bone cells (see also below) because we flushed bone marrow from bones before RNA isolation. Our finding that E2 regulates ERR{alpha} in bone is consistent with an earlier report that estrogen regulates ERR{alpha} expression in another tissue, i.e. the mouse uterus (45). Our observation that ERR{alpha} is regulated by estrogen in bone together with our recent finding that ERR{alpha} plays a functional role in osteoprogenitor cell proliferation and differentiation and that these processes are exquisitely sensitive to changes in ERR{alpha} levels (32), suggested to us that ERR{alpha} may be involved in the pathogenesis of postmenopausal osteoporosis. We found previously that inhibition of ERR{alpha} expression during the proliferation phase of RC cell cultures decreased proliferation, as seen by a decrease in cell number, and reduced differentiation, as seen by a decrease in mineralized bone nodule formation. Inhibition of ERR{alpha} early during differentiation phase also markedly decreased differentiation and bone nodule formation. Taken together, these data suggest that ERR{alpha} plays a role in bone formation and turnover with specific effects on the progression of osteoprogenitors to more mature bone-forming osteoblasts. The decrease of ERR{alpha} expression that we have now found at early times after ovariectomy (d 1 and 1 wk) of rats suggests that ERR{alpha} may be among the first players involved in the pathogenesis of the osteopenia characterized later by a decrease in osteoblast proliferation and biosynthetic activity. Interestingly, BSP, a major constituent of bone matrix, is also acutely and markedly down-regulated in bones from ovariectomized rats, consistent with its marked down-regulation in RC cell cultures in which ERR{alpha} is inhibited (32).

Our data are also in keeping with the observation that BSP is a useful biochemical marker of altered bone turnover in postmenopausal women (46, 47) and support the hypothesis that BSP is an important target gene of ERR{alpha}, a possibility that we are currently investigating (48). Consistent with this latter view, BSP has recently been described as an early response gene after estrogen treatment, increasing as early as 4 h after initiation of treatment (49). Interestingly, we found that key regulators of osteoclast formation and activity, RANKL and OPG (40, 41, 42, 43), are also acutely regulated after ovariectomy in rats. Consistent with the view that reductions in the OPG/RANKL ratio increase osteoclast formation and bone resorption (50, 51) and recent evidence that a decreased OPG/RANKL ratio is seen after estrogen treatment of OVX female mice (52), we found that RANKL, essential for osteoclastogenesis, was up-regulated, whereas OPG, the decoy receptor, was down-regulated after OVX. This latter observation is also consistent with two studies describing stimulation of the expression of OPG by E2 in vitro (53, 54). The timing of the increase in the number of osteoclasts in our OVX rat model (between d 4 and 7 after ovariectomy) (55) is consistent with the regulation of expression of RANKL and OPG we observed. Indeed, inhibition of osteoclastogenesis is one of the main mechanisms by which estrogen is thought to prevent estrogen-deficient bone loss, and growing evidence supports the hypothesis that estrogens down-regulate osteoclast formation by blunting the production of IL-1, IL-6, and TNF (22), cytokines that enhance stromal cell production of RANKL (53, 56).

Together with our observation that down-regulation of ERR{alpha} expression via AS strategies in RC cells in vitro leads to increased levels of RANKL, the data suggest that ERR{alpha} may be a key new molecular mediator of estrogen action in bone. Clearly, further work must be done to elucidate the mechanism (direct or indirect) by which ERR{alpha} expression is regulated by estrogen. ER{alpha} may be one candidate because its own expression is regulated by estrogen in osteocytes (57). We have shown recently that ER{alpha} and ERR{alpha} are coexpressed in certain cohorts of osteoblasts in vivo (calvaria, femurs) and in vitro (RC and bone marrow stromal cell cultures) (33). Together with our observation that the estrogen-induced increase in ERR{alpha} expression after estrogen treatment is abolished when RC cells are treated by the ER antagonist ICI 182,780, it seems likely that ER{alpha} and/or ERß may have a direct effect on ERR{alpha} expression in osteoblasts.

We also found that ERR{alpha} is expressed in osteoclasts in vivo (femurs of OVX rats) and in vitro (RAW cells before and after differentiation), which may explain the fact that, at 2 and 4 wk after surgery (in which the number of osteoclasts is known to increase and ERR{alpha} expression levels appear relatively normal in osteoblasts/osteocytes in these bones), we did not observe any difference between ERR{alpha} mRNA levels in femurs from OVX- vs. sham-operated animals. ER{alpha} has been reported to be expressed in osteoclasts (18), and recently estrogen was shown to reduce the ability of osteoclasts to degrade bone matrix by regulating matrix metalloproteinases and cysteine proteinases such as cathepsin K (58). Yang et al. (16) and Zhang and Teng (17) also showed that ERR{alpha} modulates the activating effect of estrogen on the lactoferrin promoter and suggested that ERR{alpha} may interact with ERs through protein-protein interactions, which makes ERR{alpha} a potential new partner of ER{alpha} in osteoclasts as well as in osteoblasts.

ERR{alpha} and adipocyte formation
Inhibition of ERR{alpha} levels by AS oligonucleotide treatment of RC cell cultures during differentiation phase not only blocks osteoblast differentiation but also increases adipogenesis, as evidenced by both an increase in adipocyte colony number and expression of several genes known to be involved in triglyceride synthesis, such as the early marker of adipocyte conversion, LPL; the fatty acid-binding protein aP2 (21); and PPAR {gamma} (59), which acts synergistically with c/EBP{alpha} to coordinate the adipocyte differentiation cascade (60). These observations are particularly interesting in view of the fact that the decrease in bone volume associated with osteoporosis is accompanied by an increase in marrow adipose tissue and fat content in general (20, 61). There is other evidence that ERR{alpha} plays a role in adipogenesis and the metabolic activity of fat tissue. It is known to be expressed in brown fat during mouse development and is more highly expressed in brown vs. white fat (12, 62).

ERR{alpha} has also been shown to be up-regulated during adipocyte differentiation in the HIB cell model and to bind to the promoter of the medium chain acyl-coenzyme A dehydrogenase gene, a pivotal enzyme in the mitochondrial fatty acid b-oxidation cycle (12, 13). Furthermore, ERR{alpha} has been shown to be a regulator in breast of the human aromatase gene (14), which is an enzyme involved in the conversion of testosterone to estrogen and known to have a function in fat metabolism because aromatase deficiency results in obesity (63). Although some of these observations appear discrepant with our observations, it seems likely that differences in ERR{alpha} regulatory activities may exist between established lines vs. primary cell models, as has been seen with other regulators of adipogenesis in other studies. In addition, it seems crucial to assess whether ERR{alpha} plays a direct or indirect role in regulation of adipogenesis in vivo. Consistent with our data, it was recently demonstrated that endogenous estrogen decreases fat content in female mice, an effect that appears to be mediated by ER{alpha} but not ERß (64, 65, 66). As already mentioned, although the mechanism by which ERR{alpha} is up-regulated by estrogen in vitro and in vivo remains to be determined, nevertheless, our data are consistent with ERR{alpha} playing a role in adipogenesis and the effect of estrogen on adipogenesis.

As already outlined, the decrease in bone volume associated with osteoporosis is accompanied by an increase in marrow adipose tissue. One mechanism that has been postulated to account for this apparent reciprocity is an imbalance in the commitment or differentiation of common progenitors of the osteoblast and adipocyte lineages toward adipogenesis. Support for this comes from a variety of experimental manipulations in vitro (21, 67). Interestingly, however, the number of adipocyte colonies formed in ERR{alpha} AS-treated RC cell cultures is significantly lower than the number of bone colonies lost (e.g. 15 adipocyte colonies vs. 60 bone colonies). Although a possible lack of optimization of adipogenic conditions cannot be excluded, the fact that those colonies that do form contain cells with abundant patent lipid droplets suggests that the conditions do support terminal adipocyte differentiation. Thus, our data suggest that ERR{alpha} is not involved in changes in fate choice of bipotential progenitors toward the adipocyte lineage but rather is involved in regulation of a preadipocyte pathway parallel to that of committed osteoprogenitors. This suggests that ERR{alpha} may have two independent functions: one on osteoprogenitors-osteoblasts as an activator of osteoblast differentiation and bone formation and one on preadipocytes-adipocytes as an inhibitor of adipogenesis.

Summary
Although the molecular basis of the function of ERR{alpha} in these different cell types remains to be determined, our results suggest that ERR{alpha} is important not only in osteoblast but also in osteoclast and adipocyte development and that it may have a function in estrogen deficiency/postmenopausal osteoporosis via actions on all three cell types. Based on our data, the decrease of ERR{alpha} expression in the OVX rat model of postmenopausal osteoporosis may participate in regulation of the decrease in bone formation and increase in bone resorption and adipocyte number, phenomena also observed in postmenopausal osteoporosis in humans. Therefore, blocking the decrease of ERR{alpha} seen after ovariectomy or estrogen deficiency or appropriate use of agonists and antagonists of ERR{alpha} may provide a novel therapeutic approach for osteopenic disorders such as osteoporosis.


    Acknowledgments
 
We thank Usha Bhargava and Victoria Wong for technical help.


    Footnotes
 
This work was supported by operating grants from the Canadian Institutes of Health Research (MT-12390), the Canadian Arthritis Network, and Milestone Medica (to J.E.A.); the NIH (AR-45421; to D.L.G.); postdoctoral fellowship support from the Association pour la Recherche sur le Cancer (France), the Arthritis Society of Canada, and Center National de la Recherche Scientifique (to E.B.); the Arthritis Foundation (to C.L.); and by graduate student fellowships from the Canadian Arthritis Network and Ontario Graduate Scholarship in Science and Technology (to V.K.).

Abbreviations: ALP, Alkaline phosphatase; aP2, fatty acid-binding protein; AS, antisense; BSP, bone sialoprotein; c/EBP{alpha}, CCAATT enhancer-binding protein {alpha}; E2, 17ß estradiol; ER, estrogen receptors; ERR{alpha}, estrogen receptor-related receptor {alpha}; FCS, fetal calf serum; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; LPL, lipoprotein lipase; OCN, osteocalcin; OVX, ovariectomized; PPAR{gamma}, peroxisome proliferator-activated receptor {gamma}; RANKL, receptor activator of nuclear factor {kappa}B ligand; RC, rat calvaria; S, sense; Sc, scrambled; TRAP, tartrate-resistant acid phosphatase.

Received January 25, 2002.

Accepted for publication May 20, 2002.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Blumberg B, Evans RM 1998 Orphan nuclear receptors—new ligands and new possibilities. Genes Dev 12:3149–3155[Free Full Text]
  2. Robinson-Rechavi M, Carpentier AS, Duffraisse M, Laudet V 2001 How many nuclear hormone receptors are there in the human genome? Trends Genet 17:554–556[CrossRef][Medline]
  3. Gronemeyer H, Laudet V 1995 Transcription factors 3: nuclear receptors. Protein Profile 2:1173–1308[Medline]
  4. Giguere V, Yang N, Segui P, Evans RM 1988 Identification of a new class of steroid hormone receptors. Nature 331:91–94[CrossRef][Medline]
  5. Committee TNRN 1999 A unified nomenclature system for the nuclear receptor superfamily. Cell 97:161–163[CrossRef][Medline]
  6. Green S, Walter P, Kumar V, Krust A, Bornert JM, Argos P, Chambon P 1986 Human oestrogen receptor cDNA: sequence, expression and homology to v-erb-A. Nature 320:134–139[CrossRef][Medline]
  7. Kuiper GG, Enmark E, Pelto-Huikko M, Nilsson S, Gustafsson JA 1996 Cloning of a novel receptor expressed in rat prostate and ovary. Proc Natl Acad Sci USA 93:5925–5930[Abstract/Free Full Text]
  8. Hong H, Yang L, Stallcup MR 1999 Hormone-independent transcriptional activation and coactivator binding by novel orphan nuclear receptor ERR3. J Biol Chem 274:22618–22626[Abstract/Free Full Text]
  9. Yang C, Chen S 1999 Two organochlorine pesticides, toxaphene and chlordane, are antagonists for estrogen-related receptor {alpha}-1 orphan receptor. Cancer Res 59:4519–4524[Abstract/Free Full Text]
  10. Tremblay GB, Kunath T, Bergeron D, Lapointe L, Champigny C, Bader JA, Rossant J, Giguere V 2001 Diethylstilbestrol regulates trophoblast stem cell differentiation as a ligand of orphan nuclear receptor ERRß. Genes Dev 15:833–838[Abstract/Free Full Text]
  11. Coward P, Lee D, Hull MV, Lehmann JM 2001 4-Hydrotamoxifen bind to and deactivates the estrogen-related receptor {gamma}. Proc Natl Acad Sci USA 98:8880–8884[Abstract/Free Full Text]
  12. Sladek R, Bader JA, Giguere V 1997 The orphan nuclear receptor estrogen-related receptor {alpha} is a transcriptional regulator of the human medium-chain acyl coenzyme A dehydrogenase gene. Mol Cell Biol 17:5400–5409[Abstract]
  13. Vega RB, Kelly DP 1997 A role for estrogen-related receptor {alpha} in the control of mitochondrial fatty acid ß-oxidation during brown adipocyte differentiation. J Biol Chem 272:31693–31699[Abstract/Free Full Text]
  14. Yang C, Zhou D, Chen S 1998 Modulation of aromatase expression in the breast tissue by ERR {alpha}-1 orphan receptor. Cancer Res 58:5695–5700[Abstract/Free Full Text]
  15. Lu D, Kiriyama Y, Lee KY, Giguere V 2001 Transcriptional regulation of the estrogen-inducible pS2 breast cancer marker gene by the ERR family of orphan nuclear receptors. Cancer Res 61:6755–6761[Abstract/Free Full Text]
  16. Yang N, Shigeta H, Shi H, Teng CT 1996 Estrogen-related receptor, hERR1, modulates estrogen receptor-mediated response of human lactoferrin gene promoter. J Biol Chem 271:5795–5804[Abstract/Free Full Text]
  17. Zhang Z, Teng CT 2000 Estrogen receptor-related receptor {alpha}1 interacts with coactivator and constitutively activates the estrogen response elements of the human lactoferrin gene. J Biol Chem 275:20837–20846[Abstract/Free Full Text]
  18. Turner RT, Riggs BL, Spelsberg TC 1994 Skeletal effects of estrogen. Endocr Rev 15:275–300[Abstract/Free Full Text]
  19. Burkhardt R, Kettner G, Bohm W, Schmidmeir M, Schlag R, Frisch B, Mallmann B, Eisenmenger W, Gilg TH 1987 Changes in trabecular bone, hematopoiesis and bone marrow vessels in aplastic anaemia, primary osteoporosis and old age: a comparative histomorphometric study. Bone 8:157–164[Medline]
  20. Meunier PJ, Aaron J, Edouard C, Vignon G 1971 Osteoporosis and the replacement of cell population of the marrow by adipose tissue. Clin Orthop 80:147–154[Medline]
  21. Nuttal ME, Gimble JM 2000 Is there a therapeutic opportunity to either prevent or treat osteopenic disorders by inhibiting marrow adipogenesis? Bone 27:177–184[Medline]
  22. Pacifici R 1996 Estrogen, cytokines, and pathogenesis of postmenopausal osteoporosis. J Bone Miner Res 11:1043–1051[Medline]
  23. Eriksen EF, Colvard DS, Berg NJ, Graham ML, Mann KG, Spelsberg TC, Riggs BL 1988 Evidence of estrogen receptors in normal human osteoblast-like cells. Science 241:84–86[Abstract/Free Full Text]
  24. Komm BS, Terpening CM, Benz DJ, Graeme KA, Gallegos A, Korc M, Greene GL, O’Malley BW, Haussler MR 1988 Estrogen binding, receptor mRNA, and biologic response in osteoblast-like osteosarcoma cells. Science 241:81–84[Abstract/Free Full Text]
  25. Korach KS 1994 Insights from the study of animals lacking functional estrogen receptor. Science 266:1524–1527[Abstract/Free Full Text]
  26. Windahl SH, Vidal O, Andersson G, Gustafsson JA, Ohlsson C 1999 Increased cortical bone mineral content but unchanged trabecular bone mineral density in female ERß(-/-) mice. J Clin Invest 104:895–901[Medline]
  27. Denger S, Reid G, Kos M, Flouriot G, Parsch D, Brand H, Korach KS, Sonntag-Buck V, Gannon F 2001 ER{alpha} gene expression in human primary osteoblasts: evidence for the expression of two receptor proteins. Mol Endocrinol 15:2064–2077[Abstract/Free Full Text]
  28. Bonnelye E, Vanacker JM, Dittmar T, Begue A, Desbiens X, Denhardt DT, Aubin JE, Laudet V, Fournier B 1997 The ERR-1 orphan receptor is a transcriptional activator expressed during bone development. Mol Endocrinol 11:905–916[Abstract/Free Full Text]
  29. Vanacker JM, Delmarre C, Guo X, Laudet V 1998 Activation of the osteopontin promoter by the orphan nuclear receptor estrogen receptor related {alpha}. Cell Growth Differ 9:1007–1014[Abstract]
  30. Denhardt DT, Noda M 1998 Osteopontin expression and function: role in bone remodeling. 25th anniversary issue. New directions and dimensions in cellular biochemistry. J Cell Biochem Suppl 30/31:92–102
  31. Ishijima M, Rittling SR, Yamashita T, Tsuji K, Kurosawa H, Nifuji A, Denhardt DT, Noda M 2001 Enhancement of osteoclastic bone resorption and suppression of osteoblastic bone formation in response to reduced mechanical stress do not occur in the absence of osteopontin. J Exp Med 193:399–404[Abstract/Free Full Text]
  32. Bonnelye E, Merdad L, Kung V, Aubin JE 2001 The orphan nuclear estrogen receptor-related receptor (ERR) is expressed throughout osteoblast differentiation and regulates bone formation in vitro. J Cell Biol 153:971–983[Abstract/Free Full Text]
  33. Bonnelye E, Aubin JE, Differential expression of the estrogen receptor related receptor, ERR{alpha}, and estrogen receptors ER{alpha} and ERß in osteoblasts in vivo and in vitro. J Bone Miner Res, in press
  34. Bellows CG, Aubin JE, Heersche JNM, Antosz ME 1986 Mineralized bone nodules formed in vitro from enzymatically released rat calvaria cell populations. Calcif Tissue Int 38:143–154[Medline]
  35. Bellows CG, Aubin JE 1989 Determination of numbers of osteoprogenitors present in isolated fetal rat calvaria cells in vitro. Dev Biol 133:8–13[CrossRef][Medline]
  36. Turksen K, Aubin JE 1991 Positive and negative immunoselection for enrichment of two classes of osteoprogenitor cells. J Cell Biol 114:373–384[Abstract/Free Full Text]
  37. Turksen K, Bhargava U, Moe HK, Aubin JE 1992 Isolation of monoclonal antibodies recognizing rat bone-associated molecules in vitro and in vivo. J Histochem Cytochem 40:1339–1352[Abstract]
  38. Ausubel FM, Brent R, Kinston RE, Moore DD, Seidman JG, Smith JA, Struhl K 1996 Current protocols in molecular biology. New York: John Wiley and Sons
  39. Aubin JE 1998 Advances in the osteoblast lineage. Biochem Cell Biol 76:899–910[CrossRef][Medline]
  40. Kong YY, Yoshida H, Sarosi I, Tan HL, Timms E, Capparelli C, Morony S, Oliveira-dos-Santos AJ, Van G, Itie A, Khoo W, Wakeham A, Dunstan CR, Lacey DL, Mak TW, Boyle WJ, Penninger JM 1999 OPGL is a key regulator of osteoclastogenesis, lymphocyte development and lymph-node organogenesis. Nature 397:315–323[CrossRef][Medline]
  41. Lacey DL, Timms E, Tan HL, Kelley MJ, Dunstan CR, Burgess T, Elliott R, Colombero A, Elliott G, Scully S, Hsu H, Sullivan J, Hawkins N, Davy E, Capparelli C, Eli A, Qian YX, Kaufman S, Sarosi I, Shalhoub V, Senaldi G, Guo J, Delaney J, Boyle WJ 1998 Osteoprotegerin ligand is a cytokine that regulates osteoclast differentiation and activation. Cell 93:165–176[CrossRef][Medline]
  42. Yasuda H, Shima N, Nakagawa N, Yamaguchi K, Kinosaki M, Mochizuki S, Tomoyasu A, Yano K, Goto M, Murakami A, Tsuda E, Morinaga T, Higashio K, Udagawa N, Takahashi N, Suda T 1998 Osteoclast differentiation factor is a ligand for osteoprotegerin/osteoclastogenesis-inhibitory factor and is identical to TRANCE/RANKL. Proc Natl Acad Sci USA 95:3597–3602[Abstract/Free Full Text]
  43. Xu J, Tan JW, Huang L, Gao XH, Laird R, Liu D, Wysocki S, Zheng MH 2000 Cloning, sequencing, and functional characterization of the rat homologue of receptor activator of NF-{kappa}B ligand. J Bone Miner Res 15:2178–2186[CrossRef][Medline]
  44. Bonnelye E, Kung V, Samuels A, Tobias JH, Aubin JE 2001 The orphan receptor, estrogen related receptor ERRa, is regulated by estrogens in bone and is involved in not only osteoblast but also adipocyte development. J Bone Miner Res 16:S204
  45. Shigeta H, Zuo W, Yang N, DiAugustine R, Teng CT 1997 The mouse estrogen receptor-related orphan receptor {alpha}1: molecular cloning and estrogen responsiveness. J Mol Endocrinol 19:299–309[Abstract/Free Full Text]
  46. Stork S, Stork C, Angerer P, Kothny W, Schmitt P, Wehr U, von Schacky C, Rambeck W 2000 Bone sialoprotein is a specific biochemical marker of bone metabolism in postmenopausal women: a randomized 1-year study. Osteoporos Int 11:790–796[CrossRef][Medline]
  47. Fassbender WJ, Ruf T, Kaiser HE, Stracke H 2000 Serum levels of immunoreactive bone sialoprotein in osteoporosis: positive relations to established biochemical parameters of bone turnover. In Vivo 14:619–624[Medline]
  48. Kung V, Bonnelye E, Aubin JE 2001 The orphan receptor estrogen related receptor {alpha} (ERR{alpha}) may regulate bone formation by its direct effect on bone sialoprotein (BSP) expression. J Bone Miner Res 16:S260
  49. Yokogawa K, Kazuhiro M, Sekido T, Higashi Y, Nomura M, Fujisawa R, Morito K, Masamune Y, Waki Y, Kasugai S, Miyamoto K 2001 Selective delivery of estradiol to bone by aspartic acid oligopeptide and its effects on ovariectomized mice. Endocrinology 142:1228–1233[Abstract/Free Full Text]
  50. Hofbauer LC, Heufelder AE 2001 Role of receptor activator of NF-kappaB ligand and osteoprotegerin in bone cell biology. J Mol Med 79:243–253[CrossRef][Medline]
  51. Kostenuik PJ, Shalhoub V 2001 Osteoprotegerin: a physiological and pharmacological inhibitor of bone resorption. Curr Pharm Des 7:613–635[CrossRef][Medline]
  52. Lindberg MK, Erlandsson M, Alatalo SL, Windahl S, Andersson G, Halleen JM, Carlsten H, Gustafsson JA, Ohlsson C 2001 Estrogen receptor {alpha}, but not estrogen receptor ß, is involved in the regulation of the OPG/RANKL (osteoprotegerin/receptor activator of NF-{kappa}B ligand) ratio and serum interleukin-6 in male mice. J Endocrinology 171:425–433[Abstract]
  53. Hofbauer LC, Khosla S, Dunstan CR, Lacey DL, Spelsberg TC, Riggs BL 1999 Estrogen stimulates gene expression and protein production of osteoprotegerin in human osteoblastic cells. Endocrinology 140:4367–4370[Abstract/Free Full Text]
  54. Saika M, Inoue D, Kido S, Matsumoto T 2001 17b-estradiol stimulates expression of osteoprotegerin by a mouse stromal cell line, ST-2, via estrogen receptor-{alpha}. Endocrinology 142:2205–2212[Abstract/Free Full Text]
  55. Lesclous P, Guez D, Llorens A, Saffar JL 2001 Time-course of mast cell accumulation in rat bone marrow after ovariectomy. Calcif Tissue Int 68:297–303[CrossRef][Medline]
  56. Srivastava S, Toraldo G, Weitzmann MN, Cenci S, Ross FP, Pacifici R 2001 Estrogen decreases osteoclast formation by down-regulating receptor activator of NF-kappa B ligand (RANKL)-induced JNK activation. J Biol Chem 276:8836–8840[Abstract/Free Full Text]
  57. Hoyland JA, Baris C, Wood L, Baird P, Selby PL, Freemont AJ, Braidman IP 1999 Effect of ovarian steroid deficiency on oestrogen receptor {alpha} expression in bone. J Pathol 188:294–303[CrossRef][Medline]
  58. Parikka V, Lehenkari P, Sassi ML, Halleen J, Risteli J, Harkonen P, Vaananen HK 2001 Estrogen reduces the depth of resorption pits by disturbing the organic bone matrix degradation activity of mature osteoclasts. Endocrinology 142:5371–5378[Abstract/Free Full Text]
  59. Tontonoz P, Hu E, Graves RA, Budavari AI, Spiegelman BM 1994 mPPAR gamma 2: tissue-specific regulator of an adipocyte enhancer. Genes Dev 8:1224–1234[Abstract/Free Full Text]
  60. Freytag SO, Paielli DL, Gilbert JD 1994 Ectopic expression of CCAAT/enhancer-binding protein {alpha} promotes the adipogenic. Genes Dev 8:1654–1663[Abstract/Free Full Text]
  61. Ornoy A, Giron S, Aner R, Goldstein M, Boyan BD, Schwartz Z 1994 Gender dependent effects of testosterone and 17ß-estradiol on bone growth and modelling in young mice. Bone Miner 24:43–58[Medline]
  62. Bonnelye E, Vanacker JM, Spruyt N, Alric S, Fournier B, Desbiens X, Laudet V 1997 Expression of the estrogen-related receptor 1 (ERR-1) orphan receptor during mouse development. Mech Dev 65:71–85[CrossRef][Medline]
  63. Cohen PG 2001 Aromatase, adiposity, aging and disease. The hypogonadal-metabolic-atherogenic-disease and aging connection. Med Hypotheses 56:702–708[CrossRef][Medline]
  64. Lindberg MK, Alatalo SL, Halleen JM, Mohan S, Gustafsson JA, Ohlsson C 2001 Estrogen receptor specificity in the regulation of the skeleton in female mice. J Endocrinol 171:229–236[Abstract]
  65. Ohlsson C, Hellberg N, Parini P, Vidal O, Bohlooly M, Rudling M, Lindberg MK, Warner M, Angelin B, Gustafsson JA 2000 Obesity and disturbed lipoprotein profile in estrogen receptor-{alpha}-deficient male mice. Biochem Biophys Res Commun 278:640–645[CrossRef][Medline]
  66. Heine PA, Taylor JA, Iwamoto GA, Lubahn DB, Cooke PS 2000 Increased in adipose tissue in male and female estrogen-{alpha} knockout mice. Proc Natl Acad Sci USA 97:12729–12734[Abstract/Free Full Text]
  67. Aubin JE, Heersche JNM 1997 Vitamin D and osteoblasts. In: Feldman D, Glorieux FH, Pike JW, eds. Vitamin D. San Diego: Academic Press; 313–328



This article has been cited by other articles:


Home page
Rheumatology (Oxford)Home page
E. Bonnelye, N. Laurin, P. Jurdic, D. A. Hart, and J. E. Aubin
Estrogen receptor-related receptor-{alpha} (ERR-{alpha}) is dysregulated in inflammatory arthritis
Rheumatology, December 1, 2008; 47(12): 1785 - 1791.
[Abstract] [Full Text] [PDF]


Home page
J Mol EndocrinolHome page
R. A Zirngibl, J. S M Chan, and J. E Aubin
Estrogen receptor-related receptor {alpha} (ERR{alpha}) regulates osteopontin expression through a non-canonical ERR{alpha} response element in a cell context-dependent manner
J. Mol. Endocrinol., February 1, 2008; 40(2): 61 - 73.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
E. Bonnelye, R. A. Zirngibl, P. Jurdic, and J. E. Aubin
The Orphan Nuclear Estrogen Receptor-Related Receptor-{alpha} Regulates Cartilage Formation in Vitro: Implication of Sox9
Endocrinology, March 1, 2007; 148(3): 1195 - 1205.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
S. Gaillard, M. A. Dwyer, and D. P. McDonnell
Definition of the Molecular Basis for Estrogen Receptor-Related Receptor-{alpha}-Cofactor Interactions
Mol. Endocrinol., January 1, 2007; 21(1): 62 - 76.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
R A Stein and D P McDonnell
Estrogen-related receptor {alpha} as a therapeutic target in cancer
Endocr. Relat. Cancer, December 1, 2006; 13(Supplement_1): S25 - S32.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
M.A. Garcia-Perez, I. Noguera, C. Hermenegildo, A. Martinez-Romero, J.J. Tarin, and A. Cano
Alterations in the phenotype and function of immune cells in ovariectomy-induced osteopenic mice
Hum. Reprod., April 1, 2006; 21(4): 880 - 887.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
J. B. Barry, J. Laganiere, and V. Giguere
A Single Nucleotide in an Estrogen-Related Receptor {alpha} Site Can Dictate Mode of Binding and Peroxisome Proliferator-Activated Receptor {gamma} Coactivator 1{alpha} Activation of Target Promoters
Mol. Endocrinol., February 1, 2006; 20(2): 302 - 310.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
G. D. Barish, M. Downes, W. A. Alaynick, R. T. Yu, C. B. Ocampo, A. L. Bookout, D. J. Mangelsdorf, and R. M. Evans
A Nuclear Receptor Atlas: Macrophage Activation
Mol. Endocrinol., October 1, 2005; 19(10): 2466 - 2477.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
E. Bonnelye and J. E. Aubin
Estrogen Receptor-Related Receptor {alpha}: A Mediator of Estrogen Response in Bone
J. Clin. Endocrinol. Metab., May 1, 2005; 90(5): 3115 - 3121.
[Abstract] [Full Text] [PDF]


Home page
J Mol EndocrinolHome page
D Liu, Z Zhang, and C T Teng
Estrogen-related receptor-{gamma} and peroxisome proliferator-activated receptor-{gamma} coactivator-1{alpha} regulate estrogen-related receptor-{alpha} gene expression via a conserved multi-hormone response element
J. Mol. Endocrinol., April 1, 2005; 34(2): 473 - 487.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. C. Carrier, G. Deblois, C. Champigny, E. Levy, and V. Giguere
Estrogen-related Receptor {alpha} (ERR{alpha}) Is a Transcriptional Regulator of Apolipoprotein A-IV and Controls Lipid Handling in the Intestine
J. Biol. Chem., December 10, 2004; 279(50): 52052 - 52058.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
X. Zhang, J. E. Aubin, T.-H. Kim, U. Payne, B. Chiu, and R. D. Inman
Synovial Fibroblasts Infected with Salmonella enterica Serovar Typhimurium Mediate Osteoclast Differentiation and Activation
Infect. Immun., December 1, 2004; 72(12): 7183 - 7189.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
S. Tang, S. L. Tan, S. K. Ramadoss, A. P. Kumar, M.-H. E. Tang, and V. B. Bajic
Computational method for discovery of estrogen responsive genes
Nucleic Acids Res., December 1, 2004; 32(21): 6212 - 6217.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Greschik, R. Flaig, J.-P. Renaud, and D. Moras
Structural Basis for the Deactivation of the Estrogen-related Receptor {gamma} by Diethylstilbestrol or 4-Hydroxytamoxifen and Determinants of Selectivity
J. Biol. Chem., August 6, 2004; 279(32): 33639 - 33646.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
S. Sanyal, J. Matthews, D. Bouton, H.-J. Kim, H.-S. Choi, E. Treuter, and J.-A. Gustafsson
Deoxyribonucleic Acid Response Element-Dependent Regulation of Transcription by Orphan Nuclear Receptor Estrogen Receptor-Related Receptor {gamma}
Mol. Endocrinol., February 1, 2004; 18(2): 312 - 325.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
D. Liu, Z. Zhang, W. Gladwell, and C. T. Teng
Estrogen Stimulates Estrogen-Related Receptor {alpha} Gene Expression through Conserved Hormone Response Elements
Endocrinology, November 1, 2003; 144(11): 4894 - 4904.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
Y. Yoshiko, N. Maeda, and J. E. Aubin
Stanniocalcin 1 Stimulates Osteoblast Differentiation in Rat Calvaria Cell Cultures
Endocrinology, September 1, 2003; 144(9): 4134 - 4143.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bonnelye, E.
Right arrow Articles by Aubin, J. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bonnelye, E.
Right arrow Articles by Aubin, J. E.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals