| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLE |
Impinges on the Estrogen Axis in Bone: Potential Function in Osteoporosis
Department of Anatomy and Cell Biology (E.B., V.K., J.E.A.), University of Toronto, Toronto, Ontario M5S 1A8, Canada; and The New England Baptist Bone and Joint Institute (C.L., D.L.G.), Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, Massachusetts 02115
Address all correspondence and requests for reprints to: Dr. Jane E. Aubin, Department of Anatomy and Cell Biology, Faculty of Medicine, University of Toronto, Room 6255, Medical Sciences Building, 1 Kings College Circle, Toronto, Ontario M5S 1A8, Canada. E-mail: jane.aubin{at}utoronto.ca.
| Abstract |
|---|
|
|
|---|
(ERR
) is expressed by osteoblastic cells and plays a functional role in osteoprogenitor proliferation and differentiation. To dissect further the role of ERR
in bone, we investigated the effects of estrogen (E2) on ERR
both in vitro and in vivo. Chronic treatment of fetal rat calvaria cells with E2-stimulated bone nodule formation and up-regulated ERR
mRNA expression at early (10 h and d 8) but not later times in culture, suggesting a link between ERR
and E2 during osteoprogenitor proliferation. ERR
mRNA levels were significantly lower in ovariectomized adult rat bones vs. those of sham-operated rats early (1 d and 1 wk) post surgery, but levels returned to control levels thereafter. ERR
is also expressed in osteoclasts (tartrate-resistant acid phosphatase + multinucleated cells) in vivo and in vitro (RAW 264.7 cells) and ovariectomization lowered the OPG/receptor activator of nuclear factor
B ligand expression ratio. Down-regulation of ERR
expression via antisense treatment of rat calvaria cells not only inhibited osteogenesis but also increased adipocyte colony formation and changed the OPG/receptor activator of nuclear factor
B ligand ratio. These data suggest that ERR
is regulated by estrogen in bone in which it may play a functional role at several levels (osteoblasts, adipocytes, and osteoclasts) in E2 deficiency diseases such as osteoporosis. | Introduction |
|---|
|
|
|---|
Two orphan receptors, estrogen receptor-related receptor (ERR)
and ERRß (4), NR3B1 and NR3B2, respectively, according to the Nuclear Receptors Nomenclature Committee, 1999 (5), are closely related to the estrogen receptors (ERs)
and ß (6, 7), NR3A1 and NR3A2, respectively. ERR
and ERRß were identified by low-stringency screening of cDNA libraries with a probe encompassing the DNA-binding domain of the human ER. Recently, a third ERR, ERR3 or ERR
, was identified by yeast two-hybrid screening with the glucocorticoid receptor-interacting protein 1 as bait (8). The DNA-binding domain region of ERRs and ERs is highly conserved; however, the other parts of the proteins share very little homology (4, 8). Sequence alignment of ERR
and the ERs, for example, reveals a high similarity (68%) in the 66 amino acids of the DNA-binding domain but only a moderate similarity (36%) in the ligand-binding E domain, which may explain the fact that ERR
does not bind estrogen. Although agonists of the ERRs have not yet been identified, the pesticides chlordane and toxaphene (9), the synthetic estrogen diethylstilbestrol (10), and the selective ER modulator 4-hydroxytamoxifen (11) have been suggested to be potential ligands for ERR
and ERR
, respectively, and all act as antagonists. ERR
has been identified as a regulator of fat metabolism (12, 13) as well as a regulator of the human aromatase gene in breast, in which it is hypothesized to be critical for normal breast development (14, 15). Yang et al. (16) and Zhang and Teng (17) also showed that ERR
modulates the activating effect of estrogens on the lactoferrin promoter and suggested that ERR
may interact with ERs through protein-protein interaction.
Postmenopausal osteoporosis is a condition caused primarily by the severe decrease of serum estrogen levels after cessation of ovarian function. The absence of estrogen results in an increase in bone turnover (18) and a negative bone-remodeling balance, leading to bone loss and an increased fracture risk. The decrease in bone volume is accompanied by an increase in marrow adipose tissue (19, 20) and it has been suggested that the increase in the number of adipocytes is due to a shift in production of adipocytes vs. osteoblasts from common bipotential precursors in the marrow cavity (21). A positive effect of estrogens on bone homeostasis has been documented in postmenopausal osteoporosis (18, 22) in which bone loss can be reversed by administration of natural or synthetic estrogens. Although the bone-preserving effect of estrogen replacement is indisputable, the molecular and cellular mechanism(s) mediating this effect remain unclear. ERs are expressed in osteoblasts (18, 23, 24), and estrogens have been found to elicit effects ranging from modulation of gene expression to regulation of proliferation in this cell type (18). In contrast, mice lacking a functional ER
or ERß have only minor skeletal abnormalities (25, 26), suggesting that other isoforms of ERs (27) or mechanisms or receptors might be important during skeletal development. Given its homology to the ERs and the evidence that it may interact with ER
and modify estrogen effects on at least some genes, we hypothesized that ERR
may intervene in the signals induced by estrogen in bone. It has been shown, for example, that ERR
positively regulates the osteopontin gene (28, 29), an extracellular matrix molecule secreted by osteoblasts and thought to play a critical role in bone resorption (30, 31). More recently, we have found that ERR
plays a functional role in osteoprogenitor cell proliferation and differentiation at least in vitro and that these processes are exquisitely sensitive to changes in ERR
levels, with both up-regulation and down-regulation of the developmental sequence seen when ERR
is respectively up-regulated or down-regulated (32). In addition, ERR
is coexpressed with ERs in osteoblasts and therefore may modulate expression of common target genes in these cells (33).
Given these observations, it seemed important to determine whether ERR
impinges on the estrogen axis in bone. We report here that ERR
expression is increased by estrogen in a differentiation stage-specific manner in fetal rat calvaria (RC) cells in vitro and decreased after ovariectomy of rats, a well-established model of postmenopausal osteoporosis. We also found that down-regulation of ERR
expression via antisense (AS) treatment in RC cells, not only inhibited osteogenesis as reported previously (32) but also increased formation of adipocyte colonies and expression of adipocyte-associated markers, peroxisome proliferator-activated receptor
(PPAR
), lipoprotein lipase (LPL), CCAATT enhancer-binding protein (c/EBP
), and the fatty acid-binding protein (aP2). Finally, we show that ERR
is expressed not only by osteoblasts but also by osteoclasts in vivo and by monocytic cells and through all developmental stages of osteoclasts differentiation in vitro. These data support the hypothesis that ERR
is regulated by estrogen in bone in which it may play a functional role at several levels (osteoblast, adipocyte, and osteoclast lineage cells) in estrogen-dependent diseases such as osteoporosis.
| Materials and Methods |
|---|
|
|
|---|
MEM containing 15% heat-inactivated fetal bovine serum (Flow Laboratories, McLean, VA) and antibiotics comprising 100 µg/ml penicillin G (Sigma, St. Louis, MO), 50 µg/ml gentamicin (Sigma), and 0.3 µg/ml Fungizone (Flow Laboratories). After a 24-h incubation, attached cells were washed with PBS to remove nonviable cells and other debris and then collected by trypsinization using 0.01% trypsin in citrate saline. Aliquots were counted with a Coulter counter (Coulter Electronics, Hialeah, FL), and the remaining cells were resuspended in the standard medium described above but lacking phenol red. The resuspended cells were plated into 100-mm tissue culture dishes at 105 cells/dish and in 24-well plates at 104 cells/well. After 24-h incubation, medium was changed and supplemented with 50 µg/ml ascorbic acid, 10 mM sodium ß-glycerophosphate, and with or without vehicle (ethanol at 0.01%), 17ß estradiol (E2) (10-8 to 10-11 M, Sigma), or ICI 182,780 (10-9 M, Tocris). For studies of E2 effects at early times after plating (10 h), 2% fetal calf serum (FCS) was used; 15% was used in all other experiments as indicated. Medium was changed every 2 d. All dishes were incubated at 37 C in a humidified atmosphere in a 95% air/5% CO2 incubator.
Osteoclasts.
RAW 264.7 (number TIB-71, American Type Culture Collection, Manassas, VA) were used to generate osteoclast-like cell using RANKL (receptor activator of nuclear factor
B ligand). Cells were plated overnight at a density of 2 x 104 cells/well in a 6-well plate in DMEM (Life Technologies, Inc., Rockville, MD) and 1% FCS. The next day the medium was changed to DMEM supplemented with 10% FCS and 30 ng/ml RANKL (Amgen, Inc., Thousand Oaks, CA). After 24 h, the medium was replaced by DMEM, pH 7.2 [13.53 g DMEM (Sigma), 0.78 g sodium bicarbonate (Sigma), 10% FCS, and 30 ng/ml RANKL (Amgen, Inc.)]. For each sample, cells were fixed and stained for tartrate-resistant acid phosphatase (TRAP) or lysed for RNA extraction.
AS and sense (S) oligonucleotide treatment
RC cells were plated in 24-well plates at 104 cells/well. AS oligonucleotide inhibition of ERR
expression was accomplished with a 20-base phosphorothioate-modified oligonucleotide, localized to the A/B domain (32). Control dishes were treated with the complementary S oligonucleotide or no oligonucleotide. Briefly, oligonucleotide concentrations we found previously not to be toxic (0.5 µM to 2 µM) were added directly to cells during the differentiation phase (d 5, the end of proliferation, to d 11) in standard medium as above supplemented with 50 µg/ml ascorbic acid, 10 mM sodium ß-glycerophosphate, and 10-8 M dexamethasone. Medium was changed every 2 d, and fresh oligonucleotides were added at each change. At d 15, cultures were terminated and mRNA was collected from some, and others were used for quantification of bone nodules and adipocyte colony formation.
Bone nodule and adipocyte colony quantification
For quantification of bone nodule and adipocyte colony formation, dishes or wells were fixed and stained by the Von Kossa technique (bone) or Sudan IV (adipocytes), and bone nodules and adipocyte colonies were counted on a grid (34, 35). Results are plotted as the mean number of nodules or adipocyte colonies ± SD of three wells for controls and each concentration of AS or S primers; results are representative of three independent experiments.
TRAP staining
Paraffin sections were deparaffinized in xylene, rehydrated (through 100%, 95%, and 70% ethanol and water), and washed twice with 1x PBS; cultured cells were fixed in 10% formalin for 10 min and then washed twice with 1x PBS. Fixed cells or sections were then incubated for 30 min and 1 h, respectively, at 37 C with freshly prepared TRAP staining solution [1 mg/ml naphthol AS MX phosphate (N-4875, Sigma)], 1% N,N,dimethylformamide (D-8654, Sigma), 0.6 mg/ml fast red TR (F-6760, Sigma), 2 mg/ml sodium tartrate (S-8640, Sigma) in 0.1M acetate buffer, pH 5.9.
Ovariectomized rats
Four-month-old female Wistar rats, either ovariectomized (OVX) or sham-operated (Sham), were kept under standard laboratory conditions for up to 4 wk. Animals were killed and the uteri weighed to ensure efficacy of the OVX surgery. Femurs were removed and samples for immunocytochemistry were processed and embedded in paraffin after fixing in 4% paraformaldehyde in PBS and decalcification for 2 wk. Total cellular RNA was prepared with Trizol reagent (Life Technologies, Inc.) from parallel femoral samples (collected at 1 d, 1 wk, 2 wk, and 4 wk after OVX) from which bone marrow had been rapidly flushed and bones had been snap-frozen in liquid nitrogen.
RT-PCR
Aliquots of total cellular RNA (1.55 µg) extracted with Trizol reagent (Life Technologies, Inc.) from RC and RAW 264.7 cells, and sham and OVX femurs were reverse transcribed using oligo dT and a first-strand synthesis kit (SuperScript II, Life Technologies, Inc.). PCR was performed with primers specific for ERR
, osteoblast-associated markers [osteocalcin (OCN), bone sialoprotein (BSP), and alkaline phosphatase (ALP); primers as in Ref. 32 ], adipocyte-associated markers (PPAR
, LPL, aP2, c/EBP
; primers below), osteoclast-associated markers (TRAP, cathepsin K; primers below), other molecules [osteoprotegerin (OPG), RANKL; primers below] markers, and the housekeeping gene ribosomal proteins L32 or glyceraldehyde 3-phosphate dehydrogenase (GAPDH). The PCR mixture contained cDNA (1 µl), 1 µl deoxynucleotide triphosphate mix (10 mM), 10x PCR buffer, Q solution, 25 pmol primers, and 5 U Taq polymerase (QIAGEN, Valencia, CA). PCR was done for 25 cycles (94 C for 1 min, 55 C for 1 min, 72 C for 1 min, and a final elongation step of 7 min at 72 C) for OCN, BSP, ALP, and PPAR
; 22 cycles for L32 and ERR
; 30 cycles and 32 cycles for OPG and c/EBP
, respectively; 37 cycles (with annealing temperatures of 57 C) for RANKL; and 30 cycles (95 C for 30 sec, 60 C for 30 sec) for TRAP, cathepsin K, and GAPDH. Nested PCR or reamplification was required to visualize LPL (20 cycles and 13 cycles for first and second PCR, respectively, with annealing temperatures of 56 C) and aP2 (25 cycles for both PCR steps with annealing temperature of 55 C). The primers used were: PPAR
upstream, GCG GAG ATC TCC AGT GAT ATC; PPAR
downstream, TCA GCG ACT GGG ACT TTT CT; aP2 upstream, AAT TTG TAC TCT AAG; aP2 downstream, GTA ATC ATC GAA GTT TTC AC; LPL upstream, GTC TGA CCA ACA AGA AGG TC; LPL downstream, CAC TTA AGC TTC ATC ATC AG; LPL downstream (nested), GAG AAA TCT CGA AGG CCT GGT TG; c/EBP
upstream, CTT GCA GTT CCA GAT CGC AC; c/EBP
downstream, CAA CTC CAA CAC CTT CTG CTG; OPG upstream, TTG TGT GAC AAA TGT GCT CC; OPG downstream, GAC GTC TCA CCT GAG AAG; RANKL upstream, GTG GTC TGC AGC ATC GCT CTG; RANKL downstream, CGC TGG GCC ACA TCC AAC C; GAPDH upstream, TTCGACAGTCAGCCGCATCTTCTT; GAPDH downstream, CAGGCGCCCAATACGACCAAATC; TRAP upstream, AGCAGCCAAGGAGGACTACGTT; TRAP downstream, TCGTTGATGTCGCACAGAGG; cathepsin K upstream, TTAATTTGGGAGAAAAACCT; cathepsin K downstream, AGCCGCCTCCACAGCCATAAT.
The identity of all the PCR products was confirmed by sequencing the bands and comparison with published sequences (NCBI; BLAST search). Amplified bands were quantified by densitometric analysis and the results plotted represent the mean ± SD of triplicate determinations of one experiment, but similar results were seen in three independent experiments.
Immunohistochemistry
Immunolabeling of femurs was done essentially as described previously (36, 37). Paraffin sections were deparaffinized in xylene, rehydrated (through 100%, 95%, and 70% ethanol and water), rinsed in PBS, and then incubated for 1 h at room temperature with 10% normal serum in PBS. After rinsing in PBS, sections were incubated for 3 h at room temperature with a 1/50 dilution of anti-ERR
(32); 10% normal serum in PBS was used as negative control. Sections were then rinsed in PBS and incubated for 1 h at room temperature with secondary antibody CY-3-conjugated antirabbit (1/300 final dilution, Jackson ImmunoResearch Laboratories, Inc., West Grove, PA). After rinsing, samples were mounted in Moviol (Hoechst Ltd., Montréal, Québec, Canada) and observed by epifluorescence microscopy on a Zeiss photomicroscope III (Zeiss, Oberkochen, Germany). For photography and printing, equal exposure times were used for specifically labeled and control cultures.
Western blots
Total protein was extracted from RC cells at d 8 according to standard methods (38) and run on 7.5% SDS-PAGE gels, and Western blots were prepared in a semidry system. Immunoblotting was performed with a 1/60 dilution of anti-ERR
(32); blots were incubated overnight at room temperature and binding was detected using horseradish peroxidase-conjugated goat antirabbit antibodies (1/3000, Bio-Rad Laboratories, Inc., Hercules, CA) and chemiluminescence.
Statistical analysis
Results for PCR analysis and quantification of bone nodule and adipocyte colony number (AS/S experiments) were expressed as mean ± SD and analyzed statistically by ANOVA followed by post hoc t tests; statistical significance was taken as P < 0.05.
| Results |
|---|
|
|
|---|
expression and osteoblast differentiation are stimulated by estrogen in RC cell cultures
expression is regulated by estrogen over this developmental sequence, we treated these same cultures with different concentrations of E2. Treatment through proliferation and up to early differentiation phase significantly stimulated ERR
mRNA expression [50% at 10-10 M after 10 h (Fig. 2A
stimulates differentiation and bone nodule formation in RC cultures (32), the number of bone nodules formed was slightly (10%) but significantly increased by E2 (10-9 M) treatment, an effect blocked by ICI 182,780 (10-9 M) treatment (Fig. 3A
mRNA expression observed at 10 h (not shown) and d 8 (Fig. 3B
protein production at d 8 (Fig. 3C
expression are mediated through ERs in RC cell cultures.
|
|
|
expression is decreased in bones of ovariectomized rats
expression by E2 in RC cell cultures prompted us to ask whether similar regulation can be seen in vivo. To address this question, we used mRNA extracted from femurs of OVX rats, a model known to mimic the bone changes seen in postmenopausal osteoporosis. Visual inspection (Fig. 4A
expression was significantly decreased 1 d and 1 wk after OVX but had rebounded to levels in sham-operated animals thereafter (Fig. 4B
protein in osteocytes and active osteoblasts along bone surfaces in both OVX- and sham-operated animals at these later time points (Fig. 4C
|
|
is expressed not only in osteoblasts but also in osteoclasts in vivo and in vitro
protein not only in osteoblasts and osteocytes but also in the numerous osteoclasts present at 4 wk after OVX (Fig. 5A
(Fig. 5A
mRNA expression by osteoclast lineage cells, RNA was extracted at various culture times from RAW cells, a monocyte-macrophage cell line that differentiates into osteoclasts after treatment by RANKL (43). ERR
mRNA is clearly expressed in RAW cell cultures at all times from the monocyte stage (d 1) to mature osteoclast stage (d 6) (Fig. 5B
may play a cell autonomous role in osteoclast differentiation, given ERR
expression in osteoblasts (Fig. 4
may be involved in osteoblast-mediated osteoclast development. To address this, RANKL and OPG mRNA expression levels were assessed by RT-PCR in RNA samples extracted from RC cell cultures treated with ERR
-AS oligonucleotides from d 5 (after cells had reached confluence and proliferation was decreased) to d 11, a treatment regimen we have found previously to block effectively ERR
expression while concomitantly inhibiting osteoblast development and osteoblast-associated marker (e.g. BSP, OCN) expression (32). Both RANKL and OPG expression were significantly increased in ERR
AS-treated RC cells, compared with control or S-treated cultures (Fig. 5E
in vitro decreases the OPG/RANKL ratio.
|
increases adipogenesis and adipocyte colony formation in RC cell cultures
levels are dysregulated. To address this question, we treated RC cells with ERR
AS, S, or scrambled (Sc) oligonucleotides and double-stained the wells at d 15 with von Kossa (black: mineralized bone nodules) and sudan IV (red lipid droplets: adipocyte colonies); double staining allowed simultaneous quantification of bone and adipocyte colonies in the same wells. Consistent with what we reported recently (44), ERR
AS (Fig. 6A
, PPAR
, and AP2) was increased (Fig. 6
|
| Discussion |
|---|
|
|
|---|
expression is regulated by estrogen in osteoblastic RC cells in vitro and bones in vivo, with both osteoblast and osteoclast lineage cells expressing this nuclear receptor. Moreover, inhibition of ERR
expression during the differentiation phase of RC cell cultures with phosphorothioate-modified AS oligonucleotides not only inhibits osteoblast development but also increases the expression of key regulators of osteoclastogenesis, RANKL and OPG and concomitantly increases adipocyte differentiation and the expression of adipocyte-associated markers. Taken together, the data suggest that ERR
impinges on the estrogen axis in bone in which it may play roles in osteoclastogenesis and the shift away from marrow osteogenesis and toward adipogenesis associated with osteoporosis and age-related osteopenia.
ERR
and the estrogen axis in osteoporosis
We have found that ERR
expression is regulated by estrogen in osteoblasts and bone. Specifically, ERR
expression is increased early during proliferative stages in RC cells in vitro after treatment with E2 at physiological concentrations and decreased early in vivo in femurs isolated from ovariectomized vs. sham-operated rats. It is important to note that these changes in ERR
expression in vivo reflect changes in expression by bone cells (see also below) because we flushed bone marrow from bones before RNA isolation. Our finding that E2 regulates ERR
in bone is consistent with an earlier report that estrogen regulates ERR
expression in another tissue, i.e. the mouse uterus (45). Our observation that ERR
is regulated by estrogen in bone together with our recent finding that ERR
plays a functional role in osteoprogenitor cell proliferation and differentiation and that these processes are exquisitely sensitive to changes in ERR
levels (32), suggested to us that ERR
may be involved in the pathogenesis of postmenopausal osteoporosis. We found previously that inhibition of ERR
expression during the proliferation phase of RC cell cultures decreased proliferation, as seen by a decrease in cell number, and reduced differentiation, as seen by a decrease in mineralized bone nodule formation. Inhibition of ERR
early during differentiation phase also markedly decreased differentiation and bone nodule formation. Taken together, these data suggest that ERR
plays a role in bone formation and turnover with specific effects on the progression of osteoprogenitors to more mature bone-forming osteoblasts. The decrease of ERR
expression that we have now found at early times after ovariectomy (d 1 and 1 wk) of rats suggests that ERR
may be among the first players involved in the pathogenesis of the osteopenia characterized later by a decrease in osteoblast proliferation and biosynthetic activity. Interestingly, BSP, a major constituent of bone matrix, is also acutely and markedly down-regulated in bones from ovariectomized rats, consistent with its marked down-regulation in RC cell cultures in which ERR
is inhibited (32).
Our data are also in keeping with the observation that BSP is a useful biochemical marker of altered bone turnover in postmenopausal women (46, 47) and support the hypothesis that BSP is an important target gene of ERR
, a possibility that we are currently investigating (48). Consistent with this latter view, BSP has recently been described as an early response gene after estrogen treatment, increasing as early as 4 h after initiation of treatment (49). Interestingly, we found that key regulators of osteoclast formation and activity, RANKL and OPG (40, 41, 42, 43), are also acutely regulated after ovariectomy in rats. Consistent with the view that reductions in the OPG/RANKL ratio increase osteoclast formation and bone resorption (50, 51) and recent evidence that a decreased OPG/RANKL ratio is seen after estrogen treatment of OVX female mice (52), we found that RANKL, essential for osteoclastogenesis, was up-regulated, whereas OPG, the decoy receptor, was down-regulated after OVX. This latter observation is also consistent with two studies describing stimulation of the expression of OPG by E2 in vitro (53, 54). The timing of the increase in the number of osteoclasts in our OVX rat model (between d 4 and 7 after ovariectomy) (55) is consistent with the regulation of expression of RANKL and OPG we observed. Indeed, inhibition of osteoclastogenesis is one of the main mechanisms by which estrogen is thought to prevent estrogen-deficient bone loss, and growing evidence supports the hypothesis that estrogens down-regulate osteoclast formation by blunting the production of IL-1, IL-6, and TNF (22), cytokines that enhance stromal cell production of RANKL (53, 56).
Together with our observation that down-regulation of ERR
expression via AS strategies in RC cells in vitro leads to increased levels of RANKL, the data suggest that ERR
may be a key new molecular mediator of estrogen action in bone. Clearly, further work must be done to elucidate the mechanism (direct or indirect) by which ERR
expression is regulated by estrogen. ER
may be one candidate because its own expression is regulated by estrogen in osteocytes (57). We have shown recently that ER
and ERR
are coexpressed in certain cohorts of osteoblasts in vivo (calvaria, femurs) and in vitro (RC and bone marrow stromal cell cultures) (33). Together with our observation that the estrogen-induced increase in ERR
expression after estrogen treatment is abolished when RC cells are treated by the ER antagonist ICI 182,780, it seems likely that ER
and/or ERß may have a direct effect on ERR
expression in osteoblasts.
We also found that ERR
is expressed in osteoclasts in vivo (femurs of OVX rats) and in vitro (RAW cells before and after differentiation), which may explain the fact that, at 2 and 4 wk after surgery (in which the number of osteoclasts is known to increase and ERR
expression levels appear relatively normal in osteoblasts/osteocytes in these bones), we did not observe any difference between ERR
mRNA levels in femurs from OVX- vs. sham-operated animals. ER
has been reported to be expressed in osteoclasts (18), and recently estrogen was shown to reduce the ability of osteoclasts to degrade bone matrix by regulating matrix metalloproteinases and cysteine proteinases such as cathepsin K (58). Yang et al. (16) and Zhang and Teng (17) also showed that ERR
modulates the activating effect of estrogen on the lactoferrin promoter and suggested that ERR
may interact with ERs through protein-protein interactions, which makes ERR
a potential new partner of ER
in osteoclasts as well as in osteoblasts.
ERR
and adipocyte formation
Inhibition of ERR
levels by AS oligonucleotide treatment of RC cell cultures during differentiation phase not only blocks osteoblast differentiation but also increases adipogenesis, as evidenced by both an increase in adipocyte colony number and expression of several genes known to be involved in triglyceride synthesis, such as the early marker of adipocyte conversion, LPL; the fatty acid-binding protein aP2 (21); and PPAR
(59), which acts synergistically with c/EBP
to coordinate the adipocyte differentiation cascade (60). These observations are particularly interesting in view of the fact that the decrease in bone volume associated with osteoporosis is accompanied by an increase in marrow adipose tissue and fat content in general (20, 61). There is other evidence that ERR
plays a role in adipogenesis and the metabolic activity of fat tissue. It is known to be expressed in brown fat during mouse development and is more highly expressed in brown vs. white fat (12, 62).
ERR
has also been shown to be up-regulated during adipocyte differentiation in the HIB cell model and to bind to the promoter of the medium chain acyl-coenzyme A dehydrogenase gene, a pivotal enzyme in the mitochondrial fatty acid b-oxidation cycle (12, 13). Furthermore, ERR
has been shown to be a regulator in breast of the human aromatase gene (14), which is an enzyme involved in the conversion of testosterone to estrogen and known to have a function in fat metabolism because aromatase deficiency results in obesity (63). Although some of these observations appear discrepant with our observations, it seems likely that differences in ERR
regulatory activities may exist between established lines vs. primary cell models, as has been seen with other regulators of adipogenesis in other studies. In addition, it seems crucial to assess whether ERR
plays a direct or indirect role in regulation of adipogenesis in vivo. Consistent with our data, it was recently demonstrated that endogenous estrogen decreases fat content in female mice, an effect that appears to be mediated by ER
but not ERß (64, 65, 66). As already mentioned, although the mechanism by which ERR
is up-regulated by estrogen in vitro and in vivo remains to be determined, nevertheless, our data are consistent with ERR
playing a role in adipogenesis and the effect of estrogen on adipogenesis.
As already outlined, the decrease in bone volume associated with osteoporosis is accompanied by an increase in marrow adipose tissue. One mechanism that has been postulated to account for this apparent reciprocity is an imbalance in the commitment or differentiation of common progenitors of the osteoblast and adipocyte lineages toward adipogenesis. Support for this comes from a variety of experimental manipulations in vitro (21, 67). Interestingly, however, the number of adipocyte colonies formed in ERR
AS-treated RC cell cultures is significantly lower than the number of bone colonies lost (e.g. 15 adipocyte colonies vs. 60 bone colonies). Although a possible lack of optimization of adipogenic conditions cannot be excluded, the fact that those colonies that do form contain cells with abundant patent lipid droplets suggests that the conditions do support terminal adipocyte differentiation. Thus, our data suggest that ERR
is not involved in changes in fate choice of bipotential progenitors toward the adipocyte lineage but rather is involved in regulation of a preadipocyte pathway parallel to that of committed osteoprogenitors. This suggests that ERR
may have two independent functions: one on osteoprogenitors-osteoblasts as an activator of osteoblast differentiation and bone formation and one on preadipocytes-adipocytes as an inhibitor of adipogenesis.
Summary
Although the molecular basis of the function of ERR
in these different cell types remains to be determined, our results suggest that ERR
is important not only in osteoblast but also in osteoclast and adipocyte development and that it may have a function in estrogen deficiency/postmenopausal osteoporosis via actions on all three cell types. Based on our data, the decrease of ERR
expression in the OVX rat model of postmenopausal osteoporosis may participate in regulation of the decrease in bone formation and increase in bone resorption and adipocyte number, phenomena also observed in postmenopausal osteoporosis in humans. Therefore, blocking the decrease of ERR
seen after ovariectomy or estrogen deficiency or appropriate use of agonists and antagonists of ERR
may provide a novel therapeutic approach for osteopenic disorders such as osteoporosis.
| Acknowledgments |
|---|
| Footnotes |
|---|
Abbreviations: ALP, Alkaline phosphatase; aP2, fatty acid-binding protein; AS, antisense; BSP, bone sialoprotein; c/EBP
, CCAATT enhancer-binding protein
; E2, 17ß estradiol; ER, estrogen receptors; ERR
, estrogen receptor-related receptor
; FCS, fetal calf serum; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; LPL, lipoprotein lipase; OCN, osteocalcin; OVX, ovariectomized; PPAR
, peroxisome proliferator-activated receptor
; RANKL, receptor activator of nuclear factor
B ligand; RC, rat calvaria; S, sense; Sc, scrambled; TRAP, tartrate-resistant acid phosphatase.
Received January 25, 2002.
Accepted for publication May 20, 2002.
| References |
|---|
|
|
|---|
-1 orphan receptor. Cancer Res 59:45194524
. Proc Natl Acad Sci USA 98:88808884
is a transcriptional regulator of the human medium-chain acyl coenzyme A dehydrogenase gene. Mol Cell Biol 17:54005409[Abstract]
in the control of mitochondrial fatty acid ß-oxidation during brown adipocyte differentiation. J Biol Chem 272:3169331699
-1 orphan receptor. Cancer Res 58:56955700
1 interacts with coactivator and constitutively activates the estrogen response elements of the human lactoferrin gene. J Biol Chem 275:2083720846
gene expression in human primary osteoblasts: evidence for the expression of two receptor proteins. Mol Endocrinol 15:20642077
. Cell Growth Differ 9:10071014[Abstract]
, and estrogen receptors ER
and ERß in osteoblasts in vivo and in vitro. J Bone Miner Res, in press
B ligand. J Bone Miner Res 15:21782186[CrossRef][Medline]
1: molecular cloning and estrogen responsiveness. J Mol Endocrinol 19:299309
(ERR
) may regulate bone formation by its direct effect on bone sialoprotein (BSP) expression. J Bone Miner Res 16:S260
, but not estrogen receptor ß, is involved in the regulation of the OPG/RANKL (osteoprotegerin/receptor activator of NF-
B ligand) ratio and serum interleukin-6 in male mice. J Endocrinology 171:425433[Abstract]
. Endocrinology 142:22052212
expression in bone. J Pathol 188:294303[CrossRef][Medline]
promotes the adipogenic. Genes Dev 8:16541663
-deficient male mice. Biochem Biophys Res Commun 278:640645[CrossRef][Medline]
knockout mice. Proc Natl Acad Sci USA 97:1272912734This article has been cited by other articles:
![]() |
E. Bonnelye, N. Laurin, P. Jurdic, D. A. Hart, and J. E. Aubin Estrogen receptor-related receptor-{alpha} (ERR-{alpha}) is dysregulated in inflammatory arthritis Rheumatology, December 1, 2008; 47(12): 1785 - 1791. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. A Zirngibl, J. S M Chan, and J. E Aubin Estrogen receptor-related receptor {alpha} (ERR{alpha}) regulates osteopontin expression through a non-canonical ERR{alpha} response element in a cell context-dependent manner J. Mol. Endocrinol., February 1, 2008; 40(2): 61 - 73. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Bonnelye, R. A. Zirngibl, P. Jurdic, and J. E. Aubin The Orphan Nuclear Estrogen Receptor-Related Receptor-{alpha} Regulates Cartilage Formation in Vitro: Implication of Sox9 Endocrinology, March 1, 2007; 148(3): 1195 - 1205. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Gaillard, M. A. Dwyer, and D. P. McDonnell Definition of the Molecular Basis for Estrogen Receptor-Related Receptor-{alpha}-Cofactor Interactions Mol. Endocrinol., January 1, 2007; 21(1): 62 - 76. [Abstract] [Full Text] [PDF] |
||||
![]() |
R A Stein and D P McDonnell Estrogen-related receptor {alpha} as a therapeutic target in cancer Endocr. Relat. Cancer, December 1, 2006; 13(Supplement_1): S25 - S32. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.A. Garcia-Perez, I. Noguera, C. Hermenegildo, A. Martinez-Romero, J.J. Tarin, and A. Cano Alterations in the phenotype and function of immune cells in ovariectomy-induced osteopenic mice Hum. Reprod., April 1, 2006; 21(4): 880 - 887. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. B. Barry, J. Laganiere, and V. Giguere A Single Nucleotide in an Estrogen-Related Receptor {alpha} Site Can Dictate Mode of Binding and Peroxisome Proliferator-Activated Receptor {gamma} Coactivator 1{alpha} Activation of Target Promoters Mol. Endocrinol., February 1, 2006; 20(2): 302 - 310. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. D. Barish, M. Downes, W. A. Alaynick, R. T. Yu, C. B. Ocampo, A. L. Bookout, D. J. Mangelsdorf, and R. M. Evans A Nuclear Receptor Atlas: Macrophage Activation Mol. Endocrinol., October 1, 2005; 19(10): 2466 - 2477. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Bonnelye and J. E. Aubin Estrogen Receptor-Related Receptor {alpha}: A Mediator of Estrogen Response in Bone J. Clin. Endocrinol. Metab., May 1, 2005; 90(5): 3115 - 3121. [Abstract] [Full Text] [PDF] |
||||
![]() |
D Liu, Z Zhang, and C T Teng Estrogen-related receptor-{gamma} and peroxisome proliferator-activated receptor-{gamma} coactivator-1{alpha} regulate estrogen-related receptor-{alpha} gene expression via a conserved multi-hormone response element J. Mol. Endocrinol., April 1, 2005; 34(2): 473 - 487. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. Carrier, G. Deblois, C. Champigny, E. Levy, and V. Giguere Estrogen-related Receptor {alpha} (ERR{alpha}) Is a Transcriptional Regulator of Apolipoprotein A-IV and Controls Lipid Handling in the Intestine J. Biol. Chem., December 10, 2004; 279(50): 52052 - 52058. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Zhang, J. E. Aubin, T.-H. Kim, U. Payne, B. Chiu, and R. D. Inman Synovial Fibroblasts Infected with Salmonella enterica Serovar Typhimurium Mediate Osteoclast Differentiation and Activation Infect. Immun., December 1, 2004; 72(12): 7183 - 7189. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Tang, S. L. Tan, S. K. Ramadoss, A. P. Kumar, M.-H. E. Tang, and V. B. Bajic Computational method for discovery of estrogen responsive genes Nucleic Acids Res., December 1, 2004; 32(21): 6212 - 6217. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Greschik, R. Flaig, J.-P. Renaud, and D. Moras Structural Basis for the Deactivation of the Estrogen-related Receptor {gamma} by Diethylstilbestrol or 4-Hydroxytamoxifen and Determinants of Selectivity J. Biol. Chem., August 6, 2004; 279(32): 33639 - 33646. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Sanyal, J. Matthews, D. Bouton, H.-J. Kim, H.-S. Choi, E. Treuter, and J.-A. Gustafsson Deoxyribonucleic Acid Response Element-Dependent Regulation of Transcription by Orphan Nuclear Receptor Estrogen Receptor-Related Receptor {gamma} Mol. Endocrinol., February 1, 2004; 18(2): 312 - 325. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Liu, Z. Zhang, W. Gladwell, and C. T. Teng Estrogen Stimulates Estrogen-Related Receptor {alpha} Gene Expression through Conserved Hormone Response Elements Endocrinology, November 1, 2003; 144(11): 4894 - 4904. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Yoshiko, N. Maeda, and J. E. Aubin Stanniocalcin 1 Stimulates Osteoblast Differentiation in Rat Calvaria Cell Cultures Endocrinology, September 1, 2003; 144(9): 4134 - 4143. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |