help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2003-0504
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yeung, H. Y.
Right arrow Articles by Wong, C. K. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yeung, H. Y.
Right arrow Articles by Wong, C. K. C.
Endocrinology Vol. 144, No. 10 4446-4452
Copyright © 2003 by The Endocrine Society

Identification of Signal Transduction Pathways that Modulate Dibutyryl Cyclic Adenosine Monophosphate Activation of Stanniocalcin Gene Expression in Neuroblastoma Cells

Ho Y. Yeung, Daniel K. O. Chan, Nai K. Mak, Graham F. Wagner and Chris K. C. Wong

Department of Biology (N.K.M., C.K.C.W.), Hong Kong Baptist University, Kowloon Tong, Hong Kong; Department of Zoology (H.Y.Y., D.K.O.C.), The University of Hong Kong, Hong Kong; and Departments of Physiology (G.F.W.), The University of Western Ontario, London, Ontario, Canada N6A 5C1

Address all correspondence and requests for reprints to: Dr. Chris K. C. Wong, Department of Biology, Hong Kong Baptist University, Kowloon Tong, Hong Kong. E-mail: ckcwong{at}hkbu.edu.hk.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Stanniocalcin (STC) is a new mammalian polypeptide hormone and appears to be a regulator of neuronal function. We have already shown that the induction of STC mRNA and protein expression by cAMP is integral to neuroblastoma cell differentiation, particularly neurite outgrowth. In this study, we examined the cAMP pathway in greater detail. Some common neuritogenic agents, euxanthone (PW1) and trans-retinoic acid (RA), were studied for possible interactions with the dibutyryl cAMP (dbcAMP)-mediated response. Our results showed that STC mRNA induction by dbcAMP was mediated by protein kinase A-cAMP response element binding protein (CREB) pathway, accompanied with phosphorylation of CREB and a reduction of p50, p65, and phosphorylated inhibitor {kappa}B{alpha} levels. Using a synthetic peptide nuclear factor-{kappa}B SN50, stimulation of dbcAMP-mediated STC expression was observed; indicating the nuclear translocation of nuclear factor {kappa}B might possibly repress STC expression. dbcAMP-induced STC mRNA expression was enhanced by PW1. In contrast, RA had highly suppressive effects. Cotreatment of cell with PW1 and cAMP provoked an increase in phosphorylated CREB (pCREB). Conversely, cotreatment with RA suppressed pCREB. The results highlighted the importance of phosphorylation of CREB in mediating STC gene expression. Taking a step further to dissect the possible regulatory pathways involved, with the aid of phorbol 12-myristate 13-acetate or ionomycin, additive effects on STC gene expression were observed. The induction was aided by further elevation of pCREB, which was completely abolished by Gö 6976, a Ca2+-dependent protein kinase C (PKC) {alpha} and PKCß1 inhibitor. Our results indicated that cross-talk with PKC and/or Ca2+ signaling pathways might sensitize cAMP-mediated effects, on CREB phosphorylation and STC gene expression.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
STANNIOCALCIN (STC) is a glycoprotein hormone that was first discovered in fish and most recently in mammals (1, 2, 3, 4). In both groups, the gene is widely expressed and both have endocrine and paracrine forms of the hormone. In fish, the endocrine form of STC is a 50-kDa protein produced by glands known as the corpuscles of Stannius. This form of STC is always present in the blood and functions in the prevention of hypercalcemia (5). The STC cells possess calcium sensing receptors and release STC in response to minute elevations in serum calcium (6). The released hormone then acts on gill, gut, and renal transporting epithelia to restore normocalcemia (3, 7, 8). The paracrine form of fish STC is more heavily glycosylated, but its function is unknown (9).

The situation in mammals is somewhat different. Most mammalian tissues produce the 50-kDa form of STC. Furthermore, unlike fishes, mammalian serum is normally free of STC (10). Therefore, in organ systems such as kidney, heart, and brain, STC only functions locally. An endocrine form of STC only appears during pregnancy and lactation when the ovaries secrete a unique high molecular weight variant into the serum (11, 12).

Mammalian STC also has a role in development. STC expression is up-regulated 100-fold in human umbilical vein endothelial cells during tubulogenesis (13) and during mouse embryogenesis (14). More specifically, STC gene expression in the mouse embryo is particularly high in kidney, testis, and cartilage primoridia (15, 16, 17). Recent studies have shown that STC is also highly expressed in differentiating neurons and may have a role in protecting the brain from ischemia (18, 19).

We have recently established a correlation between neuronal differentiation and STC gene expression in a mouse neuroblastoma cell line (20). Treatment of Neuro 2A cells with dibutyryl cAMP (dbcAMP) and euxanthone (PW1) induced cell differentiation and neurite outgrowth; however, only dbcAMP treatment resulted in STC mRNA induction. The induction in STC mRNA was accompanied by a concomitant up-regulation of the axonal marker MAP-2c and the appearance of varicose structures. More significantly, STC antisense oligodeoxynucleotides transfection studies demonstrated a cause-and-effect relationship between the expression of STC mRNA and the formation of varicosities on the neurite (20). In the present study, we have examined the cAMP pathway in Neuro 2A cells in greater detail, focusing more so on downstream signaling events and possible cross talk with other signaling pathways.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Effects of dbcAMP, PW1, or RA on cell differentiation and STC mRNA expression
N2A-BU1, a subclone of Neuro-2A, was grown in MEM supplemented with 10% fetal bovine serum (FBS) and antibiotics (50 U/ml penicillin, 50 µg/ml streptomycin, and 10 µg/ml neomycin) at a density of 105 cm-2 in six-well plates (Nunc, Nalge Nunc, Roskilde, Denmark). The cells were incubated at 37 C in a humidified 5% CO2 incubator. After overnight incubation, N2A-BU1 cells were exposed for 48 h to one of the following treatments: 1) 1 mM dbcAMP (N6, 2'-O-dibutyryladenosine 3':5'-cAMP) (Roche Molecular Biochemicals, Indianapolis, IN); 2) 50 µM PW1; 3) 10, 25, 50 µM trans-retinoic acid (RA) (Calbiochem, San Diego, CA); 4) 50 µM PW1 + 1 mM dbcAMP; and 5) 10, 25, 50 µM RA + 4 mM dbcAMP. Cells with a neurite length greater than the mean + 3 SD of neurite length measured in untreated control cells were determined to be differentiated cells (21). Six hundred cells were examined in eight to nine randomly chosen fields in each of six wells for individual treatment.

Effects of Rp-cAMPS, nuclear factor {kappa}B (NF-{kappa}B) SN50, phorbol 12-myristate 13-acetate (PMA), ionomycin, PD98059, SB202190, or protein kinase C (PKC) inhibitor on dbcAMP-mediated STC mRNA expression
For Rp-cAMPS treatment, 25–200 µM Rp-cAMPS (Calbiochem) were applied to the culture for 5 min, followed by application of 1 mM dbcAMP and 25–200 µM Rp-cAMPS for 48 h. For NF-{kappa}B SN50 treatment, 30 µg/ml NF-{kappa}B SN50 or NF-{kappa}B SN50M (Calbiochem) were applied to the culture for 15 min, followed by application of 1 mM dbcAMP and 30–60 µg/ml NF-{kappa}B SN50 or NF-{kappa}B SN50M for 48 h. For PMA and ionomycin, PD98059, SB202190 treatment, N2A-BU1 cells were exposed for 48 h to one of the following treatments: 1) 1 mM dbcAMP (Roche Molecular Biochemicals); 2) 1–10 µM ionomycin (Calbiochem); 3) 1 and 10 nM PMA (Calbiochem); 4) 1–10 µM ionomycin + 1 mM dbcAMP; 5) 1, 10 nM PMA + 1 mM dbcAMP; 6) 2 µM PD 98059 + 1 mM dbcAMP; and 7) 0.35 µM SB 202190 + 1 mM dbcAMP. To verify effect of PKC, a highly potent PKC inhibitor Gö 6976 (2.3, 6.2 nM) (Calbiochem) was employed for treating dbcAMP/ionomycin or dbcAMP/PMA-stimulated cells for 48 h.

RNA extraction and PCR product verification
Cells were dissolved in TRIZOL Reagent (Gibco/BRL, Carlsbad, CA). Total RNA was extracted according to the manufacturer’s instruction. The quality of RNA, A260/A280 ratios were between 1.6–1.8. STC, p50, p65, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were generated by PCR of total RNA derived from N2A-BU1 cells. The primers were designed on the basis of the published cDNA sequence of mouse STC [ATGTCCAAAACTCAGCAGTGATTC-forward and ACACTCAAAGTTGGTGT G-reverse] (20), p50 [TCGGAGACTGGAGCCTGTGGTG-forward and CCCTGCGTTGGATTTCGTGACT-reverse], p65 [GAAGAAGCGAGACCTGGAGCA A-forward and GTTGATGGTGCTGAGGGATGCT-reverse] (22) and GAPDH [ATGGTGAAGGTCGTGTGAAC-forward and TTCAAGAGAGTAGGGAGGGC-reverse] (20). The PCR was run for 35 cycles with a 56 C annealing cycle (1 min), a 72 C extension cycle (3 min), and a 95 C denaturing cycle (50 sec), plus final incubation at 72 C for 10 min. The PCR products (~815 bp for STC, ~604 bp for p50, ~715 bp for p65, and ~1200 bp for GAPDH) were purified, subcloned into pCRII-TOPO (Invitrogen, Groningen, The Netherlands) and subjected to verification using an automated DNA sequencer (ABI 3700).

Semiquantitative RT-PCR was conducted as described previously using the housekeeping gene, GAPDH as an internal standard (20). RT-PCR was performed using the Superscript One-Step RT-PCR system (Gibco/BRL) and was calibrated using STC/p50/p65 and GAPDH primer pairs. The number of cycles was varied to determine the optimal number that would allow detection of the amplified products, while keeping amplification for these genes in the log phase. The following amplification cycles were used to compare levels of gene expression: (p50/p65):GAPDH—30:20 cycles; STC:GAPDH–30/17 cycles. For the assay, total RNA was diluted to 0.4 µg/µl in ribonuclease-free water, mixed with 0.5 µg of polydeoxythymidine12–18, 25 µl of 2x reaction mix, 1 µl reverse transcriptase/Taq mix and 22.6 µl of ribonuclease-free water to a final volume of 50 µl in a reaction tube. The reaction was incubated at 45 C for 30 min, followed by 95 C for 2 min to inactivate the reverse transcriptase and to completely denature the template. Gene specific primer sets [STC:GAPDH or (p50/p65):GAPDH] were added into the reaction according to its corresponding precalibrated cycle number. Reactions were run for the optimized cycles with a 56 C annealing cycle (1 min), 72 C extension cycle (3 min), and a 95 C denaturing cycle (1 min). Control amplifications were done either without reverse transcriptase or without RNA. All glass- and plasticware were treated with diethyl pyrocarbonate and autoclaved.

Northern blot analysis
Control and stimulated N2A-BU1 cells were harvested, and total RNA was isolated as outlined above. Twenty micrograms of RNA per lane was resolved on 1% agarose/formaldehyde gels, and subjected to Northern blot analysis using random-primed, digoxigenin (DIG)-deoxyuridine triphosphate-labeled (Roche Molecular Biochemicals) mouse STC and GAPDH cDNA probes under conditions of high stringency (20). The membrane was then incubated in blocking solution (Roche Molecular Biochemicals) in diluent buffer [10 mM Tris (pH 7.5) containing 150 mM NaCl], followed by 1 h room temperature incubation with 1:20,000 dilution of anti-DIG-alkaline phosphatase in blocking solution. The signal was generated using CDP-Star (Amersham Biosciences, Uppsala, Sweden) and detected using x-ray film. The STC and GAPDH bands were quantified by scanning densitometry.

Western blot analysis
The treated cells were washed with two to three changes of cold PBS. Adherent cells were scraped from the plastic surface and transferred to a microcentrifuge tube. The cells were pelleted and resuspended in 30–50 µl of cold lysis buffer containing 250 mM Tris/HCl (pH 8.0), 1% Nonidet P-40, and 150 mM NaCl. After 10 min incubation on ice, the lysed cells were pelleted and supernatants were assayed for protein concentration (DC Protein Assay Kit II, Bio-Rad Pacific Ltd.). Samples were subjected to electrophoresis in NuPage 4–12% Bis-Tris gradient gels (Invitrogen). Gels were blotted onto a polyvinylidene difluoride membrane. Western blot was conducted using the WesternBreeze Chemiluminescent detection kit (Invitrogen), using rabbit antibodies to cAMP response element binding protein (CREB), phosphorylated CREB (pCREB), I{kappa}B{alpha}, and phosphorylated I{kappa}B{alpha} (p-I{kappa}B{alpha}) (Calbiochem).

Statistical analysis
Drugs treatments were performed in triplicate in the same experiments and individual experiments were repeated at least three times. All data are represented as the mean ± SEM. Statistical significance is tested by Student’s t test or one-way ANOVA followed by Duncan’s multiple range test. Groups were considered significantly different if P < 0.05.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
dbcAMP-mediated differentiation of neuroblastoma cells and induction of STC mRNA expression
Treatment of N2A-BU1 cells with dbcAMP, PW1, and RA produced different differentiating characteristics (Fig. 1Go). The more distinctive appearance of dbcAMP-induced cells was the decoration of varicosities in the neurite (Fig. 1BGo). Only cAMP treatment was accompanied with an induction of STC mRNA. Previous studies from this laboratory demonstrated a dose- and time-dependent induction of STC gene expression by dbcAMP treatment. Because the major signaling pathway that mediates responses to cAMP involves activation of the cAMP-dependent protein kinase A (PKA), a cell-permeable, metabolically stable cAMP antagonist (Rp-cAMPS) that inhibits PKA was used to determine whether PKA was required for cAMP activation of STC gene expression. In this study, Rp-cAMPS strongly reduced the ability of dbcAMP to stimulate STC expression, in a dose-dependent manner (Fig. 2Go). Several studies have shown that cAMP can modulate the MAPK-responsive transcription factor Elk-1 and cross-talk with the NF-{kappa}B pathway (23, 24, 25, 26), prompting us to investigate the possible roles of MAPK and NF-{kappa}B in cAMP activation of STC gene expression. To access the activation of transcription factors by dbcAMP, we used Western blot to determine the levels of phosphorylated cAMP response element-binding protein (CREB), pElk, and p-I{kappa}B{alpha} (Fig. 3Go). This experiment demonstrated that treatment with dbcAMP caused a dose-dependent increase in pCREB levels, and a reduction in p-I{kappa}B{alpha} levels. There were no effects on pElk. In addition, there were no observable effects obtained with PD 98059 (inhibitor of MEK) or SB 202190 (inhibitor of p38MAPK), on dbcAMP-induced STC mRNA expression, indicating the pElk has little or no effect on STC expression in these cells (results not shown). For the NF-{kappa}B pathway, RT-PCR analysis demonstrated reductions in p65 (RelA) and p50 (NF-{kappa}B1) mRNAs in dbcAMP treated cells (Fig. 4Go). To test whether inhibition of nuclear translocation of NF-{kappa}B could provoke STC expression, synthetic peptides NF-{kappa}B SN50 (a cell-permeable NF-{kappa}B nuclear translocation inhibitor) and NF-{kappa}B SN50M (cell-permeable inactive control) were used. The cotreatment with NF-{kappa}B SN50 had a synergistic effect on dbcAMP stimulated STC mRNA levels in the cells (Fig. 4Go). Collectively, our results demonstrated that STC expression was stimulated by the cAMP-PKA-pCREB pathway but suppressed by the nuclear translocation of NF-{kappa}B.



View larger version (102K):
[in this window]
[in a new window]
 
FIG. 1. Phase contrast comparison of neuroblastoma (N2A-BU1) cell response to different stimulations. A, Untreated control cells. B, Cells exposed for 48 h to 1 mM dbcAMP, C, 50 µM PW1 and D, 50 µM RA. The cells were photographed without prior fixation.

 


View larger version (29K):
[in this window]
[in a new window]
 
FIG. 2. Effect of Rp-cAMPS on STC mRNA levels of 1 mM dbcAMP treated N2A-BU1 cells. Cells were incubated for 48 h in 10% FBS/MEM containing 25, 50, 100, and 200 µM Rp-cAMPS. Four hundred nanograms of total RNA of each sample were reverse-transcribed and amplified for 30 and 17 cycles (with STC and GAPDH). PCR products were electrophoresed on a 1% agarose gel, stained with ethidium bromide. Upper panel, Inverse image of the gel; lower panel, the densitometric analysis of STC relative to GAPDH levels. Data (means ± SEM) are from four separate experiments. Bars with the same letter are not significantly different according to the results of one-way ANOVA followed by Duncan’s multiple range test (P < 0.05).

 


View larger version (48K):
[in this window]
[in a new window]
 
FIG. 3. Western blot analysis of pCREB, p-I{kappa}B{alpha}, and pElk. Cells after 48 h treatments of 1 or 4 mM dbcAMP, a dose-dependent activation of CREB phosphorylation, and suppression of I{kappa}B{alpha} were observed. No significant effect on Elk phosphorylation was noticed. Results shown were from more than three independent experiments.

 


View larger version (28K):
[in this window]
[in a new window]
 
FIG. 4. Effects of dbcAMP on NF-{kappa}B pathway. A, Representative result shows the effects of 48 h of 1 and 4 mM dbcAMP treatments on the expression of p50 (NF-{kappa}B1) and p65 (RelA) mRNA. Four hundred nanograms of total RNA of each sample were reverse transcribed and amplified for 30 and 20 cycles (with p50/p65 and GAPDH). PCR products were electrophoresed on a 1% agarose gel, stained with ethidium bromide. B, The gel shows the effect of 30 µg/ml synthetic peptide NF-{kappa}B SN50 or NF-{kappa}B SN50M on the STC mRNA expression in 48 h of 1 mM dbcAMP-treated cells. An additive effect was found in cells incubated with NF-{kappa}B SN50. Bars with the same letter are not significantly different according to the results of one-way ANOVA followed by Duncan’s multiple range test (P < 0.05). Results shown were from more than four independent experiments.

 
Interactions of dbcAMP, PW1, and RA on STC gene expression
We also tested the ability of different neuritogenic agents to modulate dbcAMP induced STC expression. PW1 had synergistic effects on dbcAMP-induced STC gene activation (Fig. 5AGo). RA, however, partially suppressed STC mRNA levels in the cells and inhibited CREB phosphorylation produced by dbcAMP treatment (Fig. 5BGo). There was a common effect mediated by both dbcAMP and PW1, which was a reduction of p-I{kappa}B{alpha} levels (Fig. 5AGo). These findings were consistent with our observations that increased pCREB and inhibition of nuclear translocation of NF-{kappa}B were essential to activation of STC gene expression.



View larger version (48K):
[in this window]
[in a new window]
 
FIG. 5. Effects of PW1, RA, ionomycin, or PMA on dbcAMP-induced STC mRNA and pCREB, p-I{kappa}B{alpha} levels in N2A-BU1. Cells were incubated for 48 h in 10% FBS/MEM containing (A) PW1 or PW1 + dbcAMP, (B) RA or RA + dbcAMP, (C) ionomycin, PMA or ionomycin/PMA + dbcAMP. Four hundred nanograms of total RNA of each sample were reverse transcribed and amplified for 30 and 17 cycles for STC and GAPDH. PCR products were electrophoresed on a 1% agarose gel, stained with ethidium bromide. A, PW1 had synergistic effects on dbcAMP-induced STC mRNA expression and additively increased pCREB formation. PW1 alone reduced the level of p-I{kappa}B{alpha} protein. B, RA partially suppressed STC mRNA levels in the cells and inhibited CREB phosphorylation produced by dbcAMP treatment. Cotreatment of dbcAMP with RA resulted in a decrease of I{kappa}B{alpha} phosphorylation. PW1 or RA alone had no observable effect on CREB phosphorylation. C, Treatment of the cells with dbcAMP/PMA or dbcAMP/ionomycin additively increased both pCREB and STC mRNA levels. Ionomycin or PMA alone had no observable effect on CREB phosphorylation. Results shown were from more than four independent experiments.

 
Interactions of dbcAMP with Ca2+or PMA on STC gene expression
Taking a step further to dissect other possible regulatory pathways involved, PMA and ionomycin were used. PMA and ionomycin challenges of the cells had no observable effect on pCREB level (Fig. 5CGo). On their own, both treatments had no observable effect on cell differentiation or STC expression. However, the combined treatment of the cells with dbcAMP/PMA or dbcAMP/ionomycin additively increased both pCREB and STC mRNA levels (Fig. 5CGo). The treatment of dbcAMP/PMA or dbcAMP/ionomycin with Gö 6976 demonstrated marked reductions in STC mRNA levels (Fig. 6Go).



View larger version (44K):
[in this window]
[in a new window]
 
FIG. 6. Effect of Gö 6976 on STC mRNA levels in dbcAMP and ionomycin or PMA cotreated N2A-BU1 cells. The cotreated cells were incubated for 48 h in 10% FBS/MEM containing 2.3 or 6.2 nM Gö 6976. The treatment of dbcAMP/PMA or dbcAMP/ionomycin with Gö 6976 demonstrated significant reductions in STC mRNA levels. Results shown were from more than three independent experiments.

 
To confirm the involvement of NF-{kappa}B and synergism of ionomycin/PMA on modulating STC gene expression, Northern blotting was conducted. Similar trends of induction of STC transcripts were confirmed (Fig. 7Go).



View larger version (40K):
[in this window]
[in a new window]
 
FIG. 7. Effects of NF-{kappa}B, PMA, and ionomycin on STC mRNA levels. Northern analysis of STC expression in N2A-BU1 cells following dbcAMP, NF-{kappa}B SN50, NF-{kappa}B SN50M, PMA, ionomycin, and combined treatments for 48 h. Total RNA (20 µg/lane) was fractionated in 3% formaldehyde-1% agarose denaturing gel, transferred, and hybridized with a mouse STC cDNA probe. GAPDH hybridization is shown to normalize the STC signal in each lane. Results shown were from more than three independent experiments.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Our previous studies have established a correlation between neuronal differentiation, neurite varicosity formation and STC gene expression in the mouse neuroblastoma cell line, N2A-BU1 (20). Most importantly, they revealed that the up-regulation in STC gene expression was a necessary requisite for varicosity formation in response to PKA activation. These findings prompted the present investigations to elucidate this regulatory pathway in greater detail. In the first part of the study, three neuritogenic agents were used to study their possible interactions with dbcAMP-mediated STC gene expression. Treatment of the cells with dbcAMP, PW1, and RA produced different cell morphologies. As in the previous study, only dbcAMP treatment resulted in STC mRNA induction (20). However, cotreatment with dbcAMP and PW1 provoked even further STC mRNA induction. In contrast, cotreatment with RA suppressed cAMP-induced STC expression.

To elucidate some of the underlying mechanisms, the cAMP pathway was investigated in more detail. We found that the effects of dbcAMP on STC mRNA levels could be blocked entirely with the antagonist Rp-cAMPS, and that cAMP activation was accompanied by CREB phosphorylation. PW1 alone had no stimulatory effect on STC mRNA or pCREB levels, but in combination with dbcAMP caused even greater phosphorylation of CREB. As previous studies have shown that PW1 activates PKC in the same cell line (21), we explored the possibility of PKC-PKA cross talk using PMA as a PKC activator and ionomycin to increase intracellular Ca2+. By themselves, both had no observable effects on CREB phosphorylation, but like PW1, they had additive effects on STC mRNA levels and CREB phosphorylation in dbcAMP-treated cells. These additive effects denoted the likely involvement of PKC and/or Ca2+ in modulating PKA-mediated STC induction. To further delineate the involvement of the PKC pathway, a highly potent PKC inhibitor Gö 6976, which selectively inhibits the Ca2+-dependent isozymes PKC{alpha} (IC50 = 2.3 nM) and PKCß1 (IC50 = 6.2 nM) was tested (27, 28, 29). Our data clearly showed that Gö 6976, had a highly suppressive effect on induced STC transcript levels. The results highlighted the obvious importance of the Ca2+-dependent PKC subtype in modulating PKA-activated STC expression. Like cAMP, Ca2+ functions as a second messenger and can lead to pleiotropic responses involving an activation of Ca2+/calmodulin-dependent kinase, PKA, PKC, and Ca2+-sensitive adenyl cyclase isoforms, which can increase phosphorylation of CREB (30, 31, 32). In the present study, the additive effects on both CREB phosphorylation and STC mRNA required prior PKA activation that differs from the situation in fish where Ca2+ alone can directly activate STC expression (33).

cAMP is one of the most important intracellular signals regulating neuronal function (34, 35) and whereas PKC cross talk enhanced dbcAMP-induced STC mRNA expression. RA had suppressive effects mediated through inhibition of CREB phosphorylation. Furthermore our results identified an additional pathway that also proved to be involved in modulating STC expression. In addition to its effects on CREB phosphorylation, dbcAMP treatment caused reductions in p50 (NF-{kappa}B1), p65 (RelA) mRNA and phospho-I{kappa}B protein levels in the cells. NF-{kappa}B/Rel protein is essential for the differentiation of some neuronal cells (36), but this does not appear to be true in the case of Neuro-2A cells. Our observations imply a cross-talk between these two pathways, whereby NF-{kappa}B was down-regulated to up-regulate STC. Antagonistic effects of NF-{kappa}B on cAMP-mediated gene transcription or vice versa have been well documented (23, 24, 37, 38, 39). The interaction is a common phenomenon as the actions of cAMP are in most cases pleiotropic, regulating the activity of multiple transcription factors (40). The ability of NF-{kappa}B protein to modulate STC mRNA expression was confirmed with the synthetic peptide NF-{kappa}B SN 50. This peptide contains the cell membrane-permeable motif and nuclear localization sequence for inhibiting the nuclear translocation of NF-{kappa}B (41). Our results provided clear evidence that inhibition of nuclear translocation of NF-{kappa}B caused further enhancement of STC expression in dbcAMP-treated cells; indicating that NF-{kappa}B is normally suppressive on expression.

In summary, these data provide evidence that the cAMP/PKA/CREB signaling cascade in N2A-BU1 cells plays an important role in regulating STC gene transcription. The cross-talk between PKC and/or Ca2+ signaling pathways augmented these cAMP-mediated effects, whereas RA and the nuclear translocation of NF-{kappa}B had suppressive effects on this activation. What effects if any these pathways have on the coactivator, CREB-binding protein, will be the subject of future studies.


    Footnotes
 
This work was supported by the Faculty Research Grant (FRG 01-02/II-10), Hong Kong Baptist University (to C.K.C.W.) and through funding from The Canadian Institutes of Health Research and the Kidney Foundation of Canada (to G.F.W.).

Abbreviations: CREB, cAMP response element binding protein; dbcAMP, dibutyryl cAMP; DIG, digoxigenin; FBS, fetal bovine serum; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; I{kappa}B{alpha}, inhibitor {kappa}B{alpha}; NF-{kappa}B, nuclear factor {kappa}B; pCREB, phosphorylated CREB; p-I{kappa}B{alpha}, phosphorylated I{kappa}B{alpha}; PKA, protein kinase A; PKC, protein kinase C; PMA, phorbol 12-myristate 13-acetate; PW1, euxanthone; RA, trans-retinoic acid; STC, stanniocalcin.

Received April 22, 2003.

Accepted for publication June 13, 2003.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Chang AC, Janosi J, Hulsbeek M, De Jong D, Jeffrey KJ, Noble JR, Reddel RR 1995 A novel human cDNA highly homologous to the fish hormone stanniocalcin. Mol Cell Endocrinol 112:241–247[CrossRef][Medline]
  2. Olsen HS, Cepeda MA, Zhang QQ, Rosen CC, Vozzolo BL 1996 Human stanniocalcin: a possible hormonal regulator of mineral metabolism. Proc Natl Acad Sci USA 93:1792–1796[Abstract/Free Full Text]
  3. Wagner GF, Hampong M, Park CM, Copp DH 1986 Purification, characterization and bioassay of teleocalcin, a glycoprotein from salmon corpuscles of Stannius. Gen Comp Endocrinol 63:481–491[CrossRef][Medline]
  4. Wagner GF, Guiraudon CC, Milliken C, Copp DH 1995 Immunological and biological evidence for a stanniocalcin-like hormone in human kidney. Proc Natl Acad Sci USA 92:1871–1875[Abstract/Free Full Text]
  5. Wagner GF 1994 The molecular biology of the corpuscles of stannius and regulation of stanniocalcin gene expression. In: Sherwood N, Hew C, eds. Fish physiology. New York: Academic Press; 273–302
  6. Radman DP, McCudden C, James K, Nemeth EM, Wagner GF 2002 Evidence for calcium-sensing receptor mediated stanniocalcin secretion in fish. Mol Cell Endocrinol 186:111–119[CrossRef][Medline]
  7. Lu M, Wagner GF, Renfro JL 1994 Stanniocalcin stimulates phosphate reabsorption by flounder renal proximal tubule in primary culture. Am J Physiol 267:R1356–R1362
  8. Sundell K, Bjornsson BT, Kawanchi H 1992 Chum salmon (Oncorhynchus keta) stanniocalcin inhibits in vitro intertinal calcium uptake in Atlantic cod (Gadus morhua). J Comp Physiol B 162:489–495[Medline]
  9. McCudden CR, Kogon MR, DiMattia GE, Wagner GF 2001 Novel expression of the stanniocalcin gene in fish. J Endocrinol 171:33–44[Abstract]
  10. Niu PD, Radman DP, Jaworshi EM, Deol H, Gentz R, Su J, Olsen HS, Wagner GF 2000 Development of a human stanniocalcin radioimmunoassay: serum and tissue hormone levels and pharmacokinetics in the rat. Mol Cell Endocrinol 162:131–144[CrossRef][Medline]
  11. Deol HK, Varghese R, Wagner GF, DiMattia GE 2000 Dynamic regulation of mouse ovarian stanniocalcin expression during gestation and lactation. Endocrinology 141:3412–3421[Abstract/Free Full Text]
  12. Paciga M, Watson AJ, DiMattia GE, Wagner GF 2002 Ovarian stanniocalcin is structurally unique in mammals and its production and release are regulated through the luteinizing hormone receptor. Endocrinology 143:3925–3934[Abstract/Free Full Text]
  13. Kahn J, Mehraban F, Ingle G, Xin X, Bryant JE, Vehar G, Schoenfeld J, Grimaldi CJ, Peale F, Draksharapu A, Lewin DA, Gerritsen ME 2000 Gene expression profiling in an in vitro model of angiogenesis. Am J Pathol 156:1887–1900[Abstract/Free Full Text]
  14. Varghese R, Wong CKC, Deol H, Wagner GF, DiMattia GE 1998 Comparative analysis of mammalian stanniocalcin genes. Endocrinology 139:4714–4725[Abstract/Free Full Text]
  15. Stasko SE, DiMattia GE, Wagner GF 2001 Dynamic changes in stanniocalcin gene expression in the mouse uterus during early implantation. Mol Cell Endocrinol 174:145–150[CrossRef][Medline]
  16. Stasko SE, Wagner GF 2001 Stanniocalcin gene expression during mouse urogenital development: a possible role in mesenchymal-epithelial signalling. Dev Dyn 220:49–59[CrossRef][Medline]
  17. Stasko SE, Wagner GF 2001 Possible roles for stanniocalcin during early skeletal patterning and joint formation in the mouse. J Endocrinol 171:237–248[Abstract]
  18. Zhang KZ, Lindsberg PJ, Tatlisumak T, Kaste M, Olsen HS, Andersson LC 2000 Stanniocalcin: a molecular guard of neurons during cerebral ischemia. Proc Natl Acad Sci USA 97:3637–3642[Abstract/Free Full Text]
  19. Zhang KZ, Westberg JZ, Paetau A, von Boguslawsky K, Lindsberg P, Erlander M, Guo H, Su J, Olsen HS, Andersson LC 1998 High expression of stanniocalcin in differentiated brain neurons. Am J Pathol 153:439–445[Abstract/Free Full Text]
  20. Wong CKC, Yeung HY, Mak NK, DiMattia GE, Chan DKO, Wagner GF 2002 Effects of dibutyryl cAMP on stanniocalcin and stanniocalcin-related protein mRNA expression in neuroblastoma cells. J Endocrinol 173:199–209[Abstract]
  21. Mak NK, Li WK, Zhang M, Wong RNS, Tai LS, Yung KKL, Leung HW 2000 Effects of euxanthone on neuronal differentiation. Life Sci 66:347–354[CrossRef][Medline]
  22. Jimi E, Nakamura I, Ikebe T, Akiyama S, Takahashi N, Suda T 1998 Activation of NF-{kappa}B is involved in the survival of osteoclasts promoted by interleukin-1. J Biol Chem273:8799–8805
  23. Parry GC, Mackman N 1997 Role of cyclic AMP response element-binding protein in cyclic AMP inhibition of NF-{kappa}B-mediated transcription. J Immunol 159:5450–5456[Abstract]
  24. Waltner-Law M, Daniels MC, Sutherland C, Granner DK 2000 NF-{kappa}B inhibits glucocorticoid and cAMP-mediated expression of the phosphoenolpyruvate carboxykinase gene. J Biol Chem 275:31847–31856[Abstract/Free Full Text]
  25. Kievit P, Lauten JD, Maurer RA 2001 Analysis of the role of the mitogen-activated protein kinase in mediating cyclic-adenosine 3', 5'-monophosphate effects on prolactin promoter activity. Mol Endocrinol 15:614–624[Abstract/Free Full Text]
  26. Dhillon AS, Pollock C, Steen H, Shaw PE, Mischak H, Kolch W 2002 Cyclic AMP-dependent kinase regulates Raf-1 kinase mainly by phosphorylation of serine 259. Mol Cell Biol 22:3237–3246[Abstract/Free Full Text]
  27. Martiny-Baron G, Kazanietz MG, Mischak H, Blumberg PM, Kochs G, Hug H, Marme D, Schächtele C 1993 Selective inhibition of protein kinase C isozymes by the indolocarbazole Go 6976. J Biol Chem 268:9194–9197[Abstract/Free Full Text]
  28. Qatsha KA, Rudolph C, Marmé D, Schächtele C, May WS 1993 Go 6976, a selective inhibitor of protein kinase C, is a potent antagonist of human immunodeficiency virus 1 induction from latent/low-level-producing reservoir cells in vitro. Proc Natl Acad Sci USA 90:4674–4678[Abstract/Free Full Text]
  29. Gschwendt M, Dieterich S, Rennecke J, Kittstein W, Muller HJ, Johannes FJ 1996 Inhibition of protein kinase C mu by various inhibitors. Differentiation from protein kinase c isoenzymes. FEBS Lett 392:77–80[CrossRef][Medline]
  30. Xia Z, Storm DR 1996 Regulatory properties of the mammalian adenylyl cyclases. Austin, TX: Chapman & Hall
  31. Chawla S, Hardingham GE, Quinn DR, Bading H 1998 CBP: a signal-regulated transcriptional coactivator controlled by nuclear calcium and CaM kinase IV. Science 281:1505–1509[Abstract/Free Full Text]
  32. Shaywitz AJ, Greenberg ME 1999 CREB: a stimulus-induced transcription factor activated by a diverse array of extracellular signals. Annu Rev Biochem 68:821–861[CrossRef][Medline]
  33. Wagner GF, Jaworski E 1994 Calcium regulates stanniocalcin mRNA levels in primary cultured rainbow trout corpuscles of Stannius. Mol Cell Endocrinol 99:315–322[CrossRef][Medline]
  34. O’Connor V, Augustine GJ, Betz H 1994 Synaptic vesicle exocytosis: molecules and models. Cell 76:785–787[CrossRef][Medline]
  35. Wickman K, Clapham DE 1995 Ion channel regulation by G proteins. Physiol Rev 75:865–885[Abstract/Free Full Text]
  36. Feng Z, Porter AG 1999 NF-{kappa}B/Rel proteins are required for neuronal differentiation of SH-SY5Y neuroblastoma cells. J Biol Chem 274:30341–30344[Abstract/Free Full Text]
  37. Chen D, Rothenberg EV 1994 Interleukin 2 transcription factors as molecular targets of cAMP inhibition: delayed inhibition kinetics and combinatorial transcription roles. J Exp Med 179:931–942[Abstract/Free Full Text]
  38. Neumann M, Grieshammer T, Chuvpilo S, Kneitz B, Lohoff M, Schimpl A, Franza Jr BR, Serfling E 1995 RelA/p65 is a molecular target for the immunosuppressive action of protein kinase A. EMBO J 14:1991–2004[Medline]
  39. Ollivier V, Parry GC, Cobb RR, de Prost D, Mackman N 1996 Elevated cyclic AMP inhibits NF-{kappa}B-mediated transcription in human monocytic cells and endothelial cells. J Biol Chem 271:20828–20835[Abstract/Free Full Text]
  40. Montminy M 1997 Transcriptional regulation by cyclic AMP. Annu Rev Biochem 66:807–822[CrossRef][Medline]
  41. Lin YZ, Yao SY, Veach RA, Torgerson TR, Hawiger J 1995 Inhibition of nuclear translocation of transcription factor NF-{kappa}B by a synthetic peptide containing a cell membrane-permeable motif and nuclear localization sequence. J Biol Chem 270:14255–14258[Abstract/Free Full Text]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yeung, H. Y.
Right arrow Articles by Wong, C. K. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yeung, H. Y.
Right arrow Articles by Wong, C. K. C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals