help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2003-0457
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Burcelin, R.
Right arrow Articles by Pralong, F. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Burcelin, R.
Right arrow Articles by Pralong, F. P.
Endocrinology Vol. 144, No. 10 4484-4491
Copyright © 2003 by The Endocrine Society

Gonadotropin-Releasing Hormone Secretion from Hypothalamic Neurons: Stimulation by Insulin and Potentiation by Leptin

Rémy Burcelin, Bernard Thorens, Micheline Glauser, Rolf C. Gaillard and François P. Pralong

Institute of Pharmacology and Toxicology (R.B., B.T.), Lausanne Medical School, and Division of Endocrinology and Diabetology (M.G., R.C.G., F.P.P.), University Hospital, 1011 Lausanne, Switzerland

Address all correspondence and requests for reprints to: François Pralong, Division of Endocrinology, BH 19-709, CHUV, 1011 Lausanne, Switzerland. E-mail: francois.pralong{at}chuv.hospvd.ch.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Insulin and leptin are peripheral metabolic factors signaling the body needs in energy to the central nervous system. Because energy homeostasis and reproductive function are closely related phenomena, we investigated the respective roles played by insulin and leptin in the hypothalamic control of GnRH secretion. We observed that increasing circulating insulin levels, by performing hyperinsulinemic clamp studies in male mice, was associated with a significant rise in LH secretion. This effect of insulin is likely mediated at the hypothalamic level, because it was also found to stimulate the secretion and the expression of GnRH by hypothalamic neurons in culture. Leptin was found to potentiate the effect of insulin on GnRH secretion in vitro but was devoid of any effect on its own. These data represent the first evidence of direct insulin sensing by hypothalamic neurons involved in activating the neuroendocrine gonadotrope axis. They also demonstrate that these neurons can integrate different hormonal signals to modulate net hypothalamic GnRH output. We propose that such integration is an essential mechanism for the adaptation of reproductive function to changes in the metabolic status of an individual.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
THE HYPOTHALAMUS EXERTS a primordial influence over two major determinants of species survival: energy balance and reproduction. These two functions are closely linked; indeed, the relationship existing between the nutritional status of an individual and the activation of the neuroendocrine gonadotrope axis has long been recognized (1). Adequate energy stores are a prerequisite to normal pubertal development and to continuing reproductive capacity in adulthood. This is true for humans as well as for rodents (2, 3, 4). However, the precise mechanisms implicated have only partially been elucidated.

Insulin and leptin are metabolic factors, circulating in the periphery, that participate in the hypothalamic control of metabolism and reproduction. It is now well established that, in addition to its role in glucose homeostasis, insulin participates in the long-term signaling of satiety to the hypothalamus (5, 6, 7, 8, 9). Moreover, it was recently demonstrated that normal insulin signaling within the central nervous system is essential for the correct activation of the gonadotrope axis in rodents (5). This is illustrated by the phenotype of mice with central insensitivity to insulin after the neuron-specific inactivation of the insulin receptor; these animals exhibit hyperphagic obesity, and they also suffer from hypogonadotropic hypogonadism (5). The potential importance of insulin in this setting is further underlined by the observation that insulin-dependent diabetes mellitus is accompanied by reproductive abnormalities resulting from impaired LH secretion in both human and animal models (10, 11).

Similarly, leptin (12) signals the body needs in energy to the central nervous system and is one of the factors implicated in the development of puberty in humans and various rodent models (13, 14, 15, 16, 17, 18, 19). Therefore, and because both insulin and leptin are transported across the blood brain barrier (20), we hypothesized that these two factors might interact within the hypothalamus to modulate the secretion of GnRH, the critical hormone ensuring normal reproductive function (21).

The aim of the present studies was to better define the respective roles and potential interactions of insulin and leptin in the control of the neuroendocrine gonadotrope axis. Therefore, we investigated the regulation of GnRH secretion by these two hormones in vitro in primary cultures of hypothalamic neurons as well as in vivo in adult male mice. We found that GnRH secretion from cultured hypothalamic neurons was stimulated directly and dose-dependently by insulin, demonstrating direct insulin sensing by hypothalamic neurons. In contrast, leptin alone had no effect in this in vitro system but was found to potentiate the insulin stimulation. The relevance of these observations for the regulation of reproductive function is suggested by our finding of a stimulation of the neuroendocrine gonadotrope axis of adult mice at the end of hyperinsulinemic clamp studies performed in vivo.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Neuronal cultures
Primary hypothalamic neuronal cell cultures were performed as recently described (22). Briefly, hypothalami were obtained from 18-d-old fetuses of both sexes; whole brains were rapidly removed from the skull, and the hypothalamus dissected out with ophthalmic scissors. An anterior coronal cut, approximately 1 mm anteriorly from the optic chiasma, and a posterior coronal cut at the posterior border of the mammillary bodies were followed by two parasagittal cuts along the hypothalamic sulci and a final cut dorsally, at a depth of approximately 2 mm from the ventral surface of the tissue block (23). Cells were dispersed mechanically in PBS buffer (PBS without calcium or magnesium; Gibco BRL, Life Technologies, Inc., Basel, Switzerland) supplemented with 0.06% glucose (Fluka Chemie GmbH, Buchs, Switzerland) and 100 U/100 µg/ml penicillin/streptomycin (Seromed, Biochrom KG, Berlin, Germany). After dispersion, cells were plated at a density of 500 live cells/mm2 in 6- or 12-well plates (Corning Costar Corp., Cambridge, MA) containing round coverslips (Assistent, Karl Hecht GmbH & Co. KG, Altnau, Switzerland) coated with 5 µg/ml poly-D-lysine (Sigma, Fluka Chemie GmbH), and grown in commercially available medium (Neurobasal, Gibco BRL, Life Technologies, Inc.) with 0.04% B27 supplement (Gibco) containing 500 µM glutamine and 25 µM glutamate (Sigma, Fluka Chemie GmbH). Forty-eight hours after plating, 2 µM cytosine ß-D-arabinofuranoside (Sigma, Fluka Chemie GmbH) was added to prevent proliferation of nonneuronal cells. Half of the medium was then changed every fourth day, and all experiments were performed in 3- to 4-wk-old cultures. This time point was chosen based on an analysis of peptide expression over time in culture (22).

Perifusion protocols
Perifusion experiments were performed in Krebs-Ringer solution [15 mM HEPES, 111 mM NaCl, 4.7 mM KCl, 2.5 mM CaCl2, 1.2 MgSO4, 24.8 mM NaHCO3, 1.2 mM KH2PO4, and 11.1 mM D-glucose (Merck Suisse SA, Geneva, Switzerland) containing 0.5% human serum albumin (ZLB Bioplasma AG, Bern, Switzerland)] and kept at pH 7.4 by constant gassing with 95% O2-5% CO2 (22). On the day of the perifusion, the coverslips were directly transferred into the perifusion chambers (two coverslips/chamber), a procedure that allows to keep intact the neuronal network formed in vitro. On transfer, the perifusion was immediately started at a flow rate of 350 µl/min, but an equilibration period of at least 1 h was always observed before beginning the experiment. The effluent medium was collected as 4-min fractions throughout the experiment, in tubes (Nalge Nunc International, Life Technologies, Inc.) kept at 4 C and containing 1 µl of 10% Tween 20 (Pierce, Socochim SA, Lausanne, Switzerland). On collection, the samples were immediately frozen until the day of the assay. Samples from an individual perifusion were always measured in the same assay. On the day of the assay, the samples were concentrated 10-fold by centrifugation (AS160 Automatic SpeedVac, Savant, Leybold AG, Köln, Germany), and GnRH could then be measured directly by RIA as described (24). The limit of detection of the assay was 3.9 pg/ml.

The capacity of these neurons to secrete GnRH in perifusion was initially characterized by their responsiveness to two well-described GnRH secretagogues, nicotine and the excitatory amino acid N-methyl-D-aspartate (NMDA), both purchased from Sigma, Fluka Chemie GmbH (25, 26). NMDA was used at a fixed concentration of 25 x 10-3 M, whereas dose-response experiments were performed with nicotine (using concentrations ranging from 5 x 10-4 M to 5 x 10-3 M, Sigma, Fluka Chemie GmbH). Next, the potential effects of insulin (Sigma, Fluka Chemie GmbH) were also evaluated by similar dose-response experiments (using concentrations ranging from 4 x 10-5 M to 8 x 10-4 M). All stimulations lasted 32 min (eight 4-min fractions), and the various concentrations of nicotine or insulin were applied in random order. Finally, similar experiments were performed with IGF-I (purchased from Life Technologies, Inc.), used at two different concentrations (100 ng/ml and 200 ng/ml).

In further in vitro experiments, insulin was always used at a concentration of 4 x 10-4 M, which was the lowest dose eliciting a significant stimulation over baseline in our system. The effects of the glucose content of the medium on the responsiveness of hypothalamic neurons to insulin were then studied. Two consecutive insulin stimulations (4 x 10-4 M) were applied, one in low glucose (0.5 mM) and the other in high glucose (20 mM). Half of the perifusions were performed with the low glucose first, and the other half with the high glucose first. In different experiments designed to evaluate the potential role of glucose per se, its concentration in the perifusion medium was changed acutely (different concentrations ranging from 0.5–20 mM were applied in random order), and basal GnRH secretion was measured in the effluent.

Next, the potential involvement of ATP-dependent potassium (KATP) channels in basal or insulin-stimulated GnRH secretion was evaluated by the study of the effects of the sulfonylurea tolbutamide on GnRH secretion from these perifused hypothalamic neurons. Tolbutamide (Serva, Feinbiochemika, Heidelberg, Germany) was used at the concentration of 2 x 10-4 M (27, 28). Experiments were performed, as follows, in Krebs-Ringer solution containing the usual 11.1 mM glucose: An initial stimulation with tolbutamide alone was applied, followed by two identical insulin stimulations (4 x 10-4 M). The second insulin stimulus was applied in the presence of tolbutamide. This design allowed us to test the effects of tolbutamide on basal GnRH secretion as well as its potential role in modulating the response to insulin.

Finally, the effects of leptin (murine leptin, a generous gift of Mark Heiman, Eli Lilly and Co., Indianapolis, IN) on basal GnRH secretion were studied both chronically and acutely. For the chronic effects, neurons were preincubated, in the presence of leptin, by changing half of the medium for leptin-containing medium, 24 or 48 h before the perifusion experiment (final leptin concentration, 10-6 M). On the same day, half of the medium of different wells of neurons obtained from the same dispersion was also changed, but without the addition of leptin (control neurons). On the day of the experiment, two different perifusions were run in parallel: the test perifusion was performed using neurons that had been exposed to leptin and was run in Krebs buffer containing the same concentration of leptin (10-6 M); the second perifusion (control) was performed in standard Krebs buffer with neurons that had not been exposed to leptin. Basal GnRH secretion was compared between the two different columns. Next, the acute effects of leptin on basal GnRH secretion were studied by stimulating the cells with leptin at two different concentrations (10-7 M and 10-6 M). Because no effect of leptin was observed in these experiments, a potential interaction between leptin and insulin was evaluated. Perifusion experiments were performed as follows: Two identical insulin stimulations (4 x 10-4 M) were applied consecutively, the first one without leptin (control) and the second one in the presence of leptin (either 10-7 M or 10-6 M). The perifusion of leptin was started 32 min (eight fractions) before the insulin stimulus. This design allowed us to evaluate a modulation of the insulin-stimulated GnRH secretion by leptin and also to confirm the absence of any acute effect of leptin alone on basal GnRH secretion.

Expression studies
These studies were performed in static neuronal cultures grown in six-well plates. On the day of the experiment, all the culture medium was gently aspirated from the wells and replaced for DMEM (Life Technologies, Inc.) with 5 mM glucose and containing either insulin (4 x 10-4 M), leptin (10-6 M), or both. Control wells were incubated with DMEM-5 mM glucose only. After 24 h, the medium was aspirated, the cells were harvested, and total RNA was extracted using commercially available reagents (TriPure Reagent, Roche Diagnostics, Rotkreuz, Switzerland). GnRH mRNA content was quantified by real-time RT-PCR as described (29), using the LightCycler technology (Roche Diagnostics, Rotkreuz, Switzerland) with SYBR green detection. Briefly, RT was performed with random primers. For PCR, the sense primer was GAACGTCTGATTGAAGAGGAAG and the antisense primer TACTTTATTATGAAATCTACGCTG. A standard curve was created with serial dilutions of a PCR fragment cloned into pGEM-T (pGEM-T easy Vector sytem I; Promega, Madison, WI), achieving a sensitivity of 10 copies/tube. Different dilutions of the samples were tested in preliminary experiments to ensure that quantification would be performed within the linear part of this standard curve. After this test, all samples were quantified in at least two different runs. The interassay CV was between 6 and 15%, and a third run was performed for samples with an interassay CV more than 10%. For quantification purposes, GnRH mRNA levels were always reported to the levels of ß2-microglobulin, a constitutively expressed gene. Primer pairs used for ß2-microglobulin amplification were the following: sense, TGAGTATGCCTGCCGTGTGA; antisense, GGCATCTTCAAACCTCCATG.

Hyperinsulinemic clamps
Hyperinsulinemic clamp studies were performed, as described (30), in freely moving adult male mice. Briefly, an indwelling catheter was placed into the femoral vein, under anesthesia; sealed under the back skin; and glued onto the top of the skull. Mice were allowed 5–6 d to recover. On the day of the experiment, they were fasted for 6 h before starting the insulin infusion at a rate of 18 mU/kg·min. Control animals were infused with the same volume of normal saline. Blood glucose was continuously measured in samples collected from the tip of the tail vein, using a blood glucose meter. The glycemia was stabilized at either 2.5 mM, 5.5 mM, or 20 mM by adjusting a variable infusion of 16.5% glucose. At the end of a 3-h clamp, animals were rapidly killed by decapitation, and trunk blood was collected for the following measurements: plasma LH levels, measured using antiserum and reagents obtained via the National Institute of Diabetes and Digestive and Kidney Diseases’ National Hormone and Pituitary Program (a generous gift from Dr. A. F. Parlow); plasma glucose concentrations, determined by a glucose oxidase method (Trinder Kit, Sigma Diagnostic, St. Louis, MO); and plasma insulin concentrations, determined by RIAs (Linco Research, Inc., St. Charles, MO).

Data analysis
All results are expressed as mean ± SEM, and a minimum of four independent perifusions, run on different days, were performed for each experiment (see figure legends). Integrated GnRH secretion was estimated by calculating the area under the secretory curve (AUC) over 32 min after stimulation, using the trapezoidal method. For each experiment, basal AUC was calculated over 32 min at the beginning (i.e. before the application of any stimulus) and at the end of the perifusion. A value of 100% was attributed to the mean of these basal values for each separate perifusion; and stimulated AUC values were expressed as percent of this basal level, to correct for the variability existing in the absolute amount of GnRH secreted between experiments.

For in vitro dose-response experiments (with nicotine and insulin), basal and stimulated AUCs were compared by ANOVA. Plasma LH levels in vivo were compared using Student’s t test. The effects of tolbutamide on stimulated GnRH secretion were assessed in two different ways. First, the GnRH values at each time point after the insulin stimulation were compared with the GnRH levels measured at the same time point after insulin+tolbutamide. Second, the AUCs in the presence and in the absence of tolbutamide were compared. These comparisons were performed by Student’s t test.

The effects of leptin on stimulated GnRH secretion were also assessed in several different ways. First, the GnRH values at each time point after the beginning of the insulin stimulation were compared by Student’s t test to the levels measured at the same time points after the insulin+leptin stimulation. Second, the AUCs of GnRH secretion after insulin, in the presence or in the absence of leptin, were compared by ANOVA. Third, the peak GnRH levels achieved after insulin alone were compared by Student’s t test to the peak levels observed after insulin and leptin. And fourth, because we noticed a change in the pattern of GnRH secretion in the presence of leptin, the slope of secretion over the initial 8 min of stimulation was calculated as follows: the difference between GnRH concentrations between 0 and +8 min was calculated, and divided by 8 to provide the average increment in GnRH concentration over 1 min. This can be summarized by the formula: ([GnRH(+8 min)]-[GnRH(0 min)])/8, expressed in pg·ml-1·min-1. The calculated slopes of stimulated GnRH secretion in the absence and in the presence of leptin were then compared by Student’s t test.

For expression studies, the ratio of GnRH over ß2-microglobulin mRNA was calculated for each sample. A value of 100% was then attributed to the control levels for each experiment, so that GnRH mRNA levels of other treatment samples was expressed as a percent of this control. The analysis was performed using these values of relative expression (i.e. relative quantification) and compared by ANOVA.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Effects of nicotine and insulin on GnRH secretion
Figure 1AGo is a representative experiment, illustrating the GnRH secretion elicited by various doses of nicotine applied in the perifusion. The dose dependency of this effect of nicotine is demonstrated by the analysis of the AUCs displayed in Fig. 1BGo; all doses tested were found to increase integrated GnRH secretion, the first concentration that produced a significant stimulation being 10-3 M. Similar secretion profiles were observed with NMDA stimulation (data not shown).



View larger version (15K):
[in this window]
[in a new window]
 
FIG. 1. A, Dose-dependent stimulation of GnRH secretion by nicotine in perifused hypothalamic neurons (representative experiment). Arrows, Stimulations with nicotine, at the concentrations specified. B, Demonstration of the dose dependency of the effect of nicotine on GnRH secretion (n = 4 at each concentration; *, P < 0.05; **, P < 0.01 vs. basal).

 
The potential effects of insulin to stimulate GnRH secretion were first tested in vitro, in similar dose-response experiments as those described above for nicotine. Comparing the AUCs of GnRH secretion after various concentrations of insulin demonstrates that this hormone stimulates GnRH secretion from perifused primary rat hypothalamic neurons in a dose-dependent manner (Fig. 2AGo). Insulin increased GnRH secretion over baseline at all concentrations tested, a significant effect being reached at 4 x 10-4 M (139.2 ± 2.8% of basal, P < 0.05 vs. basal). The highest dose of insulin employed (8 x 10-4 M) was found to increase the AUC to 278.3 ± 32.2% of basal (P < 0.01 vs. basal). Of note, similar experiments performed with IGF-I disclosed no effect on GnRH secretion in this perifusion system (data not shown).



View larger version (21K):
[in this window]
[in a new window]
 
FIG. 2. A, AUC of GnRH secretion from perifused hypothalamic neurons after stimulations with graded concentrations of insulin. This graph demonstrates the dose-dependency of this effect of insulin (n = 5–6 at each concentration; *, P < 0.05; **, P < 0.01 vs. basal). B, Stimulation of GnRH secretion from perifused hypothalamic neurons by insulin (4 x 10-4 M), in the presence of 0.5 mM or 20 mM glucose (representative experiment). The inset graph displays the AUCs of stimulated GnRH secretion in low and high glucose, demonstrating the lack of effect of the glucose content of the medium on the responsiveness of perifused neurons to insulin (n = 4).

 
The minute-to-minute profile of GnRH secretion stimulated by insulin is illustrated by the representative experiment of Fig. 2BGo. GnRH secretion increased rapidly at the start of insulin, reaching a plateau after 16 min, on average. This plateau typically lasted until the end of the insulin stimulus (32 min) and was followed by a quick return to baseline levels afterward. This experiment illustrates the lack of effect of changes in the glucose concentration of the medium on the responsiveness of GnRH secretion to insulin. This is demonstrated by the comparison of the AUCs of stimulated GnRH secretion (Fig. 2BGo, inset graph), which are identical in low and high glucose (AUC = 140 ± 4% of basal at 0.5 mM glucose, and 137.5 ± 4.3% of basal at 20 mM glucose, not significant). This comparison also demonstrates the absence of priming of the neurons by prior insulin stimulation.

The effect of insulin was then further evaluated in vivo. Adult male mice were subjected to hyperinsulinemic clamp studies (with insulin levels ranging from 315–456 µU/ml), whereas their glycemia was maintained either at 2.5 mM, 5.5 mM, or 20 mM. Circulating levels of LH were measured as a surrogate marker of hypothalamic GnRH secretion (31). At the end of a 3-h clamp study, LH was increased by 50–60% in all hyperinsulinemic groups, compared with controls (P < 0.05 for all groups, Fig. 3Go). Of note, changes in glycemia did not influence LH secretion (Fig 3Go).



View larger version (16K):
[in this window]
[in a new window]
 
FIG. 3. Circulating LH levels at the end of hyperinsulinemic clamp studies in adult male mice (means ± SEM; vertical numbers in the columns indicate the glycemia maintained throughout the experiment in the different groups; *, P < 0.05 vs. saline infused controls).

 
In vitro, basal GnRH secretion from hypothalamic neurons was not modulated by increasing (up to 20 mM) or decreasing (down to 0.5 mM) the glucose concentration of the perifusion medium. This lack of effect is illustrated by the representative experiment of Fig. 4AGo. Because KATP channels have been implicated in the coupling of glucose sensing with cell excitability, and also because KATP channels represent the target of sulfonylureas (32), the potential effects of the sulfonylurea tolbutamide on basal as well as stimulated GnRH secretion were also investigated. We found no effect of tolbutamide alone (2 x 10-4 M) on basal GnRH secretion by perifused hypothalamic neurons (Fig. 4BGo). However, the insulin-stimulated secretion was potentiated by this drug, as demonstrated by the significantly higher concentrations of GnRH achieved after insulin and tolbutamide, compared with insulin alone (Fig. 4BGo). This potentiation was also confirmed by comparing the AUCs of stimulated GnRH, which were significantly higher in the presence of tolbutamide (Fig. 4BGo, inset graph).



View larger version (22K):
[in this window]
[in a new window]
 
FIG. 4. A, Lack of effect of acute changes in the glucose concentration on basal GnRH secretion from perifused hypothalamic neurons (representative experiment). B, The sulfonylurea tolbutamide (2 x 10-4 M) has no effect on basal GnRH secretion, but it potentiates the effect of insulin on GnRH secretion (n = 5; **, P < 0.01 vs. GnRH levels at the same time point after insulin alone). The inset graph demonstrates the increase in integrated GnRH secretion induced by tolbutamide (*, P < 0.05 vs. insulin alone).

 
Effects of leptin on GnRH secretion
Leptin alone, applied either acutely or over periods of 24–48 h, did not alter basal GnRH secretion in this system (data not shown). However, when administered immediately before the insulin stimulus, leptin was found to change the pattern of GnRH secretion as well as to potentiate the insulin effect. The data displayed in Fig. 5AGo illustrate the subtle change induced by leptin (10-6 M) in the pattern of GnRH secretion. This change is more evident when the first and the second pulses are superimposed (Fig. 5BGo). This figure demonstrates the significantly increased GnRH levels measured at times 8 and 12 min in the presence of leptin at 10-6 M (GnRH levels, 36.2 ± 1.5 vs. 31.5 ± 09 pg/ml at 8 min and 34.9 ± 1.6 vs. 30.1 ± 1.1 pg/ml at 12 min; P < 0.05 for both). Consequently, the slope of the pulse was significantly steeper in the presence of 10-6 M leptin, being 1.0 ± 0.12 pg/ml·min after insulin vs. 1.57 ± 0.14 pg/ml·min after insulin+leptin (P < 0.05). The potentiation of the insulin effect is demonstrated on Fig. 5CGo, which shows the significant and dose-dependent increase in stimulated AUCs induced by the addition of leptin. This potentiation of the insulin effect by leptin was a very consistent finding, observed in five of five independent experiments with leptin at 10-6 M. It was also specific for insulin, given that nicotine-stimulated GnRH secretion was not affected by leptin in the same system (data not shown).



View larger version (24K):
[in this window]
[in a new window]
 
FIG. 5. A, Insulin (4 x 10-4 M) stimulated GnRH secretion from perifused hypothalamic neurons in the absence or in the presence of leptin (10-6 M; n = 5). B, Same data as above: the superposition of the graphs representing the GnRH response to insulin alone (open circles) or insulin plus leptin (closed circles) demonstrates the difference in the early secretion pattern (*, P < 0.05 vs. GnRH value at the same time point after insulin alone). C, Integrated GnRH secretion in response to either insulin or insulin plus leptin (10-7 M or 10-6 M), demonstrating the dose-dependent potentiation induced by leptin (n = 5; **, P < 0.01 vs. basal; ++, P < 0.01 vs. all others).

 
Gene expression studies
Figure 6Go demonstrates the stimulation by insulin of the expression of GnRH by hypothalamic neurons in static cultures. GnRH mRNA levels were increased to 221.2 ± 33.7% of controls after 24 h of incubation in the presence of insulin (4 x 10-4 M; P < 0.05). The addition of leptin (10-6 M) to insulin further increased GnRH mRNA levels to 301.7 ± 80.5% of controls, a change that was not significantly different from insulin alone.



View larger version (12K):
[in this window]
[in a new window]
 
FIG. 6. GnRH mRNA levels in static neuronal cultures incubated for 24 h in the presence of either insulin alone (4 x 10-4 M), leptin alone (10-6 M), or both (n = 6; *, P < 0.05 vs. control).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Insulin, the peripheral hormone secreted by pancreatic ß-cells, has recently been implicated in metabolic regulations by the central nervous system (5, 6, 7, 20). Here we show, for the first time, that it can directly modulate the activity of hypothalamic neurons, stimulating both GnRH secretion and expression in vitro. In addition, the consistency between these data and our observation that hyperinsulinemia can activate the neuroendocrine gonadotrope axis in intact animals demonstrates that the peripheral administration of insulin can have similar effects on hypothalamic neurons in vivo, suggesting that our results may be relevant to the hormonal regulation of reproduction. Overall, they demonstrate direct insulin sensing by hypothalamic neurons, and provide evidence for a role of insulin in the regulation of the reproductive function by changes in the overall energy balance.

Previous work has already suggested the physiologic importance of insulin in this setting. Streptozotocin-induced diabetes in the rat represents a model of insulin-deficient diabetes mellitus (33). It has been shown that the reproductive abnormalities observed in this model result from impaired LH secretion (11), an observation that is also consistent with human data on women with type 1 diabetes mellitus (10). Very recently, it was demonstrated that central insulin replacement can restore a normal ovulatory LH surge in response to estradiol and progesterone administration to streptozotocin-treated female rats (34). Our results now strongly suggest that this permissive effect of insulin on LH secretion (34), as well as the hypogonadism reported after the central inactivation of the insulin receptor gene (5), result from impaired insulin signaling within the hypothalamus. Given the heterogeneity of our neuronal cultures (22), it is impossible to identify with precision the cell type involved in the insulin response. It could be a direct modulation of GnRH neurons themselves by insulin. This hypothesis is supported by our finding of insulin receptor expression by a novel GnRH neuronal cell line (35) as well as by the GnRH-containing GT1–7 cells (36). However, it could as well represent an effect mediated via other neurons afferent to GnRH-containing cells, such as NPY neurons (37) that are present in our cultures (22). It should also be stressed here that these results were obtained in fetal hypothalamic neurons, which may not be representative of adult neurons. Despite this limitation, our cells are kept in relatively long-term cultures. In addition, their secretion of GnRH in response to nicotine and NMDA suggests that they may acquire the normal responsiveness of mature neurons to physiologic modulation (25, 26).

In contrast to insulin, the activity of hypothalamic neurons involved in modulating net GnRH output was not altered by acute variations in the glucose concentration. This is demonstrated by the in vitro data showing no effect of dramatic changes in the glucose content of the perifusion medium on either basal or insulin-stimulated GnRH secretion. A similar observation was made in vivo: important variations in the glycemia were not found to modify the effect of hyperinsulinemia on LH secretion, thus corroborating perfectly the in vitro results. In this respect, the neurons involved in the stimulatory effect of insulin on GnRH seem different from other hypothalamic neurons more specifically involved into metabolic regulations. Indeed, the latter are generally sensitive to variations in the extracellular glucose concentration (38). However, the lack of effect of acute changes in glucose levels is probably not representative of the potential pathophysiological consequences that chronic hyperglycemia may have on the central nervous system control of reproductive function.

Our findings are consistent with previous data obtained in perifused hypothalamic fragments (39); in that study, the authors also reported a stimulation of GnRH secretion by insulin, independently of the glucose concentration of the medium. In addition, they also reported that basal GnRH secretion was inhibited in the absence of glucose in the perifusion medium. Interestingly, we observed a similar drop of GnRH secretion at 0 mM glucose in our system (data not shown) that we attributed to a nonspecific silencing of GnRH neurons. Indeed, this phenomenon has been well described in many neuronal cell types (28, 40, 41). Therefore, we think that the interpretation of this particular finding is very difficult, and may not necessarily be attributed to glucose sensing by GnRH neurons.

It has been demonstrated that the presence of functional KATP channels is important for correct glucose sensing by glucose-responsive neurons (42). Therefore, we also investigated the effects of the sulfonylurea tolbutamide. We did not observe any change in basal GnRH secretion after exposure to this drug, a finding probably consistent with the lack of glucose responsiveness of the neurons involved in increasing GnRH secretion in our system. However, we also found that blockade of the KATP channels by tolbutamide resulted in a potentiation of the insulin stimulus. These data suggest the existence of a cooperation between the insulin receptor and KATP channels in insulin-sensitive neurons involved in the modulation of GnRH output by the hypothalamus. This observation implies that, notwithstanding their lack of sensitivity to glucose, these neurons can be modulated by variations in their endogenous metabolic status (41), as well as by the extracellular insulin concentration.

In line with previous studies (22), micromolar concentrations of insulin were required to elicit GnRH secretion in vitro. This may be inherent to the neuronal cultures, but it should also be stressed that very little is known about the actual concentrations of peptides achieved in vivo within the central nervous system. The need to use such concentrations could also be compatible with a transmission of the insulin signal via the IGF-I receptor. And indeed, a role of the IGF-I system in the regulation of GnRH secretion has been suggested (43, 44, 45, 46). However, perifusion experiments performed with IGF-I failed to demonstrate any effect on GnRH secretion in our in vitro system. This negative result suggests that the IGF-I receptor is probably not involved in the insulin action described here. Interestingly, it has been hypothesized that IGF-I plays a role early in the development and maturation of the GnRH neuronal system (43). If this is true, then the lack of effect of IGF-I on GnRH secretion in our culture system may indicate that these neurons behave more like adult, well-differentiated neurons. Nevertheless, the present results do not allow us to rule out any involvement of the IGF-I/IGF-I receptor system in the physiologic regulation of the gonadotrope axis.

In contrast to insulin, leptin is a more recently discovered metabolic factor (12) that has been readily implicated in the modulation of reproduction (4, 16). It has been shown to participate in the timing of puberty (17, 18) and in the preservation of reproductive function under poor metabolic conditions (47). These effects of leptin are, at least partially, mediated via an inhibition of hypothalamic neuropeptide Y expression and secretion (22, 47).

Whether leptin can directly activate GnRH neurons remains debated. Some authors have reported a stimulation of GnRH secretion by leptin in various in vitro models (48, 49), a finding consistent with the possible presence of the leptin receptor in GnRH neurons (50). Other studies failed to demonstrate such direct effect (51). At present, these contradictory results seem very difficult to reconcile, and they may represent only technical differences. In our in vitro system, leptin applied alone did not modulate GnRH secretion in various acute and chronic experimental paradigms. This observation confirms a number of in vivo studies that concur to suggest that leptin is a permissive factor for gonadotrope axis activation (4, 16, 52). In this respect, our finding that leptin potentiates the action of insulin on GnRH secretion may be very important. It is consistent with the phenotype of the neuron-specific insulin receptor knockout (NIRKO) mice: in the absence of central insulin signaling, the neuroendocrine gonadotrope axis of these animals remains quiescent despite elevated circulating levels of leptin (5). Therefore, the present data provide a mechanism for the well-recognized action of leptin on reproductive function, suggesting that long-term adaptations of the reproductive axis to metabolic parameters might be dependent on the coordinated insulin and leptin signals.

Interestingly, a detailed analysis of the pattern of GnRH secretion shows that its release in response to insulin is faster in the presence of leptin, suggesting that leptin increases the responsiveness of GnRH neurons to insulin. If this hypothesis were correct, it would be reminiscent of results obtained by others in hippocampal neurons (53). Indeed, electrophysiological studies have shown that leptin alone has no effect on the activity of these neurons, but that it can increase their responsiveness to NMDA stimulation (53).

The demonstration that insulin regulates hypothalamic GnRH secretion allows us to establish the hypothalamus as an important target for the neuroendocrine effects of this hormone. Nevertheless, the exact physiological relevance of this regulation remains an open question. Does insulin play a role in the hour-to-hour regulation of the gonadotrope axis, or is it rather acting as a permissive factor like leptin? If the second hypothesis is correct, then our data suggest that the periodic excursions of circulating insulin concentrations into the range of high values observed after meal ingestion participate in the maintenance of gonadotrope axis activity. In addition, our finding of a potentiation of this action of insulin by leptin provides a mechanism for the integration of metabolic signals by the reproductive axis. This leads to the hypothesis that interactions between the insulin and the leptin signaling pathways might be crucial for the regulation of overall energy balance by specialized hypothalamic neurons. Further work should be aimed at elucidating more precisely the type of neurons involved in the effects described in the present study.


    Acknowledgments
 
The authors thank Michel L. Aubert for his precious comments and suggestions during the revision of the manuscript. The expert technical assistance of Marie-Jeanne Voirol and Marco Giacomini is gratefully acknowledged.


    Footnotes
 
This work was supported by grants from the Swiss National Science Foundation (No. 32-59465.99) (to F.P.P.) and the Novartis Foundation.

Abbreviations: AUC, Area under the curve; KATP, ATP-dependent potassium; NMDA, N-methyl-D-aspartate.

Received April 11, 2003.

Accepted for publication June 27, 2003.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Frisch RE, McArthur JW 1974 Menstrual cycles: fatness as a determinant of minimum weight for height necessary for their maintenance or onset. Science 185:949–951[Abstract/Free Full Text]
  2. Bronson FH 1998 Energy balance and ovulation: small cages versus natural habitats. Reprod Fertil Dev 10:127–137[CrossRef][Medline]
  3. Kiess W, Muller G, Galler A, Reich A, Deutscher J, Klammt J, Kratzsch J 2000 Body fat mass, leptin and puberty. J Pediatr Endocrinol Metab 13(Suppl 1):717–722
  4. Foster DL, Nagatani S 1999 Physiological perspectives on leptin as a regulator of reproduction: role in timing puberty. Biol Reprod 60:205–215[Abstract/Free Full Text]
  5. Bruning JC, Gautam D, Burks DJ, Gillette J, Schubert M, Orban PC, Klein R, Krone W, Muller-Wieland D, Kahn CR 2000 Role of brain insulin receptor in control of body weight and reproduction. Science 289:2122–2125[Abstract/Free Full Text]
  6. Obici S, Feng Z, Karkanias G, Baskin DG, Rossetti L 2002 Decreasing hypothalamic insulin receptors causes hyperphagia and insulin resistance in rats. Nat Neurosci 5:566–572[CrossRef][Medline]
  7. Obici S, Zhang BB, Karkanias G, Rossetti L 2002 Hypothalamic insulin signaling is required for inhibition of glucose production. Nat Med 8:1376–1382[CrossRef][Medline]
  8. Schwartz MW, Woods SC, Porte Jr D, Seeley RJ, Baskin DG 2000 Central nervous system control of food intake. Nature 404:661–671[Medline]
  9. Saad MF, Bernaba B, Hwu CM, Jinagouda S, Fahmi S, Kogosov E, Boyadjian R 2002 Insulin regulates plasma ghrelin concentration. J Clin Endocrinol Metab 87:3997–4000[Abstract/Free Full Text]
  10. Griffin ML, South SA, Yankov VI, Booth Jr RA, Asplin CM, Veldhuis JD, Evans WS 1994 Insulin-dependent diabetes mellitus and menstrual dysfunction. Ann Med 26:331–340[Medline]
  11. Steger RW, Kienast SG, Pillai S, Rabe M 1993 Effects of streptozotocin-induced diabetes on neuroendocrine responses to ovariectomy and estrogen replacement in female rats. Neuroendocrinology 57:525–531[Medline]
  12. Zhang Y, Proenca R, Maffei M, Barone M, Leopold L, Friedman JM 1994 Positional cloning of the mouse obese gene and its human homologue. Nature 372:425–432[CrossRef][Medline]
  13. Farooqi IS, Matarese G, Lord GM, Keogh JM, Lawrence E, Agwu C, Sanna V, Jebb SA, Perna F, Fontana S, Lechler RI, DePaoli AM, O’Rahilly S 2002 Beneficial effects of leptin on obesity, T cell hyporesponsiveness, and neuroendocrine/metabolic dysfunction of human congenital leptin deficiency. J Clin Invest 110:1093–1103[CrossRef][Medline]
  14. Clayton PE, Gill MS, Hall CM, Tillmann V, Whatmore AJ, Price DA 1997 Serum leptin through childhood and adolescence. Clin Endocrinol (Oxf) 46:727–733[CrossRef][Medline]
  15. Cheung CC, Thornton JE, Kuijper JL, Weigle DS, Clifton DK, Steiner RA 1997 Leptin is a metabolic gate for the onset of puberty in the female rat. Endocrinology 138:855–858[Abstract/Free Full Text]
  16. Cunningham MJ, Clifton DK, Steiner RA 1999 Leptin’s actions on the reproductive axis: perspectives and mechanisms. Biol Reprod 60:216–222[Abstract/Free Full Text]
  17. Chehab FF, Mounzih K, Lu R, Lim ME 1997 Early onset of reproductive function in normal female mice treated with leptin. Science 275:88–90[Abstract/Free Full Text]
  18. Ahima RS, Dushay J, Flier SN, Prabakaran D, Flier JS 1997 Leptin accelerates the onset of puberty in normal female mice. J Clin Invest 99:391–395[Medline]
  19. Pralong FP, Gonzales C, Voirol MJ, Palmiter RD, Brunner HR, Gaillard RC, Seydoux J, Pedrazzini T 2002 The neuropeptide Y Y1 receptor regulates leptin-mediated control of energy homeostasis and reproductive functions. FASEB J 16:712–714[Free Full Text]
  20. Schwartz MW 2000 Biomedicine. Staying slim with insulin in mind. Science 289:2066–2067[Free Full Text]
  21. Marshall JC, Kelch RP 1986 Gonadotropin-releasing hormone: role of pulsatile secretion in the regulation of reproduction. N Engl J Med 315:1459–1468[Medline]
  22. Bergonzelli GE, Pralong FP, Glauser M, Cavadas C, Grouzmann E, Gaillard RC 2001 Interplay between galanin and leptin in the hypothalamic control of feeding via corticotropin-releasing hormone and neuropeptide Y. Diabetes 50:2666–2672[Abstract/Free Full Text]
  23. Merchenthaler I, Setalo G, Csontos C, Petrusz P, Flerko B, Negro-Vilar A 1989 Combined retrograde tracing and immunocytochemical identification of luteinizing hormone-releasing hormone- and somatostatin-containing neurons projecting to the median eminence of the rat. Endocrinology 125:2812–2821[Abstract/Free Full Text]
  24. Boujon CE, Bestetti GE, Reymond MJ, Rossi GL 1987 A model for combined morphological and functional investigations on the isolated mediobasal rat hypothalamus. Neuroendocrinology 45:311–317[Medline]
  25. Andersson K, Eneroth P, Fuxe K, Harfstrand A 1986 Nicotine-induced increases in brain luteinizing hormone releasing hormone-like immunoreactivity and in serum luteinizing hormone levels of the male rat. Neurosci Lett 71:289–292[CrossRef][Medline]
  26. Bourguignon JP, Gerard A, Alvarez Gonzalez ML, Franchimont P 1993 Control of pulsatile secretion of gonadotrophin releasing hormone from hypothalamic explants. Hum Reprod 8(Suppl 2):18–22
  27. Shanley LJ, Irving AJ, Rae MG, Ashford ML, Harvey J 2002 Leptin inhibits rat hippocampal neurons via activation of large conductance calcium-activated K+ channels. Nat Neurosci 5:299–300[CrossRef][Medline]
  28. Yang XJ, Kow LM, Funabashi T, Mobbs CV 1999 Hypothalamic glucose sensor: similarities to and differences from pancreatic ß-cell mechanisms. Diabetes 48:1763–1772[Abstract]
  29. Giusti V, Verdumo C, Suter M, Gaillard RC, Burckhardt P, Pralong FP 2003 Expression of ppar{gamma}1 and ppar{gamma}2 in visceral and subcutaneous adipose tissue of obese women. Diabetes 52:1673–1676[Abstract/Free Full Text]
  30. Burcelin R, Crivelli V, Dacosta A, Roy-Tirelli A, Thorens B 2002 Heterogeneous metabolic adaptation of C57BL/6J mice to high-fat diet. Am J Physiol Endocrinol Metab 282:E834–E842
  31. Clarke IJ, Cummins JT 1985 GnRH pulse frequency determines LH pulse amplitude by altering the amount of releasable LH in the pituitary glands of ewes. J Reprod Fertil 73:425–431
  32. Seino S, Iwanaga T, Nagashima K, Miki T 2000 Diverse roles of K(ATP) channels learned from Kir6.2 genetically engineered mice. Diabetes 49:311–318[Abstract]
  33. Bell Jr RH, Hye RJ 1983 Animal models of diabetes mellitus: physiology and pathology. J Surg Res 35:433–460[CrossRef][Medline]
  34. Kovacs P, Parlow AF, Karkanias GB 2002 Effect of centrally administered insulin on gonadotropin-releasing hormone neuron activity and luteinizing hormone surge in the diabetic female rat. Neuroendocrinology 76:357–365[CrossRef][Medline]
  35. Castillo E, Gaillard RC, Pralong FP GnRH neurons immortalized conditionally: OB-Rb expression may suggest a direct modulation of GnRH secretion by leptin. Program of the 84th Annual Meeting of The Endocrine Society, San Francisco, CA, 2002 (Abstract OR45-2)
  36. Olson BR, Scott DC, Wetsel WC, Elliot SJ, Tomic M, Stojilkovic S, Nieman LK, Wray S 1995 Effects of insulin-like growth factors I and II and insulin on the immortalized hypothalamic GTI-7 cell line. Neuroendocrinology 62:155–165[CrossRef][Medline]
  37. McKibbin PE, McCarthy HD, Shaw P, Williams G 1992 Insulin deficiency is a specific stimulus to hypothalamic neuropeptide Y: a comparison of the effects of insulin replacement and food restriction in streptozocin-diabetic rats. Peptides 13:721–727[CrossRef][Medline]
  38. Levin BE, Dunn-Meynell AA, Routh VH 1999 Brain glucose sensing and body energy homeostasis: role in obesity and diabetes. Am J Physiol 276:R1223–R1231
  39. Arias P, Rodriguez M, Szwarcfarb B, Sinay IR, Moguilevsky JA 1992 Effect of insulin on LHRH release by perifused hypothalamic fragments. Neuroendocrinology 56:415–418[Medline]
  40. Silver IA, Erecinska M 1994 Extracellular glucose concentration in mammalian brain: continuous monitoring of changes during increased neuronal activity and upon limitation in oxygen supply in normo-, hypo-, and hyperglycemic animals. J Neurosci 14:5068–5076[Abstract]
  41. Mobbs CV, Kow LM, Yang XJ 2001 Brain glucose-sensing mechanisms: ubiquitous silencing by aglycemia vs. hypothalamic neuroendocrine responses. Am J Physiol Endocrinol Metab 281:E649–E654
  42. Miki T, Liss B, Minami K, Shiuchi T, Saraya A, Kashima Y, Horiuchi M, Ashcroft F, Minokoshi Y, Roeper J, Seino S 2001 ATP-sensitive K+ channels in the hypothalamus are essential for the maintenance of glucose homeostasis. Nat Neurosci 4:507–512[Medline]
  43. Longo KM, Sun Y, Gore AC 1998 Insulin-like growth factor-I effects on gonadotropin-releasing hormone biosynthesis in GT1–7 cells. Endocrinology 139:1125–1132[Abstract/Free Full Text]
  44. Anderson RA, Zwain IH, Arroyo A, Mellon PL, Yen SS 1999 The insulin-like growth factor system in the GT1–7 GnRH neuronal cell line. Neuroendocrinology 70:353–359[CrossRef][Medline]
  45. Hiney JK, Ojeda SR, Dees WL 1991 Insulin-like growth factor I: a possible metabolic signal involved in the regulation of female puberty. Neuroendocrinology 54:420–423[Medline]
  46. Hiney JK, Srivastava V, Nyberg CL, Ojeda SR, Dees WL 1996 Insulin-like growth factor I of peripheral origin acts centrally to accelerate the initiation of female puberty. Endocrinology 137:3717–3728[Abstract]
  47. Ahima RS, Prabakaran D, Mantzoros C, Qu D, Lowell B, Maratos-Flier E, Flier JS 1996 Role of leptin in the neuroendocrine response to fasting. Nature 382:250–252[CrossRef][Medline]
  48. Woller M, Tessmer S, Neff D, Nguema AA, Roo BV, Waechter-Brulla D 2001 Leptin stimulates gonadotropin releasing hormone release from cultured intact hemihypothalami and enzymatically dispersed neurons. Exp Biol Med 226:591–596[Abstract/Free Full Text]
  49. Parent AS, Lebrethon MC, Gerard A, Vandersmissen E, Bourguignon JP 2000 Leptin effects on pulsatile gonadotropin releasing hormone secretion from the adult rat hypothalamus and interaction with cocaine and amphetamine regulated transcript peptide and neuropeptide Y. Regul Pept 92:17–24[CrossRef][Medline]
  50. Magni P, Vettor R, Pagano C, Calcagno A, Beretta E, Messi E, Zanisi M, Martini L, Motta M 1999 Expression of a leptin receptor in immortalized gonadotropin-releasing hormone-secreting neurons. Endocrinology 140:1581–1585[Abstract/Free Full Text]
  51. Yu WH, Kimura M, Walczewska A, Karanth S, McCann SM 1997 Role of leptin in hypothalamic-pituitary function. Proc Natl Acad Sci USA 94:1023–1028[Abstract/Free Full Text]
  52. Mann DR, Plant TM 2002 Leptin and pubertal development. Semin Reprod Med 20:93–102[CrossRef][Medline]
  53. Shanley LJ, Irving AJ, Harvey J 2001 Leptin enhances NMDA receptor function and modulates hippocampal synaptic plasticity. J Neurosci 21:RC186



This article has been cited by other articles:


Home page
DiabetesHome page
T. J. Nicolson, E. A. Bellomo, N. Wijesekara, M. K. Loder, J. M. Baldwin, A. V. Gyulkhandanyan, V. Koshkin, A. I. Tarasov, R. Carzaniga, K. Kronenberger, et al.
Insulin Storage and Glucose Homeostasis in Mice Null for the Granule Zinc Transporter ZnT8 and Studies of the Type 2 Diabetes-Associated Variants
Diabetes, September 1, 2009; 58(9): 2070 - 2083.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
R. L. Leshan, G. W. Louis, Y.-H. Jo, C. J. Rhodes, H. Munzberg, and M. G. Myers Jr
Direct Innervation of GnRH Neurons by Metabolic- and Sexual Odorant-Sensing Leptin Receptor Neurons in the Hypothalamic Ventral Premammillary Nucleus
J. Neurosci., March 11, 2009; 29(10): 3138 - 3147.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
W. Huang, M. Acosta-Martinez, T. H. Horton, and J. E. Levine
Fasting-induced suppression of LH secretion does not require activation of ATP-sensitive potassium channels
Am J Physiol Endocrinol Metab, December 1, 2008; 295(6): E1439 - E1446.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
M. Christ-Crain, B. Kola, F. Lolli, C. Fekete, D. Seboek, G. Wittmann, D. Feltrin, S. C. Igreja, S. Ajodha, J. Harvey-White, et al.
AMP-activated protein kinase mediates glucocorticoid-induced metabolic changes: a novel mechanism in Cushing's syndrome
FASEB J, June 1, 2008; 22(6): 1672 - 1683.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
J. W. Hill, J. K. Elmquist, and C. F. Elias
Hypothalamic pathways linking energy balance and reproduction
Am J Physiol Endocrinol Metab, May 1, 2008; 294(5): E827 - E832.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A.-S. Carlo, M. Pyrski, C. Loudes, A. Faivre-Baumann, J. Epelbaum, L. M. Williams, and W. Meyerhof
Leptin Sensitivity in the Developing Rat Hypothalamus
Endocrinology, December 1, 2007; 148(12): 6073 - 6082.
[Abstract] [Full Text] [PDF]


Home page
Eur J EndocrinolHome page
T. Rohrer, E. Stierkorb, S. Heger, B. Karges, K. Raile, K O. Schwab, R. W Holl, and on behalf of the Diabetes-Patienten-Verlaufsdaten
Delayed pubertal onset and development in German children and adolescents with type 1 diabetes: cross-sectional analysis of recent data from the DPV diabetes documentation and quality management system
Eur. J. Endocrinol., November 1, 2007; 157(5): 647 - 653.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
I. Neganova, H. Al-Qassab, H. Heffron, C. Selman, A. I. Choudhury, S. J. Lingard, I. Diakonov, M. Patterson, M. Ghatei, S. R. Bloom, et al.
Role of Central Nervous System and Ovarian Insulin Receptor Substrate 2 Signaling in Female Reproductive Function in the Mouse
Biol Reprod, June 1, 2007; 76(6): 1045 - 1053.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
C. Chau-Van, M. Gamba, R. Salvi, R. C. Gaillard, and F. P. Pralong
Metformin Inhibits Adenosine 5'-Monophosphate-Activated Kinase Activation and Prevents Increases in Neuropeptide Y Expression in Cultured Hypothalamic Neurons
Endocrinology, February 1, 2007; 148(2): 507 - 511.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
M. I. Hernandez, A. Martinez, T. Capurro, V. Pena, L. Trejo, A. Avila, T. Salazar, S. Asenjo, G. Iniguez, and V. Mericq
Comparison of Clinical, Ultrasonographic, and Biochemical Differences at the Beginning of Puberty in Healthy Girls Born Either Small for Gestational Age or Appropriate for Gestational Age: Preliminary Results
J. Clin. Endocrinol. Metab., September 1, 2006; 91(9): 3377 - 3381.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
Y. L. Pagan, S. S. Srouji, Y. Jimenez, A. Emerson, S. Gill, and J. E. Hall
Inverse Relationship between Luteinizing Hormone and Body Mass Index in Polycystic Ovarian Syndrome: Investigation of Hypothalamic and Pituitary Contributions
J. Clin. Endocrinol. Metab., April 1, 2006; 91(4): 1309 - 1316.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
J. Udagawa, R. Hashimoto, H. Suzuki, T. Hatta, Y. Sotomaru, K. Hioki, Y. Kagohashi, T. Nomura, Y. Minami, and H. Otani
The Role of Leptin in the Development of the Cerebral Cortex in Mouse Embryos
Endocrinology, February 1, 2006; 147(2): 647 - 658.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
R. Salvi, E. Castillo, M.-J. Voirol, M. Glauser, J.-P. Rey, R. C. Gaillard, P. Vollenweider, and F. P. Pralong
Gonadotropin-Releasing Hormone-Expressing Neurons Immortalized Conditionally Are Activated by Insulin: Implication of the Mitogen-Activated Protein Kinase Pathway
Endocrinology, February 1, 2006; 147(2): 816 - 826.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
P. Igaz, R. Salvi, J.-P. Rey, M. Glauser, F. P. Pralong, and R. C. Gaillard
Effects of Cytokines on Gonadotropin-Releasing Hormone (GnRH) Gene Expression in Primary Hypothalamic Neurons and in GnRH Neurons Immortalized Conditionally
Endocrinology, February 1, 2006; 147(2): 1037 - 1043.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
N. Pitteloud, M. Hardin, A. A. Dwyer, E. Valassi, M. Yialamas, D. Elahi, and F. J. Hayes
Increasing Insulin Resistance Is Associated with a Decrease in Leydig Cell Testosterone Secretion in Men
J. Clin. Endocrinol. Metab., May 1, 2005; 90(5): 2636 - 2641.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
V. M. Navarro, J. M. Castellano, R. Fernandez-Fernandez, S. Tovar, J. Roa, A. Mayen, R. Nogueiras, M. J. Vazquez, M. L. Barreiro, P. Magni, et al.
Characterization of the Potent Luteinizing Hormone-Releasing Activity of KiSS-1 Peptide, the Natural Ligand of GPR54
Endocrinology, January 1, 2005; 146(1): 156 - 163.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
V. M. Navarro, J. M. Castellano, R. Fernandez-Fernandez, M. L. Barreiro, J. Roa, J. E. Sanchez-Criado, E. Aguilar, C. Dieguez, L. Pinilla, and M. Tena-Sempere
Developmental and Hormonally Regulated Messenger Ribonucleic Acid Expression of KiSS-1 and Its Putative Receptor, GPR54, in Rat Hypothalamus and Potent Luteinizing Hormone-Releasing Activity of KiSS-1 Peptide
Endocrinology, October 1, 2004; 145(10): 4565 - 4574.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Burcelin, R.
Right arrow Articles by Pralong, F. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Burcelin, R.
Right arrow Articles by Pralong, F. P.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals