| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Institute of Pharmacology and Toxicology (R.B., B.T.), Lausanne Medical School, and Division of Endocrinology and Diabetology (M.G., R.C.G., F.P.P.), University Hospital, 1011 Lausanne, Switzerland
Address all correspondence and requests for reprints to: François Pralong, Division of Endocrinology, BH 19-709, CHUV, 1011 Lausanne, Switzerland. E-mail: francois.pralong{at}chuv.hospvd.ch.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Insulin and leptin are metabolic factors, circulating in the periphery, that participate in the hypothalamic control of metabolism and reproduction. It is now well established that, in addition to its role in glucose homeostasis, insulin participates in the long-term signaling of satiety to the hypothalamus (5, 6, 7, 8, 9). Moreover, it was recently demonstrated that normal insulin signaling within the central nervous system is essential for the correct activation of the gonadotrope axis in rodents (5). This is illustrated by the phenotype of mice with central insensitivity to insulin after the neuron-specific inactivation of the insulin receptor; these animals exhibit hyperphagic obesity, and they also suffer from hypogonadotropic hypogonadism (5). The potential importance of insulin in this setting is further underlined by the observation that insulin-dependent diabetes mellitus is accompanied by reproductive abnormalities resulting from impaired LH secretion in both human and animal models (10, 11).
Similarly, leptin (12) signals the body needs in energy to the central nervous system and is one of the factors implicated in the development of puberty in humans and various rodent models (13, 14, 15, 16, 17, 18, 19). Therefore, and because both insulin and leptin are transported across the blood brain barrier (20), we hypothesized that these two factors might interact within the hypothalamus to modulate the secretion of GnRH, the critical hormone ensuring normal reproductive function (21).
The aim of the present studies was to better define the respective roles and potential interactions of insulin and leptin in the control of the neuroendocrine gonadotrope axis. Therefore, we investigated the regulation of GnRH secretion by these two hormones in vitro in primary cultures of hypothalamic neurons as well as in vivo in adult male mice. We found that GnRH secretion from cultured hypothalamic neurons was stimulated directly and dose-dependently by insulin, demonstrating direct insulin sensing by hypothalamic neurons. In contrast, leptin alone had no effect in this in vitro system but was found to potentiate the insulin stimulation. The relevance of these observations for the regulation of reproductive function is suggested by our finding of a stimulation of the neuroendocrine gonadotrope axis of adult mice at the end of hyperinsulinemic clamp studies performed in vivo.
| Materials and Methods |
|---|
|
|
|---|
Perifusion protocols
Perifusion experiments were performed in Krebs-Ringer solution [15 mM HEPES, 111 mM NaCl, 4.7 mM KCl, 2.5 mM CaCl2, 1.2 MgSO4, 24.8 mM NaHCO3, 1.2 mM KH2PO4, and 11.1 mM D-glucose (Merck Suisse SA, Geneva, Switzerland) containing 0.5% human serum albumin (ZLB Bioplasma AG, Bern, Switzerland)] and kept at pH 7.4 by constant gassing with 95% O2-5% CO2 (22). On the day of the perifusion, the coverslips were directly transferred into the perifusion chambers (two coverslips/chamber), a procedure that allows to keep intact the neuronal network formed in vitro. On transfer, the perifusion was immediately started at a flow rate of 350 µl/min, but an equilibration period of at least 1 h was always observed before beginning the experiment. The effluent medium was collected as 4-min fractions throughout the experiment, in tubes (Nalge Nunc International, Life Technologies, Inc.) kept at 4 C and containing 1 µl of 10% Tween 20 (Pierce, Socochim SA, Lausanne, Switzerland). On collection, the samples were immediately frozen until the day of the assay. Samples from an individual perifusion were always measured in the same assay. On the day of the assay, the samples were concentrated 10-fold by centrifugation (AS160 Automatic SpeedVac, Savant, Leybold AG, Köln, Germany), and GnRH could then be measured directly by RIA as described (24). The limit of detection of the assay was 3.9 pg/ml.
The capacity of these neurons to secrete GnRH in perifusion was initially characterized by their responsiveness to two well-described GnRH secretagogues, nicotine and the excitatory amino acid N-methyl-D-aspartate (NMDA), both purchased from Sigma, Fluka Chemie GmbH (25, 26). NMDA was used at a fixed concentration of 25 x 10-3 M, whereas dose-response experiments were performed with nicotine (using concentrations ranging from 5 x 10-4 M to 5 x 10-3 M, Sigma, Fluka Chemie GmbH). Next, the potential effects of insulin (Sigma, Fluka Chemie GmbH) were also evaluated by similar dose-response experiments (using concentrations ranging from 4 x 10-5 M to 8 x 10-4 M). All stimulations lasted 32 min (eight 4-min fractions), and the various concentrations of nicotine or insulin were applied in random order. Finally, similar experiments were performed with IGF-I (purchased from Life Technologies, Inc.), used at two different concentrations (100 ng/ml and 200 ng/ml).
In further in vitro experiments, insulin was always used at a concentration of 4 x 10-4 M, which was the lowest dose eliciting a significant stimulation over baseline in our system. The effects of the glucose content of the medium on the responsiveness of hypothalamic neurons to insulin were then studied. Two consecutive insulin stimulations (4 x 10-4 M) were applied, one in low glucose (0.5 mM) and the other in high glucose (20 mM). Half of the perifusions were performed with the low glucose first, and the other half with the high glucose first. In different experiments designed to evaluate the potential role of glucose per se, its concentration in the perifusion medium was changed acutely (different concentrations ranging from 0.520 mM were applied in random order), and basal GnRH secretion was measured in the effluent.
Next, the potential involvement of ATP-dependent potassium (KATP) channels in basal or insulin-stimulated GnRH secretion was evaluated by the study of the effects of the sulfonylurea tolbutamide on GnRH secretion from these perifused hypothalamic neurons. Tolbutamide (Serva, Feinbiochemika, Heidelberg, Germany) was used at the concentration of 2 x 10-4 M (27, 28). Experiments were performed, as follows, in Krebs-Ringer solution containing the usual 11.1 mM glucose: An initial stimulation with tolbutamide alone was applied, followed by two identical insulin stimulations (4 x 10-4 M). The second insulin stimulus was applied in the presence of tolbutamide. This design allowed us to test the effects of tolbutamide on basal GnRH secretion as well as its potential role in modulating the response to insulin.
Finally, the effects of leptin (murine leptin, a generous gift of Mark Heiman, Eli Lilly and Co., Indianapolis, IN) on basal GnRH secretion were studied both chronically and acutely. For the chronic effects, neurons were preincubated, in the presence of leptin, by changing half of the medium for leptin-containing medium, 24 or 48 h before the perifusion experiment (final leptin concentration, 10-6 M). On the same day, half of the medium of different wells of neurons obtained from the same dispersion was also changed, but without the addition of leptin (control neurons). On the day of the experiment, two different perifusions were run in parallel: the test perifusion was performed using neurons that had been exposed to leptin and was run in Krebs buffer containing the same concentration of leptin (10-6 M); the second perifusion (control) was performed in standard Krebs buffer with neurons that had not been exposed to leptin. Basal GnRH secretion was compared between the two different columns. Next, the acute effects of leptin on basal GnRH secretion were studied by stimulating the cells with leptin at two different concentrations (10-7 M and 10-6 M). Because no effect of leptin was observed in these experiments, a potential interaction between leptin and insulin was evaluated. Perifusion experiments were performed as follows: Two identical insulin stimulations (4 x 10-4 M) were applied consecutively, the first one without leptin (control) and the second one in the presence of leptin (either 10-7 M or 10-6 M). The perifusion of leptin was started 32 min (eight fractions) before the insulin stimulus. This design allowed us to evaluate a modulation of the insulin-stimulated GnRH secretion by leptin and also to confirm the absence of any acute effect of leptin alone on basal GnRH secretion.
Expression studies
These studies were performed in static neuronal cultures grown in six-well plates. On the day of the experiment, all the culture medium was gently aspirated from the wells and replaced for DMEM (Life Technologies, Inc.) with 5 mM glucose and containing either insulin (4 x 10-4 M), leptin (10-6 M), or both. Control wells were incubated with DMEM-5 mM glucose only. After 24 h, the medium was aspirated, the cells were harvested, and total RNA was extracted using commercially available reagents (TriPure Reagent, Roche Diagnostics, Rotkreuz, Switzerland). GnRH mRNA content was quantified by real-time RT-PCR as described (29), using the LightCycler technology (Roche Diagnostics, Rotkreuz, Switzerland) with SYBR green detection. Briefly, RT was performed with random primers. For PCR, the sense primer was GAACGTCTGATTGAAGAGGAAG and the antisense primer TACTTTATTATGAAATCTACGCTG. A standard curve was created with serial dilutions of a PCR fragment cloned into pGEM-T (pGEM-T easy Vector sytem I; Promega, Madison, WI), achieving a sensitivity of 10 copies/tube. Different dilutions of the samples were tested in preliminary experiments to ensure that quantification would be performed within the linear part of this standard curve. After this test, all samples were quantified in at least two different runs. The interassay CV was between 6 and 15%, and a third run was performed for samples with an interassay CV more than 10%. For quantification purposes, GnRH mRNA levels were always reported to the levels of ß2-microglobulin, a constitutively expressed gene. Primer pairs used for ß2-microglobulin amplification were the following: sense, TGAGTATGCCTGCCGTGTGA; antisense, GGCATCTTCAAACCTCCATG.
Hyperinsulinemic clamps
Hyperinsulinemic clamp studies were performed, as described (30), in freely moving adult male mice. Briefly, an indwelling catheter was placed into the femoral vein, under anesthesia; sealed under the back skin; and glued onto the top of the skull. Mice were allowed 56 d to recover. On the day of the experiment, they were fasted for 6 h before starting the insulin infusion at a rate of 18 mU/kg·min. Control animals were infused with the same volume of normal saline. Blood glucose was continuously measured in samples collected from the tip of the tail vein, using a blood glucose meter. The glycemia was stabilized at either 2.5 mM, 5.5 mM, or 20 mM by adjusting a variable infusion of 16.5% glucose. At the end of a 3-h clamp, animals were rapidly killed by decapitation, and trunk blood was collected for the following measurements: plasma LH levels, measured using antiserum and reagents obtained via the National Institute of Diabetes and Digestive and Kidney Diseases National Hormone and Pituitary Program (a generous gift from Dr. A. F. Parlow); plasma glucose concentrations, determined by a glucose oxidase method (Trinder Kit, Sigma Diagnostic, St. Louis, MO); and plasma insulin concentrations, determined by RIAs (Linco Research, Inc., St. Charles, MO).
Data analysis
All results are expressed as mean ± SEM, and a minimum of four independent perifusions, run on different days, were performed for each experiment (see figure legends). Integrated GnRH secretion was estimated by calculating the area under the secretory curve (AUC) over 32 min after stimulation, using the trapezoidal method. For each experiment, basal AUC was calculated over 32 min at the beginning (i.e. before the application of any stimulus) and at the end of the perifusion. A value of 100% was attributed to the mean of these basal values for each separate perifusion; and stimulated AUC values were expressed as percent of this basal level, to correct for the variability existing in the absolute amount of GnRH secreted between experiments.
For in vitro dose-response experiments (with nicotine and insulin), basal and stimulated AUCs were compared by ANOVA. Plasma LH levels in vivo were compared using Students t test. The effects of tolbutamide on stimulated GnRH secretion were assessed in two different ways. First, the GnRH values at each time point after the insulin stimulation were compared with the GnRH levels measured at the same time point after insulin+tolbutamide. Second, the AUCs in the presence and in the absence of tolbutamide were compared. These comparisons were performed by Students t test.
The effects of leptin on stimulated GnRH secretion were also assessed in several different ways. First, the GnRH values at each time point after the beginning of the insulin stimulation were compared by Students t test to the levels measured at the same time points after the insulin+leptin stimulation. Second, the AUCs of GnRH secretion after insulin, in the presence or in the absence of leptin, were compared by ANOVA. Third, the peak GnRH levels achieved after insulin alone were compared by Students t test to the peak levels observed after insulin and leptin. And fourth, because we noticed a change in the pattern of GnRH secretion in the presence of leptin, the slope of secretion over the initial 8 min of stimulation was calculated as follows: the difference between GnRH concentrations between 0 and +8 min was calculated, and divided by 8 to provide the average increment in GnRH concentration over 1 min. This can be summarized by the formula: ([GnRH(+8 min)]-[GnRH(0 min)])/8, expressed in pg·ml-1·min-1. The calculated slopes of stimulated GnRH secretion in the absence and in the presence of leptin were then compared by Students t test.
For expression studies, the ratio of GnRH over ß2-microglobulin mRNA was calculated for each sample. A value of 100% was then attributed to the control levels for each experiment, so that GnRH mRNA levels of other treatment samples was expressed as a percent of this control. The analysis was performed using these values of relative expression (i.e. relative quantification) and compared by ANOVA.
| Results |
|---|
|
|
|---|
|
|
The effect of insulin was then further evaluated in vivo. Adult male mice were subjected to hyperinsulinemic clamp studies (with insulin levels ranging from 315456 µU/ml), whereas their glycemia was maintained either at 2.5 mM, 5.5 mM, or 20 mM. Circulating levels of LH were measured as a surrogate marker of hypothalamic GnRH secretion (31). At the end of a 3-h clamp study, LH was increased by 5060% in all hyperinsulinemic groups, compared with controls (P < 0.05 for all groups, Fig. 3
). Of note, changes in glycemia did not influence LH secretion (Fig 3
).
|
|
|
|
| Discussion |
|---|
|
|
|---|
Previous work has already suggested the physiologic importance of insulin in this setting. Streptozotocin-induced diabetes in the rat represents a model of insulin-deficient diabetes mellitus (33). It has been shown that the reproductive abnormalities observed in this model result from impaired LH secretion (11), an observation that is also consistent with human data on women with type 1 diabetes mellitus (10). Very recently, it was demonstrated that central insulin replacement can restore a normal ovulatory LH surge in response to estradiol and progesterone administration to streptozotocin-treated female rats (34). Our results now strongly suggest that this permissive effect of insulin on LH secretion (34), as well as the hypogonadism reported after the central inactivation of the insulin receptor gene (5), result from impaired insulin signaling within the hypothalamus. Given the heterogeneity of our neuronal cultures (22), it is impossible to identify with precision the cell type involved in the insulin response. It could be a direct modulation of GnRH neurons themselves by insulin. This hypothesis is supported by our finding of insulin receptor expression by a novel GnRH neuronal cell line (35) as well as by the GnRH-containing GT17 cells (36). However, it could as well represent an effect mediated via other neurons afferent to GnRH-containing cells, such as NPY neurons (37) that are present in our cultures (22). It should also be stressed here that these results were obtained in fetal hypothalamic neurons, which may not be representative of adult neurons. Despite this limitation, our cells are kept in relatively long-term cultures. In addition, their secretion of GnRH in response to nicotine and NMDA suggests that they may acquire the normal responsiveness of mature neurons to physiologic modulation (25, 26).
In contrast to insulin, the activity of hypothalamic neurons involved in modulating net GnRH output was not altered by acute variations in the glucose concentration. This is demonstrated by the in vitro data showing no effect of dramatic changes in the glucose content of the perifusion medium on either basal or insulin-stimulated GnRH secretion. A similar observation was made in vivo: important variations in the glycemia were not found to modify the effect of hyperinsulinemia on LH secretion, thus corroborating perfectly the in vitro results. In this respect, the neurons involved in the stimulatory effect of insulin on GnRH seem different from other hypothalamic neurons more specifically involved into metabolic regulations. Indeed, the latter are generally sensitive to variations in the extracellular glucose concentration (38). However, the lack of effect of acute changes in glucose levels is probably not representative of the potential pathophysiological consequences that chronic hyperglycemia may have on the central nervous system control of reproductive function.
Our findings are consistent with previous data obtained in perifused hypothalamic fragments (39); in that study, the authors also reported a stimulation of GnRH secretion by insulin, independently of the glucose concentration of the medium. In addition, they also reported that basal GnRH secretion was inhibited in the absence of glucose in the perifusion medium. Interestingly, we observed a similar drop of GnRH secretion at 0 mM glucose in our system (data not shown) that we attributed to a nonspecific silencing of GnRH neurons. Indeed, this phenomenon has been well described in many neuronal cell types (28, 40, 41). Therefore, we think that the interpretation of this particular finding is very difficult, and may not necessarily be attributed to glucose sensing by GnRH neurons.
It has been demonstrated that the presence of functional KATP channels is important for correct glucose sensing by glucose-responsive neurons (42). Therefore, we also investigated the effects of the sulfonylurea tolbutamide. We did not observe any change in basal GnRH secretion after exposure to this drug, a finding probably consistent with the lack of glucose responsiveness of the neurons involved in increasing GnRH secretion in our system. However, we also found that blockade of the KATP channels by tolbutamide resulted in a potentiation of the insulin stimulus. These data suggest the existence of a cooperation between the insulin receptor and KATP channels in insulin-sensitive neurons involved in the modulation of GnRH output by the hypothalamus. This observation implies that, notwithstanding their lack of sensitivity to glucose, these neurons can be modulated by variations in their endogenous metabolic status (41), as well as by the extracellular insulin concentration.
In line with previous studies (22), micromolar concentrations of insulin were required to elicit GnRH secretion in vitro. This may be inherent to the neuronal cultures, but it should also be stressed that very little is known about the actual concentrations of peptides achieved in vivo within the central nervous system. The need to use such concentrations could also be compatible with a transmission of the insulin signal via the IGF-I receptor. And indeed, a role of the IGF-I system in the regulation of GnRH secretion has been suggested (43, 44, 45, 46). However, perifusion experiments performed with IGF-I failed to demonstrate any effect on GnRH secretion in our in vitro system. This negative result suggests that the IGF-I receptor is probably not involved in the insulin action described here. Interestingly, it has been hypothesized that IGF-I plays a role early in the development and maturation of the GnRH neuronal system (43). If this is true, then the lack of effect of IGF-I on GnRH secretion in our culture system may indicate that these neurons behave more like adult, well-differentiated neurons. Nevertheless, the present results do not allow us to rule out any involvement of the IGF-I/IGF-I receptor system in the physiologic regulation of the gonadotrope axis.
In contrast to insulin, leptin is a more recently discovered metabolic factor (12) that has been readily implicated in the modulation of reproduction (4, 16). It has been shown to participate in the timing of puberty (17, 18) and in the preservation of reproductive function under poor metabolic conditions (47). These effects of leptin are, at least partially, mediated via an inhibition of hypothalamic neuropeptide Y expression and secretion (22, 47).
Whether leptin can directly activate GnRH neurons remains debated. Some authors have reported a stimulation of GnRH secretion by leptin in various in vitro models (48, 49), a finding consistent with the possible presence of the leptin receptor in GnRH neurons (50). Other studies failed to demonstrate such direct effect (51). At present, these contradictory results seem very difficult to reconcile, and they may represent only technical differences. In our in vitro system, leptin applied alone did not modulate GnRH secretion in various acute and chronic experimental paradigms. This observation confirms a number of in vivo studies that concur to suggest that leptin is a permissive factor for gonadotrope axis activation (4, 16, 52). In this respect, our finding that leptin potentiates the action of insulin on GnRH secretion may be very important. It is consistent with the phenotype of the neuron-specific insulin receptor knockout (NIRKO) mice: in the absence of central insulin signaling, the neuroendocrine gonadotrope axis of these animals remains quiescent despite elevated circulating levels of leptin (5). Therefore, the present data provide a mechanism for the well-recognized action of leptin on reproductive function, suggesting that long-term adaptations of the reproductive axis to metabolic parameters might be dependent on the coordinated insulin and leptin signals.
Interestingly, a detailed analysis of the pattern of GnRH secretion shows that its release in response to insulin is faster in the presence of leptin, suggesting that leptin increases the responsiveness of GnRH neurons to insulin. If this hypothesis were correct, it would be reminiscent of results obtained by others in hippocampal neurons (53). Indeed, electrophysiological studies have shown that leptin alone has no effect on the activity of these neurons, but that it can increase their responsiveness to NMDA stimulation (53).
The demonstration that insulin regulates hypothalamic GnRH secretion allows us to establish the hypothalamus as an important target for the neuroendocrine effects of this hormone. Nevertheless, the exact physiological relevance of this regulation remains an open question. Does insulin play a role in the hour-to-hour regulation of the gonadotrope axis, or is it rather acting as a permissive factor like leptin? If the second hypothesis is correct, then our data suggest that the periodic excursions of circulating insulin concentrations into the range of high values observed after meal ingestion participate in the maintenance of gonadotrope axis activity. In addition, our finding of a potentiation of this action of insulin by leptin provides a mechanism for the integration of metabolic signals by the reproductive axis. This leads to the hypothesis that interactions between the insulin and the leptin signaling pathways might be crucial for the regulation of overall energy balance by specialized hypothalamic neurons. Further work should be aimed at elucidating more precisely the type of neurons involved in the effects described in the present study.
| Acknowledgments |
|---|
| Footnotes |
|---|
Abbreviations: AUC, Area under the curve; KATP, ATP-dependent potassium; NMDA, N-methyl-D-aspartate.
Received April 11, 2003.
Accepted for publication June 27, 2003.
| References |
|---|
|
|
|---|
1 and ppar
2 in visceral and subcutaneous adipose tissue of obese women. Diabetes 52:16731676This article has been cited by other articles:
![]() |
M. Christ-Crain, B. Kola, F. Lolli, C. Fekete, D. Seboek, G. Wittmann, D. Feltrin, S. C. Igreja, S. Ajodha, J. Harvey-White, et al. AMP-activated protein kinase mediates glucocorticoid-induced metabolic changes: a novel mechanism in Cushing's syndrome FASEB J, June 1, 2008; 22(6): 1672 - 1683. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. W. Hill, J. K. Elmquist, and C. F. Elias Hypothalamic pathways linking energy balance and reproduction Am J Physiol Endocrinol Metab, May 1, 2008; 294(5): E827 - E832. [Abstract] [Full Text] [PDF] |
||||
![]() |
A.-S. Carlo, M. Pyrski, C. Loudes, A. Faivre-Baumann, J. Epelbaum, L. M. Williams, and W. Meyerhof Leptin Sensitivity in the Developing Rat Hypothalamus Endocrinology, December 1, 2007; 148(12): 6073 - 6082. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Rohrer, E. Stierkorb, S. Heger, B. Karges, K. Raile, K O. Schwab, R. W Holl, and on behalf of the Diabetes-Patienten-Verlaufsdaten Delayed pubertal onset and development in German children and adolescents with type 1 diabetes: cross-sectional analysis of recent data from the DPV diabetes documentation and quality management system Eur. J. Endocrinol., November 1, 2007; 157(5): 647 - 653. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Neganova, H. Al-Qassab, H. Heffron, C. Selman, A. I. Choudhury, S. J. Lingard, I. Diakonov, M. Patterson, M. Ghatei, S. R. Bloom, et al. Role of Central Nervous System and Ovarian Insulin Receptor Substrate 2 Signaling in Female Reproductive Function in the Mouse Biol Reprod, June 1, 2007; 76(6): 1045 - 1053. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Chau-Van, M. Gamba, R. Salvi, R. C. Gaillard, and F. P. Pralong Metformin Inhibits Adenosine 5'-Monophosphate-Activated Kinase Activation and Prevents Increases in Neuropeptide Y Expression in Cultured Hypothalamic Neurons Endocrinology, February 1, 2007; 148(2): 507 - 511. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. I. Hernandez, A. Martinez, T. Capurro, V. Pena, L. Trejo, A. Avila, T. Salazar, S. Asenjo, G. Iniguez, and V. Mericq Comparison of Clinical, Ultrasonographic, and Biochemical Differences at the Beginning of Puberty in Healthy Girls Born Either Small for Gestational Age or Appropriate for Gestational Age: Preliminary Results J. Clin. Endocrinol. Metab., September 1, 2006; 91(9): 3377 - 3381. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. L. Pagan, S. S. Srouji, Y. Jimenez, A. Emerson, S. Gill, and J. E. Hall Inverse Relationship between Luteinizing Hormone and Body Mass Index in Polycystic Ovarian Syndrome: Investigation of Hypothalamic and Pituitary Contributions J. Clin. Endocrinol. Metab., April 1, 2006; 91(4): 1309 - 1316. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Udagawa, R. Hashimoto, H. Suzuki, T. Hatta, Y. Sotomaru, K. Hioki, Y. Kagohashi, T. Nomura, Y. Minami, and H. Otani The Role of Leptin in the Development of the Cerebral Cortex in Mouse Embryos Endocrinology, February 1, 2006; 147(2): 647 - 658. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Salvi, E. Castillo, M.-J. Voirol, M. Glauser, J.-P. Rey, R. C. Gaillard, P. Vollenweider, and F. P. Pralong Gonadotropin-Releasing Hormone-Expressing Neurons Immortalized Conditionally Are Activated by Insulin: Implication of the Mitogen-Activated Protein Kinase Pathway Endocrinology, February 1, 2006; 147(2): 816 - 826. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Igaz, R. Salvi, J.-P. Rey, M. Glauser, F. P. Pralong, and R. C. Gaillard Effects of Cytokines on Gonadotropin-Releasing Hormone (GnRH) Gene Expression in Primary Hypothalamic Neurons and in GnRH Neurons Immortalized Conditionally Endocrinology, February 1, 2006; 147(2): 1037 - 1043. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Pitteloud, M. Hardin, A. A. Dwyer, E. Valassi, M. Yialamas, D. Elahi, and F. J. Hayes Increasing Insulin Resistance Is Associated with a Decrease in Leydig Cell Testosterone Secretion in Men J. Clin. Endocrinol. Metab., May 1, 2005; 90(5): 2636 - 2641. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. M. Navarro, J. M. Castellano, R. Fernandez-Fernandez, S. Tovar, J. Roa, A. Mayen, R. Nogueiras, M. J. Vazquez, M. L. Barreiro, P. Magni, et al. Characterization of the Potent Luteinizing Hormone-Releasing Activity of KiSS-1 Peptide, the Natural Ligand of GPR54 Endocrinology, January 1, 2005; 146(1): 156 - 163. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. M. Navarro, J. M. Castellano, R. Fernandez-Fernandez, M. L. Barreiro, J. Roa, J. E. Sanchez-Criado, E. Aguilar, C. Dieguez, L. Pinilla, and M. Tena-Sempere Developmental and Hormonally Regulated Messenger Ribonucleic Acid Expression of KiSS-1 and Its Putative Receptor, GPR54, in Rat Hypothalamus and Potent Luteinizing Hormone-Releasing Activity of KiSS-1 Peptide Endocrinology, October 1, 2004; 145(10): 4565 - 4574. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |