help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology, doi:10.1210/en.2002-0008
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
144/12/5242    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Campbell, M. C.
Right arrow Articles by Mariash, C. N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Campbell, M. C.
Right arrow Articles by Mariash, C. N.
Endocrinology Vol. 144, No. 12 5242-5248
Copyright © 2003 by The Endocrine Society

Human Spot 14 Glucose and Thyroid Hormone Response: Characterization and Thyroid Hormone Response Element Identification

Mark C. Campbell, Grant W. Anderson and Cary N. Mariash

Division of Endocrinology and Diabetes, Department of Medicine, University of Minnesota, Minneapolis, Minnesota 55455

Address all correspondence and requests for reprints to: Cary N. Mariash, M.D., University of Minnesota, MMC 101, 420 Delaware Street SE, This study was supported by NIH Grants T32-DK07203 and P30-DK50456. Minneapolis, Minnesota 55455. E-mail: cary{at}lenti.med.umn.edu.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Spot 14 is a 17-kDa protein expressed in lipogenic tissues and is postulated to play a role in thyroid hormone stimulation of lipogenesis. To further our understanding of Spot 14 regulation in humans, our laboratory recently cloned the human Spot 14 gene. The gene is highly homologous to the rat Spot 14 ortholog and located on a chromosomal region implicated in human obesity. Because our understanding of Spot 14 transcriptional regulation is derived from rat promoter studies, we assessed the thyroid hormone responsivity of the human Spot 14 promoter. These studies revealed a significantly greater thyroid hormone response for the human promoter, compared with the rat. Deletional studies of the human Spot 14 promoter reveal a 774-bp region at approximately position -2700, which is both necessary and sufficient for the thyroid hormone response. EMSAs with subfragments from this region identify a 146-bp DNA fragment capable of binding a TRß1-retinoid X receptor heterodimer. Site-directed mutagenesis confirmed the identity of a candidate DR-4 thyroid hormone response element within this fragment that is similar, but not identical, to the two rat Spot 14 thyroid hormone response elements. We hypothesize that the difference in thyroid hormone response between the orthologous promoters may allow a selective advantage to each species based on their different nutritional and physiological niches.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
CONTROL OF BODY weight and metabolism is closely regulated by dietary and hormonal factors. One of the major metabolic regulators is thyroid hormone (TH). An important function of TH is to stimulate hepatic de novo lipogenesis. Previous studies in our laboratory revealed a protein, Spot 14, which is required for this hepatic response (1, 2). TH regulates Spot 14 transcription, which in turn is required for TH-stimulated transcription of lipogenic genes (3, 4, 5).

TH regulation of gene expression is achieved through a nuclear TH receptor (TR), which regulates cognate gene expression by binding the upstream promoters of TH-responsive genes at specific sequences (6). Studies of the TH response element (TRE) revealed an optimal consensus of a direct hexameric repeat (A/G)GGT(C/A)A with four bases between the repeats (7). The rat Spot 14 promoter has been found to contain two such elements at approximately position -2500 (5, 8).

To study the role of Spot 14 in human disease, our laboratory has recently cloned the human gene (9). The human gene has been mapped to chromosome 11q.13, a region implicated in human obesity (10, 11, 12). Furthermore, we have shown that this gene is abnormally regulated in obese individuals (13), further underscoring the importance of identifying the regulatory factors required for human Spot 14 expression. Thus, we asked the following question: are there differences in TH-dependent regulation of human vs. rat Spot 14 gene transcription?

In this study we demonstrate that the human and rat Spot 14 promoters differ in the magnitude of response to both TH and the dietary inducer of de novo lipogenesis, glucose. We determined that the rat promoter responds most robustly to glucose, whereas the human promoter responds most robustly to TH. Both promoters are similar in that they demonstrate a synergistic response to the combination of glucose and TH. Using deletional studies and mobility shift assays, we identified a 774-bp region that mediates TH-dependent transcriptional activation of the human Spot 14 promoter. We further identified a putative TRE located within this promoter region. This sequence binds TR, and TH-dependent transcriptional activation of the human Spot 14 promoter is abolished when the TRE is mutagenized.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Preparation of constructs
Deletions within the 4.3-kb human Spot 14 promoter:reporter construct (9) were prepared by subjecting the plasmid to partial digestion by HindIII. After a heat denaturation step, the plasmids were religated and transformed into Escherichia coli. Resultant plasmids were analyzed by restriction map analysis to determine structure. Deletions from bases -4300 to -2774, -2774 to -2000, and -2774 to -370 ({Delta}1, {Delta}2, and {Delta}2,3) were prepared in this fashion. To generate a deletion from -2080 to -595 ({Delta}3), partial digestion with ScaI followed by ligation was used.

We inserted the 774-bp TH-responsive DNA fragment into a heterologous mouse mammary tumor virus (MMTV) basal promoter:luciferase reporter vector (14). The fragment was ligated into a HindIII site within the reporter construct polylinker. Insertion and orientation were verified by restriction map analysis. The 774-bp TH-responsive region was also inserted into HindIII digested pBluescript to facilitate generation of the approximately 150-bp fragments used in the mobility shift assays. The sequence of fragment 2.1 (-2774/-2639) is: AAGCTTTGCCCTCTGCATCTGGCCCAGACCTGGATTTGGCTGCCTGTTCTGCCCTGGAGAAGCAAGGCCAACTGTCAACACAGGGTGACTTCAGGTCATCTGTGGCTATGCATGGCCAGCCTGCCAAGGGACTTGACGAGAGGGAA.

Mutations in the TRE candidate region were prepared using the Stratagene QuikChange kit (Stratagene, La Jolla, CA). PCR primers were designed to convert the third and fourth G of both hexameric TRE half-sites to T (underlined) as follows: sense strand, -CAACTGTCAACACAGTTTGACTTCATTTCATCTGTGGCTATG- and antisense strand, -CATAGCCACAGATGAAATGAAGTCAAACTGTGTTGACAGTTG. The wild-type 4.3-kb human promoter insert in the PXP2 vector was used as a PCR template. PCR was performed in a GeneAmp PCR System 2400 thermal cycler (Perkin-Elmer, Norwalk, CT), amplifying for 16 cycles. Cycling conditions were: 30 sec at 95 C followed by 1 min at 55 C and then 22 min at 68 C. PCR products were digested with the restriction enzyme DpnI, and transformed into competent Escherichia coli DH5{alpha} cells. We screened for the mutation using DraIII digests of isolated plasmid DNA, and identified mutations were then verified by sequence analysis.

Cell culture, transfections, and luciferase assay
Primary rat hepatocytes were isolated from male Sprague Dawley rats (200–400 g, Harlan Laboratories, Madison, WI) by collagenase perfusion as described previously (9, 15). All animal studies were conducted in accordance with the principles and procedures outlined in the National Institutes of Health guide for the Care and Use of Laboratory Animals and approved by the University of Minnesota’s Animal Care and Use Committee. After isolation, hepatocytes (1.3 x 106 cells per 35-mm Primaria culture dish, Falcon, Oxnard, CA) were incubated in William’s medium E media supplemented with insulin (0.01 U/ml) and dexamethasone (1 x 10-8 M) with penicillin-streptomycin, 5.5 mM glucose, and 10% TH-stripped fetal bovine serum. After 6 h of incubation, 0.6 µg of experimental constructs and 0.l µg pCDM8 rat TR{alpha} expression construct were cotransfected into cells using synthetic liposomes as described previously (Lipofectin, Life Technologies, Inc., Grand Island, NY) (9). The transfections were performed in the absence of serum and penicillin-streptomycin. After 17 h the cells were incubated under low (5.5 mM) or high (27.5 mM) glucose conditions in the presence or absence of 500 nM T3 for 48 h with medium renewal at 24 h. The media used after the transfection did not contain fetal bovine serum. The luciferase assay was performed as described previously (9).

EMSAs
In vitro synthesized TRß and retinoid X receptor (RXR)ß were prepared using the TNT-coupled reticulocyte lysate system (Promega, Madison, WI). A TRß1 cDNA pTZ18r construct and the RXRß construct, kindly provided by Dr. Howard Towle (University of Minnesota), were used as templates for in vitro-coupled transcription and translation reactions.

The 5' ends of isolated DNA fragments used as probes were labeled using Klenow enzyme and {alpha}-32P-dCTP. The DNA fragments were produced by the following double digests: fragment 2.1, HindIII, BsmF1; fragment 2.2, BsmF1, Eco0109I; fragment 2.3, Eco0109I, Tth111-I; fragment 2.4, Tth111-I, NdeI; fragment 2.5 NdeI, HindIII. For digests with Dcm-sensitive enzymes, dcm/dam unmethylated DNA was prepared by transforming dcm/dam-deficient competent cells (Life Technologies, Inc.). The purified DNA fragments were radioactively labeled using a Klenow fill-in reaction with {alpha}32P-dCTP. Free nucleotides were removed with a size exclusion column (Nuc Trap column, Stratagene).

Binding reactions were performed as described previously, with the following modifications: the cold equivalent of 1.5 x 105 cpm TR and RXR, 1 x 104 cpm of labeled probe, and binding buffer [10 mM Tris HCl, (pH 7.5), 50 mM NaCl, 5% glycerol, 1 mM EDTA, 1 mM dithiotheritol] in a 20-µl volume for 30 min at room temperature (5). Electrophoresis was performed using a 4.5% nondenaturing polyacrylamide gel system with 20 mM Tris (pH 8.3), 200 mM glycine, and 1 mM EDTA running buffer for 2.5 h at 150 V. Autoradiography was performed to visualize labeled bands.

Statistical methods
Statistical analyses were performed using DataDesk version 6 software (Data Description, Inc., Ithaca, NY) for the Macintosh (Apple Computer, Cupertino, CA). Samples were normalized by subtracting the average mock value for that experiment and then dividing the value by the average expression for a maximally expressed experimental construct. Normalized data from each experiment were then pooled, transformed with the DataDesk box-Cox transformation for homogeneity of variance, and then homogeneity of variance tested with the method of Levine. ANOVA was performed, and the significance of comparisons was determined with a Bonferonni post hoc analysis. Results are expressed as the mean ± SEM for each set of normalized data.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Comparison of the human and rat Spot 14 promoter responses to TH and glucose
To compare the glucose and TH responses of the human and rat Spot 14 promoters, primary hepatocytes were transfected with either the human or rat Spot 14 promoter:luciferase constructs. Cells were then cultured in the presence or absence of 500 nM TH and the presence of either 5.5 or 27.5 mM glucose to generate four culture conditions for each construct. The luciferase activity for each condition is shown in Fig. 1Go.



View larger version (17K):
[in this window]
[in a new window]
  		FIG. 1. The human and rat Spot 14 promoters respond to TH and glucose. The Spot 14 promoter:luciferase expression constructs were transfected into rat primary hepatocytes. The cells were cultured in the presence (solid bars) or absence (hatched bars) of 500 nM T3 and high (27.5 mM) or low (5.5 mM) glucose to generate four possible conditions per construct. Results are expressed as the mean ± SEM. Data were normalized for each construct to the percent of mean value when the construct is transfected in the presence of both high glucose and TH. *, Statistically significant difference in TH-dependent luciferase activity at a given glucose concentration (P < 0.01); {alpha}, statistically significant difference in glucose-dependent luciferase activity at a given TH dose (P < 0.01). Each bar represents from 10–43 data points and a minimum of three experimental repetitions.

 
The human promoter responds robustly to TH stimulation (Fig. 1Go). In low glucose, we observed a 12.3-fold TH-dependent induction. In high glucose, a significantly increased 21.4-fold TH-dependent induction was observed. In contrast, the rat promoter did not demonstrate a significant TH-dependent response in low glucose (1.04-fold) and only a modest 2.93-fold induction in high glucose.

We next assessed the effects of glucose on promoter activity. The human Spot 14 promoter demonstrated a modest 2.85-fold glucose-dependent response when cells were cultured in the presence of TH and no response when the cells were cultured in the absence of TH. A similar result using this construct was previously reported (9). In contrast, the rat promoter demonstrated a 7.43-fold glucose-dependent response when cells were cultured in the presence of TH and a 2.64-fold glucose-dependent response when cells were cultured in the absence of TH.

These data demonstrate that both the human and rat Spot 14 promoters respond to TH and glucose stimulation.

Identifying the human Spot 14 promoter TH-responsive region
The TH-dependent activation of the human Spot 14 promoter suggests the presence of a TRE in the proximal promoter. To determine the location of the human Spot 14 gene TRE, we prepared deletions within the 4.3-kb human Spot 14 promoter using the reporter plasmid previously described. Deletions were prepared from -4300 to -2774 bases upstream of the transcription start site ({Delta}1); -2774 to -2000 ({Delta}2); -2060 to -595 ({Delta}3); and -2774 to -370 ({Delta}2,3) (Fig. 2Go). These constructs were transiently transfected into primary rat hepatocytes. We found that constructs with deletions including -2774 to -2000 bases from the transcription start site ({Delta}2 and {Delta}2,3) lost the TH-dependent response (Fig. 2Go). All constructs containing this region (wild-type, {Delta}1, and {Delta}3) retained a highly significant TH response in both high and low glucose. Although the loss of general transcription function reduced the absolute values obtained, the TH-responsive constructs retained wild-type fold responses (>10-fold). Thus, the -2774 to -2000 region is necessary for TH-dependent activation of the human Spot 14 promoter.



View larger version (13K):
[in this window]
[in a new window]
  		FIG. 2. Deletion of a 774-bp region from the 4.3-kb human Spot 14 promoter prevents TH-dependent activation. The five structures diagramed on the left represent the human Spot 14 promoter deletions from position -4300 to -2774 ({Delta}1); -2774 to -2000 ({Delta}2); -2060 to -595 ({Delta}3); or -2774 to -400 ({Delta}2,3). These constructs were cotransfected with the rat TR{alpha}1 expression plasmid into primary rat hepatocytes. Cells were cultured in the presence (solid columns) or absence (hatched columns) of 500 nM T3. This figure demonstrates results for cells cultured in high (27.5 mM) glucose. Data are the mean ± SEM for at least two experiments with n = 30 for the wild-type promoter, n = 9 for {Delta}1, {Delta}2, and n = 4 for {Delta}1 and {Delta}2,3. The asterisk denotes a statistically significant difference (P < 0.05) in TH-dependent reporter gene activity. Each construct and treatment group is normalized to the mean activity of the wild-type promoter transfected in the presence of TH.

 
To demonstrate that the 774-bp region from -2774 to -2000 of the human Spot 14 promoter was sufficient to confer T3 response, we tested its ability to confer a T3 response on a heterologous promoter. The 774-bp region was ligated 5' to the MMTV promoter in a luciferase expression vector. The construct was transiently transfected, and cells were cultured in the presence and absence of T3. We observed that the 774-bp region is able to confer a highly significant 30-fold TH-dependent response to the basal MMTV promoter (Fig. 3Go). This demonstrates that this 774-bp region of the human Spot 14 promoter is both necessary and sufficient to mediate a TH-dependent response.



View larger version (8K):
[in this window]
[in a new window]
  		FIG. 3. The human Spot 14 promoter -2774 to -2000 region confers TH-dependent activation of a heterologous promoter. The 774-bp TH-responsive region was ligated 5' to the minimal MMTV promoter luciferase expression vector. Constructs were transiently transfected into primary rat hepatocytes and cultured in the presence (solid bars) and absence (hatched bars) of 500 nM T3. Results represent the mean ± SEM for two experiments with n = 8 for each group. Values were normalized to maximal wild-type reporter gene activities. The asterisk denotes a statistically significant difference (P < 0.01) in TH-dependent reporter gene activity.

 
To determine whether regions within the 774-bp TH-responsive region were capable of binding TR, mobility shift assays were performed using in vitro synthesized TRß and RXRß. TRß-RXRß heterodimers bound to the 146-bp fragment 2.1 (Fig. 4Go). TRß and RXRß alone were unable to produce a mobility shift. No other DNA fragment derived from the 774-bp region bound TR. To further confirm the identity of the bands in the shift, a supershift assay was performed using antiserum against TR. The doublet produced by heterodimer formation with fragment 2.1 was supershifted with the TR-specific antiserum but not control sera (data not shown). These data demonstrate that the 5' 146-base fragment of the 774-bp TH-responsive region is capable of binding a TRß-RXRß heterodimer.



View larger version (40K):
[in this window]
[in a new window]
  		FIG. 4. A subfragment of the 774-bp TH-responsive human Spot 14 promoter region binds TR. Approximately 150-bp subfragments of the 774-bp TH-responsive region were prepared by restriction enzyme digestion and radioactively labeled. Labeled fragments were incubated with in vitro synthesized TRß and RXRß. The five fragments produced from digestion of the 774-bp TH-responsive region are labeled 2.1–2.5. Mobility shift results are shown beneath each corresponding subfragment. UPL, Unprogrammed reticulocyte lysate; RXRß and TRß, lysate containing in vitro synthesized RXRß or TRß receptor. The arrow identifies a TRß-RXRß heterodimeric mobility shift, whereas the asterisk denotes the presence of nonspecific bands observed in both UPL and experimental lanes. Receptors in vitro translated from these expression constructs routinely produce doublet gel shifts on other bona fide TREs (25 ) and are likely the result of truncated synthesized receptors.

 
Identification of the human Spot 14 TRE
To determine the location and sequence of a candidate TRE on fragment 2.1, an alignment to the canonical TRE consensus sequence was performed. A candidate sequence with the greatest homology was found approximately 2660 bases 5' from transcription start site (Fig. 5Go). This candidate sequence differed from the canonical DR-4 TRE sequence by only two nucleotides. One mismatch was a G-for-C substitution, in the fifth position of the second repeat, which may be a common variant from the TRE consensus (6, 16). The other mismatch was a G-for-A substitution in the first position of the first repeat. The four critical guanines in positions 2 and 3 of both repeats were conserved (7). The rat Spot 14 promoter TREs contain a greater number of nonallowed mismatches when compared with the TRE consensus. These data demonstrate that the 146-bp TR-binding fragment near position -2700 contains a sequence homologous to bona fide TREs.



View larger version (20K):
[in this window]
[in a new window]
  		FIG. 5. The 146-bp TR-binding region contains a sequence homologous to the consensus TRE sequence. To determine whether any candidate TRE sequences could be detected by computer analysis within the TR binding fragment, a GCG sequence analysis using the "MAP" algorithm was performed. The consensus DR-4 element is shown aligned to the human Spot 14 sequence. Comparison of the two sequences reveals only two mismatches, which are located at the first and fifth bases of the 5' half-site. Aligned below the human sequence are the two rat TREs (8 ).

 
To determine whether the candidate TRE sequence mediates TH responsivity, sequences within the wild-type human Spot 14 promoter:luciferase construct were altered by site-directed mutagenesis. The mutations consisted of replacing four critical guanines with thymidines (Fig. 6Go). These G-to-T mutations have been shown to ablate TH responsivity in other promoters (5, 17). Both the mutant and wild-type constructs were then transiently transfected into primary rat hepatocytes. Disruption of the candidate TRE sequence abolished TH-dependent activation of reporter gene activity (Fig. 6Go). In addition, increased basal expression of the mutant reporter construct was noted when cells were cultured in the absence of TH, consistent with a loss of unliganded TR-mediated repression. Surprisingly, we also noted a TH-dependent fall in reporter gene activity when the mutant construct was transfected under low glucose conditions. Together these data suggest that the candidate TRE sequences identified near -2700 of the human Spot 14 promoter function as a bona fide TRE.



View larger version (16K):
[in this window]
[in a new window]
  		FIG. 6. The TRE sequence at -2660 is required for TH-dependent activation of the human Spot 14 promoter. The diagrams on the left represent the 4.3-kb human Spot 14 promoter:luciferase construct. The putative wild-type TRE sequence is marked in bold in the upper panel, and the mutated TRE sequences are underlined in the lower panel. These constructs were cotransfected with the rat TR{alpha}1 expression plasmid into primary rat hepatocytes. Cells were then cultured in the presence (solid columns) or absence (hatched columns) of 500 nM T3. Cells were also cultured in high (27.5 mM) or low (5.5 mM) glucose to produce four possible conditions. Data represent the mean ± SEM for two experiments with n = 8 for the mutant, and at least seven experiments with n = 30 for the wild-type construct. Each construct and treatment group is normalized to the mean activity of the wild-type promoter transfected in the presence of TH and high glucose. The asterisk denotes a statistically significant difference (P < 0.01) in TH-dependent reporter gene activity for the same concentration of glucose. The {alpha} denotes a statistically significant difference (P < 0.01) in glucose-dependent reporter gene activity for the same concentration of TH. To the right of the graph is the fold induction by TH.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
The rat Spot 14 gene was one of the first TH-responsive genes characterized at the molecular level (2, 5, 18, 19). Spot 14 has been subsequently used to elucidate the molecular mechanisms of TH and carbohydrate-regulated gene expression. To further our understanding of the Spot 14 gene function and regulation, our laboratory cloned the human Spot 14 gene (9). Spot 14 localizes to a chromosomal region linked to human obesity, and Spot 14 expression is differentially regulated in obese humans (10, 11, 12, 13). More recently we showed that Spot 14 null mice show an abnormality in lipogenesis (20), confirming the role of this gene in the regulation of lipogenesis.

We have now assessed the transcriptional regulation of human Spot 14 in an effort to further understand the role of Spot 14 in human physiology. We found that, like the rat, the human Spot 14 gene responds to TH and carbohydrate signaling (Fig. 1Go). These data suggest that the molecular mechanisms controlling the Spot 14 gene response to these signals are evolutionarily maintained. Maintenance of these regulatory responses suggests that Spot 14 plays a critical role in the physiology of at least these two mammalian species. Interestingly, we noted that the magnitude of the responses significantly differed among species. For example, we found that the human promoter responds robustly to TH and modestly to glucose. Conversely, the rat promoter responds modestly to TH but robustly to glucose. Perhaps these differences in gene regulation indicate different physiologic needs for induced de novo lipogenesis in the rat vs. the human.

The rat Spot 14 promoter contains three regions responsible for mediating TH-dependent regulation of the gene (5, 8). These regions are located approximately -2500 bases from the transcription start site. Interestingly, the regions responsible for mediating the TH-dependent regulation of the human Spot 14 gene are located approximately -2700 bases from the transcription start site (Fig. 4Go). Identification of the human Spot 14 TRE revealed extensive sequence similarity to the rat Spot 14 TREs (Fig. 5Go). Thus, we can conclude that the mechanism whereby the Spot 14 promoter responds to TH is highly conserved between these two species. It is of interest that the Spot 14 TREs are located so distant from the start site of transcription. TREs identified in other genes are usually found in close proximity to the start site of transcription (17). Perhaps the synergistic interaction between TH and carbohydrate regulation of Spot 14 transcription requires the TRE and carbohydrate response elements (ChoREs) to be located near each other. The rat ChoREs are located at about -1500 (18, 21).

The 146-bp TR-binding fragment of the human Spot 14 promoter contains a sequence that is homologous to the DR-4 TRE consensus (6). When the TRE was mutated, the 4.3-kb human promoter lost the TH-dependent response (Fig. 6Go). Additionally, the basal state of the mutant promoter is elevated from wild-type expression, consistent with relief of repression from unliganded TR. What was not expected, however, was the TH-dependent fall in mutant expression. There are several possible explanations for this response. First, there may be a negative TRE within the human promoter, which becomes uncovered when the positive TRE is ablated. In this scenario, the positive TRE dominates in the wild-type promoter and when ablated, the negative TRE is allowed to repress transcription in the presence of TH. Similarly, it is known that a negative TRE exists in the luciferase gene (22). Again, this negative TRE may become uncovered when the positive TRE located within the Spot 14 promoter is ablated. It is also possible that mutation of the positive Spot 14 TRE has created a negative TRE.

Why the human and rat promoters respond so differently to TH is unclear. Perhaps the promoters of the two genes differ in the ability to assemble a TH-response apparatus. It would be of interest to determine whether there are differences in coactivator and corepressor interactions with TR on the rat vs. human promoter. Additionally, it is possible that the human TREs bind TR with higher affinity. This would not be entirely surprising because the human Spot 14 TRE more closely resembles the canonical TRE than does the rat. With respect to the carbohydrate response, it is not clear why the human promoter responds less vigorously to carbohydrate than the rat (Fig. 1Go). Perhaps the human ChoREs differ in their response to carbohydrate through mechanisms similar to those just proposed for the TH-response differences. Analysis of this question awaits identification of the human Spot 14 ChoRE.

Why are the TH and carbohydrate responses of the human and rat Spot 14 gene similar in mechanism and yet different in magnitude? The conservation of regulatory function suggests the importance of Spot 14 in mammalian physiology. The differences in response characteristics, however, may speak to differences between rodent and human physiology. Rodents and humans inhabit unique thermodynamic niches and exhibit markedly disparate body sizes and surface area to mass ratios. Additionally, rodents possess a significantly greater percentage of brown fat. Rodents typically subsist on a herbivore diet, whereas humans have evolved to survive as omnivorous hunters and gatherers. Thus, carbohydrates play a less predominant role in the human diet, compared with rodents. It is possible that the absence of starvation is a better signal for the synthesis of fat in humans than acute carbohydrate feeding. Consequently, carbohydrates may induce de novo lipogenesis to a lesser extent in humans, compared with rodents. TH levels are primarily regulated by illness, temperature, and fasting, whereas hepatic carbohydrate metabolism occurs only in the fed state (23, 24). Thus, TH may play the predominant role as an inducer of de novo lipogenesis in humans because TH levels may indicate when a metabolically favorable lipogenic state is obtained.


   Footnotes
 
This study was supported by NIH Grants T32-DK07203 and P30-DK50456.

Abbreviations: ChoRE, Carbohydrate response element; MMTV, mouse mammary tumor virus; RXR, retinoid X receptor; TH, thyroid hormone; TR, TH receptor; TRE, TH response element.

Received November 5, 2002.

Accepted for publication August 14, 2003.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Oppenheimer JH, Kinlaw WB, Wong NC, Schwartz HL, Mariash CN 1987 Regulation of gene S-14 by triiodothyronine in liver. Horm Metab Res Suppl 17:1–5[Medline]
  2. Seelig S, Liaw C, Towle HC, Oppenheimer JH 1981 Thyroid hormone attenuates and augments hepatic gene expression at a pretranslational level. Proc Natl Acad Sci USA 78:4733–4737[Abstract/Free Full Text]
  3. Brown SB, Maloney M, Kinlaw WB 1997 "Spot 14" protein functions at the pretranslational level in the regulation of hepatic metabolism by thyroid hormone and glucose. J Biol Chem 272:2163–2166[Abstract/Free Full Text]
  4. Kinlaw WB, Church JL, Harmon J, Mariash CN 1995 Direct evidence for a role of the "spot 14" protein in the regulation of lipid synthesis. J Biol Chem 270:16615–16618[Abstract/Free Full Text]
  5. Zou L, Hagen SG, Strait KA, Oppenheimer JH 1994 Identification of thyroid hormone response elements in rodent Pcp-2, a developmentally regulated gene of cerebellar Purkinje cells. J Biol Chem 269:13346–13352[Abstract/Free Full Text]
  6. Chin WW 1994 Molecular mechanisms of thyroid hormone action. Thyroid 4:389–393[Medline]
  7. Brent GA, Harney JW, Chen Y, Warne RL, Moore DD, Larsen PR 1989 Mutations of the rat growth hormone promoter which increase and decrease response to thyroid hormone define a consensus thyroid hormone response element. Mol Endocrinol 3:1996–2004[CrossRef][Medline]
  8. Zilz ND, Murray MB, Towle HC 1990 Identification of multiple thyroid hormone response elements located far upstream from the rat S14 promoter. J Biol Chem 265:8136–8143[Abstract/Free Full Text]
  9. Ota Y, Mariash A, Wagner JL, Mariash CN 1997 Cloning, expression and regulation of the human S14 gene. Mol Cell Endocrinol 126:75–81[CrossRef][Medline]
  10. Moncur JT, Park JP, Memoli VA, Mohandas TK, Kinlaw WB 1998 The "Spot 14" gene resides on the telomeric end of the 11q13 amplicon and is expressed in lipogenic breast cancers: implications for control of tumor metabolism. Proc Natl Acad Sci USA 95:6989–6994[Abstract/Free Full Text]
  11. Bruford EA, Riise R, Teague PW, Porter K, Thomson KL, Moore AT, Jay M, Warburg M, Schinzel A, Tommerup N, Tornqvist K, Rosenberg T, Patton M, Mansfield DC, Wright AF 1997 Linkage mapping in 29 Bardet-Biedl syndrome families confirms loci in chromosomal regions 11q13, 15q22.3-q23, and 16q21. Genomics 41:93–99[CrossRef][Medline]
  12. Chagnon YC, Perusse L, Bouchard C 1998 The human obesity gene map: the 1997 update. Obes Res 6:76–92[Medline]
  13. Kirschner LA, Mariash CN 1999 Adipose S14 mRNA is abnormally regulated in obese subjects. Thyroid 9:143–148[Medline]
  14. Nordeen SK 1988 Luciferase reporter gene vectors for analysis of promoters and enhancers. Biotechniques 6:454–458[Medline]
  15. Mariash CN, Seelig S, Schwartz HL, Oppenheimer JH 1986 Rapid synergistic interaction between thyroid hormone and carbohydrate on mRNAS14 induction. J Biol Chem 261:9583–9586[Abstract/Free Full Text]
  16. Naar AM, Boutin JM, Lipkin SM, Yu VC, Holloway JM, Glass CK, Rosenfeld MG 1991 The orientation and spacing of core DNA-binding motifs dictate selective transcriptional responses to three nuclear receptors. Cell 65:1267–1279[CrossRef][Medline]
  17. Anderson GW, Mariash CN, Oppenheimer JH 2000 molecular actions of thyroid hormone. In: Braverman LE, Utiger RD, eds. The thyroid: a fundamental and clinical text. 8th ed. New York: Lippincott, Williams, and Wilkins; 174–195
  18. Sudo Y, Goto Y, Mariash CN 1993 Location of a glucose-dependent response region in the rat S14 promoter. Endocrinology 133:1221–1229[Abstract]
  19. Shih HM, Liu Z, Towle HC 1995 Two CACGTG motifs with proper spacing dictate the carbohydrate regulation of hepatic gene transcription. J Biol Chem 270:21991–21997[Abstract/Free Full Text]
  20. Zhu Q, Mariash A, Margosian MR, Gopinath S, Fareed MT, Anderson GW, Mariash CN 2001 Spot 14 gene deletion increases hepatic de novo lipogenesis. Endocrinology 142:4363–4370[Abstract/Free Full Text]
  21. Towle HC, Kaytor EN, Shih HM 1997 Regulation of the expression of lipogenic enzyme genes by carbohydrate. Annu Rev Nutr 17:405–433[CrossRef][Medline]
  22. Maia AL, Harney JW, Larsen PR 1996 Is there a negative TRE in the luciferase reporter cDNA? Thyroid 6:325–328[Medline]
  23. Tomasi TE 1991 Utilization rates of thyroid hormones in mammals. Comp Biochem Physiol A Comp Physiol 100:503–516[CrossRef]
  24. McIver B, Gorman CA 1997 Euthyroid sick syndrome: an overview. Thyroid 7:125–132[Medline]
  25. Anderson GW, Larson RJ, Oas DR, Sandhofer CR, Schwartz HL, Mariash CN, Oppenheimer JH 1998 Chicken ovalbumin upstream promoter-transcription factor (COUP-TF) modulates expression of the Purkinje cell protein-2 gene. A potential role for COUP-TF in repressing premature thyroid hormone action in the developing brain. J Biol Chem 273:16391–16399[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 Poult. Sci.Home page
Z. P. Cao, S. Z. Wang, Q. G. Wang, Y. X. Wang, and H. Li
Association of Spot14{alpha} Gene Polymorphisms with Body Weight in the Chicken
Poult. Sci., September 1, 2007; 86(9): 1873 - 1880.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
H. Dong, C. L. Yauk, A. Williams, A. Lee, G. R. Douglas, and M. G. Wade
Hepatic Gene Expression Changes in Hypothyroid Juvenile Mice: Characterization of a Novel Negative Thyroid-Responsive Element
Endocrinology, August 1, 2007; 148(8): 3932 - 3940.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
144/12/5242    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Campbell, M. C.
Right arrow Articles by Mariash, C. N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Campbell, M. C.
Right arrow Articles by Mariash, C. N.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals