| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Division of Endocrinology and Diabetes, Department of Medicine, University of Minnesota, Minneapolis, Minnesota 55455
Address all correspondence and requests for reprints to: Cary N. Mariash, M.D., University of Minnesota, MMC 101, 420 Delaware Street SE, This study was supported by NIH Grants T32-DK07203 and P30-DK50456. Minneapolis, Minnesota 55455. E-mail: cary{at}lenti.med.umn.edu.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
TH regulation of gene expression is achieved through a nuclear TH receptor (TR), which regulates cognate gene expression by binding the upstream promoters of TH-responsive genes at specific sequences (6). Studies of the TH response element (TRE) revealed an optimal consensus of a direct hexameric repeat (A/G)GGT(C/A)A with four bases between the repeats (7). The rat Spot 14 promoter has been found to contain two such elements at approximately position -2500 (5, 8).
To study the role of Spot 14 in human disease, our laboratory has recently cloned the human gene (9). The human gene has been mapped to chromosome 11q.13, a region implicated in human obesity (10, 11, 12). Furthermore, we have shown that this gene is abnormally regulated in obese individuals (13), further underscoring the importance of identifying the regulatory factors required for human Spot 14 expression. Thus, we asked the following question: are there differences in TH-dependent regulation of human vs. rat Spot 14 gene transcription?
In this study we demonstrate that the human and rat Spot 14 promoters differ in the magnitude of response to both TH and the dietary inducer of de novo lipogenesis, glucose. We determined that the rat promoter responds most robustly to glucose, whereas the human promoter responds most robustly to TH. Both promoters are similar in that they demonstrate a synergistic response to the combination of glucose and TH. Using deletional studies and mobility shift assays, we identified a 774-bp region that mediates TH-dependent transcriptional activation of the human Spot 14 promoter. We further identified a putative TRE located within this promoter region. This sequence binds TR, and TH-dependent transcriptional activation of the human Spot 14 promoter is abolished when the TRE is mutagenized.
| Materials and Methods |
|---|
|
|
|---|
1,
2, and
2,3) were prepared in this fashion. To generate a deletion from -2080 to -595 (
3), partial digestion with ScaI followed by ligation was used. We inserted the 774-bp TH-responsive DNA fragment into a heterologous mouse mammary tumor virus (MMTV) basal promoter:luciferase reporter vector (14). The fragment was ligated into a HindIII site within the reporter construct polylinker. Insertion and orientation were verified by restriction map analysis. The 774-bp TH-responsive region was also inserted into HindIII digested pBluescript to facilitate generation of the approximately 150-bp fragments used in the mobility shift assays. The sequence of fragment 2.1 (-2774/-2639) is: AAGCTTTGCCCTCTGCATCTGGCCCAGACCTGGATTTGGCTGCCTGTTCTGCCCTGGAGAAGCAAGGCCAACTGTCAACACAGGGTGACTTCAGGTCATCTGTGGCTATGCATGGCCAGCCTGCCAAGGGACTTGACGAGAGGGAA.
Mutations in the TRE candidate region were prepared using the Stratagene QuikChange kit (Stratagene, La Jolla, CA). PCR primers were designed to convert the third and fourth G of both hexameric TRE half-sites to T (underlined) as follows: sense strand, -CAACTGTCAACACAGTTTGACTTCATTTCATCTGTGGCTATG- and antisense strand, -CATAGCCACAGATGAAATGAAGTCAAACTGTGTTGACAGTTG. The wild-type 4.3-kb human promoter insert in the PXP2 vector was used as a PCR template. PCR was performed in a GeneAmp PCR System 2400 thermal cycler (Perkin-Elmer, Norwalk, CT), amplifying for 16 cycles. Cycling conditions were: 30 sec at 95 C followed by 1 min at 55 C and then 22 min at 68 C. PCR products were digested with the restriction enzyme DpnI, and transformed into competent Escherichia coli DH5
cells. We screened for the mutation using DraIII digests of isolated plasmid DNA, and identified mutations were then verified by sequence analysis.
Cell culture, transfections, and luciferase assay
Primary rat hepatocytes were isolated from male Sprague Dawley rats (200400 g, Harlan Laboratories, Madison, WI) by collagenase perfusion as described previously (9, 15). All animal studies were conducted in accordance with the principles and procedures outlined in the National Institutes of Health guide for the Care and Use of Laboratory Animals and approved by the University of Minnesotas Animal Care and Use Committee. After isolation, hepatocytes (1.3 x 106 cells per 35-mm Primaria culture dish, Falcon, Oxnard, CA) were incubated in Williams medium E media supplemented with insulin (0.01 U/ml) and dexamethasone (1 x 10-8 M) with penicillin-streptomycin, 5.5 mM glucose, and 10% TH-stripped fetal bovine serum. After 6 h of incubation, 0.6 µg of experimental constructs and 0.l µg pCDM8 rat TR
expression construct were cotransfected into cells using synthetic liposomes as described previously (Lipofectin, Life Technologies, Inc., Grand Island, NY) (9). The transfections were performed in the absence of serum and penicillin-streptomycin. After 17 h the cells were incubated under low (5.5 mM) or high (27.5 mM) glucose conditions in the presence or absence of 500 nM T3 for 48 h with medium renewal at 24 h. The media used after the transfection did not contain fetal bovine serum. The luciferase assay was performed as described previously (9).
EMSAs
In vitro synthesized TRß and retinoid X receptor (RXR)ß were prepared using the TNT-coupled reticulocyte lysate system (Promega, Madison, WI). A TRß1 cDNA pTZ18r construct and the RXRß construct, kindly provided by Dr. Howard Towle (University of Minnesota), were used as templates for in vitro-coupled transcription and translation reactions.
The 5' ends of isolated DNA fragments used as probes were labeled using Klenow enzyme and
-32P-dCTP. The DNA fragments were produced by the following double digests: fragment 2.1, HindIII, BsmF1; fragment 2.2, BsmF1, Eco0109I; fragment 2.3, Eco0109I, Tth111-I; fragment 2.4, Tth111-I, NdeI; fragment 2.5 NdeI, HindIII. For digests with Dcm-sensitive enzymes, dcm/dam unmethylated DNA was prepared by transforming dcm/dam-deficient competent cells (Life Technologies, Inc.). The purified DNA fragments were radioactively labeled using a Klenow fill-in reaction with
32P-dCTP. Free nucleotides were removed with a size exclusion column (Nuc Trap column, Stratagene).
Binding reactions were performed as described previously, with the following modifications: the cold equivalent of 1.5 x 105 cpm TR and RXR, 1 x 104 cpm of labeled probe, and binding buffer [10 mM Tris HCl, (pH 7.5), 50 mM NaCl, 5% glycerol, 1 mM EDTA, 1 mM dithiotheritol] in a 20-µl volume for 30 min at room temperature (5). Electrophoresis was performed using a 4.5% nondenaturing polyacrylamide gel system with 20 mM Tris (pH 8.3), 200 mM glycine, and 1 mM EDTA running buffer for 2.5 h at 150 V. Autoradiography was performed to visualize labeled bands.
Statistical methods
Statistical analyses were performed using DataDesk version 6 software (Data Description, Inc., Ithaca, NY) for the Macintosh (Apple Computer, Cupertino, CA). Samples were normalized by subtracting the average mock value for that experiment and then dividing the value by the average expression for a maximally expressed experimental construct. Normalized data from each experiment were then pooled, transformed with the DataDesk box-Cox transformation for homogeneity of variance, and then homogeneity of variance tested with the method of Levine. ANOVA was performed, and the significance of comparisons was determined with a Bonferonni post hoc analysis. Results are expressed as the mean ± SEM for each set of normalized data.
| Results |
|---|
|
|
|---|
|
We next assessed the effects of glucose on promoter activity. The human Spot 14 promoter demonstrated a modest 2.85-fold glucose-dependent response when cells were cultured in the presence of TH and no response when the cells were cultured in the absence of TH. A similar result using this construct was previously reported (9). In contrast, the rat promoter demonstrated a 7.43-fold glucose-dependent response when cells were cultured in the presence of TH and a 2.64-fold glucose-dependent response when cells were cultured in the absence of TH.
These data demonstrate that both the human and rat Spot 14 promoters respond to TH and glucose stimulation.
Identifying the human Spot 14 promoter TH-responsive region
The TH-dependent activation of the human Spot 14 promoter suggests the presence of a TRE in the proximal promoter. To determine the location of the human Spot 14 gene TRE, we prepared deletions within the 4.3-kb human Spot 14 promoter using the reporter plasmid previously described. Deletions were prepared from -4300 to -2774 bases upstream of the transcription start site (
1); -2774 to -2000 (
2); -2060 to -595 (
3); and -2774 to -370 (
2,3) (Fig. 2
). These constructs were transiently transfected into primary rat hepatocytes. We found that constructs with deletions including -2774 to -2000 bases from the transcription start site (
2 and
2,3) lost the TH-dependent response (Fig. 2
). All constructs containing this region (wild-type,
1, and
3) retained a highly significant TH response in both high and low glucose. Although the loss of general transcription function reduced the absolute values obtained, the TH-responsive constructs retained wild-type fold responses (>10-fold). Thus, the -2774 to -2000 region is necessary for TH-dependent activation of the human Spot 14 promoter.
|
|
|
|
|
| Discussion |
|---|
|
|
|---|
We have now assessed the transcriptional regulation of human Spot 14 in an effort to further understand the role of Spot 14 in human physiology. We found that, like the rat, the human Spot 14 gene responds to TH and carbohydrate signaling (Fig. 1
). These data suggest that the molecular mechanisms controlling the Spot 14 gene response to these signals are evolutionarily maintained. Maintenance of these regulatory responses suggests that Spot 14 plays a critical role in the physiology of at least these two mammalian species. Interestingly, we noted that the magnitude of the responses significantly differed among species. For example, we found that the human promoter responds robustly to TH and modestly to glucose. Conversely, the rat promoter responds modestly to TH but robustly to glucose. Perhaps these differences in gene regulation indicate different physiologic needs for induced de novo lipogenesis in the rat vs. the human.
The rat Spot 14 promoter contains three regions responsible for mediating TH-dependent regulation of the gene (5, 8). These regions are located approximately -2500 bases from the transcription start site. Interestingly, the regions responsible for mediating the TH-dependent regulation of the human Spot 14 gene are located approximately -2700 bases from the transcription start site (Fig. 4
). Identification of the human Spot 14 TRE revealed extensive sequence similarity to the rat Spot 14 TREs (Fig. 5
). Thus, we can conclude that the mechanism whereby the Spot 14 promoter responds to TH is highly conserved between these two species. It is of interest that the Spot 14 TREs are located so distant from the start site of transcription. TREs identified in other genes are usually found in close proximity to the start site of transcription (17). Perhaps the synergistic interaction between TH and carbohydrate regulation of Spot 14 transcription requires the TRE and carbohydrate response elements (ChoREs) to be located near each other. The rat ChoREs are located at about -1500 (18, 21).
The 146-bp TR-binding fragment of the human Spot 14 promoter contains a sequence that is homologous to the DR-4 TRE consensus (6). When the TRE was mutated, the 4.3-kb human promoter lost the TH-dependent response (Fig. 6
). Additionally, the basal state of the mutant promoter is elevated from wild-type expression, consistent with relief of repression from unliganded TR. What was not expected, however, was the TH-dependent fall in mutant expression. There are several possible explanations for this response. First, there may be a negative TRE within the human promoter, which becomes uncovered when the positive TRE is ablated. In this scenario, the positive TRE dominates in the wild-type promoter and when ablated, the negative TRE is allowed to repress transcription in the presence of TH. Similarly, it is known that a negative TRE exists in the luciferase gene (22). Again, this negative TRE may become uncovered when the positive TRE located within the Spot 14 promoter is ablated. It is also possible that mutation of the positive Spot 14 TRE has created a negative TRE.
Why the human and rat promoters respond so differently to TH is unclear. Perhaps the promoters of the two genes differ in the ability to assemble a TH-response apparatus. It would be of interest to determine whether there are differences in coactivator and corepressor interactions with TR on the rat vs. human promoter. Additionally, it is possible that the human TREs bind TR with higher affinity. This would not be entirely surprising because the human Spot 14 TRE more closely resembles the canonical TRE than does the rat. With respect to the carbohydrate response, it is not clear why the human promoter responds less vigorously to carbohydrate than the rat (Fig. 1
). Perhaps the human ChoREs differ in their response to carbohydrate through mechanisms similar to those just proposed for the TH-response differences. Analysis of this question awaits identification of the human Spot 14 ChoRE.
Why are the TH and carbohydrate responses of the human and rat Spot 14 gene similar in mechanism and yet different in magnitude? The conservation of regulatory function suggests the importance of Spot 14 in mammalian physiology. The differences in response characteristics, however, may speak to differences between rodent and human physiology. Rodents and humans inhabit unique thermodynamic niches and exhibit markedly disparate body sizes and surface area to mass ratios. Additionally, rodents possess a significantly greater percentage of brown fat. Rodents typically subsist on a herbivore diet, whereas humans have evolved to survive as omnivorous hunters and gatherers. Thus, carbohydrates play a less predominant role in the human diet, compared with rodents. It is possible that the absence of starvation is a better signal for the synthesis of fat in humans than acute carbohydrate feeding. Consequently, carbohydrates may induce de novo lipogenesis to a lesser extent in humans, compared with rodents. TH levels are primarily regulated by illness, temperature, and fasting, whereas hepatic carbohydrate metabolism occurs only in the fed state (23, 24). Thus, TH may play the predominant role as an inducer of de novo lipogenesis in humans because TH levels may indicate when a metabolically favorable lipogenic state is obtained.
| Footnotes |
|---|
Abbreviations: ChoRE, Carbohydrate response element; MMTV, mouse mammary tumor virus; RXR, retinoid X receptor; TH, thyroid hormone; TR, TH receptor; TRE, TH response element.
Received November 5, 2002.
Accepted for publication August 14, 2003.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
Z. P. Cao, S. Z. Wang, Q. G. Wang, Y. X. Wang, and H. Li Association of Spot14{alpha} Gene Polymorphisms with Body Weight in the Chicken Poult. Sci., September 1, 2007; 86(9): 1873 - 1880. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Dong, C. L. Yauk, A. Williams, A. Lee, G. R. Douglas, and M. G. Wade Hepatic Gene Expression Changes in Hypothyroid Juvenile Mice: Characterization of a Novel Negative Thyroid-Responsive Element Endocrinology, August 1, 2007; 148(8): 3932 - 3940. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |