Endocrinology, doi:10.1210/en.2003-0728
Endocrinology Vol. 144, No. 12 5411-5421
Copyright © 2003 by The Endocrine Society
Molecular Basis for the Substrate Selectivity of Cat Type I Iodothyronine Deiodinase
George G. J. M. Kuiper,
Frank Wassen,
Willem Klootwijk,
Hans van Toor,
Ellen Kaptein and
Theo J. Visser
Department of Internal Medicine, Erasmus Medical Center, 3000 DR Rotterdam, The Netherlands
Address all correspondence and requests for reprints to: George Kuiper, Ph.D., Department of Internal Medicine, Room Ee 502, Erasmus Medical Center, Dr. Molewaterplein 40, 3015 GD Rotterdam, The Netherlands. E-mail: g.kuiper{at}erasmusmc.nl.
 |
Abstract
|
|---|
The type I iodothyronine deiodinase (D1) catalyzes the activation of T4 to T3 as well as the degradation of T3 (rT3) and sulfated iodothyronines. A comparison of the catalytic activities of D1 in liver microsomal preparations from several species revealed a remarkable difference between cat D1 on one hand and rat/human D1 on the other hand. The Michaelis constant (Km) of cat D1 for rT3 (11 µM) is 30-fold higher than that of rat and human D1 (0.20.5 µM). Deiodination of rT3 by cat D1 is facilitated by sulfation [maximal velocity (Vmax)/Km rT3 = 3 and Vmax/Km rT3S = 81]. To understand the molecular basis for the difference in substrate interaction the cat D1 cDNA was cloned, and the deduced amino acid sequence was compared with rat/human D1 protein. In the region between amino acid residues 40 and 70 of cat D1, various differences with rat/human D1 are concentrated. By site-directed mutagenesis of cat D1 it was found that a combination of mutations was necessary to improve the deiodination of rT3 by cat D1 enzyme. For efficient rT3 deiodination, a Phe at position 65 and the insertion of the Thr-Gly-Met-Thr-Arg4852 sequence as well as the amino acids Gly and Glu at position 4546 are essential. Either of these changes alone resulted in only a limited improvement of rT3 deiodination. At the same time the combination of the described mutations did not affect the already quite efficient outer ring deiodination of rT3S nor the inner ring deiodination of T3S, whereas each of the described changes alone did affect rT3S deiodination. Our findings suggest great flexibility of the active site in D1 that adapts to its various substrates. The active site of wild-type cat D1 is less flexible than the active site of rat/human D1 and favors sulfated iodothyronines.
 |
Introduction
|
|---|
THE MAJOR ROUTE for the production of the active form of thyroid hormone, T3, is by enzymatic outer ring deiodination (ORD) of the prohormone, T4, in peripheral tissues. Alternatively, inner ring deiodination (IRD) of T4 produces the inactive metabolite reverse T3 (rT3). Three membrane-bound iodothyronine deiodinases have been identified (1, 2, 3). The type I iodothyronine deiodinase (D1) selenoprotein is expressed in liver, kidney, thyroid, and pituitary. This enzyme is responsible for a large part of the peripheral production of T3 from T4 in euthyroid animals (4, 5). Remarkably, D1 is capable of both ORD and IRD of T4, and shows preference for rT3 as the substrate (6, 7). D1 activity in vitro is stimulated by thiol compounds such as dithiotreitol (DTT) and is inhibited by propylthiouracil (8). N-bromoacetyl-[125I]-T3 has proven to be a useful affinity label of D1, allowing the specific labeling of the 27-kDa protein in microsomal fractions (9, 10). Molecular sieve chromatography and sedimentation analysis of the detergent solubilized D1 yielded an approximately 50-kDa active enzyme preparation, suggesting that the D1 protein is composed of a homodimer of 27-kDa subunits (11, 12). The functional significance of dimerization is unknown, because it has been shown that dimers containing only one wild-type partner are catalytically active (12, 13). There is general agreement that D1 is an integral membrane protein, but different cellular localizations have been found. In kidney cells, D1 is present in the plasma membrane (12, 14, 15), whereas in liver cells D1 is present in the endoplasmic reticulum with its active site oriented to the cytoplasm (16, 17). In transiently transfected HEK-293 cells D1 was localized in the plasma membrane as determined by immunofluorescence confocal microscopy (18).
More detailed structure-function analysis became possible after cloning of the D1 cDNA (6). The D1 protein contains a single selenocysteine residue (SeC) in the catalytic center, which is essential for efficient catalysis (6, 19, 20). A comparison of the deduced amino acid sequences of rat (6), human (21), dog (22), chicken (23), tilapia (24), and killifish (25) D1 reveals that only a single domain in the N terminus is sufficiently hydrophobic to qualify as a transmembrane sequence. In vitro translation studies using pancreatic microsomes showed that the transmembrane domain of rat D1 is located between basic amino acids at positions 11 and 12 and a group of charged residues at positions 3439 (26). The presence of essential active site histidine (His) residue(s) was postulated on the basis of experiments with histidine- directed reagents (27). Systematic site-directed mutagenesis studies of the four histidine residues in rat D1 showed that mutagenesis of His174 caused a significant increase in the Michaelis constant (Km) for rT3 deiodination, compatible with the formation of an imidazolium-selenolate ion pair (28). Comparative functional-structural analysis of human and dog D1 enzymes showed that amino acids between residues 30 and 70 of dog D1 account for the difference in Km value for rT3 ORD between dog and human D1 (22). Dog D1 has an approximately 30-fold higher Km for rT3 ORD than human D1 (22, 29). More detailed studies demonstrated that it is mainly the Phe65Leu substitution which explains the slow ORD of rT3 by dog D1 vs. human and rat D1 (22, 30).
Investigations on iodothyronine deiodination by cat liver and kidney microsomal fractions revealed that the ORD of rT3 is even slower than that by dog liver microsomes (31). The Km for ORD of rT3 by cat D1 was at least 500-fold higher than that of rat D1 (>100 µM vs. 0.2 µM), whereas cat and rat D1 deiodinated T4 at a similar rate with equal Km values (2 µm). In kittens reared on a low-selenium diet, plasma total T4 increased, whereas total T3 decreased (32), suggesting that cat D1 is a selenoprotein just as rat and human D1 albeit with differential substrate selectivity.
The present studies were undertaken to obtain detailed information about the substrate binding site in D1 protein. We have therefore isolated a D1 cDNA from cat liver and expressed this enzyme in COS cells to analyze its kinetic properties with different iodothyronine substrates. By comparing the cat and rat/human D1 primary sequences and subsequent site-directed mutagenesis experiments with cat D1 we have identified a region that is involved in iodothyronine substrate interaction.
 |
Materials and Methods
|
|---|
Materials
Nonradioactive iodothyronines were obtained from Henning (Berlin, Germany). [3'-125I]T3 (2000 mCi/µmol) and [3',5'-125I]T4 (1200 mCi/µmol) were obtained from Amersham Pharmacia Biotech (Little Chalfont, UK). [3',5'-125I]reverseT3 (rT3) and [3'-125I]T2 were prepared by radioiodination of T2 (3,3'-diiodothyronine) using the chloramine-T method as described (33). Radioactive as well as nonradioactive rT3S, T3S, and T2S were prepared by reaction of rT3, T3, or T2 with chlorosulfonic acid as described (34). Radioactively labeled N-bromoacetyl-T3 (BrAc[125I]T3) was synthesized from bromoacetylchloride and [3'-125I]T3 as described (35). Pfu (Pyrococcus furiosus) thermostable DNA polymerase, DpnI restriction endonuclease and pGEM-T vector were obtained from Promega Corp. (Madison, WI). XL-10 ultracompetent Escherichia coli cells were obtained from Stratagene (La Jolla, CA). Synthetic oligonucleotides, recombinant Taq DNA-polymerase, Moloney murine leukemia virus reverse transcriptase and cell culture media were ordered from Invitrogen-Life Technologies (Paisley, Scotland, UK).
Human and animal liver tissue
Normal adult human liver tissue was obtained at surgery for liver tumors. Approval was obtained from the Medical Ethical Committee of the Erasmus Medical Center.
All animal protocols were reviewed and approved by the institutional animal care and use committees of the School of Veterinary Medicine, Utrecht University (cats, dogs) or the Erasmus Medical Center (pigs, rats).
Assay of ORD and IRD activity in liver microsomes
Liver tissue from different species (human, pig, rat, cat, and dog) was homogenized and microsomal fractions were prepared by differential centrifugation as described (36). Microsomal pellets were dissolved in 100 mM phosphate (pH 7.2), 2 mM EDTA buffer containing 1 mM DTT (PED1). Protein concentrations (1525 mg/ml) were determined with the Bradford method using the Bio-Rad protein assay reagent and BSA as standard. Aliquots of microsomes were snap-frozen on dry ice, and stored at -80 C.
The ORD activity was measured by incubation of diluted microsomal fractions (final concentration 1050 µg protein/ml) in P100E2D10 buffer [100 mM phosphate (pH 7.2); 2 mM EDTA, 10 mM DTT] with 10 nM (100,000 cpm) 125I-labeled substrate (rT3, rT3S, T2S) followed by isolation and quantitation of the 125I- released as described (30, 37). The ORD of rT3 was analyzed in more detail. Microsomal fractions were incubated for 60 min at 37 C with 0.0130 µM 125I-rT3 (100,000 cpm) in P100E2D10. Values for maximal velocity (Vmax) and Km were estimated using double reciprocal plots as previously described (37).
The IRD assay with T3S is based on the determination of product formation (125I-labeled T2S and 125I-) by reverse-phase HPLC analysis of reaction mixtures containing outer-ring labeled 125I-T3S. Diluted microsomal fractions (50 µg protein/ml) were incubated with 10 nM (200,000 cpm) 125I-labeled T3S for 60 min at 37 C in P100E2D10. The reactions were stopped by addition of methanol (1:1), and analyzed by HPLC as described (38).
RT-PCR cloning of cat D1 cDNA and construction of expression vector
Total RNA was isolated from cat liver tissue with TRIzol reagent (Life Technologies, Inc.), and cDNA was obtained using random hexamer primers and Moloney murine leukemia virus reverse transcriptase. The coding sequence of cat D1 was cloned by PCR with oligonucleotide primers derived from the rat/human D1 cDNA sequences around the translational start codon (5'-ATGGGGCTGTCCCAGCTA), and the stop codon (5'-TTAACTGTGGAGCTTTTC). The PCR products obtained were subcloned in the pGEM-T vector and sequenced in both directions.
Because a SECIS element (selenocysteine insertion sequence element) is required for incorporation of SeC in selenoproteins, we prepared chimeric constructs in which the cat D1 cDNA was inserted 5' to the SECIS element of the rat D1 gene. For this purpose, the G21-pcDNA3 rat D1 expression vector (6) was digested with HindIII, and the 6-kb DNA band containing vector DNA plus 0.7 kb of the rat D1 3'-untranslated region (including the SECIS element) was isolated from a preparative agarose gel. The D1 sequence of the pGEM plasmid was amplified with primers containing flanking HindIII restriction sites (in italics): 5'-CAAGCTTGCCACCATGGGGCTGTCCCAGCTA (Kozak start consensus underlined) and 5'-CAAGCTTTTAACTGTGGAGCTTTTC (stop codon underlined) and cloned in pGEM-T vector. The pGEM vector containing cat D1 cDNA was digested with HindIII, and the isolated fragment was cloned into the prepared rat D1-SECIS-pcDNA3 vector.
Site-directed mutagenesis of cat D1
The cat D1 expression vector was used as template for site-directed mutagenesis via the circular mutagenesis procedure, followed by selection for mutants by DpnI digestion (39, 40).
The desired mutations were introduced successively. In the first round of mutagenesis the L60Y61 wild-type (wt) sequence was changed via overlapping sense and antisense primers containing the nucleotide changes needed to produce the F60Y61 (sense 5'CAACTGGGCCCCAACTTTTTACAGCGTGCAGTATTTCTGG), the Y60Y61 (sense 5'CAACTGGGCCCCAACTTACTACAGCGTGCAGTATTTCTGG), the F60F61 (sense 5'CAACTGGGCCCCAACTTTTTTCAGCGTGCAGTATTTCTGG) and the L60L61 (sense 5'CAACTGGGCCCCAACTCTGTTGAGCGTGCAGTATTTCTGG) mutants. Circular mutagenesis reactions were performed with 50 ng plasmid template and 2 U Pfu DNA polymerase. The cycling protocol consisted of 30 sec 95 C, 1 min 55 C, 14 min 68 C for 18 cycles using a Perkin-Elmer model 480 PCR machine. The products were incubated with 10 U DpnI for 2 h at 37 C, and transformed to competent E. coli XL-10 cells according to manufacturers instructions. Plasmid DNA isolated from several clones was sequenced to verify that the desired mutation had been generated, and that no unwanted mutations were introduced. Plasmids were maintaned in E. coli DH5
cells and purified for transfection with QIAfilter cartridges (QIAGEN, Hilden, Germany).
In the second round of mutagenesis the TGMTR insertion between amino acid residues 47 and 48 was introduced in wt cat D1 and the described mutants using the sense oligonucleotide primer 5'GCCATGAACCGGAAGACCGGAATGACCAGGAACCCCCACTTTTCC (insertion underlined).
In the third round of mutagenesis the N45R46 to G45E46 mutation was introduced in wt cat D1 (L60Y61) and the F60Y61, F60F61, L60Y61 + TGMTR insertion, F60Y61 + TGMTR insertion and the F60F61 + TGMTR insertion D1 mutants using the sense oligonucleotide primer 5'CACATCGTGGCCATGGGCGAGAAGAACCCCCACTTTTCC (mutants without TGMTR insertion) or 5'CACATCGTGGCCATGGGCGAGAAGACCGGAATGACCAGG (mutants with TGMTR insertion).
Expression of D1 protein
The wt and mutant D1 enzymes were expressed in COS cells (65-cm2 dishes) after DEAE-dextran-mediated transfection (8 µg/dish) of the expression vectors (37). COS cells were grown in DMEM-Hams F-12 medium containing 10% FBS and 40 nM sodium selenite. Two days after transfection, the cells were rinsed with PBS and collected in 0.25 ml P100E2D10 buffer, sonicated, aliquoted, and stored at -80 C.
Assay of ORD actvity in COS cell homogenates
Two different ORD assays were done, involving 1) incubation with [3',5'-125I]rT3 and isolation and quantitation of the 125I- released or 2) incubation with [3',5'-125I]rT3S and isolation and quantitation of the 125I- released with subsequent correction via HPLC analysis of reaction products for 125I- released from [3'-125I]T2S.
1) Varying amounts of homogenates (50250 µg protein/ml) were incubated for 60 min at 37 C with 0.130 µM rT3 (100,000 cpm) in 0.1 ml P100E2D10 buffer. Reactions were stopped by addition of 0.1 ml 5% BSA on ice. Protein-bound iodothyronines were precipitated by 10% TCA on ice, and the radioiodide in the supernatant was isolated by chromatography on Sephadex LH-20 mini columns as described (30). Protein was adjusted to consume less than 30% of substrate, and deiodination was corrected for nonenzymatic deiodination in blank incubations with homogenates of mock transfected COS cells. The radioiodide production was multiplied by two to account for the random labeling and deiodination at the 3' and 5' positions of the substrate.
2) Varying amounts of homogenate (20100 µg protein/ml) were incubated for 60 min at 37 C with 302000 nM 125I-rT3S (50,000 cpm) in 0.1 ml P100E2D10. The amount of 125I- released was determined in the same way as described for rT3 ORD.
In parallel incubations 100300 nM 125I-rT3S (200,000 cpm) was incubated in the same manner and the reaction was stopped by the addition of 0.1 ml methanol. The supernatant was mixed (1:1) with 0.02 M ammonium acetate (pH 4.0) and applied to a Symmetry C18 column connected to a Alliance HPLC system (Waters, Milford, MA), which was eluted with a 20 min linear gradient of 2429% acetonitrile followed by a 6 min gradient of 2950% acetonitrile in 0.02 M ammonium acetate. Radioactivity in the eluate was monitored online using a Radiomatic A-500 flow scintillation detector (Packard, Meriden, CT). The amount of 125I- released as determined by chromatography over LH-20 columns was multiplied with the correction factor (125I- cpm + 125I-T2S cpm)/(125I- cpm) calculated from the HPLC analysis. The correction factor was 1.51.7 in most cases. In this way, only the conversion of rT3S to T2S is taken into consideration.
Assay of IRD activity in COS cell homogenates
IRD activity was measured with outer ring 125I-labeled T3S. In this assay IRD activity is the sum of 125I-T2S as well as 125I- formed. The latter is formed by outer ring deiodination of 125I-T2S. Homogenates (0.140.17 mg protein/ml final concentration) were incubated for 60 min at 37 C with 0.1 µM 125I-T3S (200,000 cpm) in 0.1 ml P100E2D10. The reaction was stopped by the addition of methanol (1:1) on ice, and the reaction mixtures were analyzed by reverse-phase HPLC as described above for rT3S.
Measurement of serum iodothyronines
Total T4, T3, and rT3 were analyzed by RIA as previously described (33).
Polyclonal antiserum production and Western blotting
Polyclonal antisera were raised in rabbits by Eurogentec SA (Seraing, Belgium) against the keyhole limpet hemocyanin (KLH) conjugate of the synthetic peptide (C)NPEEVRAVLEKLHS (human D1 amino acid residue 236249). Antiserum (designated 1068) from the final bleed was used without further purification. Homogenates from transfected COS cells (2040 µg protein) were separated on 12% SDS-PAGE gels in the Mini-Protean III cel (Bio-Rad Laboratories, Hercules, CA) according to manufacturers instructions. After electrophoresis the proteins were blotted to nitrocellulose membranes and probed with antiserum 1068 (1:500) as described previously (38). The intensity of the D1 protein bands was analyzed by densitometry. In control experiments, it was shown that the antiserum does not detect human D2 or D3 protein.
Affinity labeling of D1 with N-bromoacetyl-[125I]T3
BrAc[125I]T3 (1500 mCi/µmol) was synthesized as described (35), and HPLC analysis demonstrated that the purity was at least 85% with unreacted [125I]T3 as the main contaminant.
Solutions of BrAc[125I]T3 (100,000 cpm, 0.03 pmol) in ethanol were pipetted into microcentrifuge tubes, and the solvent was evaporated by a stream of nitrogen. After addition of 25 µl P100E2D10 and vortexing, the COS cell homogenates (50 µg protein) were added in a total volume of 50 µl P100E2D10. The mixtures were incubated for 20 min at 37 C. Reactions were terminated by addition of SDS-PAGE gel-loading buffer, and samples were analyzed by SDS-PAGE (12% gel) followed by autoradiography to Kodak BioMax MS film (Eastman Kodak, Rochester, NY) at -80 C with intensifying screen. After autoradiography, lanes were excised from the gel and the slices were counted for radioactivity. The radioactivity in slices from lanes of nontransfected cells was subtracted. The netto incorporation in cat D1 wt protein was 56% of the added amount of 125I-labeled BrAcT3.
 |
Results
|
|---|
Enzymatic activities of D1 from different species
Deiodination of various iodothyronine derivatives by human, porcine, rat, cat, and dog liver microsomes was studied. The results obtained with various substrates (rT3, rT3S, T2S, T3S) at a concentration of 10 nM are presented in Fig. 1
. It is obvious that human, and especially rat and porcine D1 prefer rT3 as substrate, whereas cat and dog D1 prefer sulfated rT3 (rT3S) as substrate. Furthermore, whereas dog D1 slowly deiodinates rT3 compared with rat, human, and porcine D1, it is obvious that cat D1 does not deiodinate rT3 at all under the conditions used. The kinetics of the ORD of rT3 were studied in detail by incubation of liver microsomes with varying rT3 concentrations (Table 1
). The Km values for ORD of rT3 by cat D1 are 2250 times higher compared with human, porcine and rat D1. Cat D1 is even less efficient than dog D1 with regard to ORD of rT3 as reflected in the 3-fold higher Km value and the 5-fold lower Vmax value.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 1. Rate of deiodination of different iodothyronine derivatives by human, pig, rat, cat and dog liver microsomes. ORD activity was measured by incubation of diluted microsomal fractions in P100E2D10 with 10 nM (100,000 cpm) 125I-labeled substrate (rT3, rT3S, T2S) for 60 min at 37 C. IRD activity was measured by incubation of diluted microsomal fractions in P100E2D10 with 10 nM (200,000 cpm) 125I-T3S for 60 min at 37 C. The reaction was stopped by the addition of methanol, and analyzed by reverse-phase HPLC.
|
|
The slow deiodination of rT3 by cat liver microsomes could in part be the consequence of a low D1 protein expression level and/or it could be an intrinsic property of this enzyme. To answer this question, Western blots were made of cat, porcine, and human liver microsomal preparations using a newly developed D1 antiserum. This antiserum recognizes an epitope at the C-terminus of human D1 protein which is conserved in porcine and cat D1 proteins. The antiserum detects proteins with an apparent molecular mass of 2425 kDa in cat liver microsomes and 2728 kDa in human and porcine liver microsomes (Fig. 2
). The molecular mass of human and porcine D1 is in line with the value of 2728 kDa reported after affinity labeling with 125I-BrAcT3 of human, porcine, and rat liver microsomes (9). For cat and dog liver D1, somewhat lower molecular mass values of 2526 kDa were found after affinity labeling (9, 31). The expression level of cat D1 protein is almost equal to that of porcine D1 as judged by Western blot (see Fig. 2
); nevertheless, the rT3 ORD activity by cat D1 is much lower than that of porcine D1. In other words, the slow deiodination of rT3 by cat D1 is an intrinsic property of the enzyme, as was also reflected in the increased Km value for rT3 deiodination (Table 1
).

View larger version (45K):
[in this window]
[in a new window]
|
FIG. 2. Western blot analysis of cat, porcine, and human liver microsomes. Twenty micrograms of microsomal protein were probed with a new anti-D1 antiserum generated in our laboratory against an 14-amino-acid peptide corresponding to the C-terminal sequence of human D1 (see Materials and Methods). The signal was absent when the microsomes were probed with preimmune serum (not shown). Migration distances of molecular mass markers (kilodaltons) are indicated.
|
|
Serum rT3 concentration in euthyroid cats
The rather inefficient deiodination of rT3 under our in vitro conditions suggests that hepatic metabolism of rT3 by D1 cannot proceed at a significant rate in the cat. This could be reflected in elevated serum rT3 concentrations. In an effort to investigate this, serum T4, T3, and rT3 levels were measured in sera from two cats and compared with mean reference values for cats and humans (Table 2
). Although the T3/T4 ratios for cats and humans are in the same range, the rT3/T4 ratios for cats are elevated compared with humans. Because only two cats were investigated, these results should be interpreted with caution, but they suggest that rT3 metabolism in the cat is less efficient than in humans.
Cloning and characterization of cat D1
Based on homology between conserved amino acid sequences in known D1 proteins (6, 21, 22, 23, 24, 25) oligonucleotide primers were designed corresponding to sequences around the start and stop codons (see Materials and Methods). RT-PCR with these primers on cat liver total RNA produced a DNA fragment of about 800 bp, which was subcloned and sequenced. Alignment of the deduced amino acid sequence with the reported sequences of other deiodinases (Fig. 3
) revealed 80% overall identity with human, rat and porcine D1. The same alignment showed 92% overall identity with dog D1. Deiodinases contain a single SeC residue in the catalytic center, which is essential for catalytic activity (19, 20). The core catalytic center of about 15 amino acid residues around the SeC residue is completely conserved between rat, human, porcine, dog, and cat D1. This indicates that the observed differences in substrate preference are probably caused by amino acid variations in other functional domain(s).

View larger version (77K):
[in this window]
[in a new window]
|
FIG. 3. Alignment of the deduced amino acid sequences of cat, dog, human, rat, and Fundulus heteroclitus (killifish) type I iodothyronine deiodinase (D1). The selenocysteine residue in the catalytic center is indicated by U (residue 121 in cat D1).
|
|
Transient expression in COS cells of the cDNA fragment encoding cat D1 carried in the pcDNA3 expression vector as a chimeric construct with the rat D1 SECIS element, resulted in the synthesis of a functional deiodinase (Table 3
). The Km for ORD of rT3 by the recombinant cat D1 enzyme was as high as that of the native D1 enzyme (15 vs. 11 µM). The Km of cat D1 is 80 times higher than rat D1, and assuming equal protein expression levels it appears that the catalytic efficiency (Vmax/Km ratio) of cat D1 is 70-fold reduced compared with rat D1. The ORD of rT3 by cat D1 is facilitated by sulfation (Vmax/Km rT3 = 3 and Vmax/Km rT3S = 81). Both native and recombinant cat D1 ORD activity is effectively inhibited by propylthiouracil, and the IC50 value is 510 µM (not shown).
Site-directed mutagenesis of cat D1 and ORD of rT3 or rT3S
Aim of the mutagenesis experiments was to improve the ORD of rT3 by cat D1 without affecting the efficient ORD of rT3S. In other words, to create a mutant cat D1 enzyme with characteristics similar to those of rat D1 which deiodinates rT3 and rT3S with equal efficiency (see Table 3
). Between amino acid residues 40 and 70, several remarkable differences exist between cat and rat/human D1, in particular the deletion of the TGMTR sequence (amino acid residues48, 49, 50, 51, 52) in cat D1 (Fig. 4
). Other differences are the substitution of F65L/F66Y (human/rat vs. cat D1) and the substitution of G45N/Q46R (rat vs. cat D1) or G45N/E46R (human vs. cat D1).

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 4. Amino acid sequences of CWT and mutant cat D1 enzymes (CM1CM15) between amino acid residues 40 and 70.
|
|
The effects of the various mutations alone or in combination on the ORD of rT3 are summarized in Table 4
and Fig. 5
. The L65F substitution (CM1 and CM2) provides only a small improvement in catalytic efficiency (Vmax/Km ratio) by doubling of the Vmax value. On the other hand, the L65Y and Y66L substitutions (CM3 and CM4) inactivate the enzyme.

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 5. Kinetic parameters for wt and mutant cat D1 enzymes depicted as Vmax/Km ratios (after standardization by Western blotting) for the substrates rT3 and rT3S.
|
|
Surprisingly, the TGMTR insertion (CM5) in itself does not improve deiodination of rT3. Only in combination with the L65F substitution further improvements in catalytic efficiency are obtained (CM6 and CM7). Similarly, the combined N45G and R46E substitutions provide only a small improvement in deiodinase activity (CM10), but in combination with the L65F or TGMTR insertion greater increases in catalytic efficiency are obtained (CM11, CM12, and CM13). Combination of all three mutations, that is the L65F, N45G and R46E substitutions plus the TGMTR insertion strongly improved the catalytic efficiency (CM14 and CM15). These mutations seem to influence each other in a positive fashion. For example, the TGMTR insertion alone has no effect (CM5) but the TGMTR insertion in CM11 (giving CM14) and CM12 (giving CM15) results in a 5-fold increase in catalytic efficiency. The Km for ORD of rT3 by CM14 and CM15 is 1 µM or less, i.e. a >15-fold decrease vs. wt (Table 4
). A Phe residue at position 65, as in rat/human D1, is important for efficient ORD because CM13 is clearly less active than CM15. In the absence of Phe at position 65, as in CWT (cat D1 wt), a Tyr at position 66 is essential for activity because CM4 and CM9 are inactive.
With regard to ORD of rT3S, the catalytic efficiency of the CM1 to CM13 (except CM12) mutants was lower than that of the cat D1 wt enzyme (Fig. 5
). This is the consequence of increased Km values and/or decreased Vmax values (Table 4
). Especially the introduction of the TGMTR insertion (CM5) strongly reduced catalytic efficiency. Single mutants or double mutants (for instance CM6 and CM13) have reduced catalytic efficiency, whereas the triple mutants CM14 and CM15 have increased catalytic efficiency compared with wt. Similarly as for ORD of rT3 a Phe residue at position 65 is important because the catalytic efficiency of CM14/CM15 is 6-fold higher than CM13. The mutants CM14 and CM15 have similar Km values as the cat D1 wt enzyme and a 4-fold increased catalytic efficiency. All in all, the kinetic characteristics of CM14 and CM15 resemble those of rat/human D1. These mutants still prefer rT3S above rT3 as substrate, but the difference in catalytic efficiency is much smaller than in the wt cat D1 (2-fold vs. 30-fold).
Site-directed mutagenesis of cat D1 and IRD of T3S
The preferred substrate for IRD by cat D1 is T3S (Fig. 1
). In this respect, cat D1 resembles rat/human D1 for which also IRD of T3 is strongly facilitated by sulfation (7, 42, 43). IRD activity was measured with outer ring 125I-labeled T3S. In this assay IRD activity is the sum of 125I-T2S and 125I- formed. The latter is formed by ORD of 125I-T2S. Figure 6
shows the level of the different deiodination products after incubation of 0.1 µM T3S with the D1 mutants. The IRD levels of CWT, CM1, CM2, CM5, CM6, CM7, CM8, CM11, CM12, CM14, and CM15 showed relatively little variation. The accumulation of T2S in incubations with CM1, CM2, CM5, CM6, CM7, CM8, CM11, and CM12 correlates well with their low rT3 and rT3S ORD activity. In incubations with CWT, CM14 and CM15 significant amounts of T2S are further deiodinated (ORD), in accordance with their efficient deiodination of rT3S. The T3S IRD activity of CM10 and CM13 was increased compared with CWT. Not only for ORD but also for IRD a tyrosine at position 66 is important because CM4 and CM9 are inactive. A Phe or Tyr residue at position 65 is not essential because CM5, CM10, and CM13 are more or equally active as CWT, CM3, CM8, CM14, and CM15.

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 6. Inner ring deiodination of T3S (0.1 µM) by wild-type and mutant cat D1 enzymes in COS cell homogenates (0.140.17 mg protein/ml). Rat liver and cat liver microsomes (50 µg protein / ml) were analyzed under similar conditions. IRD activity was measured with outer ring 125I-labeled T3S. In this assay IRD activity is the sum of 125I-T2S as well as 125I- formed. The latter is formed by ORD of 125I-T2S.
|
|
Quantitation of cat D1 mutant enzymes
BrAc[125I]T3 has been used extensively as affinity label for D1, allowing the specific identification of D1 in microsomal fractions of liver and kidney (9, 10, 31, 35). Affinity labeling with BrAc[125I]T3 was also used for the quantitation of D1 expression levels by saturation analysis in microsomal preparations and homogenates of transfected cells, allowing the calculation of substrate turnover numbers (9, 19, 22).
Our initial plan was to use affinity labeling for the quantitation of the various cat D1 mutants. However, when equal amounts of homogenate protein were used in affinity labeling experiments up to 6-fold differences in labeling intensity were observed (Fig. 7
). Especially CM3 (not shown), CM4 (not shown), CM6, CM7, CM11, and CM12 were only weakly labeled (
20% of CWT), precluding saturation analysis for the quantitation of expression levels. In fact, the labeling of CWT was the most intense. The net incorporation of 125I-BrAcT3 in CWT was about 6%. The various mutations likely also influenced the interaction with the BrAcT3-affinity label.

View larger version (67K):
[in this window]
[in a new window]
|
FIG. 7. Labeling patterns obtained by SDS-PAGE and autoradiography after reaction of COS cell homogenates (100 µg protein) containing cat D1 wt or mutant enzymes as indicated with BrAc[125I]T3 in the presence of 10 mM DTT at 37 C. Cat liver microsomes (25 µg protein) were analyzed under similar conditions. Migration distances of molecular mass markers (kilodaltons) are indicated.
|
|
As an alternative to affinity labeling we performed Western blotting using a D1 antiserum directed to the C terminus of D1 protein (Fig. 8
). The mutants with the TGMTR insertion, for instance CM5, have a slightly reduced mobility compared with CWT. The intensity of the protein bands was determined by densitometry and the Vmax/Km ratios in Fig. 5
were corrected for the measured differences in protein levels. The Vmax values presented in Table 4
are the measured, that is uncorrected values. The Western blotting was repeated two times with homogenates from different transfections, and the expression level of most mutants was close to that of CWT (between 0.7- and 1.1-fold of CWT). The CM6, CM11, and CM12 mutants had reduced expression levels (0.5- to 0.6-fold of CWT), whereas CM8 and CM9 had a more (<0.3-fold of CWT) reduced expression level. The correction of the Vmax/Km ratios (Table 4
and Fig. 5
) for differences in protein expression levels did not cause big changes in the relative catalytic efficiency of the various mutant D1 enzymes, nor did it influence the conclusions drawn.

View larger version (55K):
[in this window]
[in a new window]
|
FIG. 8. Western blots of homogenates made from COS cells transiently expressing cat D1 wt or D1 mutant enzymes as indicated. Cells were lysed as described, and 2030 µg of total protein were analyzed on 12% SDS-PAGE and probed with anti-D1 antibody as described in Materials and Methods. Migration distances of molecular mass markers (kilodaltons) are indicated in the lower panel.
|
|
 |
Discussion
|
|---|
The aim of the present study was to investigate the molecular basis for the substrate selectivity of cat D1, more in particular the weak interaction with nonsulfated substrates as rT3. By site-directed mutagenesis of cat D1 it was found that a combination of several changes was needed to significantly improve the deiodination of rT3. While these results provide more detailed insight in D1 substrate interaction, an important issue is the physiological role of D1 in cat liver. A substantial fraction of circulating T3 is derived from ORD of T4 by liver D1, at least in rats and humans where detailed investigations were performed (2, 3, 4, 5). Due to the presence of an essential SeC residue in D1 it is conceivable that selenium deficiency of rats caused reduction of hepatic D1 activity and increased serum T4 levels (44, 45, 46). From the fact that selenium deficiency in kittens caused increased plasma T4 and decreased T3 levels (32) it might be concluded that also in cats (liver) D1 provides a large portion of plasma T3. However, an additional role for D2 in this regard is still possible. We have not detected D2 activity (low Km and propylthiouracil-insensitive ORD of T4) in cat liver homogenates.
rT3 appears to be the preferred substrate for D1 in rats and humans, whereas rT3S is the preferred substrate for cat D1. The role of the deiodination of the biologically inactive rT3 may be the recovery of the trace element iodine. Sulfated iodothyronines as T4S and T3S are deiodinated by human/rat D1 at a significantly faster rate than the corresponding nonsulfated iodothyronines (42, 43). The same is true for cat D1 in the sense that deiodination of rT3 and T2 is stimulated by prior sulfation. Because rT3 ORD activity of cat D1 is very low, it is likely that in cats metabolism of rT3 occurs via prior sulfation with subsequent deiodination. The balance between the activity of sulfotransferases, sulfatases and deiodinases acting upon iodothyronines is important for the regulation of thyroid hormone levels, especially during fetal development (43, 47, 48). We have indeed measured T2 and rT3 sulfation activity in cat liver cytosol (not shown), but we have not investigated the responsible sulfotranferase(s) nor their kinetic characteristics. Meanwhile, the serum rT3/T4 ratio in cats is elevated compared with humans, indicating reduced efficiency of rT3 metabolism in cats. Apart from D1, other differences between cat and human, for instance in serum binding-protein concentrations and affinities as well as production rates, might influence the plasma rT3 levels.
It is remarkable that a combination of changes that is, the substitution of Phe for Leu at position 65, the insertion of five amino acids (TGMTR) and the mutation of N45R46 to G45E46, is necessary to obtain mutant cat D1 enzymes (CM14 and CM15) with catalytic efficiencies for rT3 ORD comparable to those of rat/human D1. In fact, the combination of the changes causes a 4-fold further increase in the efficiency for ORD of rT3S compared with cat D1 wt. Each of the changes alone or even combinations of two changes has either no or only a small impact on rT3 ORD, whereas for rT3S ORD they reduce catalytic efficiency. The substitution of Phe for Leu65 causes a big increase in catalytic efficiency both for rT3 and rT3S ORD. This is most clear in the context of the other two changes, i.e. the TGMTR insertion and the GE for NR substitution (compare CM13 with CM14). In this regard our results are in line with previous studies on dog D1 which suggested the interaction of the inner ring of rT3 with the aromatic ring of Phe65 (22, 30). The substitution of Tyr for Leu65 as such is detrimental or causes only a small increase in activity in combination with the TGMTR insertion. We did not test the Leu65Tyr mutation in the context of the TGMTR insertion and the NR to GE change. Nevertheless, it is likely that this mutant would have improved rT3 ORD activity compared with cat D1 wt although probably not to the same extent as mutants with a Phe at position 65. Recently, D1 from the killifish Fundulus heteroclitus was cloned (25), and it contains a Tyr residue at position 65 (Y65G66) in combination with the insertion VTMTQ and G45E46 (Fig. 3
). Fundulus heteroclitus D1 has a Km for ORD of rT3 in the same range as rat/human D1 (0.12 µM), but no comparative data on catalytic efficiencies (Vmax/Km ratios) for rT3 and rT3S are available. The substitution of Leu for Tyr66 completely inactivates cat D1 (CM4 and CM9). This might indicate that in wt cat D1 rT3 and rT3S interact with Tyr 66 in the absence of Phe at position 65.
The insertion of TGMTR as such in cat D1 (CM5) does not improve ORD of rT3 and greatly decreases ORD of rT3S. However, the TGMTR insertion is important in the context of a Phe at residue 65 and the NR to GE change. The ORD efficiency of CM14/CM15 is about 5-fold higher than CM11/CM12 (no TGMTR insertion) both for rT3 and rT3S. Either the positioning of Phe65 toward the inner-ring of rT3 and rT3S is improved by this insertion and/or the positioning of the outer-ring toward the catalytic center (SeC) is improved. From the fact that especially for rT3 the increased Vmax/Km ratio is mainly caused by a decrease of the Km value it might be concluded that the main effect is improved interaction of Phe65 with rT3. Our results are in contrast to the study of Toyoda et al. (30) who found that the TGMTR insertion in dog D1 does not improve ORD of rT3, whereas it inhibits ORD of T2S, and therefore Bianco et al. (3) concluded that "these five amino acids are not critical to D1 function." However, Toyoda et al. (30) did not test the TGMTR insertion in the context of the substitution of Phe for Leu at position 65 and the GE substitution for NR but only as such in wt dog D1. They may, thus, have overestimated the importance of the substitution of Phe for Leu65 in dog D1. Our results with cat D1 show that the three changes as such cause only small improvements in rT3 ORD, but that the combination of all three changes is synergistic and that each change is necessary.
An intriguing property of wt cat D1 is the facilitated deiodination of rT3S. Both rT3 and rT3S are only deiodinated in the outer ring, and therefore both substrates bind in such a way that the iodines of the outer ring are in close proximity to the catalytic center, that is the SeC residue. The negatively charged sulfate group of rT3S might interact with the positively charged side group of a basic amino acid (Lys, Arg), thereby stabilizing the interaction with D1. Initially, we thought that R46, which is unique for cat D1 at that position fulfills this role. However, the mutation R46E did not inhibit rT3S deiodination. Of course, another basic amino acid residue in D1 might be involved. Alternatively, conformational differences between rT3 and rT3S may influence interaction with D1. Crystallographic data support a so-called antiskewed conformation for rT3 (49, 50), but as far as we know no structural data are available for rT3S.
The IRD activity with T3S showed relatively little variation with the different constructs, especially if one compares the IRD activity of CWT and CM14/CM15. In other words, none of the mutated residues in the 4070 residue region involved in rT3 and rT3S interaction/ORD are essential for T3S interaction and IRD. The fact that liver microsomal fractions catalyze both ORD and IRD has always been difficult to understand, however, because the cloning of D1 it is certain that this involves a single enzyme (6, 7, 8, 51, 52, 53). The fact that D1 catalyzes ORD and IRD suggests different orientations of substrate binding within a single site, so that either the iodines of the inner ring or of the outer ring are in close proximity to the catalytic center. Alternatively, two different substrate binding sites connected with deiodination might exist, one for ORD (rT3, rT3S) and one for IRD (T3S). On first sight our data support the two substrate binding site model, consisting of a site which binds substrates with two iodines in the outer ring and involved in ORD and one site that binds substrates with two iodines in the inner ring and involved in IRD. This could explain why T4 undergoes ORD as well as IRD. So T4, with two iodines in both rings, would have to interact with both sites. A problem with this model is the shift in deiodination preference of T4 upon sulfation. IRD of T4 by rat/human D1 is strongly facilitated following its sulfation, whereas ORD of T4S is undetectable (43, 54). This would imply that the binding site connected with ORD would accept rT3S and T2S but not T4S, which is difficult to explain. All in all, the most simple model is to assume that D1 has a single substrate binding site with limited substrate specificity and that the various substrates bind in orientations which either favor ORD or IRD. More detailed insights in D1 structure-function relationships must come from the three-dimensional structure when this is resolved by crystallographic studies. Unfortunately, these studies are greatly hampered by the difficulties encountered with overexpressing this membrane-integrated enzyme in a soluble active form.
 |
Acknowledgments
|
|---|
We thank Ronald van der Wal for assistance with DNA-sequencing of plasmids. We are grateful to Dr. Jan Mol (University of Utrecht, School of Veterinary Medicine, Utrecht, The Netherlands) for providing us with cat and dog liver tissue.
 |
Footnotes
|
|---|
This work was supported by The Netherlands Organization for Scientific research (NWO grant 903-40-194) and the Quality of Life Research program of the European Union (FP5 Grant QLG3-CT-2000-00930).
This work was presented in part at the 74th Annual Meeting of the American Thyroid Association (2002), Los Angeles, California (Abstract 204).
The cat D1 iodothyronine deiodinase sequence has been submitted to the GenBank database under accession number AY347714.
Abbreviations: CWT, Cat D1 wt; D1, type I iodothyronine deiodinase; DTT, dithiothreitol; His, histidine; Km, Michaelis constant; ORD, outer ring deiodination; rT3, reverse T3; rT4, reverse T4; SeC, selenocysteine residue SECIS, selenocysteine insertion sequence element; T2, 3,3'-diiodothyronine; T4S and T3S, sulfated iodothyronines; Vmax, maximal velocity; wt, wild-type.
Received June 10, 2003.
Accepted for publication August 6, 2003.
 |
References
|
|---|
- Darras VM, Hume R, Visser TJ 1999 Regulation of thyroid hormone metabolism during fetal development. Mol Cell Endocrinol 151:3747[CrossRef][Medline]
- Köhrle J 2002 Iodothyronine deiodinases. Methods Enzymol 347:125167[Medline]
- Bianco AC, Salvatore D, Gereben B, Berry ML, Larsen PR 2002 Biochemistry, cellular and molecular biology, and physiological roles of the iodothyronine deiodinases. Endocr Rev 23:3889[Abstract/Free Full Text]
- van Doorn J, van der Heide D, Roelfsema F 1983 Sources and quantity of 3,5,3'-triiodothyronine in several tissues of the rat. J Clin Invest 72:17781792
- Nguyen TT, Chapa F, DiStefano III JJ 1998 Direct measurement of the contributions of type I and type II 5'-deiodinases to whole body steady state 3, 5, 3'-triiodothyronine production from thyroxine in the rat. Endocrinology 139:46264633[Abstract/Free Full Text]
- Berry MJ, Banu L, Larsen PR 1991 Type I iodothyronine deiodinase is a selenocysteine containing enzyme. Nature 349:438440[CrossRef][Medline]
- Moreno M, Berry MJ, Horst C, Thoma R, Coglia F, Harney JW, Larsen PR, Visser TJ 1994 Activation and inactivation of thyroid hormone by type I iodothyronine deiodinase. FEBS Lett 344:143146[CrossRef][Medline]
- Visser TJ, Fekkes D, Docter R, Hennemann G 1978 Sequential deiodination of thyroxine in rat liver homogenate. Biochem J 174:221229[Medline]
- Schoenmakers CHH, Pigmans IGAJ, Visser TJ 1992 Species differences in liver type I iodothyronine deiodinase. Biochim Biophys Acta 1121:160166[CrossRef][Medline]
- Köhrle J, Rasmussen UB, Ekenbarger DM, Alex S, Rokos H, Hesch RD, Leonard JL 1990 Affinity labeling of rat liver and kidney type I deiodinase. J Biol Chem 265:61556163[Abstract/Free Full Text]
- Safran M, Leonard JL 1991 Comparison of the physicochemical properties of type I and type II iodothyronine 5'-deiodinase. J Biol Chem 266:32333238[Abstract/Free Full Text]
- Leonard JL, Visser TJ, Leonard DB 2001 Characterization of the subunit structure of catalytically active type I iodothyronine deiodinase. J Biol Chem 276:26002607[Abstract/Free Full Text]
- Curcio-Morelli C, Gereben B, Zavacki A, Kim BW, Huang S, Harney JW, Larsen PR, Bianco AC 2003 In vivo dimerization of types 1, 2 and 3 iodothyronine selenodeiodinases. Endocrinology 144:937946[Abstract/Free Full Text]
- Leonard JL, Rosenberg IN 1978 Subcellular distribution of thyroxine 5'-deiodinase in the rat kidney: a plasma membrane location. Endocrinology 103:274280[Abstract/Free Full Text]
- Leonard JL, Ekenbarger DM, Frank SJ, Farwell AP, Köhrle J 1991 Localization of type I iodothyronine 5'-deiodinase to the basolateral plasma membrane in renal cortical epithelial cells. J Biol Chem 266:1126211269[Abstract/Free Full Text]
- Fekkes D, van Overmeeren-Kaptein E, Docter R, Hennemann G, Visser TJ 1979 Location of rat liver iodothyronine deiodinating enzymes in the endoplasmic reticulum. Biochim Biophys Acta 587:1219[Medline]
- Auf Dem Brinke D, Hesch RD, Köhrle J 1979 Re-examination of the subcellular localization of thyroxine 5'-deiodination in rat liver. Biochem J 180:273279[Medline]
- Baqui MM, Gereben B, Harney JW, Larsen PR, Bianco AC 2000 Distinct subcellular localization of transiently expressed types 1 and 2 iodothyronine deiodinases as determined by immunofluorescence confocal microscopy. Endocrinology 141:43094312[Abstract/Free Full Text]
- Berry MJ, Maia AL, Kieffer JD, Harney JW, Larsen PR 1992 Substitution of cysteine for selenocysteine in type I iodothyronine deiodinase reduces the catalytic efficiency of the protein but enhances its translation. Endocrinology 131:18481852[Abstract/Free Full Text]
- Berry MJ, Kieffer JD, Harney JW, Larsen PR 1991 Selenocysteine confers the biochemical properties characteristic of the type I iodothyronine deiodinase. J Biol Chem 266:1415514158[Abstract/Free Full Text]
- Mandel SJ, Berry M, Kieffer JD, Harney JW, Warne RL, Larsen PR 1992 Cloning and in vitro expression of the human selenoprotein, type I iodothyronine deiodinase. J Clin Endocrinol Metab 75:11331139[Abstract]
- Toyoda N, Harney JW, Berry MJ, Larsen PR 1994 Identification of critical amino acids for 3, 3', 5'-triiodothyronine deiodination by human type I deiodinase based on comparative functional-structural analysis of the human, dog and rat enzymes. J Biol Chem 269:2032920334[Abstract/Free Full Text]
- van der Geyten S, Sanders J, Kaptein E, Darras VM, Kuhn ER, Leonard JL, Visser TJ 1997 Expression of chicken hepatic type I and III iodothyronine deiodinases during embryonic development. Endocrinology 138:51445152[Abstract/Free Full Text]
- Sanders JP, van der Geyten S, Kaptein E, Darras VM, Kühn ER, Leonard JL, Visser TJ 1997 Characterization of a propylthiouracil-insensitive type I iodothyronine deiodinase. Endocrinology 138:51535160[Abstract/Free Full Text]
- Orozco A, Villalobos P, Jeziorski MC, Valverde-R C 2003 The liver of Fundulus heteroclitus expresses deiodinase type I mRNA. Gen Comp Endocrinol 130:8491[CrossRef][Medline]
- Toyoda N, Berry MJ, Harney JW, Larsen PR 1995 Topological analysis of the integral membrane protein, type I iodothyronine deiodinase. J Biol Chem 270:1231012318[Abstract/Free Full Text]
- Mol JA, Docter R, Hennemann G, Visser TJ 1984 Modification of rat liver 5'-deiodinase activity with diethylpyrocarbonate and rose bengal: evidence for an active site histidine residue. Biochem Biophys Res Commun 120:2836[CrossRef][Medline]
- Berry MJ 1992 Identification of essential histidine residues in rat type I iodothyronine deiodinase. J Biol Chem 267:1805518059[Abstract/Free Full Text]
- Laurberg P, Boye N 1982 Outer and inner ring monodeiodination of thyroxine by dog thyroid and liver: a comparative study using a particulate cell fraction. Endocrinology 110:21242130[Abstract/Free Full Text]
- Toyoda N, Kaptein E, Berry MJ, Harney JW, Larsen PR, Visser TJ 1997 Structure-activity relationships for thyroid hormone deiodination by mammalian type I iodothyronine deiodinases. Endocrinology 138:213219[Abstract/Free Full Text]
- Foster DJ, Thoday KL, Beckett GJ 2000 Thyroid hormone deiodination in the domestic cat. J Mol Endocrinol 24:119126[Abstract]
- Yu S, Howard KA, Wedekind KJ, Morris JG, Rogers QR 2002 A low-selenium diet increases thyroxine and decreases 3, 5, 3'-triiodothyronine in the plasma of kittens. J Anim Physiol Anim Nutr 86:3641[Medline]
- Visser TJ, Docter R, Hennemann G 1977 Radioimmunoassay of reverse-triiodothyronine. J Endocrinol 73:395396[Abstract/Free Full Text]
- Mol JA, Visser TJ 1985 Synthesis and some properties of sulfate esters and sulfamates of iodothyronines. Endocrinology 117:17[Abstract/Free Full Text]
- Mol JA, Docter R, Kaptein E, Jansen G, Hennemann G, Visser TJ 1984 Inactivation and affinity-labeling of rat liver iodothyronine deiodinase with N-bromo-acetyl-3, 3', 5-triiodothyronine. Biochem Biophys Res Commun 124:475483[CrossRef][Medline]
- Visser TJ, Kaptein E, Terpstra OT, Krenning EP 1988 Deiodination of thyroid hormone by human liver. J Clin Endocrinol Metab 67:1723[Abstract/Free Full Text]
- Kuiper GGJM, Klootwijk W, Visser TJ 2002 Substitution of cysteine for a conserved alanine residue in the catalytic center of type II iodothyronine deiodinase alters interaction with reducing cofactor. Endocrinology 143:11901198[Abstract/Free Full Text]
- Kuiper GGJM, Klootwijk W, Visser TJ 2003 Substitution of cysteine for selenocysteine in the catalytic center of type III iodothyronine deiodinase reduces catalytic efficiency and alters substrate preference. Endocrinology 144:25052513[Abstract/Free Full Text]
- Sambrook J, Russell DW 2001 In vitro mutagenesis using double-stranded DNA templates: selection of mutants with Dpn I. In: Molecular cloning, a laboratory manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press; 13.1913.25
- Parikh A, Guengerich FP 1998 Random mutagenesis by whole-plasmid PCR amplification. Biotechniques 24:428431[Medline]
- Kaptein EM, Hays MT, Ferguson DC 1994 Thyroid hormone metabolisma comparative evaluation. Vet Clin North Am Small Anim Pract 24:431466[Medline]
- Otten MH, Mol JA, Visser TJ 1983 Sulfation preceding deiodination of iodothyronines in rat hepatocytes. Science 221:8183[Abstract/Free Full Text]
- Visser TJ 1994 Sulfation and glucuronidation pathways of thyroid hormone metabolism. In: Wu S-Y, Visser TJ, eds. Thyroid hormone metabolism: molecular biology and alternate pathways. Boca Raton, FL: CRC Press; pp 85117
- Beckett GJ, Beddows SE, Morrice PC, Nicol F, Arthur JR 1987 Inhibition of hepatic deiodination of thyroxine is caused by selenium deficiency in rats. Biochem J 248:443447[Medline]
- Behne D, Kyriakopoulos A, Meinhold H, Kohrle J 1990 Identification of type I iodothyronine 5'-deiodinase as a selenoenzyme. Biochem Biophys Res Commun 173:11431149[CrossRef][Medline]
- DePalo D, Kinlaw WB, Zhao C, Engelberg-Kulka H, St Germain DL 1994 Effect of selenium deficiency on type I 5'-deiodinase. J Biol Chem 269:1622316228[Abstract/Free Full Text]
- Kester MHA, Kaptein E, Roest TJ, van Dijk C, Tibboel D, Meinl W, Glatt H, Coughtrie MWH, Visser TJ 1999 Characterization of human iodothyronine sulfotranserases. J Clin Endocrinol Metab 84:13571364[Abstract/Free Full Text]
- Kester MHA, Kaptein E, van Dijk C, Roest TJ, Tibboel D, Coughtie MWH, Visser TJ 2002 Characterization of iodothyronine sulfatase activities in human and rat liver and placenta. Endocrinology 143:814819[Abstract/Free Full Text]
- Kohrle J, Aufmkolk M, Rokos H, Hesch R-D, Cody V 1986 Rat liver iodothyronine monodeiodinaseevaluation of the iodothyronine ligand-binding site. J Biol Chem 261:1161311622[Abstract/Free Full Text]
- Okabe N, Fujiwara T, Yamagata Y, Tomita K 1982 The crystal structure of a major metabolite of thyroid hormone: 3, 3', 5'-triiodo-L-thyronine. Biochim Biophys Acta 717:179181[Medline]
- Visser TJ, Fekkes D, Docter R, Hennemann G 1979 Kinetics of enzymic reductive deiodination of iodothyronines. Biochem J 179:489495[Medline]
- Fekkes D, Hennemann G, Visser TJ 1982 Evidence for a single enzyme in rat liver catalysing the deiodination of the tyrosyl and the phenolic ring of iodothyronines. Biochem J 201:673676[Medline]
- Heinen E, Basler M, Herrmann J, Hafner D, Kruskemper HL 1980 Enzyme kinetic and substrate-binding studies of the thyroxine to 3, 5, 3'-triiodothyronine convertin enzyme in the rat liver microsomal fraction. Endocrinology 107:11981204[Abstract/Free Full Text]
- Visser TJ 1994 Role of sulfation in thyroid hormone metabolism. Chem Biol Interact 92:293303[CrossRef][Medline]
This article has been cited by other articles:

|
 |

|
 |
 
E. Silvestri, A. Lombardi, P. de Lange, L. Schiavo, A. Lanni, F. Goglia, T. J. Visser, and M. Moreno
Age-related changes in renal and hepatic cellular mechanisms associated with variations in rat serum thyroid hormone levels
Am J Physiol Endocrinol Metab,
June 1, 2008;
294(6):
E1160 - E1168.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. G. J. M. Kuiper, W. Klootwijk, G. Morvan Dubois, O. Destree, V. M. Darras, S. Van der Geyten, B. Demeneix, and T. J. Visser
Characterization of Recombinant Xenopus laevis Type I Iodothyronine Deiodinase: Substitution of a Proline Residue in the Catalytic Center by Serine (Pro132Ser) Restores Sensitivity to 6-Propyl-2-Thiouracil
Endocrinology,
July 1, 2006;
147(7):
3519 - 3529.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. H. M. Klaren, R. Haasdijk, J. R. Metz, L. M. C. Nitsch, V. M. Darras, S. Van der Geyten, and G. Flik
Characterization of an Iodothyronine 5'-Deiodinase in Gilthead Seabream (Sparus auratus) that Is Inhibited by Dithiothreitol
Endocrinology,
December 1, 2005;
146(12):
5621 - 5630.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. G J M Kuiper, W. Klootwijk, and T. J Visser
Expression of recombinant membrane-bound type I iodothyronine deiodinase in yeast
J. Mol. Endocrinol.,
June 1, 2005;
34(3):
865 - 878.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. W. J. S. Wassen, W. Klootwijk, E. Kaptein, D. J. Duncker, T. J. Visser, and G. G. J. M. Kuiper
Characteristics and Thyroid State-Dependent Regulation of Iodothyronine Deiodinases in Pigs
Endocrinology,
September 1, 2004;
145(9):
4251 - 4263.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. A. Shepherdley, W. Klootwijk, K. W. Makabe, T. J. Visser, and G. G. J. M. Kuiper
An Ascidian Homolog of Vertebrate Iodothyronine Deiodinases
Endocrinology,
March 1, 2004;
145(3):
1255 - 1268.
[Abstract]
[Full Text]
[PDF]
|
 |
|