| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLE |
Endocrinology Unit, Departments of Medical Sciences (M.E.C., B.R.W., J.R.S.), and Clinical Neuroscience (P.A.T.K.), University of Edinburgh, Western General Hospital, Crewe Road South, Edinburgh EH4 2XU, United Kingdom
Address all correspondence and requests for reprints to: Professor Jonathan R. Seckl, Endocrinology Unit, Molecular Medicine Centre, Western General Hospital, Edinburgh EH4 2XU, United Kingdom. E-mail: j.seckl{at}ed.ac.uk.
| Abstract |
|---|
|
|
|---|
1 to
2 expression and a reduction in lipoprotein lipase mRNA (by 28%, P < 0.02). Adipose leptin, uncoupling protein-3 and resistin mRNAs, muscle GLUT-4, and circulating lipids were not affected by prenatal dex. These data suggest that hyperglycemia in 6-month-old rats exposed to dexamethasone in utero is not due to attenuated peripheral glucose disposal. However, increased GR and attenuated fatty acid uptake specifically in visceral adipose are consistent with insulin resistance in this crucial metabolic depot and could indirectly contribute to increased hepatic glucose output. | Introduction |
|---|
|
|
|---|
Glucocorticoids are important in the prenatal development of various organ systems and elevated glucocorticoid levels during pregnancy are associated with in utero growth retardation (9, 10). Rats exposed to dexamethasone (dex) during the third week of pregnancy become hypertensive (11, 12), hyperglycemic, glucose intolerant, and hyperinsulinemic in adulthood (13).
Hyperglycemia in these offspring could arise through failure of the inhibition of hepatic glucose output by insulin (14) and/or the attenuation of glucose uptake by the insulin-regulated glucose transporter (GLUT-4) in skeletal muscle and adipose tissue (15). The pattern of glucose intolerance (raised fasting and postprandial glucose levels) (13) suggest that both components may be abnormal. Increased hepatic gluconeogenesis is probably explained by permanent elevation in expression of hepatic phosphoenolpyruvate carboxykinase in dex-treated offspring (13). The effects of prenatal glucocorticoid overexposure on glucose uptake and metabolism in muscle and adipose have not been investigated.
Changes in local glucocorticoid action may mediate the observed metabolic changes in dex-programmed offspring through altered level of glucocorticoid receptor (GR) expression. Widespread permanent GR up-regulation has been reported in the offspring of protein-restricted rat mothers, which also exhibit insulin resistance and hypertension (16), whereas GR is elevated in the liver (13) but down-regulated in the hippocampus of adult dex-treated offspring (12, 17). This tissue-specific pattern probably explains the combination of increased circulating corticosterone levels (because of impaired hippocampal negative feedback to the hypothalamic-pituitary-adrenal axis) and glucocorticoid-dependent increase in phosphoenolpyruvate carboxykinase in the dex model. If GR is also altered in tissues contributing to peripheral glucose uptake, then the consequences may vary according to adipose depot and skeletal muscle fiber type. Type I and II muscle fibers as found predominantly in soleus and extensor digitorum longus (EDL) muscles, respectively (18), differ with respect to absolute levels of GR expression (19). Intraabdominal or visceral fat is particularly sensitive to glucocorticoids because GR is expressed at a higher level in this depot (20) and is less responsive to the antilipolytic effects of insulin than sc fat (21). Lipid accumulation in visceral fat is specifically associated with other features of the metabolic syndrome in man (22), but the expression of muscle and fat GR in dex-programmed offspring has yet to be reported.
In this study, we aimed to determine whether deranged skeletal muscle and white adipose tissue metabolism contributes to the insulin resistance syndrome induced in adult rats following prenatal overexposure to glucocorticoids and whether this is attributable to dysregulation of GR expression. We administered dex or vehicle to pregnant rats during the third week of gestation and studied the muscle and fat phenotypes of adult offspring.
| Materials and Methods |
|---|
|
|
|---|
Plasma measurements
Measurement of the plasma concentration of various metabolites and hormones was carried out at 67 months of age, either in trunk blood collected at time of death during ad libitum feeding (leptin) or in tail-tip samples obtained after overnight food deprivation, either at 0900 h or 30 min after rats were given 2 g/kg glucose in water by gavage. Plasma leptin concentration was determined by ELISA (Crystal Chem Inc., Chicago, IL). Triglycerides, total cholesterol, high-density lipoprotein cholesterol and nonesterified fatty acids (NEFA) were determined using kits (Wako Pure Chemical Industries Ltd., Osaka, Japan) or Roche Diagnostics Ltd., Lewes, UK). Plasma [glucose] was determined using the hexokinase method (Sigma, Poole, UK).
Uptake of radiolabeled 2-deoxyglucose (2-DOG) into tissues
Seven- to 8-month-old rats (n = 9/group) were deprived of food overnight, weighed, and anesthetized with halothane in a nitrous oxide/oxygen mixture between 0800 h and 1130 h. Polythene cannulae were inserted into the right femoral artery and vein under local anesthetic. Lightly restrained rats were allowed to recover from anesthesia for a minimum of 2 h. Animals prepared in this way exhibit minimal physiological signs of stress (23).
Glucose uptake into muscles and fat depots was measured using the method of Sokoloff et al. (24), adapted as described previously (23, 25). The measurement was initiated with a 30-sec iv injection of tracer (200 µCi/kg 2-deoxy-D-[2,6-3H]glucose, 43 Ci/mmol; Amersham Pharmacia Biotech, Buckinghamshire, UK) with 0.5 g/kg glucose in 0.9% saline (1.5 ml total). Fourteen timed arterial blood samples were collected over 45 min. Rats were then killed and tissues dissected and weighed within 1015 min.
Tracer concentration and total glucose were determined as described (25). Weighed portions of muscle and fat from the left hindlimb were digested at 50 C overnight in 1 ml Soluene-350 (Packard Bioscience, Groningen, The Netherlands) and 3H content measured by scintillation analysis. Tissue-specific deoxyglucose uptake was calculated, using an adapted operational equation derived from the method of Sokoloff et al. (24) but with the incorporation of the lumped constants of Ferre et al. (26) and the whole-body kinetic parameters of Jenkins et al. (27).
Assay of muscle glycogen
Portions of quadriceps muscle removed from ad libitum-fed 6-month-old rats were powdered under liquid nitrogen and homogenized in 30% KOH. Glycogen was quantified, as described (28, 29).
Isolation of RNA
RNA was isolated from tissues removed from ad libitum-fed 6-month-old rats using TriZol (Invitrogen, Life Technologies, Inc., Paisley, UK). The integrity of total RNA was assessed using ethidium bromide after agarose gel electrophoresis.
DNA templates
The pGEM-T Easy vector containing a 186-bp length of rat GR exon two, derived by 5'-rapid amplification of cDNA ends PCR from rat thymus RNA (30) (courtesy Dr. Karen Chapman) was linearized with NCo-I, the complementary antisense RNA strand (383 bp) was generated using SP6 RNA polymerase. The p-TRI-B-actin-125-rat plasmid containing a rat ß-actin DNA insert (Ambion, Inc., Austin, TX) was linearized using BamH-I and transcribed using SP6 polymerase. Because of a base mismatch, ribonuclease digestion under these conditions results in the generation of a 108-bp hybrid from a 218-bp probe, rather than the 125-bp indicated in the company literature.
cDNA templates were prepared by RT-PCR for uncoupling protein 3 (UCP-3) (236bp) from total muscle RNA; and leptin (511 bp), resistin (360 bp), lipoprotein lipase (LPL) (361 bp), and peroxisome proliferator activated receptor
(PPAR
) (347 bp) using total RNA extracted from adipose tissue. Oligonucleotide primers were designed to target rat mRNA sequences of interest of between 200 and 500 bp and purchased from TAGN (Newcastle-Upon-Tyne, UK). These were based on published sequences (BLAST, NCBI, NLM, MD) (31). For PPAR
, primers were designed such that two protected bands of differing size would be generated from a single riboprobe on a Rnase protection gel, corresponding to the PPAR
2 isoform and total PPAR
mRNA. UCP-3: TTGGCCTCTACGACTCTG and GACACCTTTCCCTGAACC. LPL: ACTGCCACTTCAACCACAG and CCCAATACTTCGACCAGG. PPAR
: AGATTTGAAAGAAGCTGTGAACC and TGTGAACGGGATGTCGTCTTCATAG. Leptin: CCAAAACCCTCATCAAGACCand GTCCAACTGTTGAAGAATGTCCC. Resistin: TGTGCCCTGCTGCTGAGCTCTC and GCTAGTGACGGTTGTGCCTTC.
Two to 5 µg micrograms RNA in 60 µl ultrapure water were denatured at 65 C 10 min and reverse transcription (RT) undertaken using mixes containing 4 µl first-strand buffer, 1 µl 10 mM mixed deoxynucleotide triphosphates (dNTPs), 2 µl 0.1 M dithiothreitol, 1 µl random priming hexamers, and 2 µl SuperScript II enzyme (Invitrogen, Paisley, UK). Multiples of 10 µl of RT mix were added to 10 µl denatured RNA and incubated at 42 C for 90 min. In subsequent PCR, multiples of 2 µl cDNA, 5 µl 10x PCR buffer, 0.5 µl 10 mM mixed dNTPs, 2 µl each of 10 pg/ml forward and reverse primers, 0.5 µl Taq DNA polymerase, and 38 µl ultrapure dH2O were mixed. Tubes were subjected to 37 cycles of PCR amplification, consisting of 1 min at each of 95 C, the specific annealing temperature for the primers used (5358 C), and 72 C, followed by a final 10 min at 72 C. Negative RT reactions were regularly performed alongside to reveal genomic contamination. Purified products were ligated into pGEM-T Easy vector and cloned in JM109 Escherichia coli. Minipreps of positive colonies, prepared using the Wizard Plus system (Promega Corp., Southampton, UK) were used to verify correct length and orientation of inserts by restriction digestion and agarose gel electrophoresis vs. DNA ladders, or chain termination sequencing using [
-33P] dNTPs (55.5 TBq/mmol, Amersham Pharmacia Biotech).
Ribonuclease protection assays
Riboprobes and markers were synthesized using [
-32P]-GTP (111 TBq/mmol, Amersham Pharmacia Biotech) (30), with cold GTP added according to the optimal specific activity for each probe. RNase protection assays were carried out using Hybspeed RPA kits (Ambion, Inc.) and a mixture of RNases A (0.5 U/µl) and T1 (8 Kunitz units/µl). The amounts of total RNA (550 µg) and probe were optimized in preliminary experiments. Protected RNA hybrids (lengths: actin 108 bp, GR 186 bp, UCP-3 163 bp, leptin 394 bp, LPL 315 bp, total PPAR
239 bp, PPAR
2 171 bp, and resistin 262 bp) were separated on a 4% polyacrylamide gel containing 7 M urea. Results were quantified using a phosphor imager and Aida 2.0 auto image data analyzer software (Raytest Scientific Ltd., Sheffield, UK). Comparison of the relative abundance of test mRNA between treatment groups was made after normalization to actin.
Western blotting
Protein expression of GR and GLUT-4 was determined semiquantitatively in whole lysate and low-density microsomal (LDM) fractions of quadriceps muscle, respectively.
Tissue preparation
For GR, 1200 mg of each muscle was minced and then autohomogenized in ice-cold 1.05 ml low salt-molybdate buffer (32), containing 20 mM HEPES, 10 mM KCl, 20 mM sodium molybdate, 1 mM EDTA, 1 mM EGTA, 0.1 mM sodium orthovanadate (pH 7.9), 0.2% Nonidet P-40, and 10% glycerol to which 2 µg/ml each of pepstatin A, leupeptin, aprotinin, soybean trypsin inhibitor, and antipain, and 400 µM phenylmethylsulfonyl fluoride (all from Sigma) had been added immediately before use. Homogenates were centrifuged and the supernatants frozen at -20 C overnight.
For GLUT-4 quantitation, LDM fractions were prepared as described (33, 34). Homogenates were centrifuged at 11,400 x g for 10 min and the supernatants recentrifuged at 356,000 g for 60 min. The resulting pellets were resuspended in 100250 µl ice-cold buffer C (20 mM Tris, 255 mM sucrose, 1 mM EDTA, pH 7.4). Protein content was measured by the Bradford method.
Comparison with GR ligand binding
Quantitation of GR protein was improved by standardizing between blots using a bulk preparation of liver cytosol of dex-binding capacity as described (35). The dissociation constant and Bmax for the preparation were calculated from Scatchard analysis of the data, using the Radlig package (Biosoft, Cambridge, UK). Scatchard analysis of the standard liver cytosol preparation yielded a dissociation constant of 3.5 x 10-9 M and Bmax (maximal binding capacity) of 6.3 x 10-9 M.
SDS-PAGE and Western blotting
Homogenates were diluted 1:1 in 2x Laemmli buffer (4% sodium dodecyl sulfate, 20% glycerol, 2 mM dithiothreitol, 125 mM Tris, 10% ß-mercaptoethanol, pH 6.8, with bromophenol blue) and denatured for 4 min at 95 C. For GR, 60 µg muscle protein samples were electrophoresed alongside lanes containing 4, 14, 26, and 40 µg liver cytosol protein of known binding characteristics. LDM preparations for GLUT-4 (25 µg protein per sample) were electrophoresed alongside quadruplicate lanes containing a bulk preparation of standard quadriceps LDM to control for intergel variation in band intensity. Samples were electrophoresed in triplicate in running buffer (25 mM Tris, 200 mM glycine, and 3.5 mM sodium dodecyl sulfate) at 40 mA. The resolving gel was then presoaked in transfer buffer (25 mM Tris, 200 mM glycine, and 20% methanol) along with enhanced chemiluminescence blotting membrane. Proteins were transferred to the membrane by electroblotting in cold transfer buffer at 250 mA for 2.53 h.
Antibody application and visualization
Membranes were agitated overnight at 4 C in 2.5x Tris-buffered saline containing 5% milk powder and 0.1% Tween 20. Dilutions of primary antibody (Ab) GR M-20 (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) or RaIRGT anti-GLUT-4 Ab (Biogenesis Ltd., Poole, Dorset, UK) were applied for 2 h, followed by three washes. Antirabbit secondary antibody (Amersham Pharmacia Biotech) was applied for 1 h and washed GR blots were exposed to 1:500 dilutions of anti-GR Ab, followed by 1:5000 dilutions of 2° Ab, yielding single bands at a molecular weight of approximately 95,000. For GLUT-4, antibodies were applied at dilutions of 1:750 and 1:7500, respectively, producing a main band equivalent to a molecular weight of 43,000. Enhanced chemiluminescence (Amersham Pharmacia Biotech) was used to visualize bands.
Quantitation
Film images (MCID-M4 image analysis version 3.0 revised 1.5, Imaging Research, Inc., St. Catharines, Canada) were captured and band intensity analyzed using Aida. Plots of microgram protein loaded vs. GR band intensity for the liver cytosol were used to determine the amount of liver cytosol protein that would yield the GR band intensity in each muscle lane, and thus Bmax for GR in each quadriceps. Mean band intensity between groups was used to compare GLUT-4 expression.
Statistics
Data are mean ± SEM. For comparison between dex and saline-treated offspring, t tests, or Mann-Whitney rank sum tests were used, as appropriate. Two-way ANOVA was used to analyze data in which a second variable was involved, with post hoc analysis by t test or Tukeys test. Significance was set at P of 0.05 or less.
| Results |
|---|
|
|
|---|
Body and tissue weight
Dex-treated offspring remained significantly lighter than controls from birth until 160 d of age (Fig. 1
). Whereas dex offspring were on average 25% lighter at birth, they were only 1416% lighter from 2 months of age onward, i.e. incomplete catch-up growth had occurred.
|
|
|
|
|
|
Expression of metabolic genes in skeletal muscle and adipose tissue
No effect of prenatal treatment was seen on UCP-3 mRNA in quadriceps muscle or on either leptin or resistin mRNA in retroperitoneal fat (Fig. 5
). However, there was a 28% reduction in LPL mRNA in retroperitoneal fat of dex offspring. Although there was no significant change in expression of PPAR
1, PPAR
2, or total PPAR
mRNA in retroperitoneal fat (Fig. 6
), there was a trend toward increased PPAR
2 (P = 0.09) and a significant shift from PPAR
1 to PPAR
2 expression in this tissue.
|
|
| Discussion |
|---|
|
|
|---|
2 in intraabdominal adipose tissue. Dex-treated rats remained lighter than saline-treated controls until 56 months, although partial catch-up growth occurred during the first 2 months of life. Although prior single measurements of body weight in adulthood have not shown this maintained difference (13), this trend is more typical of recent unpublished longitudinal studies in our laboratory in which body weight has been followed up in rat cohorts. Increased muscle mass relative to body weight in dex-treated offspring could imply muscular hypertrophy; however, the marked reduction in the size of epididymal fat pads, and probably other fat depots, suggests that dex-programmed rats are leaner than controls, at least on a standard chow diet.
GR expression was programmed in skeletal muscle by prenatal dex in a fiber type-specific manner. Whereas in EDL muscle, comprising predominantly type II fibers, there was no difference in GR between groups, GR mRNA was decreased by prenatal dex in soleus muscle, which contains mainly type I fibers. An intermediate trend was apparent in quadriceps, consistent with its mixture of type I and II muscle fibers (18). GR mRNA and protein expression showed identical trends between treatment groups in quadriceps, consistent with predominant transcriptional regulation of the GR gene. The reduced glucocorticoid sensitivity in soleus muscle, and therefore presumably in type I fibers, is of uncertain significance. Replacement of type I with type II fibers may be responsible for the reduction in GR here, as in other insulin resistant states (36) because type I fibers express more GR than type II fibers (19). Importantly, our data showed that type II fibers in EDL and quadriceps muscle do not show the up-regulation of GR expression evident in liver and adipose tissue.
Reduced glycogen storage in quadriceps could imply either attenuated glucose uptake or increased muscular activity in dex-programmed rats. Behavioral testing did not suggest that dex offspring were more active (17). Glucose transport is thought to be the rate-limiting step in glycogen accumulation (37) and is predominantly carried out in muscle through GLUT-4. Transport activity using GLUT-4 is controlled primarily through intracellular trafficking of glucose transporters (38), so it is perhaps not surprising that no difference in total GLUT-4 protein was detected in dex offspring. Indeed, prenatal malnutrition of rats results in altered subcellular distribution of GLUT-4 (39), which would not have been detected by the methods employed here. More persuasively, measurement of 2-DOG uptake into quadriceps and soleus muscle was unaffected by prenatal dex treatment, implying no attenuation of glucose uptake. Indeed, 2-DOG uptake into EDL muscle was slightly increased. Thus, these data do not support a contribution of attenuated glucose uptake into muscle to dex-programmed hyperglycemia.
In retroperitoneal adipose tissue, the combination of increased GR and plasma corticosterone (12) in a glucocorticoid-sensitive adipose depot (20) would be expected to greatly amplify glucocorticoid-mediated effects. This does not, however, appear to impact on glucose uptake. Uptake of 2-DOG by adipose depots was quantitatively less than into muscle and greatest in the sc rather than intraabdominal depot, consistent with previous reports of relatively higher insulin sensitivity and glucose uptake in sc fat (40). Moreover, no differences in adipose glucose uptake as a result of prenatal treatment was identified. Thus, like muscle, attenuated glucose uptake into fat does not appear to contribute to dex-programmed hyperglycemia. Interestingly, a similar observation has been made in 3-month-old prenatally protein-restricted rats, which show improved glucose uptake into muscle and also adipocytes (39) yet later become profoundly insulin resistant. The link between up-regulation of adipose GR and insulin resistance may lie, however, in the fact that intraabdominal fat depots are important in determining hepatic insulin sensitivity (41).
In the absence of altered glucose uptake in adipose tissue, the significance of up-regulation of GR expression, and mechanisms for reduced fat mass, were further explored by examining several glucocorticoid-regulated genes, which are differentially regulated in insulin resistance. In retroperitoneal fat, leptin mRNA and plasma leptin were unaltered by prenatal dex, despite the reduced epididymal fat pad size and leanness of the animals. This may reflect an altered set point of leptin secretion relative to fat mass promoting satiety. This is supported by the observation that plasma leptin was increased in 1-yr-old rats given dex continuously during their third week of gestation (42), suggesting that this phenotype could deteriorate with age. In addition, LPL mRNA was decreased in adipose in dex-programmed animals, which could contribute to the reduction in size of fat depots through reduced uptake of fatty acids from plasma. Reduced LPL activity has also been recorded in adipocytes from insulin resistant patients (43). No parallel alterations in plasma triglycerides, NEFA, or lipoprotein profile were identified; however, these measurements reflect whole-body lipid turnover, rather than specific output from visceral fat. Because delivery of NEFAs from visceral adipose tissue to the liver is associated with increased hepatic glucose output (44), portal sampling of lipid parameters in dex rats could yield a different pattern. The mechanism of alteration in LPL mRNA is unclear; LPL expression is up-regulated in visceral adipocytes by glucocorticoids (45), suggesting that this is not a direct effect of elevated plasma corticosterone or GR.
An additional consequence of increased GR mRNA in adipose tissue of dex-programmed rats may lie in its effects on adipose differentiation. In this, it may interact with PPAR
(46). Altered expression of PPAR
isoforms, alongside changes in GR, could be involved in mediating expression of metabolic genes in fat. Glucocorticoids predominantly increase the
1 isoform; thus, the shift in favor of the
2 isoform is not likely to be a result of hypercorticosteronemia or elevated GR (47). However, PPAR
2 has recently been identified as the isoform most involved in adipocyte differentiation (48), and its expression was increased in fat from obese insulin resistant patients (47).
In summary, fat and muscle metabolism is programmed by prenatal glucocorticoid overexposure. GR expression is programmed in a tissue-specific fashion. It is down-regulated in soleus muscle but unchanged in two other muscles. However, elevated GR expression in visceral adipose with concomitant hypercorticosteronemia suggests markedly increased glucocorticoid action in this depot and consequent local (adipose and hepatic) insulin resistance. Additional changes in adipose, including altered expression of PPAR
isoforms and reduced LPL expression, are unlikely to be mediated directly by increased glucocorticoid action and may either be independently programmed or be indirect consequences of insulin resistance. The absence of measurable attenuation of glucose uptake into fat and muscle suggests that increased hepatic glucose output is most likely to be responsible for the programmed hyperglycemia. Reduced fat deposition is probably explained in part by increased leptin secretion and in part by down-regulation of LPL expression, consistent with a programmed attenuation of fatty acid uptake by visceral fat. Consequent alteration in the supply of NEFAs to the liver could be responsible for increased hepatic glucose output in adult dex-programmed rats.
| Acknowledgments |
|---|
| Footnotes |
|---|
Abbreviations: Ab, Antibody; dex, dexamethasone; dNTP, deoxynucleotide triphosphate; 2-DOG, 2-deoxyglucose; EDL, extensor digitorum longus; GR, glucocorticoid receptor; LDM, low-density microsomal; LPL, lipoprotein lipase; NEFA, nonesterified fatty acid; PPAR, peroxisome proliferator activated receptor; RT, reverse transcription; UCP-3, uncoupling protein 3.
Received May 28, 2002.
Accepted for publication November 22, 2002.
| References |
|---|
|
|
|---|
activation has coordinate effects on gene expression in multiple insulin-sensitive tissues. Endocrinology 142:12691277
knockdown by engineered transcription factors: exogenous PPAR
2 but not PPAR
1 reactivates adipogenesis. Genes Dev 16:2732This article has been cited by other articles:
![]() |
A. L. Fowden and A. J. Forhead Hormones as epigenetic signals in developmental programming Exp Physiol, June 1, 2009; 94(6): 607 - 625. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. H. Fasting, E. Oken, C. S. Mantzoros, J. W. Rich-Edwards, J. A. Majzoub, K. Kleinman, S. L. Rifas-Shiman, T. Vik, and M. W. Gillman Maternal Levels of Corticotropin-Releasing Hormone during Pregnancy in Relation to Adiponectin and Leptin in Early Childhood J. Clin. Endocrinol. Metab., April 1, 2009; 94(4): 1409 - 1415. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. J. Andersson, Y.-Y. Jiang, and S. T. Davidge Maternal stress and development of atherosclerosis in the adult apolipoprotein E-deficient mouse offspring Am J Physiol Regulatory Integrative Comp Physiol, March 1, 2009; 296(3): R663 - R671. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. S Wyrwoll, P. J Mark, T. A Mori, and B. J Waddell Developmental programming of adult hyperinsulinemia, increased proinflammatory cytokine production, and altered skeletal muscle expression of SLC2A4 (GLUT4) and uncoupling protein 3 J. Endocrinol., September 1, 2008; 198(3): 571 - 579. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. G. Bechtold, K. Vernon, T. Hines, and D. A. Scheuer Genetic predisposition to hypertension sensitizes borderline hypertensive rats to the hypertensive effects of prenatal glucocorticoid exposure J. Physiol., January 15, 2008; 586(2): 673 - 684. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. S. Wyrwoll, P. J. Mark, and B. J. Waddell Developmental Programming of Renal Glucocorticoid Sensitivity and the Renin-Angiotensin System Hypertension, September 1, 2007; 50(3): 579 - 584. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. E Bruin, L. D Kellenberger, H. C Gerstein, K. M Morrison, and A. C Holloway Fetal and neonatal nicotine exposure and postnatal glucose homeostasis: identifying critical windows of exposure J. Endocrinol., July 1, 2007; 194(1): 171 - 178. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. J McNeil, M. O Nwagwu, A. M Finch, K. R Page, A. Thain, H. J McArdle, and C. J Ashworth Glucocorticoid exposure and tissue gene expression of 11{beta} HSD-1, 11{beta} HSD-2, and glucocorticoid receptor in a porcine model of differential fetal growth Reproduction, March 1, 2007; 133(3): 653 - 661. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Gray, B. S Stonestreet, S. Thamotharan, G. B Sadowska, M. Daood, J. Watchko, and S. U Devaskar Skeletal muscle glucose transporter protein responses to antenatal glucocorticoids in the ovine fetus. J. Endocrinol., May 1, 2006; 189(2): 219 - 229. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. S. Wyrwoll, P. J. Mark, T. A. Mori, I. B. Puddey, and B. J. Waddell Prevention of Programmed Hyperleptinemia and Hypertension by Postnatal Dietary {omega}-3 Fatty Acids Endocrinology, January 1, 2006; 147(1): 599 - 606. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Thamotharan, B.-C. Shin, D. T. Suddirikku, S. Thamotharan, M. Garg, and S. U. Devaskar GLUT4 expression and subcellular localization in the intrauterine growth-restricted adult rat female offspring Am J Physiol Endocrinol Metab, May 1, 2005; 288(5): E935 - E947. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. C. Mcmillen and J. S. Robinson Developmental Origins of the Metabolic Syndrome: Prediction, Plasticity, and Programming Physiol Rev, April 1, 2005; 85(2): 571 - 633. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. He, A. Varma, L. A. Weissfeld, and S. U. Devaskar Postnatal glucocorticoid exposure alters the adult phenotype Am J Physiol Regulatory Integrative Comp Physiol, July 1, 2004; 287(1): R198 - R208. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Wake, E. Rask, D. E. W. Livingstone, S. Soderberg, T. Olsson, and B. R. Walker Local and Systemic Impact of Transcriptional Up-Regulation of 11{beta}-Hydroxysteroid Dehydrogenase Type 1 in Adipose Tissue in Human Obesity J. Clin. Endocrinol. Metab., August 1, 2003; 88(8): 3983 - 3988. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |