| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLE |
Section on Steroid Regulation, Endocrinology and Reproduction Research Branch, The National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, Maryland 20892-4510
Address all correspondence and requests for reprints to: Dr. Charles A. Strott, Building 49, Room 6A36, National Institutes of Health, Bethesda, Maryland 20892-4510. E-mail: chastro{at}mail.nih.gov.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
To gain insight into functionality of the mouse SULT2 subfamilies and perhaps a clue as to their physiologic relevance, we have overexpressed and purified the three mouse SULT2 isozymes for use in examining substrate preferences and performing kinetic analyses. Furthermore, we have determined tissue expression patterns by real-time PCR as well as expression during embryonic development by traditional RT-PCR.
| Materials and Methods |
|---|
|
|
|---|
RNA extraction
Female mice at 5 months of age (C57BL/6; Charles River Laboratories, Inc., Wilmington, MA) were used for isolation of total RNA from the hypothalamus and adrenal glands. Total RNA was extracted using the Absolutely RNA RT-PCR Miniprep Kit according to the manufacturers instructions (Stratagene, La Jolla, CA). The use of animals was carried out under an approved protocol and in accordance with NIH Guidelines for the Care and Use of Animals.
Cloning of mouse SULT2B1a cDNA
A mouse expressed sequence tags (EST) database was searched using Basic Local Alignment Search Tool (BLAST) and a bait sequence that corresponded to a region of the SULT2B1b cDNA (GenBank accession no. AF026072), presumably located in the second exon, based on the genomic organization of the human SULT2B1 gene previously reported (1). A single EST clone (GenBank accession no. BE863542), with a partially different sequence from the mouse SULT2B1b cDNA, was obtained. To isolate the full-length cDNA of the EST clone, 1 µg hypothalamic total RNA was reverse transcribed with random hexamer primers, using the ThermoScript RT-PCR System (Invitrogen, Carlsbad, CA). Subsequently, high-fidelity PCR with Pfu Turbo Hotstart DNA polymerase (Stratagene) was performed using the EST clone-specific sense primer (5'-GTCGACG(nt122)TATGACATCACGGGACTGCTGTGGTG-GAG(nt151)-3') and mouse SULT2B1b-specific antisense primer (5'-GCGGCCGCT(nt1086)TTATT-GTGAGGATCCTGGGTTGGGGTCATC(nt1057)-3'). Underlines indicate SalI and NotI restriction sites, respectively. PCR conditions were: denaturing at 95 C for 3 min, followed by 45 cycles of denaturing at 95 C for 30 sec, annealing at 62 C for 30 sec, and extension at 72 C for 2 min. PCR products were purified, subcloned into pCR2.1-TOPO vector (Invitrogen), designated pCR-mSULT2B1a, and sequenced on both strands. The analysis to determine genomic organization was carried out by aligning the mouse SULT2B1a and SULT2B1b cDNAs with the mouse genome draft sequence (GenBank accession no. AC073774) derived from mouse chromosome 7. Briefly, information on mouse SULT2B1 was searched for at the UniGene web site (http://www.ncbi.nlm.nih.gov/unigene/). Using the MacVector 7.0 Clustal W program, homologous regions between the mouse genome and the mouse SULT2B1 cDNAs were determined.
5'-Untranslated region (UTR) of mouse SULT2B1a cDNA
To confirm the 5'-UTR, 5'-rapid amplification of cDNA ends (RACE) was employed using the SMART RACE cDNA Amplification Kit according to the manufacturers instructions (BD Biosciences, San Diego, CA). Briefly, a mixture of 0.3 µg hypothalamic total RNA and SMART II A oligonucleotide was used to carry out a reverse transcription (RT) reaction using a 5'-RACE CDS primer provided with the kit. PCR was performed using universal primer mix A and SULT2B1a-specific primer (5'-T(nt224)CATTCACACGCCAGTGAGGAGTGTC(nt199)-3'). PCR conditions were: heat denature at 94 C for 5 sec and annealing/extension at 72 C for 2 min, 5 cycles; heat denature at 94 C for 5 sec, annealing at 70 C for 10 sec, and extension at 72 C for 1 min, 5 cycles; heat denature at 94 C for 5 sec, annealing at 68 C for 10 sec, and extension at 72 C for 1 min, 35 cycles. PCR products were analyzed by electrophoresis using 2% agarose gels. After gel purification, PCR products were subcloned into pCR2.1-TOPO vector and sequenced.
mRNA expression analysis of adult mouse SULT2A1, SULT2B1a, and SULT2B1b isozymes by real-time RT-PCR
Total RNA, isolated from mouse skin and small intestine, was obtained from OriGene Technologies, Inc. (Rockville, MD), whereas total RNA isolated from all other mouse tissues was obtained from CLONTECH Laboratories, Inc. (Palo Alto, CA). RT was performed using the ThermoScript RT-PCR system according to the manufacturers instructions (Invitrogen). Briefly, using 3 µg total RNA as a template, first-strand cDNA was made using 25 pmol oligo(deoxythymidine) 20 and 25 ng random hexamer primer (Invitrogen) in a 20-µl reaction vol. After heat denaturing at 65 C for 5 min, RT was carried out at 25 C for 10 min and then 60 C for 50 min.
Real-time PCR was performed using a fluorescence temperature cycler (LightCycler) and SYBR Green I as a double-stranded DNA-specific binding dye, according to the manufacturers instructions (Roche Molecular Biochemicals, Indianapolis, IN). This technique continuously monitors the cycle-by-cycle accumulation of fluorescently labeled PCR product. Amplifications were carried out using 1 U Platinum Taq DNA Polymerase (Invitrogen), 0.5 µM of each primer, 3 mM MgCl2, 10x Platinum Taq DNA polymerase buffer [200 mM Tris-HCl (pH 8.4), 500 mM KCl], 0.2 mM deoxynucleotide triphosphate, 1 mg/ml BSA, 1 µl 1:2000 diluted SYBR Green I nucleic acid gel stain (BioWhittaker, Inc. Molecular Applications, Rockland, ME), and 2 µl 1:5 diluted cDNA in a total vol of 20 µl. The real-time PCR conditions were: preheat denature at 95 C for 5 min, annealing at 59 C for 10 sec, and extension at 72 C for 7 sec; cycle number, 45. SYBR Green I fluorescence was detected at 72 C at the end of each cycle to monitor the amount of PCR product formed during that cycle. A melting curve analysis of the amplification products was performed at the end of the PCR run by rapidly increasing the temperature to 95 C; followed by immediate cooling to 65 C for 15 sec; after which, the temperature was gradually increased to 95 C at a rate of 0.1 C/sec with continuous measurement of fluorescence to confirm amplification of specific transcripts. The melting temperature profile for all samples of SULT2A1, SULT2B1a, and SULT2B1b, as well as glyceraldehyde-3-phosphate dehydrogenase (GAPDH), demonstrated single peaks at 88, 89, 88, and 89 C, respectively. The interassay and intraassay coefficients of variation were calculated to be 7.4% and 5.7%, respectively, using SULT2B1b primer and skin cDNA.
Primer sequences used were: 5'-A(nt28)TGATGTCAGACTATAATTGGTTTGAAGGC(nt57)-3' (sense) and 5'-A(nt319)GGTTATGAGTCGTGGTCCTTCCTTATTG(nt291)-3' (antisense) for SULT2A1, 5'-A(nt200)CACTCCTCACTGGCGTGTGAATG(nt223)-3' (sense) and 5'T(nt551)TGAAGGCGCTTATGATGGTCTCGC(nt527)-3' (antisense) for SULT2B1a, and 5'-T(nt95)GTGGAGCTCGTCTGAGAAAAATGTTTCCG(nt124)-3' (sense) and the same primer as SULT2B1a (antisense) for SULT2B1b. Primers were designed to recognize a different exon in each gene; furthermore, the appropriate size of PCR products was verified by agarose gel electrophoresis. External cDNA standards for SULT2A1, SULT2B1a, and SULT2B1b were produced by inserting PCR products, which were generated using the same primers as noted above, and liver, brain, and skin cDNAs as templates, into the pCR2.1 vector using the TOPO TA Cloning kit (Invitrogen). Vector constructs were used to transform XL1-blue (Stratagene), and plasmid DNA was prepared by QIAprep Spin Miniprep Kit (QIAGEN, Valencia, CA). Inserts of control vectors for the SULT2s were verified by sequencing. The concentration of each standard was determined by measuring the OD260 and the copy number calculated.
Mouse GAPDH was quantified to normalize SULT2 mRNA levels, and the final results are expressed as the ratio of the copy number of a specific SULT2 to the copy number of GAPDH. Primer sequences for GAPDH were: 5'-A(nt140)ACGACCCCTTCATTGAC(nt157)-3' (sense) and 5'-T(nt330)CCACGACATACTCAGCAC(nt312)-3' (antisense). The appropriate size of PCR product was verified by agarose gel electrophoresis. Quantitative standards were generated similarly to those for the SULT2s by cloning the product obtained by PCR amplification of skin cDNA.
mRNA expression analysis of embryonic mouse SULT2A1, SULT2B1a, and SULT2B1b isozymes by RT-PCR
Expression profile of the SULT2 isozymes during mouse embryonic development (Inbred of FVB) was analyzed using RAPID-SCAN gene expression panels (OriGene Technologies, Inc.). Lyophilized cDNAs were suspended in 25 µl H2O, and 4-µl (for detection of SULT2 mRNAs) and 2-µl (for detection of ß-actin mRNA) aliquots were used as templates. Primers used were: 5'-GTCGACGTATGATGTCAGACTATAATTGGTTTGAAGGC-3' (sense) and 5'-AGGTTATG-AGTCGTGGTCCTTCCTTATTG-3' (antisense) for mouse SULT2A1, 5'-ACACTCCTC-ACTG-GCGTGTGAATG-3' (sense) and 5'-TTGAAGGCGCTTATGA-TGGTCTCGC-3' (antisense) for mouse SULT2B1a, and 5'-TGTGG-AGCTCGTCTGAGAAAAATGTTTCCG-3' (sense) and 5'-TTGAA-GGCGCTTATGATGGTCTCGC-3' (antisense) for mouse SULT2B1b. Expected sizes of SULT2A1, SULT2B1a, and SULT2B1b PCR products were, respectively, 299 bp, 341 bp, and 300 bp. PCR conditions were: denaturing at 95 C for 5 min, followed by 35 cycles of denaturing at 94 C for 15 sec, annealing at 55 C for 15 sec, and extension at 72 C for 30 sec. Each PCR product was subcloned and sequenced. To check quality and quantity of cDNA used, PCR was also performed using ß-actin-specific primers provided with the kit. PCR products were analyzed by electrophoresis using 3% agarose gels.
Construction of mouse SULT2A1, SULT2B1a, and SULT2B1b expression vectors
To isolate SULT2A1 cDNA, RT-PCR was employed. One microgram of adrenal total RNA was reverse transcribed using ThermoScript RT-PCR System (Invitrogen), and the cDNA was amplified with mouse SULT2A1-specific primers: 5'-GTCGACGTATGATGTCAGACTATAATTGGTTTGAA-GGC-3' (sense), 5'-GCGGCCGCTTATTCCCATGGGAACATCCCTGGGGGGAATC-3' (antisense). Underlines indicate SalI and NotI sites, respectively. PCR conditions with high-fidelity DNA polymerase were: denaturing at 95 C for 3 min, followed by 45 cycles of denaturing at 95 C for 30 sec, annealing at 62 C for 30 sec, and extension at 72 C for 2 min. The PCR product was subcloned into pCR 2.1-TOPO vector (Invitrogen) and sequenced. After digestion with SalI and NotI, insert DNA was ligated to SalI/NotI-digested pGEX-6P-1 (Amersham Biosciences, Piscataway, NJ). SULT2B1b cDNA (GenBank accession no. AF026072), kindly provided by Dr. Ming-Cheh Liu (University of Texas Health Center, Tyler, TX), was digested with EcoRI and NotI and ligated into EcoRI/NotI-digested pGEX-6P-1 vector. To generate SULT2B1a expression vector, pCR-mSULT2B1a was digested with SalI and NotI, and the insert DNA fragment was ligated to SalI/NotI-digested pGEX-6P-1 vector. Proper clones were verified by sequencing.
Generation of recombinant mouse SULT2A1, SULT2B1a, and SULT2B1b
Glutathione-S-transferase (GST) gene fusion system (Amersham Biosciences) was employed for purification of bacterially overexpressed recombinant proteins. Briefly, plasmids were used for transformation of BL21-Gold (DE3) pLysS (Stratagene). Vectors were mixed with competent cells, incubated on ice for 30 min, heat-shocked at 42 C for 45 sec, and incubated on ice for 2 min. Bacterial cultures were added to 100 ml Luria-Bertani broth and grown overnight at 26 C in ampicillin medium to minimize expressed proteins in inclusions bodies. Additional Luria-Bertani broth containing ampicillin was then added to increase culture volumes to 1 liter, and incubations continued until the OD595 nm reached 0.6, at which time, isopropyl ß-D-thiogalactopyranoside was added to a final concentration of 50 µM. After overnight incubation, cells were collected by centrifugation, and the bacterial pellets were frozen at -80 C. Pellets were extracted by sonication in iced PBS, to which had been added a protease inhibitor cocktail tablet (Roche Molecular Biochemicals) and 1 mg/ml lysozyme (Sigma). The sonication step was carried out for 1 min and repeated 4 times on ice. Extracts were centrifuged at 204,000 x g for 1 h at 4 C. Supernatants were collected, mixed with 1 ml glutathione Sepharose 4B resin (Amersham Biosciences), and incubated for 13 h at 4 C. The resin mixture of GST-fusion protein was transferred to a plastic column and washed with a 25-column volume of cleavage buffer [50 mM Tris-HCl (pH 7.0), 150 mM NaCl, 1 mM EDTA, 1 mM dithiothreitol]. Forty microliters (80 U) of PreScission Protease (Amersham Biosciences) in 1 ml cleavage buffer were applied per 1 ml column resin and incubated overnight at 4 C. After elution, protein concentrations were determined by BCA Protein Assay kit (Pierce Chemical Co., Rockford, IL) using BSA as standard. To check the quality of recombinant proteins, SDS-PAGE was performed using a NuPAGE 10% Bis-Tris gel (Invitrogen) and a standard procedure. Degree of purity, determined by densitometry, was based on expected protein size. For imaging analysis, Quantity One Software (Bio-Rad Laboratories, Inc., Hercules, CA) was used.
Kinetic analyses of mouse SULT2A1, SULT2B1a, and SULT2B1b
Sulfotransferase activity was determined using radiolabeled cholesterol, pregnenolone, and DHEA. A 20-µl reaction vol contained a specific substrate, 0.1 mM PAPS, and a purified enzyme preparation as described above: SULT2A1 (2 µg), SULT2B1a (0.2 µg), SULT2B1b (0.1 µg) in the cholesterol assay; SULT2A1 (1 µg), SULT2B1a (2 µg), SULT2B1b (1 µg) in the DHEA assay; SULT2A1 (1 µg), SULT2B1a (0.4 µg), SULT2B1b (0.1 µg) in the pregnenolone assay, in 0.1 mM Tris-HCl buffer (pH 7.5) containing 5 mM MgCl2, 0.2 mM 2-hydroxypropyl-ß-cyclodextrin, and 4% ethanol (vol/vol). Reactions were carried out at 37 C for 5 min and stopped at 100 C for 5 min. After adding 10 µl of 5 mg/ml of a respective sulfoconjugated standard as a carrier, 5 µl of aliquots were applied to silica gel-TLC plates, and chromatography was carried out using the solvent system of chloroform/methanol/acetone/acetic acid/water (8:2:4:2:1). After development, TLC plates were dried and exposed to iodine vapor to visualize location of the sulfoconjugated products. The iodine-adsorbed spots were excised, the silica was placed into counting vials containing 5 ml scintillation cocktail, and the radioactivity was determined by liquid scintillation spectrometry.
Amino acid sequence analysis
Multiple alignment analysis was carried out using the MacVector 7.0 system, which is based on the Clustal W algorithm (4).
| Results |
|---|
|
|
|---|
|
|
Based on the amino acid sequence alignment (Fig. 2
), it is apparent that the SULT2B1 isoforms are identical except for their amino-terminal ends, where the greater length of the amino terminus unique to SULT2B1a accounts for its greater size. The mouse SULT2B1 isoforms are considerably longer than the prototypical mouse hydroxysteroid sulfotransferase, SULT2A1, a feature attributable primarily to the extended amino- and carboxy-terminal ends of the former proteins. Overall, the three proteins are 37% identical; however, if the amino- and carboxy-terminal ends of the SULT2B1 isoforms are excluded from the analysis, amino acid identities increase to approximately 48%. More importantly, key amino acid residues involved in the binding of the sulfonate donor molecule, PAPS, as determined by the crystal structure of mouse estrogen sulfotransferase (8) and human hydroxysteroid sulfotransferase SULT2A1 (9), are completely conserved in the three proteins (Fig. 2
).
mRNA expression of mouse SULT2B1a, SULT2B1b, and SULT2A1
Multiple mouse tissues were examined by real-time PCR for expression of the SULT2B1 isoforms, as illustrated in Fig. 3
. Expression of SULT2B1a is most prominent in the brain and spinal cord, with modest expression in the lung, skin, and spleen. SULT2B1b is most prominently expressed in skin and small intestine, with modest expression in muscle and prostate. The same tissues were also examined for expression of SULT2A1; remarkably, however, expression of this SULT2 isozyme by the liver is exceedingly high, being several orders of magnitude greater than any other tissue (data not presented). Interestingly, real-time PCR reveals that SULT2B1a is most abundantly expressed in the brain, in contrast to SULT2B1b and SULT2A1, which are weakly, if at all, expressed in this tissue (Fig. 4
). On the other hand, SULT2B1b is the most prominent SULT2 isozyme expressed in skin (Fig. 4
).
|
|
|
|
| Discussion |
|---|
|
|
|---|
In addition to the structural distinction between human and mouse SULT2B1a, they also differ functionally. Human SULT2B1a sulfonates cholesterol very weakly (10), whereas mouse SULT2B1a sulfonates cholesterol with a high degree of efficiency. Mouse and human SULT2B1b, on the other hand, are similar in that both avidly sulfonate cholesterol with the highest kcat/Km ratios. Thus, contrary to the human SULT2B1 isoforms, both mouse SULT2B1 isoforms sulfonate cholesterol efficiently. Mouse SULT2A1, on the other hand, weakly sulfonates cholesterol, a finding similar to that of human SULT2A1 (11). Notably, the three mouse SULT2 isozymes, particularly SULT2B1a, strongly sulfonate pregnenolone, a finding consistent with the behavior of the human SULT2 isozymes (10).
The pattern of mRNA expression of the mouse SULT2 isozymes is informative. For instance, the SULT2B1a isoform seems to be the exclusive SULT2 isozyme expressed in the brain and spinal cord, whereas SULT2B1b and SULT2A1 are weakly, if at all, expressed in the central nervous system (CNS). On the other hand, the SULT2B1b isoform is clearly the most prominent SULT2 isozyme expressed in skin, whereas SULT2B1a and SULT2A1 are weakly expressed in this tissue. SULT2A1 is expressed in the liver at a level that overwhelms the level of expression in any other tissue; in contrast, the SULT2B1 isoforms are weakly, if at all, expressed in this organ system. It should be noted that, although the SULT2 isoform real-time PCR data were standardized using GAPDH, essentially the same results were obtained when 18S-rRNA was used for normalization (data not presented).
Cloning of the hydroxysteroid sulfotransferase SULT2B1 subfamilies in the mouse and human, which are structurally distinct from all previously cloned cytosolic sulfotransferases, represents a significant advancement in the field of biotransformation by sulfonation. Of particular importance is the fact that these new enzymes demonstrate unique substrate preferences and patterns of expression when compared with the prototypical mouse and human SULT2A1 hydroxysteroid sulfotransferases. Based on the current findings with mouse SULT2B1 and our previous report on the human SULT2B1 ortholog (10, 11), it now seems likely that this subfamily of hydroxysteroid sulfotransferases is normally involved in cholesterol metabolism via sulfonation. It should be noted that, in previous reports regarding the SULT2B1b isoform involving both the mouse (2) and human (12) orthologs, no catalytic activity with cholesterol as substrate was found, presumably because of a difference in methodology regarding cholesterol solubility (13).
The differential expression of mouse SULT2B1a, SULT2B1b, and SULT2A1, along with their distinct substrate preferences, has physiologic relevance. For instance, the almost-sole expression of SULT2B1a in the CNS and its tendency for greater activity with pregnenolone as a substrate would be in keeping with the importance of pregnenolone sulfate as a neurosteroid (14, 15, 16, 17). Though pregnenolone sulfonation can also be carried out by SULT2A1, this sulfotransferase isozyme is not expressed in the mouse brain. The prominent expression of SULT2B1b in skin and the fact that it clearly has a predilection for cholesterol as a substrate are in keeping with the importance of cholesterol sulfate as a regulatory molecule in murine epidermal differentiation (18, 19). Likewise, cholesterol sulfate is a regulatory molecule in human keratinocyte differentiation and development of the barrier (20, 21), and SULT2B1b is quantitatively the predominant hydroxysteroid sulfotransferase expressed in human skin (unpublished data). There is also evidence that cholesterol sulfonation in rat skin is carried out by a similar sulfotransferase subfamily (22). Finally, the robust expression of mouse SULT2A1 in liver would be in keeping with its role in general metabolism. For example, there is evidence in humans that, in addition to its involvement in the sulfonation of a variety of steroids, including androgens and estrogens, SULT2A1 is the principal bile acid sulfonating enzyme in liver (23). This is in keeping with the fact that bile acids contain a 3
-hydroxyl group and that SULT2A1 will sulfonate compounds that are 3
-hydroxylated (24, 25), whereas the SULT2B1 isoforms are specific for steroid/sterols where the 3-hydroxy group has a ß-orientation (11, 12, 26).
An interesting finding is that the mouse SULT2B1 and SULT2A1 genes are differentially expressed during embryonic development, with the former being expressed at all stages from E8.5-E19, whereas the latter is not expressed until E19. These results suggest that expression of the SULT2B1 gene is more critical during early development than expression of the SULT2A1 gene, especially the expression of SULT2B1a during the early stages of brain maturation and the expression of SULT2B1b during keratinocyte differentiation and epidermal development.
Sulfoconjugated neurosteroids are widely distributed in the CNS, where they act as modulators of neurotransmitter receptors such as
-aminobutyric acid type A, N-methyl-D-aspartate, and sigma 1 (14, 27). However, regardless of the physiologic importance of steroid sulfoconjugates, little is known about their synthesis in the CNS. We are aware of only a single report describing the expression of SULT2A1 mRNA in rat brain (28), although several groups have reported on hydroxysteroid sulfotransferase activity using brain cytosolic extracts (29, 30, 31, 32). The fact that SULT2A1 mRNA has been detected in the rat brain, but not the mouse brain, suggests that there are significant species differences. It is notable that, unlike the case of sulfonated neurosteroids such as pregnenolone sulfate, there are few reports on the role of cholesterol sulfate in the CNS. One such report revealed that significant amounts of cholesterol sulfate were detectable in rat brain; furthermore, a dramatic change during early development was noted (33). However, the physiologic significance of this observation is not understood.
As noted above, the outstanding structural feature of the mouse SULT2B1 isoforms that makes them unusual and distinct from mouse SULT2A1 is their extended amino- and carboxy-terminal ends. A similar relationship exists for the human SULT2B1 and SULT2A1 orthologs (1, 11). Mouse SULT2A1 contains 285 amino acids, which is the typical size for hydroxysteroid as well as other cytosolic sulfotransferases (34), whereas the mouse SULT2B1 isoforms are 5387 amino acids longer, a length difference of up to approximately 30%. The extended carboxy termini of the mouse SULT2B1 isoforms, which are identical, with 1 exception, are proline-rich, a finding that is similar to the human SULT2B1 orthologs (1). The extended amino termini, on the other hand, are quite distinct, both in length and amino acid composition. The mouse SULT2B1 and SULT2A1 genes, as well as the genes for human SULT2B1 and SULT2A1, are presumably the result of gene duplication and are thus paralogs (35). Furthermore, the mouse genes are closely linked on chromosome 7 and are syntenic to the similarly closely linked human SULT2B1 and SULT2A1 genes located on chromosome 19 (http://www.ncbi.nlm.nih.gov/homology/).
In summary, the mouse SULT2B1 isoforms have a predilection for cholesterol over that for DHEA, which is ordinarily sulfonated by the SULT2A1 subfamily of hydroxysteroid sulfotransferases (36). Of particular interest is the finding that the genes for mouse SULT2B1 and SULT2A1 are differentially expressed during embryonic development. Furthermore, as determined by real-time PCR, the mouse SULT2 genes demonstrate distinct expression patterns in mature animals. Notably, SULT2B1a is the exclusive SULT2 isozyme expressed in the CNS, whereas SULT2B1b is the prominent SULT2 isozyme expressed in skin. On the other hand, SULT2A1 is the manifest hydroxysteroid sulfotransferase expressed in the liver. The explicit expression patterns of the SULT2 isozymes, in association with their respective substrate predilections, have interesting physiologic implications.
| Footnotes |
|---|
Abbreviations: CNS, Central nervous system; EST, expressed sequence tags; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GST, glutathione-S-transferase; kcat, catalytic constant; Km, Michaelis-Menten constant; PAPS, 3'-phosphoadenosine 5'-phosphosulfate; pI, isoelectric point; RACE, rapid amplification of cDNA ends; RT, reverse transcription; TLC, thin-layer chromatography; UTR, untranslated region.
Received September 27, 2002.
Accepted for publication December 16, 2002.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
H. Yao, I. Edirisinghe, S.-R. Yang, S. Rajendrasozhan, A. Kode, S. Caito, D. Adenuga, and I. Rahman Genetic Ablation of NADPH Oxidase Enhances Susceptibility to Cigarette Smoke-Induced Lung Inflammation and Emphysema in Mice Am. J. Pathol., May 1, 2008; 172(5): 1222 - 1237. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. He and C. N. Falany Characterization of Proline-Serine-Rich Carboxyl Terminus in Human Sulfotransferase 2B1b: Immunogenicity, Subcellular Localization, Kinetic Properties, and Phosphorylation Drug Metab. Dispos., October 1, 2006; 34(10): 1749 - 1755. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Alnouti and C. D. Klaassen Tissue Distribution and Ontogeny of Sulfotransferase Enzymes in Mice Toxicol. Sci., October 1, 2006; 93(2): 242 - 255. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Liere, A. Pianos, B. Eychenne, A. Cambourg, S. Liu, W. Griffiths, M. Schumacher, J. Sjovall, and E.-E. Baulieu Novel lipoidal derivatives of pregnenolone and dehydroepiandrosterone and absence of their sulfated counterparts in rodent brain J. Lipid Res., December 1, 2004; 45(12): 2287 - 2302. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Assem, E. G. Schuetz, M. Leggas, D. Sun, K. Yasuda, G. Reid, N. Zelcer, M. Adachi, S. Strom, R. M. Evans, et al. Interactions between Hepatic Mrp4 and Sult2a as Revealed by the Constitutive Androstane Receptor and Mrp4 Knockout Mice J. Biol. Chem., May 21, 2004; 279(21): 22250 - 22257. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Yanai, N. B. Javitt, Y. Higashi, H. Fuda, and C. A. Strott Expression of Cholesterol Sulfotransferase (SULT2B1b) in Human Platelets Circulation, January 6, 2004; 109(1): 92 - 96. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. A. Lee, H. Fuda, Y. C. Lee, M. Negishi, C. A. Strott, and L. C. Pedersen Crystal Structure of Human Cholesterol Sulfotransferase (SULT2B1b) in the Presence of Pregnenolone and 3'-Phosphoadenosine 5'-Phosphate: RATIONALE FOR SPECIFICITY DIFFERENCES BETWEEN PROTOTYPICAL SULT2A1 AND THE SULT2B1 ISOFORMS J. Biol. Chem., November 7, 2003; 278(45): 44593 - 44599. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Strott and Y. Higashi Cholesterol sulfate in human physiology: what's it all about? J. Lipid Res., July 1, 2003; 44(7): 1268 - 1278. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |