| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
ARTICLE |
Department of Molecular and Cellular Biology, Baylor College of Medicine, Houston, Texas 77030
Address all correspondence and requests for reprints to: Dr. Jianming Xu, Department of Molecular and Cellular Biology, Baylor College of Medicine, One Baylor Plaza, Houston, Texas 77030. E-mail: jxu{at}bcm.tmc.edu.
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and ERß), progesterone receptors A and B, androgen receptor, glucocorticoid receptor (GR), and mineralocorticoid receptor change their confirmations, form homodimers, bind to their cognate hormone response elements (HREs), recruit coactivators, and enhance their target gene transcription (2, 3, 4). On the other hand, nuclear receptors that form heterodimers with the retinoid X receptor (RXR) such as the thyroid hormone receptor (TR), the retinoic acid receptor (RAR), and the vitamin D receptor (VDR) bind their HREs in the absence of ligands, associate with corepressors and inhibit transcription of their target genes. After binding to their ligands, these HRE-bound receptors release the repression function through dissociation of corepressors and gain transcriptional activation function through recruitment of coactivators (2, 3). Since the observation of the transcriptional interference between different steroid receptors indicated that common cofactors might be required for bridging the receptor and general transcription machinery (5), intensive efforts have been devoted to the hunting of novel nuclear receptor coregulators. To date, a number of important coactivators have been identified (3, 6). The members of the steroid receptor coactivator (SRC) family and the TR-associated protein (TRAP) complex or VDR- interacting protein (DRIP) complex are among the most extensively studied nuclear receptor coactivators. The three coactivators in the SRC family interact with the ligand binding domains of nuclear receptors in a ligand-dependent manner and recruit histone acetyltransferases such as cAMP response element binding protein-binding protein (CBP), p300, and p300/CBP-associated factor and protein methyltransferases such as the coactivator-associated arginine methyltransferase 1 and the protein arginine methyltransferase 1 as well, facilitating chromatin remodeling and target gene transcription (for review, see Ref. 4). The TRAP or DRIP complex directly interacts with both ligand-bound nuclear receptors and general transcription factors to coactivate target gene transcription (for review, see Refs.3 and 6).
The amplified in breast cancer-3 (AIB3), also known as ASC-2, RAP250, PRIP, TRBP and NRC, was initially identified from a highly amplified chromosomal region (20q11–12) in human breast tumor cells and subsequently characterized as a strong coactivator for many nuclear receptors (7, 8, 9, 10, 11, 12). The AIB3 protein contains two LXXLL (L, leucine; X, any amino acid) motifs, whereas only the N-terminal one is essential for interaction with the ligand binding domain of nuclear receptors including RXR, RAR, TR, VDR, GR, ER, and peroxisome proliferator-associated receptor 
. AIB3 contains two transcriptional activation domains located on both sides of the first LXXLL motif. Furthermore, AIB3 interacts with general coactivators and basal transcription factors including SRC-1, CBP, p300, DRIP130, TATA binding protein, and transcription factor IIA (8, 9, 10, 11, 12). DRIP130 is one of the components in the DRIP or TRAP coactivator complex (13, 14). Therefore, AIB3 may enhance transcriptional activities of the nuclear receptors through linking the SRC-1·CBP chromatin-remodeling coactivator complex and the DRIP coactivator complex into a larger coactivator complex (15). Interestingly, AIB3 also interacts with the coactivator activator that contains a RNA recognition domain and modulates RNA splicing patterns in a nuclear receptor- dependent manner (16, 17). Apart from the nuclear receptors, AIB3 also interacts with and coactivates other classes of transcription factors involved in the regulation of cell survival, proliferation, differentiation, and immune responses such as AP-1, serum response factor, cAMP response element binding protein, CCAAT/enhancer binding protein /EBP and nuclear factor-
B (11, 18, 19). These findings suggest that AIB3 may play important roles in multiple signaling pathways regulated by hormones, growth factors, and cytokines.
The AIB3 gene is amplified in 10% of breast cancers, 30% of colon cancers, and 13% of lung cancers (7, 8, 20). These findings suggest that AIB3 may play an important role in cell growth and tumorigenesis. To understand the role of AIB3 in development, our laboratory has recently generated AIB3 null mice. AIB3 null mouse embryos exhibit growth retardation, hypoplastic heart development, defective placentation, and embryonic lethality from 9.75–11.5 d post conception (21). These results indicate that AIB3 is essential for embryonic development. However, the developmental role of AIB3 beyond the lethal stage and the physiological function of AIB3 in adulthood remains unknown. As an initial step to understand the role of AIB3 in adulthood, we have quantitatively measured the AIB3 mRNA levels in different tissues and mapped the tissue and cell type-specific distribution patterns of the AIB3 protein in this study.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Expression and purification of AIB3 recombinant protein
A DNA fragment encoding the C terminus (amino acids 1517–2067) of AIB3 was amplified by PCR from a reverse-transcribed mouse embryonic cDNA library (CLONTECH Laboratories, Inc., Palo Alto, CA). The forward and reverse PCR primers were GGAATTCTGGAAGTAACACCTCCAGT and TAAGAATTCAAGTCATATTCCAGCTCGC. The purified DNA fragment was digested with EcoR1 and subcloned into the pGEX-2T plasmid as previously described (23). HB101 competent cells were transformed with the expression plasmid DNA and treated with isopropyl-ß-D-thiogalactoside as previously described (23). Bacterial pellets were lysed in PBS containing 1% of Triton X-100 with mild sonication. The soluble glutathione-S-transferase (GST)-AIB3 fusion protein was retained on a glutathione Sepharose 4B affinity column (Amersham Pharmacia Biotech, Arlington Heights, IL) and eluted with 5 mM reduced form of glutathione. Purified proteins were analyzed by performing SDS-PAGE.
Generation of the AIB3 antiserum and Western blot analysis
All animal experimentation described in this study was conducted in accordance with mandated standards of humane care approved by the Animal Care Committee at Baylor College of Medicine. Female BALB/c mice were immunized with the purified AIB3 C-terminal recombinant protein as previously described (23). After each boosting, antiserum was prepared from blood samples collected from the tail vein. The titer of antiserum was determined by the ELISA method. For Western blot analysis, isopropyl-ß-D-thiogalactoside-treated bacteria was directly lysed in 2x sodium dodecyl sulfate reducing buffer and separated by 8% SDS-PAGE and transferred to nitrocellulose membrane. The membrane was reacted with a 1:2000 antiserum dilution and a secondary goat antimouse IgG conjugated with horseradish peroxidase (1:5000, Promega Corp., Madison, WI) and visualized by enhanced chemiluminescence (Amersham Pharmacia Biotech).
Immunohistochemistry
Mouse tissue samples were fixed in 4% paraformaldehyde in PBS (pH 7.3) for 6 h at 4 C. Paraffin sections were cut 5 µm thick. After deparaffinization, sections were treated with 3% H2O2 in PBS (pH 7.6) for 30 min and briefly microwaved in 10 mM citrate buffer (pH 5.5) for antigen retrieval. The immunostaining was performed with the primary AIB3 antiserum (1:200) and the secondary biotinylated rabbit antimouse IgG1 (1:500, Zymed Laboratories, South San Francisco, CA) as previously described (24). The immunostaining signals were visualized by using the avidin-conjugated horseradish peroxidase and diaminobenzidine reagent (Vector Laboratories, Burlingame, CA).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
. Although the AIB3 mRNA was detected in all examined tissues, its expression levels differed substantially from one tissue to the other. The lowest expression level of AIB3 mRNA was found in the female virgin mammary gland. The AIB3 mRNA levels in the liver and skeletal muscle are 14- and 19-fold higher, respectively, than that in the virgin mammary gland. In the heart, kidney, uterus, and lung, AIB3 is expressed 20- to 35-fold higher than that in the virgin mammary gland. In the adrenal gland, ovary, pituitary, and white fat, AIB3 is expressed 45- to 60-fold higher than in the virgin mammary gland. In the thymus and brain, AIB3 mRNA is 70- to 100-fold higher than in the virgin mammary gland. The highest level of AIB3 mRNA is located in the testis, which is 165-fold higher than in the virgin mammary gland (Fig. 1). These data demonstrate that although AIB3 is widely expressed, its expression levels vary dramatically in dependent tissues.
|
, lane 2). In Western blot analysis using bacterial lysates, the antiserum reacted with the 83-kDa GST-AIB3 fusion protein, the 26-kDa GST protein and a 70-kDa bacterial protein probably due to an impurity in the antigen solution (Fig. 2B). After the antiserum was preadsorbed with the bacterial lysate containing the GST protein, only the 83-kDa GST-AIB3 fusion protein was detected in Western blots (Fig. 2C). These results indicate that the antiserum contains antibodies specific to the AIB3 recombinant protein.
|
). These results indicate that the antiserum can specifically detect AIB3 protein in mouse tissues.
|
. In the testis, the most intensive signals of AIB3 immunostaining were located in the nuclei of Sertoli cells attached to the base membrane of the seminiferous tubules. Moderate levels of signals were observed in Leydig cells in the interstitial tissues. Lower levels of AIB3 were stained in the spermatids. In contrast, nearly no AIB3 protein could be detected in the spermatocytes and elongated spermatids in the seminiferous epithelium (Fig. 3C
and Table 1). To further validate the specificity of the immunostaining, the antiserum was preadsorbed with the purified recombinant antigen and then used to react with the testis sections under the same conditions. This analysis demonstrated that the AIB3 immunoreactivity in the testis was completely neutralized by the purified AIB3 recombinant protein (Fig. 3D). In addition, there was also no immunostaining background in the testis when preimmune serum was used as a negative control (data not shown). In the prostate, substantial AIB3 immunoreactivity was observed in the nuclei of epithelial cells. Lower levels of immunostaining signals were also observed in stromal cells (Fig. 3E and Table 1).
|
). In the ovary, high levels of AIB3 immunostaining were found in the follicular granulosa cells and lower signals in theca cells, cumulus cells, and oocytes. In the interstitial tissue, about 50–60% of cells were positively stained, and they were evenly scattered among negatively stained cells (Fig. 3F). In the endometrium, substantial immunostaining signals were observed in the epithelial cells of the uterine glands. Relatively lower immunoreactivities were also found in the luminal epithelium and in about 60–70% of the stromal cells (Fig. 3G). In the female virgin mammary gland, clear AIB3 immunostaining was mainly observed in the luminal epithelium and myoepithelial cells. The AIB3 immunoreactivity was also detected in the nuclei of mammary gland adipocytes but not detected in the fibroblasts around the mammary ducts (Fig. 3H).
Expression of AIB3 protein in endocrine organs
In the pituitary, high levels of AIB3 immunostaining signals were observed in the nuclei of all endocrine cells of the anterior and intermediate lobes but not observed in the endothelial cells of the blood vessels (Fig. 3I and Table 1). In the posterior lobe, a proportion of AIB3-positive cells was scattered in AIB3-negative cells (Table 1). In the adrenal gland, strong AIB3 immunostaining signals were observed in the region of zona glomerulosa, the outer layer of the adrenal cortex responsible for the biosynthesis of aldosterone. In contrast, cells in the adrenal capsule and in other layers of the adrenal cortex exhibited either no AIB3 immunostaining or extremely weak staining. In the adrenal medulla, the central area consisting of chromaffin cells, also showed low levels of AIB3 immunostaining (Fig. 3J and Table 1). In the thyroid gland, AIB3 protein was detected in all of the follicular epithelial cells with round nuclei. However, a small number of epithelial cells with flat nuclei did not show AIB3 immunostaining signals. In addition, the parafollicular cells, connective cells, and capillary endothelial cells were also negative for AIB3 immunostaining (Fig. 3K and Table 1). In the parathyroid gland, all of the parenchyma cells were positively stained by the AIB3 antiserum (Fig. 3L). In the pancreas, all endocrine cells in the islets of Langerhans exhibited strong AIB3 immnunoreactivity (Fig. 3M and Table 1). Collectively, these results suggest that AIB3 protein is produced in many types of endocrine cells, and it may play diverse function in development and regulation of the endocrine systems.
Immunohistochemical analysis of the AIB3 protein in the brain
In the cerebral cortex, the AIB3 protein was detected only in a proportion of neurons (Fig. 4A and Table 1). In the hippocampus, moderate levels of the AIB3 immunostaining signals were observed in neurons of the CA1, CA2, CA3, and dentate gyrus regions (Fig. 4A and Table 1). In the cerebellum, moderate levels of AIB3 immunoreactivity were located in the Purkinje cells and weaker immunoreactivities in some of the neurons of the granular layer (Fig. 4B and Table 1). In contrast, the AIB3 protein was undetectable in the molecular layer and the white matter of the cerebellum. In addition, the AIB3 protein was also detectable in the brain regions of the olfactory bulb and hypothalamus (Fig. 4C and Table 1).
|
and Table 1). In the small intestine, AIB3 was mainly detected in the nuclei of enterocytes. Weak staining was also observed in the cytoplasm of the enterocytes. However, the intestinal mucous cells and smooth muscle cells showed no AIB3 immunostaining (Fig. 4E and Table 1). In the liver, AIB3 immunoreactivity was weak and the immunostaining signals were observed only in the hepatocytes. The positive signals in the nuclei of hepatocytes were stronger than in their cytoplasm (Fig. 4F). In the exocrine pancreas, only a subpopulation (20–30%) of Acini cells exhibited a low level of AIB3 immunoreactivity (Fig. 3M and Table 1).
AIB3 immunostaining in other organs
In the heart, weak AIB3 immunostaining was observed in the inner layers of the myocardium (Table 1). In the lung, strong AIB3 immunostaining was detected in the epithelial cells of bronchioles and certain alveolar epithelial cells. The locations of these positively stained alveolar epithelial cells correlate with the positions of type II cells in the alveoli (Fig. 4G and Table 1). The type II cells are surfactant-secreting cells and nuclear receptors including GR, RAR, and RXR are critical regulators of the type II cell functions (25). In the kidney, AIB3 immunostaining was predominantly localized in the proximal and distal convoluted tubules in the cortex. Interestingly, in the epithelial cells of the proximal convoluted tubules, high levels of AIB3 immunoreactivity was detected not only in the nuclei but also in the cytoplasm of these cells. In contrast, most of the cells in the glomeruli of the cortex were weakly stained or not stained (Fig. 4H and Table 1).
In the spleen, the AIB3 immunoreactivities were mainly observed in the cellular nuclei of the white pulp, which is a center for B lymphocyte proliferation (Fig. 4I). In the red pulp, which is a region with active phagocytosis of aged or damaged erythrocytes, less intensive AIB3 immunostaining signals were also observed in scattered cells (Fig. 4I and Table 1). In the thymus, moderate levels of AIB3 immunostaining were observed in 5–10% of cells in the cortex. Medium levels of AIB3 immunostaining were also observed in about 50% of cells in the medulla. In both cortex and medulla, the AIB3-positive cells were evenly distributed among negative cells (Fig. 4J and Table 1).
In skeletal muscle, medium levels of AIB3 protein were detected in both nucleus and cytoplasm (data not shown). In the cartilage, the young chondrocytes located in the peripheral region exhibited stronger immunostaining. In contrast, the elder chondrocytes located in the central region were weakly immunostained (Fig. 4K and Table 1).
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
To define the subcellular localization and the cell type-specific expression patterns of the AIB3 protein in different tissues and cell types, AIB3 recombinant protein was produced to generate AIB3 antiserum. The specificity of the antiserum was clearly demonstrated in multiple experiments. First, the antiserum specifically recognizes AIB3 recombinant protein produced in the bacteria. Second, the immunostaining signals in mouse tissues can be neutralized by preadsorption of the antibodies with purified AIB3 recombinant protein. Third, both positively and negatively immunostained cells are identified in the same sections prepared from multiple tissues. And fourth, the AIB3 protein is only detected in the wild-type mouse embryos, and not in the knockout mouse embryos lacking the AIB3 protein. When mouse tissues were immunostained with the specific antiserum, the AIB3 protein was mainly identified in the nuclei of most cell types. However, in certain cell types including the epithelial cells of the kidney proximal convoluted tubules, the hepatocytes, the skeletal muscle cells and the epithelial cells of the small intestine, the AIB3 protein was detected in both nucleus and cytoplasm. Previous studies showed that SRC-1 is translocated into the nucleus with ER in transfected cells after estrogen treatment (26). SRC-3 (p/CIP) is translocated into the nucleus in a phosphorylation-dependent manner after cells are treated with a growth factor or cytokine (27, 28). Therefore, the differences in AIB3 subcellular localization suggest that AIB3 function may be partially regulated through controlling its subcellular movement by signal transduction pathways.
Although AIB3 mRNA in the virgin mammary gland is very low (Fig. 1), the amount of AIB3 protein is quite abundant in the epithelial cells of the virgin mammary gland (Fig. 3H and Table 1). The discrepancy can be explained by the low ratio of mammary epithelial cells to total cells in the fat pads of the virgin mammary glands. Because the RNA samples were isolated from the entire mammary glands and AIB3 protein appears mainly in the mammary epithelial cells, the low concentration of AIB3 mRNA in RNA samples of the entire mammary glands is due to a dilution of the AIB3 mRNA from the epithelial cells. In addition, our preliminary results demonstrate that the concentrations of AIB3 mRNA are largely elevated in the RNA samples from pregnant and lactation mammary glands due to increases in AIB3 mRNA levels and epithelial cell numbers (data not shown). These results suggest that AIB3 may play an important role in mammary gland development, and its expression level may be related to the status of mammary gland epithelial proliferation and differentiation.
In reproductive organs, previous analysis by in situ hybridization showed that AIB3 mRNA is expressed in the seminiferous tubules of the testis, prostate epithelium, and the ovarian granulosa cells and interstitial cells (9, 29). In the adult rat brain, AIB3 mRNA is mainly expressed in the olfactory bulb, piriform cortex, hippocampus, and cerebellar cortex (9). Our results obtained from immunohistochemistry are consistent with the mRNA expression patterns in these locations and provide much more detailed information regarding the distribution of AIB3 protein. For example, this study demonstrates high levels of the AIB3 protein in the Sertoli cells of the seminiferous tubules and in the Purkinje cells of the cerebellum.
The defined spatial expression pattern of AIB3 mRNA and protein will help to understand the developmental and functional roles of AIB3 in different tissues. Recently, we have reported that deletion of the AIB3 gene in mice results in defective placentation and embryonic lethality from 9.75–11.5 d post coitus (21). Therefore, animal models with tissue-specific inactivation of the AIB3 gene will be valuable to provide information regarding the role of AIB3 in development beyond the lethal stage of AIB3 null mice. The tissue- and cell type-distribution pattern of AIB3 will allow investigators to look for the right place for AIB3 function in vivo.
Importantly, AIB3 protein is coexpressed with steroid receptors in most of steroid hormone target cells. It is known that ER and progesterone receptor are expressed in the epithelial cells of the mammary gland and uterus, as well as in the granulosa cells of the ovarian follicles (30, 31). Androgen receptor is highly expressed in the epithelial cells of the prostate and in the Sertoli cells and Leydig cells of the testis (32). GR is expressed in the epithelial cells of the mammary gland and in the neurons of the hippocampus (33). The spatial coexpression of AIB3 protein with steroid receptors in all of the above steroid hormone target cells highlights their potential partnerships and suggests that AIB3 may play an important role in mediating steroid receptor function in vivo. Because previous studies have demonstrated that AIB3 strongly enhances steroid receptor-mediated target gene transcription in ex vivo experiments and the AIB3 gene is highly amplified and overexpressed in breast and ovarian cancers (7, 8, 9, 10, 11, 12), the AIB3 concentrations in the hormonal target cells may have a great influence on hormonal sensitivity and hormonal promotion of tumorigenesis.
Similar to its mRNA expression, the amount of AIB3 protein in different cell types varies substantially. Interestingly, the three homologous coactivators in the SRC family are also expressed differentially in different tissues (4). In the brain, all three SRCs are expressed in the hippocampus, but only high levels of SRC-1 and low levels of SRC-2 are expressed in the cerebellar Purkinje cells. Accordingly, SRC-1 knockout mice exhibit a delay in Purkinje cell development without any developmental abnormalities in the hippocampus (34). In the testis, SRC-2 (TIF2) is the major member in the SRC family expressed in Sertoli cells and SRC-2 (TIF2) knockout mice exhibit a spermatogenic problem and partial impairment of male fertility (35). SRC-3 is expressed in the vascular smooth muscle cells and endothelial cells but extremely low in the uterine endometrium. Accordingly, SRC-3-deficient mice exhibit an insensitive inhibition of neointimal growth by estrogen after vascular injury, but an equal uterine growth response to estrogen (24). In this study, AIB3 protein is detected in the hippocampus, Purkinje cells, and Sertoli cells, which may partially compensate for the functional loss of SRCs in mutant mice. In addition, AIB3 may play more important roles in tissues where SRCs are expressed at low levels or not expressed, such as in the skeletal muscle and uterine endometrium (34, 36).
Collectively, the partially overlapping expression profiles of individual coactivators may provide, in part, a physiological platform for their functional redundancy and specificity in coactivation of nuclear receptors. The differential expression patterns of both nuclear receptors and coactivators in different tissues suggest that there are at least two levels of functional relationships between nuclear receptors and coactivators: 1) a specific coactivator may be used by different receptors in different tissues; and 2) the same receptor may be supported by different combinations of coactivators in different tissues, adding a further layer of tissue-specific modulation of receptor function "downstream" of ligand activation. Therefore, we propose that the spatial expression levels and specific combinations of individual coactivators in different tissues may serve as a critical factor to determine the tissue-specific activities of nuclear receptors.
|
Footnotes |
|---|
Abbreviations: AF-1, Activation function-1; AIB3, amplified in breast cancer-3; CBP, cAMP response element binding protein-binding protein; DRIP, VDR-interacting protein; HRE, hormone response element; GST, glutathione-S-transferase; RAR, retinoic acid receptor; RXR, retinoid X receptor; SRC, steroid receptor coactivator; TR, thyroid hormone receptor; TRAP, TR-associated protein; VDR, vitamin D receptor.
Received November 8, 2002.
Accepted for publication December 9, 2002.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B, and serum response factor as novel target molecules of the cancer-amplified transcription coactivator ASC-2. Mol Endocrinol 14:915–925 in granulocyte differentiation of HL-60 promyelocytic cell. Biochem Biophys Res Commun 282:1257–1262[CrossRef][Medline]
and steroid receptor coactivator-1. Mol Endocrinol 14:518–534B kinase. Mol Cell Biol 22:3549–3561 and ß in the human reproductive organs. J Clin Endocrinol Metab 85:4835–4840This article has been cited by other articles:
 |
|
 |
|
  G. H. Kim, K. Park, S.-Y. Yeom, K. J. Lee, G. Kim, J. Ko, D.-K. Rhee, Y. H. Kim, H. K. Lee, H. W. Kim, et al. Characterization of ASC-2 as an Antiatherogenic Transcriptional Coactivator of Liver X Receptors in Macrophages Mol. Endocrinol., July 1, 2009; 23(7): 966 - 974. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Q. Li, M.-J. Chu, and J. Xu Tissue- and Nuclear Receptor-Specific Function of the C-Terminal LXXLL Motif of Coactivator NCoA6/AIB3 in Mice Mol. Cell. Biol., December 1, 2007; 27(23): 8073 - 8086. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Mussi, L. Liao, S.-E. Park, P. Ciana, A. Maggi, B. S. Katzenellenbogen, J. Xu, and B. W. O'Malley Haploinsufficiency of the corepressor of estrogen receptor activity (REA) enhances estrogen receptor function in the mammary gland PNAS, November 7, 2006; 103(45): 16716 - 16721. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S.-Y. Yeom, G. H. Kim, C. H. Kim, H. D. Jung, S.-Y. Kim, J.-Y. Park, Y. K. Pak, D.-K. Rhee, S.-Q. Kuang, J. Xu, et al. Regulation of Insulin Secretion and {beta}-Cell Mass by Activating Signal Cointegrator 2 Mol. Cell. Biol., June 15, 2006; 26(12): 4553 - 4563. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S.-Q. Kuang, L. Liao, S. Wang, D. Medina, B. W. O'Malley, and J. Xu Mice Lacking the Amplified in Breast Cancer 1/Steroid Receptor Coactivator-3 Are Resistant to Chemical Carcinogen-Induced Mammary Tumorigenesis Cancer Res., September 1, 2005; 65(17): 7993 - 8002. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. A. Mahajan and H. H. Samuels Nuclear Hormone Receptor Coregulator: Role in Hormone Action, Metabolism, Growth, and Development Endocr. Rev., June 1, 2005; 26(4): 583 - 597. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Zhang, S.-Q. Kuang, L. Liao, S. Zhou, and J. Xu Haploid Inactivation of the Amplified-in-Breast Cancer 3 Coactivator Reduces the Inhibitory Effect of Peroxisome Proliferator-Activated Receptor {gamma} and Retinoid X Receptor on Cell Proliferation and Accelerates Polyoma Middle-T Antigen-Induced Mammary Tumorigenesis in Mice Cancer Res., October 1, 2004; 64(19): 7169 - 7177. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S.-Q. Kuang, L. Liao, H. Zhang, A. V. Lee, B. W. O'Malley, and J. Xu AIB1/SRC-3 Deficiency Affects Insulin-Like Growth Factor I Signaling Pathway and Suppresses v-Ha-ras-induced Breast Cancer Initiation and Progression in Mice Cancer Res., March 1, 2004; 64(5): 1875 - 1885. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y.-H. Goo, S.-Y. Na, H. Zhang, J. Xu, S. Hong, J. Cheong, S.-K. Lee, and J. W. Lee Interactions between Activating Signal Cointegrator-2 and the Tumor Suppressor Retinoblastoma in Androgen Receptor Transactivation J. Biol. Chem., February 20, 2004; 279(8): 7131 - 7135. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
