help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Longobardi, L.
Right arrow Articles by Spagnoli, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Longobardi, L.
Right arrow Articles by Spagnoli, A.
Endocrinology Vol. 144, No. 5 1695-1702
Copyright © 2003 by The Endocrine Society

A Novel Insulin-Like Growth Factor (IGF)-Independent Role for IGF Binding Protein-3 in Mesenchymal Chondroprogenitor Cell Apoptosis

Lara Longobardi1, Monica Torello1, Caroline Buckway, Lynda O’Rear, William A. Horton, Vivian Hwa, Charles T. Roberts, Jr., Francesco Chiarelli, Ron G. Rosenfeld and Anna Spagnoli

Department of Pediatrics (L.L., A.S., L.O.), Vanderbilt University Medical Center, Nashville, Tennessee 37232-2579; Research Center (M.T., W.A.H.), Shriners Hospital for Children, and Department of Pediatrics (C.B., V.H., C.T.R., R.G.R.), Oregon Health & Science University, Portland, Oregon 97201; and Department of Pediatrics (F.C.), University of Chieti, 66013 Chieti, Italy

Address all correspondence and requests for reprints to: Anna Spagnoli, Department of Pediatrics, Vanderbilt University Medical Center, T-0107 Medical Center North, Nashville, Tennessee 37232-2579. E-mail: anna.spagnoli{at}mcmail.vanderbilt.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Chondrogenesis results from the condensation of mesenchymal chondroprogenitor cells (MCC) that proliferate and differentiate into chondrocytes. We have previously shown that IGF binding protein (IGFBP)-3 has an IGF-independent antiproliferative effect in MCC. The current study evaluates the IGF-independent apoptotic effect of IGFBP-3 on MCC to modulate chondrocyte differentiation. We employed the RCJ3.1C5.18 chondrogenic cell line, which in culture progresses from MCC to differentiated chondrocytes; cells do not express IGFs or IGFBP-3. We also used IGFBP-3 mutants with decreased (I56 substituted to G56; L80 and L81 to G80G81) or abolished binding for IGFs (I56, L80, and L81 to G56G80G81). MCC transfected with IGFBP-3 detached, changed their phenotype, and underwent apoptosis. A maximal IGFBP-3 apoptotic effect was observed 24 h after transfection (463 ± 73% of controls; P < 0.001). Remarkably, IGFBP-3 mutants had similar effects, demonstrating that the IGFBP-3 apoptotic action was clearly IGF independent. In addition, treatment with IGFBP-3 in serum-free conditions resulted in a significant increase of apoptosis (173 ± 23% of controls; P < 0.05). Moreover, this apoptotic effect was selective for MCC, resulting in a selective reduction of chondrocytic nodules and a significant decrease in type II collagen expression and proteoglycan synthesis. In summary, we have identified a novel IGF-independent role for IGFBP-3 in the modulation of chondrocyte differentiation.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
CHONDROGENESIS RESULTS FROM the condensation and proliferation of mesenchymal chondroprogenitor cells (MCC), which in turn, mature into differentiated chondrocytes. Unlike most tissues, cartilage lacks a natural regenerative ability. This inability has made difficult the development of effective treatments for injured or degenerated cartilage and has led to efforts to develop alternative means. One of the most promising is the use of MCC to restore the integrity of damaged cartilage (1, 2, 3, 4, 5, 6, 7, 8, 9). MCC are present in different adult tissues including bone marrow, and the recent development of culture techniques for MCC has opened new perspectives to use these cells for cellular and gene therapy to repair cartilage. Most have been proof-of-concept studies, demonstrating that MCC can express the chondrocytic phenotype. However, little is known about the molecular mechanisms by which growth factors control the proliferation/differentiation program of MCC. The remarkable degree of growth failure observed in animals carrying null mutations of the genes encoding the IGFs and the type I IGF receptor has clearly indicated the fundamental role of IGFs in the growth process (10, 11). Six IGF binding proteins (IGFBPs), referred to as IGFBP-1–6, have been characterized as IGF carriers (12, 13). The multifunctional nature of some of the IGFBPs, and in particular IGFBP-3, has been characterized over the past few years. IGFBP-3 is the major circulating IGFBP present during postnatal life (14) and sequesters IGF, inhibiting binding to the IGF receptor (IGF-dependent effect; Ref.15). In some cell systems, IGFBP-3 has been demonstrated to have a direct effect on cell replication, independent of IGF binding (IGF-independent effect; Refs.15, 16, 17).

The functional relationship between IGF and IGFBP-3 in endochondral bone growth is not well understood. Using the RCJ3.1C5.18 chondrogenic cell line as an established model (18, 19) to study the chondrogenesis process in vitro, we have recently demonstrated a novel IGF-independent role for IGFBP-3 in this process (20). RCJ3.1C5.18 cells are especially suitable for this purpose. Over the 2 wk of culture, they undergo a reproducible, time-dependent progression from chondroprogenitors to hypertrophic chondrocytes (18, 19). Furthermore, RCJ3.1C5.18 cells do not express IGFs or IGFBP-3; therefore, the action of these peptides can be studied without interference from endogenous molecules (20). Using RCJ3.1C5.18 cells, we have previously reported that IGFBP-3 has an IGF-independent antiproliferative effect in MCC and early differentiated chondrocytes but not in terminally differentiated chondrocytes (20). We have also demonstrated that IGFBP-3 induces STAT-1 (signal transducer and activator of transcription-1) gene expression and protein phosphorylation in MCC but not in terminally differentiated cells. Furthermore, we have demonstrated that STAT-1 activation has a functional role in the apoptotic action of IGFBP-3 in MCC (21).

In the present study, we focus our attention on the cellular events that link the IGF-independent IGFBP-3 proapoptotic effect on MCC to the chondrocyte differentiation process. We have recently produced and characterized IGFBP-3 mutants with reduced or abolished affinity for IGFs (22). These mutants represent unique tools to investigate the IGF-independent biological effects of IGFBP-3 in the process of chondrogenesis. The present study was aimed at: 1) evaluating the IGF-independent apoptotic effect of IGFBP-3 in RCJ3.1C5.18 MCC; and 2) characterizing how the apoptotic effect of IGFBP-3 modulates the rate of chondrocyte differentiation.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Chemical reagents
Human recombinant IGF-I, des-(1–3)-IGF-I (des-IGF-I) were purchased from GroPep Pty. Ltd. (Adelaide, Australia). des-IGF-I exhibits 30- to 100-fold reduced affinity for IGFBP-3 but unaltered affinity for the type I IGF receptor compared with IGFs (23, 24). FGF-2 (fibroblast growth factor-2) was purchased from R&D Systems (Minneapolis, MN). Recombinant nonglycosylated human IGFBP-3 and ND-IGFBP-3 variant (25) were expressed in Escherichia coli was generously supplied by Celtrix Pharmaceuticals, Inc. (Santa Clara, CA). Recombinant bovine IGFBP-4 expressed in a baculovirus system was generously donated by Dr. Robert S. Bar (University of Iowa, Iowa City, IA). Fetal bovine serum, {alpha}-MEM, and sodium pyruvate were purchased from Life Technologies, Inc. (Gaithersburg, MD). Dexamethasone, ß-glycerophosphate, and Alcian Blue were obtained from Sigma (St. Louis, MO). Ascorbic acid was obtained from Wako Pure Biochemicals Industries, Ltd. (Osaka, Japan). E-TOXATE kit (Sigma) was used to test contamination with endotoxin in the plasmid preparations and recombinant proteins used. No contamination was detected. Assay is based on the fact that lysate, obtained from circulating amebocytes of the Limulus polyphemus horseshoe crab, increases in opacity when exposed to minute quantities of endotoxin.

Cell culture
RCJ3.1C5.18 cells, generously donated by Dr. Jane E. Aubin (University of Toronto, Toronto, Ontario, Canada), were plated and grown in {alpha}-MEM supplemented with 15% heat-inactivated fetal bovine serum, 10-7 M dexamethasone, and 2 mM sodium pyruvate. Cells were plated at a density of 6 x 104 cells/well in 6-well dishes or 0.6 x 104 cell/well in 24-well dishes. After reaching confluence (4 d of culture), fresh differentiating medium supplemented with 50 µg/ml of ascorbic acid and 10 mM ß-glycerophosphate was added. Cultures were monitored over a total period of 7 d. We have previously shown that cells grown in this manner undergo a reproducible, time-dependent progression from chondroprogenitors to early differentiated chondrocytes (19, 20).

IGFBP-3 mutant constructs and cell transfection
IGFBP-3 mutant cDNAs were generated by site-directed mutagenesis as previously described (22). Briefly, residues I56, L80, and L81 were mutated to G56 (G mutant), to G80G81 (GG mutant), and to G56G80G81 (GGG mutant). Binding studies (including BIAcore analysis) showed that the G and GG mutant proteins had reduced affinity for IGFs, and the GGG mutant protein had abolished affinity for IGFs (22). For transfection, human IGFBP-3 and IGFBP-3 mutant cDNAs were subcloned into pCMV6 vector, as previously described (22). Bovine IGFBP-4 cDNA, subloned into a pSP73 vector, was generously donated by Dr. Robert S. Bar. IGFBP-3 mutant cDNA lacking the signal peptide sequence (NSP-IGFBP-3) was generated by PCR amplification from human IGFBP-3 cDNA. The following 5' complementary oligonucleotide containing a BamHI restriction site, cgggatccatgggcgcgagc tcgg, was employed. The following 3' complementary oligonucleotide containing an XbaI restriction site: ggtctagactacttgctctgc was used. PCR product was introduced into a pCR2.1 plasmid vector using a TA Cloning kit from Invitrogen (Carlsbad, CA) and sense and antisense strands were sequenced. Preparations were introduced into a pcDNA3.1 vector (Invitrogen) using Rapid DNA Ligation Kit (Roche Molecular Biochemicals, Mannheim, Germany), and preps were transformed into DH5{alpha} E. coli-competent cells. Cells were seeded in 6-well dishes and 24 h later were transfected with 4 µg of expression vector plasmid using Mirus Transit LT-1 as described by the manufacturer (PanVera, Madison, WI).

Measurement of cell apoptosis and cell number
Cell apoptosis was measured using two independent assays, cytoplasmic histone-associated DNA fragments by ELISA and Annexin V binding assay. Cytoplasmic histone-associated DNA fragments (mono- and oligonucleosomes) generated in the early phase of apoptosis were measured using the cell death detection ELISA kit (Roche Molecular Biochemicals). The assay is based on a quantitative sandwich enzyme immunoassay, using antibodies directed against DNA and histones. This allows the specific determination of mono- and oligonucleosomes, which are released into the cytoplasm of apoptotic cells. To determine the IGF-independent effect of transfected IGFBP-3, cells were seeded in six-well dishes, and 24 h later transfected with 4 µg of expression vector plasmid (IGFBP-3, GGG mutant, or empty vector). Six, 12, 24, and 48 h after transfection, cell lysates, obtained combining floating and attached cells, were prepared and subjected in duplicate to the cell death detection assay. To determine the specificity of the IGFBP-3 apoptotic effect, cells, 24 h after seeding, were transfected, with bovine IGFBP-4, IGFBP-3, GGG mutant and empty vectors and cell lysates were obtained 24 h after transfection. The effect of the NSP-IGFBP-3 was assessed in the same experimental conditions.

To measure the level of cell apoptosis at 7-d culture, cells were seeded in six-well dishes and 24 h later were transfected with 4 µg of expression vector plasmid (IGFBP-3, GGG mutant, or empty vector). After 4 d of culture, cells reached confluence and fresh differentiating medium was added. Cell lysates were obtained 6 d after transfection and subjected in duplicate to the cell death detection assay, as described above.

To determine the IGF-independent effect of exogenously added IGFBP-3, cells were treated with recombinant IGFBP-3. Cells were seeded in 6-well or 24-well dishes and treated with IGFBP-3 at 2 d and/or 6 d of culture in serum-free conditions. Increasing concentrations of exogenous IGFBP-3 (0.1, 1, 15, and 30 nM) were tested. Effects of IGFBP-4 (30 nM) and IGFBP-3 ND variant (30 nM; Ref.25) were also tested. Cell lysates from floating and attached cells were prepared and subjected in duplicate to the cell death detection assay, as described above.

Expression of phosphatidylserine in the outer leaflet of the plasma membrane (an early marker of apoptosis) was detected by binding of Annexin-V-fluorescein using the Annexin-V-FLUOS Staining Kit from Roche Molecular Biochemicals. Cells were simultaneously stained with propidium iodide (PI) to detect necrotic cells. Cells were seeded in six-well dishes and 48 h later were treated in serum-free conditions with or without IGFBP-3 (30 nM) for 4 h. Cells were detached using 0.02% EDTA and subjected to Annexin V/PI staining following manufacturer’s instructions (Roche Molecular Biochemicals). Stained cells were analyzed on a fluorescence-activated FACScan flow cytometer (BD Immunocytometry Systems, San Jose, CA). For each sample, forward light scatter, side scatter, green fluorescence (Annexin-V-fluorescein) and red fluorescence (PI) of 10,000 cells were acquired. Debris and remaining cells were excluded by gating on basis of forward and side scatter. The spectral overlap of the different fluorescence emission spectra was corrected by electronic compensation. Data analysis was performed using WinMDI software (http://facs.scripps.edu). Viable cells were distinguished by necrotic cells by simultaneous staining with PI. Cells stained positive for Annexin V and negative for PI were considered apoptotic.

Measurement of cell proliferation was determined by cell counting. Cell number was determined at the same time points by counting trypsinized cells in a hemocytometer.

RNA isolation and Northern blotting analysis
To determine the IGF-independent effect of transfected IGFBP-3 on chondrocyte differentiation, cells were transfected 24 h after seeding with expression vector plasmid (IGFBP-3, GGG, or empty vector) or left untransfected. Six days after transfection, total RNA was extracted from cultured cells as described by the manufacturer, using RNeasy columns (QIAGEN Inc., Santa Clarita, CA) and quantified by spectrophotometric analysis. Ten micrograms of RNA were subjected to Northern Blotting analysis as previously described (20). A mouse type II collagen probe, generously donated by Dr. Eero Vuorio, was labeled by random priming with [{alpha}32P]deoxy-CTP, and hybridization was performed in Rapid-hyb buffer (Amersham Biosciences, Buckinghamshire, UK). Washed filters were autoradiographed, and densitometric analysis was done with a GS700 Imaging Densitometer (Bio-Rad Laboratories, Inc., Hercules, CA). 18S rRNA was used as an internal control for RNA loading.

To determine the IGF-independent effect of exogenously added IGFBP-3 on chondrocyte differentiation, 6-d-old cells were incubated for 24 h with recombinant IGFBP-3 (30 nM) in serum free conditions. Cells were also treated with FGF-2 (50 ng/ml) and des-IGF-I (15 nM), with and without IGFBP-3 (30 nM), to induce type II collagen expression. Total RNA was extracted from cultured cells as described by the manufacturer, using RNeasy columns (QIAGEN Inc.), quantified by spectrophotometric analysis and subjected to type II collagen northern analysis as described above for transfected cells.

Quantitative proteoglycan (PG) synthesis assay
PG synthesis was quantified by Alcian blue staining as previously described (18). Briefly, cells were transfected 24 h after seeding with expression vector plasmid (IGFBP-3, GGG-IGFBP-3, or empty vector) or left untransfected. Six days after transfection cell monolayers were stained with Alcian blue (1% in 3% acetic acid) for 30 min, washed three times for 2 min in 3% acetic acid, rinsed once with water, and solubilized in 1% sodium dodecyl sulfate. The absorbance measured at 605 nm was determined for triplicate samples and expressed as percentage of absorbance measured in untransfected control cells.

Measurement of IGFBP-3 and GGG mutant
Conditioned media were obtained 6, 12, 24, and 48 h after transfection as well as 5 and 7 d after transfection. Media were concentrated 7- to 10-fold using Centricon 3 columns (Amicon, Boston, MA), and IGFBP-3 and GGG concentrations were determined using a commercial immunoradiometric assay (IRMA) kit for human IGFBP-3 (Diagnostic Systems Laboratories, Inc., Webster, TX). The minimum detection limit of the assay is 0.5 ng/ml; the intraassay coefficient of variation ranges from 1.8 to 3.9% and the interassay coefficient of variation ranges from 0.5–1.9%. The GGG mutation did not interfere with the ability of the peptide to be recognized by the anti-IGFBP-3 antibodies used in the assay, and a parallel curve of the mutant was generated with each assay run, suggesting minimal disruption of the tertiary structure and the epitopes recognized by the antibodies (22).

Determination that GGG mutant expressed in MCC does not bind IGFs
To determine that GGG mutant expressed in MCC has abolished affinity for IGFs, cells were transfected 24 h after seeding with expression vector plasmid (IGFBP-3, GGG, or empty vector) or left untransfected. Conditioned media (CM) were obtained 24 h after transfection and were concentrated 7- to 10-fold using Centricon 3 columns (Amicon). IGFBP-3 and GGG concentrations were determined using a commercial IRMA kit for human IGFBP-3 (Diagnostic Systems Laboratories, Inc.). Four nanograms of IGFBP-3 or GGG present in the CM and 4 ng of IGFBP-3 presents in human serum obtained from normal subjects [NHS; n = 6 (as control)] were subjected to immunoprecipitation as described previously (26, 27) using the polyclonal antibody against IGFBP-3 presents in the IGFBP-3 IRMA kit. Immunoprecipitates were dissociated in sodium dodecyl sulfate sample buffer, boiled, and centrifuged. Supernatants electrophoresed in SDS-PAGE were subjected to Western ligand blotting (WLB) analysis, a mixture of 125I-IGF-I and 125I-IGF-II (1.5 x 106 cpm of each) was used as previously described (28, 29).

Statistics
Data are presented as mean ± SD. Statistical differences between groups were assessed by one-way ANOVA followed by Student- Newman-Keuls test for all pairwise multiple comparisons, or, when necessary, by one-way ANOVA on ranks (Kruskal-Wallis) followed by Student-Newman-Keuls test for all pairwise multiple comparisons. Statistical significance was set at P < 0.05. Statistical analysis was performed with the Sigmastat Package (Sigmastat, Jandel Scientific, San Rafael, CA).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
IGF-independent effect of IGFBP-3 on MCC morphology and apoptosis
Remarkable cell morphology changes were noted after transfection of RCJ3.1C5.18 MCC with IGFBP-3 or IGFBP-3 mutants (G, GG, GGG). Figure 1Go depicts cells 24 h after transfection: IGFBP-3-transfected cells detached and lost their characteristic cuboidal phenotype. Effects similar to those seen with wild-type IGFBP-3 were seen in cells transfected with IGFBP-3 mutants with low (Fig. 1Go, D–E, G, and GG mutants, respectively) or abolished affinity for IGFs (Fig. 1FGo, GGG mutant). Since all mutants had equivalent effects only the GGG mutant was employed in subsequent experiments.



View larger version (177K):
[in this window]
[in a new window]
 
Figure 1. IGF-independent effects of IGFBP-3 on cell morphology. Cells were plated in six-well dishes and 24 h later were transfected with empty vector (B), IGFBP-3 (C), G mutant (D), GG mutant (E), or GGG mutant (F). A, Untransfected cells. All panels show cell phenotype at 24 h after transfection.

 
To define if the morphological changes were determined by IGFBP-3 induced apoptosis, cell apoptosis was measured by quantifying cytoplasmic histone-associated DNA fragments. As shown in Fig. 2Go, cells transfected with IGFBP-3 or the GGG mutant gradually underwent apoptosis, with a maximal effect 24 h after transfection (~400–500% of untransfected control).



View larger version (18K):
[in this window]
[in a new window]
 
Figure 2. IGFBP-3 induces apoptosis. Twenty-four-hour-old cells were transfected with IGFBP-3, GGG mutant, or empty vector. Cell apoptosis was measured by quantifying cytoplasmic histone-associated DNA fragments using a cell death detection ELISA kit. Apoptosis was determined at 6, 12, 24, and 48 h after transfection. Results are expressed as percentage of the apoptosis measured in untransfected control cells, which was given an arbitrary value of 100%.

 
The IGF-independent IGFBP-3 apoptotic effect was also assessed using exogenously added IGFBP-3. Because RCJ3.1C5.18 cells do not express IGFs or IGFBP-3 (20), the experiment was performed in serum free conditions to exclude any dependence on IGF binding. Cells treated with IGFBP-3 underwent to a significant increase of cell apoptosis in a dose-dependent manner (IGFBP-3 0.1 nM, 88 ± 8% of control; IGFBP-3 1 nM, 120 ± 20%; IGFBP-3 15 nM, 163 ± 27%; IGFBP-3 30 nM, 198 ± 57%; n = 4; P < 0.01). Because IGFBP-3 had maximal effect at 30 nM, this dose was used in subsequent experiments. IGFBP-3 ND variant (170 ± 37% of control) had apoptotic effects similar to IGFBP-3 (173 ± 23% of control; n = 6; P = NS).

A separate and independent determination of apoptosis was carried out by measuring the presence of phosphatidylserine on the outside of the plasma membrane using Annexin-V-fluorescein. As shown in Fig. 3Go, a marked increase in the proportion of apoptotic cells (Annexin-V positive/PI negative, lower right quadrants) was seen in cells treated with IGFBP-3 in serum-free conditions (45.5 ± 0.21% in IGFBP-3 treated cells vs. 24.2 ± 2.2% in control cells; P < 0.05). The number of necrotic cells (upper right quadrants) was not significantly affected by IGFBP-3.



View larger version (23K):
[in this window]
[in a new window]
 
Figure 3. Exogenously added IGFBP-3 induces apoptosis. Apoptosis was assessed by flow cytometric analysis in cells that were simultaneously stained with Annexin-V and PI. Dot plots of 48-h-old cells incubated in absence (A, control) or presence of 30 nM recombinant IGFBP-3 in serum-free condition (B) are shown. For each sample forward light scatter, side scatter, green fluorescence (Annexin-V-fluorescein) and red fluorescence (PI) of 10,000 cells were acquired. Debris and remaining cells were excluded by gating on basis of forward and side scatter. The proportion of cells in each quadrant is given as the percentage of forward- and side-scatter gated cells. Annexin V-positive/PI-negative cells (lower right quadrant) are apoptotic.

 
The IGF-independent effect of IGFBP-3 was also observed on cell growth. As shown in Fig. 4Go, 24 h after transfection with IGFBP-3 or GGG mutant, cells reached the lowest cell number (~30 to ~10% of control). At the same time point after transfection with IGFBP-3 or GGG, cells reached the highest level of apoptosis (see Fig. 2Go). Forty-eight hours after transfection with IGFBP-3 or GGG, cells resumed their growth, as indicated by an increase in cell number (Fig. 4Go).



View larger version (17K):
[in this window]
[in a new window]
 
Figure 4. IGFBP-3 effect on cell number. Twenty-four-hour-old cells were transfected with IGFBP-3, GGG mutant or empty vector. Cell number was determined at 6, 12, 24, and 48 h after transfection by counting trypsinized cells in a hemocytometer. Results are expressed as percentage of the number of untransfected control cells, which was given an arbitrary value of 100%.

 
To determine whether the effect of IGFBP-3 was specific, we transfected cells with IGFBP-4 and measured levels of apoptosis 24 h after transfection. IGFBP-4 had no effect on cell apoptosis (100 ± 35% of empty vector; n = 4; P < 0.05 vs. empty vector). Similarly, exogenously added IGFBP-4 (30 nM) had also no effect on cell apoptosis (95 ± 5% of control; n = 4; P < 0.05 vs. untreated control). We also tested the effect of the NSP-IGFBP-3 mutant, lacking the signal peptide sequence. Cells transfected with NSP-IGFBP-3 mutant showed a slight increase of cell apoptosis (143 ± 33% of empty vector; n = 4; P = NS vs. empty vector) that did not reach statistical significance.

In the media of cells transfected with IGFBP-3 or GGG, up to 70 ng/ml IGFBP-3 and 60 ng/ml GGG mutant were measured, with maximal levels 24 h after transfection. At 5 and 7 d after transfection IGFBP-3 or GGG mutant were undetectable in the cell media. Furthermore, we determined that the GGG mutant expressed in MCC did not bind IGFs (Fig. 5Go). IGFBP-3 and GGG levels were measured in concentrated CM obtained from cells transfected with expression vector plasmid (IGFBP-3, GGG, or empty vector) or left untransfected. Equal amount of IGFBP-3 and GGG mutant as well as NHS (positive control) were subjected to immunoprecipitation using IGFBP-3 polyclonal antibody and immunoprecipitates subjected to WLB analysis using iodinated IGF mixture. As shown in Fig. 5Go, IGFBP-3 presents in the CM obtained from MCC transfected with IGFBP-3 retained the ability to bind IGF, whereas the GGG mutant expressed by MCC transfected with GGG did not show any IGF binding.



View larger version (15K):
[in this window]
[in a new window]
 
Figure 5. The GGG mutant expressed in MCC does not bind IGFs. Levels of IGFBP-3 and GGG were measured in concentrated CM obtained from cells transfected with IGFBP-3 (BP-3), GGG mutant (GGG), empty vector (Empty), or left untransfected (Untrans), 24 h after transfection. Appropriate amount of CM containing 4 ng of IGFBP-3 (BP-3), or GGG mutant (GGG) were immunoprecipitated using IGFBP-3 polyclonal antibody. As positive control, we immunopreciptated the appropriate amount (containing 4 ng of IGFBP-3) of human serum (NHS) obtained from six normal subjects. Immunoprecipitates were subjected to WLB analysis using a mixture of 125I-IGF-I and 125I-IGF-II.

 
IGF-independent effect of IGFBP-3 on chondrocyte differentiation
To determine whether the proapoptotic action of IGFBP-3 on MCC affected the chondrocyte differentiation process, we induced cell differentiation and observed the morphological changes induced by IGFBP-3. Figure 6Go depicts 5- and 7-d-old cells, studied 4 and 6 d after IGFBP-3 transfection. Cells transfected with IGFBP-3 continued growth (Fig. 6Go, panel 1C) and reached confluence (Fig. 6Go, panel 2C) but did not form chondrocytic nodules (indicated by arrows), as did untransfected (Fig. 6Go, panels 1A and 2A) or empty vector-transfected cells (Fig. 6Go, panels 1B and 2B). These results indicate that the IGFBP-3 effect was selective on the MCC population that is committed to become differentiated chondrocytes, and for this reason determined a long-term effect on differentiation. A similar effect was noted when cells were transfected with GGG (data not shown). To confirm this selective effect of IGFBP-3 on chondrocyte maturation, type II collagen expression and PG synthesis were measured, as markers of chondrocyte differentiation. As determined at 7 d of culture, transfection of undifferentiated cells with IGFBP-3 or GGG mutant induced at least a 50% decrease of type II collagen mRNA expression (Fig. 7AGo) and PG synthesis (Fig. 7BGo), compared with cells untransfected or transfected with empty vector.



View larger version (155K):
[in this window]
[in a new window]
 
Figure 6. Selective effect of IGFBP-3 on chondroprogenitors. Twenty-four-hour-old cells were transfected with IGFBP-3 (panels 1C and 2C), empty vector (panels 1B and 2B) or left untransfected (panels 1A and 2A). After reaching confluence (4 d of culture), fresh differentiating medium supplemented with 50 µg/ml of ascorbic acid and 10 mM ß-glycerophosphate was added. Cells are depicted at 5 d (5D) and 7 d (7D) of culture. Chondrocytic nodules are indicated by arrows.

 


View larger version (56K):
[in this window]
[in a new window]
 
Figure 7. IGF-independent effect of IGFBP-3 on type II collagen expression and PG synthesis. Twenty-four-hour-old cells were transfected with IGFBP-3, GGG mutant, empty vector or left untransfected (Untransf) and 6 d after transfection, type II collagen expression (A) and PG synthesis (B) was measured. For type II collagen expression, 10 µg of RNA were subjected to Northern analysis using a mouse type II collagen probe. The 18S rRNA bands are shown to demonstrate equal RNA loading. PG synthesis was determined by using a quantitative Alcian blue assay. Results are expressed as percentage of absorbance measured in untransfected control cells, which was given an arbitrary value of 100%.

 
This hypothesis was further tested using exogenous IGFBP-3. When 6-d-old cells were incubated with recombinant IGFBP-3 in serum-free conditions, a significant increase in cell apoptosis was noted (165 ± 7% of control; n = 6; P < 0.05 vs. control). This effect was similar to that observed when 2-d-old cells were treated with IGFBP-3 (173 ± 23% of control, as reported above). Nevertheless, when cells were treated with recombinant IGFBP-3 at MCC stage (2 d old) and then at 6 d of culture no significant effect on cell apoptosis was detected (109 ± 5% of control; n = 6; P < 0.05 vs. control). As shown in Fig. 8Go, a dramatic decrease (more than 80% compared with control) of type II collagen expression was observed when 6-d-old cells were treated with recombinant IGFBP-3. IGFBP-3 reduced also type II collagen expression induced by FGF-2 (52% reduction) and by des-IGF-I (84% reduction). These results indicate that 6-d-old cells are still responsive to IGFBP-3 treatment and reinforce the concept that IGFBP-3 has a selective effect on the cell population that is programmed to differentiate or is on the early stage of differentiation.



View larger version (45K):
[in this window]
[in a new window]
 
Figure 8. IGF-independent effect of exogenously added IGFBP-3 on type II collagen expression. Total RNA was obtained from cells cultured for 7 d and treated for 24 h with IGFBP-3 (30 nM) in serum-free condition. Cells were also treated with des-IGF-I (15 nM) and FGF-2 (50 ng/ml) to induce type II collagen expression. Ten micrograms of RNA were subjected to Northern analysis using a mouse type II collagen probe. Type II collagen RNA levels were formalized for 18S RNA levels.

 
As expected, cell differentiation was accompanied by cell death. In fact, a dramatic increase of cell apoptosis was noted in 7-d-old differentiated cells compared with 2-d undifferentiated MCC (1993 ± 237% of MCC apoptosis; n = 3; P < 0.05 7-d vs. 2-d control cells). Remarkably, in cells transfected with IGFBP-3 and GGG at the MCC stage, the level of apoptosis assessed at 7 d was, respectively, 61 ± 8% and 71 ± 5% of 7-d control (n = 3; P < 0.05). Similar results were obtained by treating cells with recombinant IGFBP-3 at MCC stage and assessing apoptosis at 7 d (80 ± 3% of 7-d control, n = 4; P < 0.05).


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In the present study, we have identified a novel IGF-independent role for IGFBP-3: IGFBP-3 has a selective apoptotic effect on MCC that is specific and dose dependent. This IGFBP-3 effect on MCC determines a remarkable loss of chondrocytic nodule formation, which is associated with a significant decrease of type II collagen expression and PG synthesis. We hypothesize that IGFBP-3, by controlling the number of chondroprogenitors committed to undergo differentiation, modulates chondrogenesis.

It was originally believed that the IGFBPs were simply present to passively modulate the IGF-induced mitogenic and survival signals (30, 31, 32, 33, 34, 35, 36), being both stimulatory (22, 37) or inhibitory (32, 33, 34, 35, 36) to IGF action. In addition to these IGF-dependent actions, it is becoming increasingly clear that IGFBP-3 can also exert IGF-independent actions that can affect aspects of both cell growth and apoptosis.

We have previously reported that IGFBP-3 has an IGF-independent antiproliferative (20) effect on RCJ3.1C5.18 MCC. RCJ3.1C5.18 chondrogenic cell line is a well established model to study chondrogenesis (18, 19, 20, 38). The cells sequentially acquire, over 2 wk of culture, markers for early chondrocytic differentiation and terminal differentiation (19, 20). Furthermore, RCJ3.1C5.18 cells do not express IGFs or IGFBP-3; therefore, the action of these peptides can be studied without interference from endogenous molecules. In the present study, we have demonstrated that IGFBP-3 has a selective apoptotic and antiproliferative effect on a specific cell population that is programmed to differentiate into chondrocytes. The antiproliferative and apoptotic effects of IGFBP-3 might be two independent events, or the IGFBP-3 antiproliferative effect on MCC might be mediated through cell apoptosis.

IGF-independent actions of IGFBP-3 in controlling cell growth and inducing and/or potentiating apoptosis have been inferred from studies that: 1) transfected IGFBP-3 cDNA into cells unresponsive to IGFs; 2) added exogenous IGFBP-3 or stimulated its endogenous production in systems without IGFs interference; and 3) employed IGF analogs with selective affinities for IGF receptor or IGFBPs (32, 33, 34, 35). For all such studies, however, potential alternative explanations can be given for IGFBP-3 action. The use of IGFBP-3 mutants lacking affinity for IGFs provides more definitive proof of IGFBP-3 IGF-independent action (36). The current study clearly demonstrates an IGF-independent apoptotic effect of IGFBP-3 on RCJ3.1C5.18 cells using two independent approaches: 1) transfecting cells with IGFBP-3 mutants with abolished affinity for IGFs; 2) treating cells that lack endogenous IGFs and IGFBP-3 peptides with IGFBP-3 in serum free conditions. The IGF-independent role of IGFBP-3 as a growth-inhibitory factor has been demonstrated in various cell lines (mostly cancer cell lines; Refs.15, 20, 21, 32, 33, 34, 35, 36, 39, 40). In breast cancer cells, IGFBP-3 has been reported to have a direct growth inhibitory effect or to mediate TGF-ß (41) and retinoic acid (42) actions. In prostate cancer cells, IGFBP-3 has been shown to induce apoptosis (33, 36). In our study, we were able to induce the expression of IGFBP-3 mutant protein with abolished affinity for IGFs in a cellular system that is physiologically relevant. The study, elucidating the role of IGFBP-3 in chondrogenesis, provides novel insights into the physiological relevance of IGFBP-3 on biological systems and gives essential basis for the potential use of cultured MCC to repair damaged or injured cartilage.

We have demonstrated that, in our cell system, there is a subset of IGFBP-3 responsive cells present through the differentiation process from the MCC phase into the early differentiated phase of the cells. The effect of IGFBP-3 is clearly specific on this population, in fact when the cells are treated in the MCC phase and subsequently in the early phase of differentiation, they become unresponsive. Differentiation is a continuum process through which chondroprogenitors gradually progress into mature chondrocytes. We can hypothesize that MCC are consistently present during the first 6 d of culture and they are the target for IGFBP-3 or, alternatively, that MCC differentiate at 6 d of culture into early chondrocytes that are still responsive to IGFBP-3. IGFBP-3 effects cannot be explained by an overall reduction in cell number because MCC transfected with IGFBP-3 or GGG, 48 h after transfection, resume a rapid cell growth (approximately 80% of control) and, although they reach cell confluence, they show a dramatic reduction of chondrocytic nodule formation and expression of chondrocytic markers. The relative increase in cell number in the cell population that is IGFBP-3 resistant can be explained by their exponential growth that follows IGFBP-3 effect, whereas control cells have already reached confluence. An alternative explanation might be that the IGFBP-3-resistant cells selected by IGFBP-3 treatment are more rapidly growing cells.

The chondrocyte differentiation process is normally accompanied by an increase of cell apoptosis that was remarkable in our cell system. Interestingly, in cells transfected or treated with IGFBP-3 at MCC stage a decrease in cell apoptosis was noted at 7-d culture. Further studies are needed to determine how the IGFBP-3 interferes with the differentiation-related apoptosis.

IGF-I and FGF-2 have been reported to promote chondrocyte differentiation (43, 44, 45). In our study, IGFBP-3 reduced the expression of type II collagen induced by FGF-2 and Des-IGF-I. During the process of chondrogenesis, MCC progress through an ordered program of proliferation and differentiation. This program is strictly regulated, so that proper bone length is maintained. Several hormones and growth factors have been demonstrated to regulate differentiation rate through antiproliferative and/or apoptotic mechanisms (46, 47, 48). Transgenic mice carrying a dominant-negative mutation of the TGF-ß type II receptor exhibit an increase in terminally differentiated chondrocytes (46). In humans, activating mutations of FGF receptor (FGFR)-3 lead to the most common forms of chondrodysplasia, including achondroplasia (49, 50). Conversely, skeletal overgrowth has been reported in mice carrying a null mutation of FGFR-3 (47). In chondrocytes, STAT-1 has been implicated as a key signaling molecule that mediates the antiproliferative and apoptotic activity of FGFR-3 (51, 52, 53, 54, 55). Mice carrying null mutations of the PTHrP or the PTHrP receptor show accelerated chondrocyte differentiation (48). Similar to these findings, we hypothesize that the inhibitory effect of IGFBP-3 directly on MCC, or on growth factors stimulated MCC, can contribute to the modulation of the differentiation process. The control of skeletal development is a complex phenomenon, and the current data support a novel role for IGFBP-3 in this process.

We have previously reported that in MCC, IGFBP-3, and GGG mutant have transcriptional activity inducing STAT-1 gene expression as well as activation. The mechanisms by which IGFBP-3 induces STAT-1 transcription that in turn induces MCC apoptosis are unknown. A slight but not significant increase of apoptosis was noted when cells were transfected with an IGFBP-3 mutant that lacks the signal peptide sequence. Results indicate that the molecular mechanisms involved in the IGF-independent action of IGFBP-3 are complex and most likely a combination of autocrine and paracrine actions are involved.

In summary, understanding the IGF-independent role of IGFBP-3 in MCC provides critical information on the cartilage formation process that might support the therapeutic use of MCC for cartilage repair.


    Acknowledgments
 
The authors are grateful to Dr. Robert S. Bar for providing the recombinant IGFBP-4 and the IGFBP-4 cDNA.


    Footnotes
 
This work was supported in part by Lawson Wilkins Pediatric Endocrine Society (LWPES) Clinical Scholar Award and by Vanderbilt University Physician Scientist Development Program Award (to A.S.). This work was presented in part at the 83rd Annual Meeting of The Endocrine Society, Denver, CO, June 2001, and the 6th Joint Meeting of the LWPES and European Society for Paediatric Endocrinology, Montréal, Canada, July 2001.

1 L.L. and M.T. contributed equally to this work. Back

Abbreviations: CM, Conditioned media; des-IGF-I, des-(1–3)-IGF-I; FGF-2, fibroblast growth factor-2; FGFR, FGF receptor; GGG, GGG-IGFBP-3 mutant; IGFBP, IGF binding protein; IRMA, immunoradiometric assay; MCC, mesenchymal chondroprogenitor cells; NHS, normal human serum; NSP-IGFBP-3, IGFBP-3 no-signal peptide mutant; PG, proteoglycan; PI, propidium iodide; STAT-1, signal transducer and activator of transcription-1; WLB, Western ligand blotting.

Received October 25, 2002.

Accepted for publication January 8, 2003.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Johnstone B, Hering TM, Caplan AI, Goldberg VM, Yoo JU 1998 In vitro chondrogenesis of bone marrow-derived mesenchymal progenitor cells. Exp Cell Res 238:265–272[CrossRef][Medline]
  2. Mackay AM, Beck SC, Murphy JM, Barry FP, Chichester CO, Pittenger MF 1998 Chondrogenic differentiation of cultured human mesenchymal stem cells from marrow. Tissue Eng 4:415–428[Medline]
  3. Yoo JU, Barthel TS, Nishimura K, Solchaga L, Caplan AI, Goldberg VM, Johnstone B 1998 The chondrogenic potential of human bone-marrow-derived mesenchymal progenitor cells. J Bone Joint Surg Am 80:1745–1757[Abstract/Free Full Text]
  4. Yoo JU, Johnstone B 1998 The role of osteochondral progenitor cells in fracture repair. Clin Orthop S73–S81
  5. Yoo JU, Mandell I, Angele P, Johnstone B 2000 Chondrogenitor cells and gene therapy. Clin Orthop S164–S170
  6. Johnstone B, Yoo JU 1999 Autologous mesenchymal progenitor cells in articular cartilage repair. Clin Orthop S156–S162
  7. O’Driscoll SW 1999 Articular cartilage regeneration using periosteum. Clin Orthop S186–S203
  8. Johnstone B, Yoo J 2001 Mesenchymal cell transfer for articular cartilage repair. Expert Opin Biol Ther 1:915–921[Medline]
  9. Nishimura K, Solchaga LA, Caplan AI, Yoo JU, Goldberg VM, Johnstone B 1999 Chondroprogenitor cells of synovial tissue. Arthritis Rheum 42:2631–2637[CrossRef][Medline]
  10. Baker J, Liu JP, Robertson EJ, Efstratiadis A 1993 Role of insulin-like growth factors in embryonic and postnatal growth. Cell 75:73–82[CrossRef][Medline]
  11. Liu JP, Baker J, Perkins AS, Robertson EJ, Efstratiadis A 1993 Mice carrying null mutations of the genes encoding insulin-like growth factor I (Igf-1) and type 1 IGF receptor (Igf1r). Cell 75:59–72[Medline]
  12. Spagnoli A, Rosenfeld RG 1996 The mechanisms by which growth hormone brings about growth. Endocrinol Metab Clin North Am 25:615–631[CrossRef][Medline]
  13. Rosenfeld RG, Hwa V, Wilson L, Lopez-Bermejo A, Buckway C, Burren C, Choi WK, Devi G, Ingermann A, Graham D, Minniti G, Spagnoli A, Oh Y 1999 The insulin-like growth factor binding protein superfamily: new perspectives. Pediatrics 104:1018–1021[Abstract/Free Full Text]
  14. Spagnoli A, Rosenfeld RG 1997 The insulin-like growth factor binding proteins family. Curr Opin Endocrinol Diabetes 4:1–9
  15. Baxter RC 2000 Insulin-like growth factor (IGF)-binding proteins: interactions with IGFs and intrinsic bioactivities. Am J Physiol Endocrinol Metab 278:E967–E976
  16. Cohen P, Lamson G, Okajima T, Rosenfeld RG 1993 Transfection of the human insulin-like growth factor binding protein-3 gene into Balb/c fibroblasts inhibits cellular growth. Mol Endocrinol 7:380–386[Abstract]
  17. Hollowood AD, Lai T, Perks CM, Newcomb PV, Alderson D, Holly JM 2000 IGFBP-3 prolongs the p53 response and enhances apoptosis following UV irradiation. Int J Cancer 88:336–341[CrossRef][Medline]
  18. Grigoriadis AE, Heersche JN, Aubin JE 1996 Analysis of chondroprogenitor frequency and cartilage differentiation in a novel family of clonal chondrogenic rat cell lines. Differentiation 60:299–307[CrossRef][Medline]
  19. Lunstrum GP, Keene DR, Weksler NB, Cho YJ, Cornwall M, Horton WA 1999 Chondrocyte differentiation in a rat mesenchymal cell line. J Histochem Cytochem 47:1–6[Abstract/Free Full Text]
  20. Spagnoli A, Hwa V, Horton WA, Lunstrum GP, Roberts Jr CT, Chiarelli F, Torello M, Rosenfeld RG 2001 Antiproliferative effects of insulin-like growth factor-binding protein-3 in mesenchymal chondrogenic cell line. RCJ3.1C5.18. J Biol Chem 276:5533–5540[Abstract/Free Full Text]
  21. Spagnoli A, Torello M, Nagalla SR, Horton WA, Pattee P, Hwa V, Chiarelli F, Roberts CT, Rosenfeld RG 2002 Identification of STAT-1 as a molecular target of IGFBP-3 in the process of chondrogenesis. J Biol Chem 277:18860–18867[Abstract/Free Full Text]
  22. Buckway CK, Wilson EM, Ahlsén M, Bang P, Oh Y, Rosenfeld RG 2001 Mutation of three critical amino acids of the N-terminal domain of insulin-like growth factor (IGF) binding protein-3 essential for high affinity IGF binding. J Clin Endocrinol Metab 86:4943–4950[Abstract/Free Full Text]
  23. Oh Y, Muller HL, Lee DY, Fielder PJ, Rosenfeld RG 1993 Characterization of the affinities of insulin-like growth factor (IGF)-binding proteins 1–4 for IGF-I, IGF-II, IGF-I/insulin hybrid, and IGF-I analogs. Endocrinology 132:1337–1344[Abstract]
  24. Francis GL, Ross M, Ballard FJ, Milner SJ, Senn C, McNeil KA, Wallace JC, King R, Wells JR 1992 Novel recombinant fusion protein analogues of insulin-like growth factor (IGF)-I indicate the relative importance of IGF-binding protein and receptor binding for enhanced biological potency. J Mol Endocrinol 8:213–223[Abstract]
  25. Conover CA, Bale LK, Durham SK, Powell DR 2000 Insulin-like growth factor (IGF) binding protein-3 potentiation of IGF action is mediated through the phosphatidylinositol-3-kinase pathway and is associated with alteration in protein kinase B/AKT sensitivity. Endocrinology 141:3098–3103[Abstract/Free Full Text]
  26. Gargosky SE, Pham HM, Wilson KF, Liu F, Giudice LC, Rosenfeld RG 1992 Measurement and characterization of insulin-like growth factor binding protein-3 in human biological fluids: discrepancies between radioimmunoassay and ligand blotting. Endocrinology 131:3051–3060[Abstract]
  27. Wilson EM, Oh Y, Rosenfeld RG 1997 Generation and characterization of an IGFBP-7 antibody: identification of 31kD IGFBP-7 in human biological fluids and Hs578T human breast cancer conditioned media. J Clin Endocrinol Metab 82:1301–1303[Abstract/Free Full Text]
  28. Spagnoli A, Gargosky SE, Spadoni GL, MacGillivray M, Oh Y, Boscherini B, Rosenfeld RG 1995 Characterization of a low molecular mass form of insulin-like growth factor binding protein-3 (17.7 kilodaltons) in urine and serum from healthy children and growth hormone (GH)-deficient patients: relationship with GH therapy. J Clin Endocrinol Metab 80:3668–3676[Abstract]
  29. Spagnoli A, Chiarelli F, Vorwerk P, Boscherini B, Rosenfeld RG 1999 Evaluation of the components of insulin-like growth factor (IGF)-IGF binding protein (IGFBP) system in adolescents with type 1 diabetes and persistent microalbuminuria: relationship with increased urinary excretion of IGFBP-3 18 kD N-terminal fragment. Clin Endocrinol (Oxf) 51:587–596[CrossRef][Medline]
  30. Jones JI, Clemmons DR 1995 Insulin-like growth factors and their binding proteins: biological actions. Endocr Rev 16:3–34[CrossRef][Medline]
  31. Rechler MM 1993 Insulin-like growth factor binding proteins. Vitam Horm 47:1–114[Medline]
  32. Valentinis B, Bhala A, DeAngelis T, Baserga R, Cohen P 1995 The human insulin-like growth factor (IGF) binding protein-3 inhibits the growth of fibroblasts with a targeted disruption of the IGF-I receptor gene. Mol Endocrinol 9:361–367[Abstract]
  33. Rajah R, Valentinis B, Cohen P 1997 Insulin-like growth factor (IGF)-binding protein-3 induces apoptosis and mediates the effects of transforming growth factor-ß1 on programmed cell death through a p53- and IGF-independent mechanism. J Biol Chem 272:12181–12188[Abstract/Free Full Text]
  34. Gill ZP, Perks CM, Newcomb PV, Holly JM 1997 Insulin-like growth factor-binding protein (IGFBP-3) predisposes breast cancer cells to programmed cell death in a non-IGF-dependent manner. J Biol Chem 272:25602–25607[Abstract/Free Full Text]
  35. Oh Y, Muller HL, Lamson G, Rosenfeld RG 1993 Insulin-like growth factor (IGF)-independent action of IGF-binding protein-3 in Hs578T human breast cancer cells. Cell surface binding and growth inhibition. J Biol Chem 268:14964–14971[Abstract/Free Full Text]
  36. Hong J, Zhang G, Dong F, Rechler MM 2002 Insulin-like growth factor (IGF)-binding protein-3 mutants that do not bind IGF-I or IGF-II stimulate apoptosis in human prostate cancer cells. J Biol Chem 277:10489–10497[Abstract/Free Full Text]
  37. Blum WF, Jenne EW, Reppin F, Kietzmann K, Ranke MB, Bierich JR 1989 Insulin-like growth factor I (IGF-I)-binding protein complex is a better mitogen than free IGF-I. Endocrinology 125:766–772[Abstract]
  38. Grigoradis AE, Heersche JN, Aubin JE 1990 Continuosly growing bipotential and monopotential myogenic, adipogenic, and chondrogenic subclones isolated from the multipotential RCJ3.1 clonal cell line. Dev Biol 142:313–318[CrossRef][Medline]
  39. Oh Y, Muller HL, Pham H, Rosenfeld RG 1993 Demonstration of receptors for insulin-like growth factor binding protein-3 on Hs578T human breast cancer cells. J Biol Chem 268:26045–26048[Abstract/Free Full Text]
  40. Butt AJ, Firth SM, King MA, Baxter RC 2000 Insulin-like growth factor-binding protein-3 modulates expression of Bax and Bcl-2 and potentiates p53-independent radiation-induced apoptosis in human breast cancer cells. J Biol Chem 275:39174–39181[Abstract/Free Full Text]
  41. Oh Y, Muller HL, Ng L, Rosenfeld RG 1995 Transforming growth factor-beta-induced cell growth inhibition in human breast cancer cells is mediated through insulin-like growth factor-binding protein-3 action. J Biol Chem 270:13589–13592[Abstract/Free Full Text]
  42. Gucev ZS, Oh Y, Kelley KM, Rosenfeld RG 1996 Insulin-like growth factor binding protein 3 mediates retinoic acid- and transforming growth factor ß2-induced growth inhibition in human breast cancer cells. Cancer Res 56:1545–1550[Abstract/Free Full Text]
  43. Hill DJ, Logan A, McGarry M, De Sousa D 1992 Control of protein and matrix-molecule synthesis in isolated ovine fetal growth-plate chondrocytes by the interactions of basic fibroblast growth factor, insulin-like growth factors-I and -II, insulin and transforming growth factor-ß1. J Endocrinol 133:363–373[Abstract]
  44. Maor G, Hochberg Z, Silbermann M 1993 Insulin-like growth factor I accelerates proliferation and differentiation of cartilage progenitor cells in cultures of neonatal mandibular condyles. Acta Endocrinol (Copenh) 128:56–64
  45. Wang J, Zhou J, Bondy CA 1999 Igf1 promotes longitudinal bone growth by insulin-like actions augmenting chondrocyte hypertrophy. FASEB J 13:1985–1990[Abstract/Free Full Text]
  46. Serra R, Johnson M, Filvaroff EH, LaBorde J, Sheehan DM, Derynck R, Moses HL 1997 Expression of a truncated, kinase-defective TGF-ß type II receptor in mouse skeletal tissue promotes terminal chondrocyte differentiation and osteoarthritis. J Cell Biol 139:541–552[Abstract/Free Full Text]
  47. Deng C, Wynshaw-Boris A, Zhou F, Kuo A, Leder P 1996 Fibroblast growth factor receptor 3 is a negative regulator of bone growth. Cell 84:911–921[CrossRef][Medline]
  48. Kronenberg HM, Lanske B, Kovacs CS, Chung UI, Lee K, Segre GV, Schipani E, Juppner H 1998 Functional analysis of the PTH/PTHrP network of ligands and receptors. Recent Prog Horm Res 53:283–301
  49. Shiang R, Thompson LM, Zhu YZ, Church DM, Fielder TJ, Bocian M, Winokur ST, Wasmuth JJ 1994 Mutations in the transmembrane domain of FGFR-3 cause the most common genetic form of dwarfism, achondroplasia. Cell 78:335–342[CrossRef][Medline]
  50. Horton WA 1996 Molecular genetic basis of the human chondrodysplasias. Endocrinol Metab Clin North Am 25:683–697[CrossRef][Medline]
  51. Su WC, Kitagawa M, Xue N, Xie B, Garofalo S, Cho J, Deng C, Horton WA, Fu XY 1997 Activation of STAT-1 by mutant fibroblast growth factor receptor in thanatrophic dysplasia type II dwarfism. Nature 386:288–292[CrossRef][Medline]
  52. Sahni M, Ambrosetti DC, Mansukhani A, Gertner R, Levy D, Basilico C 1999 FGF signaling inhibits chondrocyte proliferation and regulates bone development through the STAT-1 pathway. Genes Dev 13:1361–1366[Abstract/Free Full Text]
  53. Legeai-Mallet L, Benoist-Lasselin C, Delezoide AL, Munnich A, Bonaventure J 1998 Fibroblast growth factor receptor 3 mutations promote apoptosis but do not alter chondrocyte proliferation in thanatophoric dysplasia. J Biol Chem 273:13007–13014[Abstract/Free Full Text]
  54. Sahni M, Raz R, Coffin JD, Levy D, Basilico C 2001 STAT-1 mediates the increased apoptosis and reduced chondrocyte proliferation in mice overexpressing FGF-2. Development 128:2119–2129[Abstract/Free Full Text]
  55. Li C, Chen L, Iwata T, Kitagawa M, Fu XY, Deng CX 1999 A Lys644Glu substitution in fibroblast growth factor receptor 3 (FGFR3) causes dwarfism in mice by activation of STATs and ink4 cell cycle inhibitors. Hum Mol Genet 8:35–44[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Dent. Res.Home page
T. Yokota, H. Shimokawa, S. Shibata, K. Itoh, Y. Baba, K. Ohya, K. Ohyama, and S. Suzuki
Insulin-like Growth Factor I Regulates Apoptosis in Condylar Cartilage
J. Dent. Res., February 1, 2008; 87(2): 159 - 163.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
P. Cohen
Insulin-like growth factor binding protein-3: insulin-like growth factor independence comes of age.
Endocrinology, May 1, 2006; 147(5): 2109 - 2111.
[Full Text] [PDF]


Home page
EndocrinologyHome page
J. V. Silha, P. C. Sheppard, S. Mishra, Y. Gui, J. Schwartz, J. G. Dodd, and L. J. Murphy
Insulin-Like Growth Factor (IGF) Binding Protein-3 Attenuates Prostate Tumor Growth by IGF-Dependent and IGF-Independent Mechanisms
Endocrinology, May 1, 2006; 147(5): 2112 - 2121.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
J. P. Chute, G. G. Muramoto, H. K. Dressman, G. Wolfe, N. J. Chao, and S. Lin
Molecular Profile and Partial Functional Analysis of Novel Endothelial Cell-Derived Growth Factors that Regulate Hematopoiesis
Stem Cells, May 1, 2006; 24(5): 1315 - 1327.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
M. Takaoka, C. E. Smith, M. K. Mashiba, T. Okawa, C. D. Andl, W. S. El-Deiry, and H. Nakagawa
EGF-mediated regulation of IGFBP-3 determines esophageal epithelial cellular response to IGF-I
Am J Physiol Gastrointest Liver Physiol, February 1, 2006; 290(2): G404 - G416.
[Abstract] [Full Text] [PDF]


Home page
J Mol EndocrinolHome page
L O'Rear, L Longobardi, M Torello, B K Law, H L Moses, F Chiarelli, and A Spagnoli
Signaling cross-talk between IGF-binding protein-3 and transforming growth factor-{beta} in mesenchymal chondroprogenitor cell growth
J. Mol. Endocrinol., June 1, 2005; 34(3): 723 - 737.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
C. E. Barbieri, C. A. Perez, K. N. Johnson, K. A. Ely, D. Billheimer, and J. A. Pietenpol
IGFBP-3 Is a Direct Target of Transcriptional Regulation by {Delta}Np63{alpha} in Squamous Epithelium
Cancer Res., March 15, 2005; 65(6): 2314 - 2320.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
J. V. Silha, Y. Gui, S. Mishra, A. Leckstrom, P. Cohen, and L. J. Murphy
Overexpression of Gly56/Gly80/Gly81-Mutant Insulin-Like Growth Factor-Binding Protein-3 in Transgenic Mice
Endocrinology, March 1, 2005; 146(3): 1523 - 1531.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Mishra and L. J. Murphy
Tissue Transglutaminase Has Intrinsic Kinase Activity: IDENTIFICATION OF TRANSGLUTAMINASE 2 AS AN INSULIN-LIKE GROWTH FACTOR-BINDING PROTEIN-3 KINASE
J. Biol. Chem., June 4, 2004; 279(23): 23863 - 23868.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted