| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Tsukuba Research Institute (S.M., A.I., H.I., H.S., Z.O., J.I., M.Y., M.O., J.S., T.Fuku., M.J., M.I., T.Fuka., A.K.), Banyu Pharmaceutical Co., Ltd., Tsukuba 300-2611, Japan; and Merck Research Laboratories (N.R.M., D.J.M., L.H.T.V.d.P.), Merck \|[amp ]\| Co., Inc., Rahway, New Jersey 07065
Address all correspondence and requests for reprints to: Dr. Akane Ishihara, Tsukuba Research Institute, Banyu Pharmaceutical Co., Ltd., Okubo 3, Tsukuba 300-2611, Japan. E-mail: isihraan{at}banyu.co.jp.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Physiological functions of NPY are evoked through the action of G protein-coupled receptors. At least six subtypes of NPY, PYY, and PP receptors have been identified. It has been reported that Y1, Y2, Y4, Y5, and y6 receptors are widely expressed in brain, and their distribution appears to be species specific. Among them, Y1, Y2, and Y5 are abundantly expressed in the hypothalamic area controlling energy homeostasis, and only Y2 receptor acts as an autoreceptor (12). Several lines of evidence show that both Y1 and Y5 receptor subtypes are involved in NPY-mediated obesity. The ability of some NPY-related peptides to stimulate food intake is well correlated to in vitro binding affinity for the Y5 receptor (13, 14) and peptide-based selective Y5 agonist stimulation of food intake (15, 16). On the other hand, the Y1 receptor may also have an important role in regulating food intake. Selective Y1 receptor antagonists suppressed NPY-induced and spontaneous food intake (17, 18, 19, 20, 21), and NPY-induced food intake was significantly suppressed in Y1-deficient mice (22). These data suggest that the orexigenic effect of NPY may be mediated by both Y1 and Y5 receptor subtypes. However, the involvement of the Y5 receptor in feeding regulation is still controversial, because there have been some reports that the Y5 antagonist has no effect on spontaneous food intake and the NPY-induced food intake was not suppressed in Y5-deficient mice (22, 23, 24).
In this study, to address the role of the Y5 receptor in the regulation of food intake and energy homeostasis, we investigated the chronic effects of a selective Y5 agonist in lean mice. Parker et al. (15) reported that one of the NPY analogs, D-Trp34NPY, was a potent and selective NPY Y5 receptor agonist, and markedly increased food intake in rats. However, little is known about chronic activation of the Y5 receptor. Recently, we developed a potent and selective Y5 antagonist, 3,3-dimethyl-9-(4,4-dimethyl-2,6-dioxocyclohexyl)- 1-oxo-1,2,3,4-tetrahydroxanthene, as previously described (25). The antagonist showed a high affinity for the rat Y5 receptor with a Ki value of 31 nM, whereas any significant affinity for 120 other receptors was not observed at 10 µM. In addition, the antagonist inhibited the Y5 selective agonist (bovine PP)-induced food intake in rats. Thus, we used the antagonist to make sure of specific activation of the Y5 receptor in the central nervous system. In the present study, we show that specific and chronic activation of the Y5 receptor, validated by structurally different Y5 selective agonists and antagonists, produces obesity in mice. We also examine the effect of the Y5 receptor stimulation on energy metabolism by using a pair-feeding study.
| Materials and Methods |
|---|
|
|
|---|
Expression of mouse receptors in COS-7 cells and receptor binding assays
The coding regions of mouse (m)Y1, mY2, mY4, mY5, and my6 (GenBank accession nos. Z18280, D86238, U40189, AF022948, and U58367, respectively) were cloned by PCR into the multiple cloning site of pCI-neo (Promega Corp., Madison, WI) with an optimal Kozac sequence, GCCGCCACC, before the ATG start codons. The nucleotide sequences of the resulting clones were confirmed to be free of PCR-induced errors with an ABI 373A automated sequencer (Perkin Elmer Corp., Norwalk, CT). DNA was transfected into COS-7 cells, membranes were prepared, binding reactions were performed, and the data were analyzed as described previously (26), except that artificial cerebrospinal fluid (CSF) buffer (Life Technologies, Inc., Bethesda, MD) was used as the binding buffer. Artificial CSF buffer contained 1.5 mM CaCl2, 4 mM KCl, 120 mM NaCl, 1 mM MgCl2, and 25 mM NaHCO3.
Animals
Male C57BL/6J mice (912 wk old; CLEA Japan Inc., Tokyo, Japan) were housed individually in plastic cages and were kept at 23 ± 2 C, 55 ± 15% relative humidity, and a light-dark cycle from 07001900 h. Water and regular chow (CE-2, CLEA Japan Inc.) were available ad libitum. All experimental procedures followed the Japanese Pharmacological Society Guideline for Animal Use.
Surgical procedure and experimental designs
Mice were anesthetized with sodium pentobarbital (80 mg/kg, ip, Dainabot, Tokyo, Japan), and a sterile brain infusion cannula (28 gauge, Alzet, Palo Alto, CA) was stereotaxically implanted into the right lateral ventricle. The stereotaxic coordinates used were 0.4 mm posterior to the bregma, 0.8 mm lateral to the midline, and 2.0 mm from the surface of the skull using a flat skull position. Cannulae were fixed to the skull with dental cement. The infusion cannula was connected to an osmotic minipump (model 2002, Alzet) filled with 10 mM PBS containing 0.05% BSA (PBS) with a polyvinylchloride tubing. The pump was implanted under the skin of the mouses back, and antibiotic (Cefamedin
, 50 mg/kg, Fujisawa Pharmaceutical Co., Ltd., Tokyo, Japan) was injected sc. In all experiments, mice were divided into groups to match average values of basal food intake and body weight. The placement of the cannula was confirmed at the end of the experiments by injection of 0.5% Evans blue dye.
Experiment 1. Intracerebroventricular (ICV) infusion of D-Trp34NPY in mice
After 714 d of postsurgery recovery, the pump was replaced with another (model 2001, Alzet) filled with D-Trp34NPY (1, 5, and 10 µg/d; n = 11 per group) or its vehicle (PBS; n = 6 per group) under ether anesthesia. Body weight and daily food intake were measured for 7 d.
Experiment 2. Effect of a Y5 antagonist on D-Trp34NPY-induced obesity
Animals were infused with 5 µg/d of D-Trp34NPY for 7 d using osmotic pumps. Vehicle or a Y5 antagonist at a dose of 100 mg/kg, twice a day, was orally administered by gavage from the day of pump change, and daily food intake and body weight were measured (n = 79 per group). The Y5 antagonist was suspended in 0.5% methylcellulose in distilled water. The administration was done 1 h before the beginning of the dark period after the measurement of body weight (evening treatment) and 1 h after the beginning of the light period (morning treatment).
Experiment 3. Pair-feeding study
Animals were fed 20 mg of pellet-type regular chow (dustless precision pellets, Bio-Serv Inc., Frenchtown, NJ) to simplify the measurement of food intake and to restrict food intake precisely in the pair-fed group. Mice were divided into three groups and ICV infused with D-Trp34NPY (5 µg/d) or PBS for 6 d using osmotic pumps (n = 1112 per group). PBS- and one of the D-Trp34NPY-infused groups were allowed to eat ad libitum (PBS-infused control and ad libitum-fed group, respectively). Another group of mice infused with D-Trp34NPY was pair-fed the same amount as the PBS-infused control (pair-fed group). The amount of food was divided into four meals and given at 0800, 1200, 1800, and 2300 h to mimic normal feeding patterns (10).
At the end of the above experiments, mice were fasted overnight and euthanized by collecting whole blood under ether anesthesia. Plasma biochemical and lipidic parameters were measured. Epididymal adipose tissues and liver were excised and weighed.
Experiment 4. Pair-feeding study for measurement of enzyme activity and gene expression
To examine the Y5-mediated metabolic changes more precisely, we conducted another pair-feeding study to measure mRNA expression levels, enzyme activities, and the triglyceride (TG) and glycogen contents of selective tissues. Using a similar protocol as that in experiment 3, an ICV infusion of D-Trp34NPY and pair-feeding were done for 6 d (n = 1112 per group). At the end of the experiment, mice were fasted 2 h, and blood, liver, WAT (epididymal, retroperitoneal, and mesenteric), brown adipose tissue (BAT), and muscle (quadriceps) were collected for measurement of mRNA expression levels, enzyme activities, and TG and glycogen contents.
Measurement of hormone and blood chemistry
Plasma glucose, TG, total cholesterol, high-density lipoprotein (HDL)-cholesterol, and non-HDL-cholesterol levels were measured using commercial kits [Determiner GL-E, L TGII, L TCII, L HDL-C, and L LDL-C (Kyowa Medex, Tokyo, Japan)]. Plasma free fatty acids (FFA) were measured using commercial kits [NEFA-HA testwako (II) (Wako Pure Chemical Industries, Ltd., Osaka, Japan)]. Insulin and leptin levels were measured by ELISA (Morinaga, Yokohama, Japan).
Measurement of lipoprotein lipase (LPL) and hormone-sensitive lipase (HSL) activities
Retroperitoneal adipose tissue (50 mg) was homogenized in 1 ml of 10 mM Tris, 0.25 M sucrose, 12 mM deoxycholate, and 1 mM EDTA (pH 7.4). The homogenate was centrifuged (12,000 x g for 20 min at 4 C). The fraction between the upper fat layer and the bottom sediment was removed and stored at -80 C until measurement. LPL and HSL activity was measured by hydrolysis of [14C]triolein, as described previously (27, 28). Thawed tissue homogenates (50 µl) were incubated under gentle agitation for 1 h at 28 C with 350 µl of a substrate mixture. The substrate mixture for LPL activity measurement consisted of 0.2 M Tris-HCl buffer (pH 8.6), which contained 0.04 MBq/ml [14C]triolein and 1.5 mM cold triolein emulsified in 5% gum arabic, as well as 1% fatty acid free BSA, 0.17 µM Apo CII (only for LPL activity), and either the presence or absence of 1 M NaCl. The substrate mixture for HSL activity measurement consisted of 0.2 M Tris-HCl buffer (pH 7.0), which contained 0.04 MBq/ml [14C]triolein and 1.5 mM cold triolein emulsified in 5% gum arabic, as well as 1% fatty acid free BSA and 0.25 M NaCl. After 1 h of incubation, the reaction was stopped by adding 5.2 ml methanol:chloroform:heptane (1.41:1.25:1), 50 µl [3H]oleic acid (0.5 kBq) as an internal standard for estimating recovery (29), and 1.75 ml potassium carbonate buffer (pH 10.5). The assay tubes were then shaken for 5 min and centrifuged at 2000 x g for 15 min at room temperature. A 3-ml sample of the aqueous upper phase was taken for double-label liquid scintillation counting (Perkin-Elmer Life Science, Inc., Boston, MA). LPL and HSL activities were expressed as micromoles of fatty acid produced per milligram of protein in 1 h. Protein content of the tissue extracts was measured by the BCA protein assay kit (Pierce Biotechnology, Rockford, IL).
Measurement of TG and glycogen contents
TG and glycogen contents were measured in liver and quadriceps. Total lipids in the liver and muscle were extracted by the procedure of Folch et al. (30). After drying, the extracts were dissolved in isopropanol, and the TG content in the samples was measured enzymatically using a commercial kit (Determiner L TG II, Kyowa Medex). Glycogen in liver and muscle was determined by use of the anthrone method (31). Tissue was extracted by boiling with 30% KOH; then ethanol was added to precipitate glycogen. The glycogen precipitate, dissolved in water, was measured by using anthrone.
TaqMan analysis
Oligonucleotide primers and TaqMan probes were designed using Primer Express version 1.5 (PE Applied Biosystems, Foster City, CA). Primers and probes used in this study were as follows: uncoupling protein (UCP)-1 (GenBank accession no. U63418), forward, GCAGATATCATCACCTTCCCG; reverse, CCTGGCCTTCACCTTGGAT; TaqMan probe, 5'-6FAM-TGGACACTGCCAAAGTCCGCCTTC-TAMRA-3'; UCP-2 (GenBank accession no. U69135), forward, TCCTGAAAGCCAACCTCATGA; reverse, CGATGACGGTGGTGCAGA; TaqMan probe, 5'-6FAM-AGATGACCTCCCTTGCCACTTCACTTCTG-TAMRA-3'; UCP-3 (GenBank accession no. AF053352), forward, GAAGATGGTGGCTCAGGAGG; reverse, AAGCTCCCAGACGCAGAAAG; TaqMan probe, 5'-6FAM-CCACGGCCTTCTACAAAGGATTTGTGC-TAMRA-3'; sterol regulatory element binding protein (SREBP)-1c (GenBank accession no. AB046200), forward, GTAGCGTCTGCACGCCCTA; reverse, CTTGGTTGTTGATGAGCTGGAG; TaqMan probe, 5'-6FAM-ACGGAGCCATGGATTGCACATTTGAAG-TAMRA-3'. A primer and VIC-labeled probe set for ß-actin were synthesized based on sequences by Niiya et al. (32). A primer and VIC-labeled probe set for 18s ribosomal RNA were purchased from PE Applied Biosystems.
Total RNA was isolated from the liver, mesenteric WAT, and BAT samples using ISOGEN reagent (Nippongene, Toyama, Japan).
TaqMan reverse transcription reagent (PE Applied Biosystems) was used for reverse transcriptase reactions. All reverse transcriptions were performed according to the manufacturers instruction. Each 40 µl of reverse transcriptase reaction mixture included 0.8 µg total RNA and random hexamers. At the same time, the negative control reactions (No-RT) for each RNA sample were performed in the absence of reverse transcriptase to assess genomic DNA contamination. Thereafter, all reactions were diluted 4-fold with distilled water and subjected to TaqMan assay.
ABI Prism 7700 Sequence Detector (PE Applied Biosystems) was used for the TaqMan assay according to the manufacturers instruction. Then, 0.5 µl of cDNA or No-RT control (equivalent to 2.5 ng total RNA) were used, respectively, per 25 µl of the reaction mixture (TaqMan Universal PCR Master Mix, PE Applied Biosystems). The concentrations of primers and probes were as follows: 18s rRNA, each forward and reverse primer, 50 nM, and probe, 200 nM; other cDNAs, each forward and reverse primer, 900 nM, and probe, 250 nM. The PCRs were a multiplex of a target and an internal control cDNA to standardize the amount of cDNA. The internal standards were adapted to 18s rRNA for liver, WAT, and BAT transcripts. The relative quantities of the transcripts were calculated from the average of triplicate reactions using a standard curve method.
Statistical analysis
Data are expressed as mean ± SEM. Body weight changes were compared between groups using repeated measure ANOVA coupled to a post hoc Bonferroni test. For food intake, blood parameters, tissue weights, and mRNA levels, two-way ANOVA coupled to a post hoc Bonferroni test was performed. P values below 0.05 were considered significant.
| Results |
|---|
|
|
|---|
|
|
|
|
|
|
|
|
|
|
| Discussion |
|---|
|
|
|---|
When D-Trp34NPY-induced hyperphagia was prevented by pair-feeding, which allowed mice access to the same amount of food consumed by PBS-infused mice, there was no increase in body weight. This result indicates that the increase in body weight is mainly due to hyperphagia through activation of the Y5 receptor. However, in contrast to treatment with the Y5 antagonist, the D-Trp34NPY-induced increase in adipose tissue weight was not prevented by pair-feeding, in agreement with the data that D-Trp34NPY at a dose of 1 µg/d ICV infusion tended to increase adipose tissue without hyperphagia (Fig. 2
). Moreover, several obesity-related plasma parameters were still increased in the D-Trp34NPY-infused pair-fed group compared with the PBS-infused group. These data clearly indicate that the Y5 receptor mediates additional aspects of energy homeostasis along with feeding regulation.
Insulin is known to be an important hormonal factor influencing lipogenesis by increasing uptake of glucose and activating lipogenic and glycolytic enzymes. Chronic activation of the Y5 receptor led to an increase in the 2-h fasting plasma insulin level even in the pair-fed group. Previous studies have shown that acute central injection of NPY produces a transient increase in the plasma insulin level, indicating that insulin release might also be involved in NPY-mediated obesity (6, 7, 11, 33, 34). Our findings indicate that, at least in part, NPY-stimulated insulin release is caused by the activation of the Y5 receptor and suggest that increased plasma insulin might play one of the key roles in Y5-mediated obesity. To support this hypothesis, D-Trp34NPY significantly increased the expression of hepatic SREBP-1c mRNA in the ad libitum group and tended to increase it in the pair-fed group. SREBPs are transcription factors that regulate the expression of genes related to cholesterol and fatty acid metabolism (35, 36, 37), and SREBP-1c is thought to be a major mediator of insulin action (38). Furthermore, the D-Trp34NPY-infused pair-fed mice had a significant elevation of plasma TG level and a significant reduction of liver glycogen content. This may imply that D-Trp34NPY preferentially uses carbohydrates derived from diet for lipid synthesis, not for glycogen synthesis, and releases them as very low-density lipoprotein-TG. Thus, these changes support the hypothesis that Y5-mediated insulin secretion may evoke lipogenesis through the stimulation of the SREBP-1c pathway. However, it could be difficult to conclude from the present data whether these changes were direct or indirect effects through the activation of central Y5 receptor. Further investigation, such as comparison with acute effects of D-Trp34NPY, might be important.
Zarjevski et al. (10, 39) reported that the ICV administration of NPY resulted in a pronounced increase in insulin-stimulated glucose uptake by adipose tissue. It is noteworthy that the plasma glucose level was significantly decreased in the D-Trp34NPY-infused pair-fed group after overnight fasting. Together with increased adiposity in the D-Trp34NPY-infused pair-fed group, decreased plasma glucose might be explained by the increased uptake of glucose into WAT, as in the case of NPY. Enhanced insulin-stimulated glucose uptake by activation of the Y5 receptor may also contribute to the development of obesity.
We measured LPL and HSL activities in WAT to determine whether Y5 stimulation increases adiposity by increasing uptake of plasma TG or by decreasing the hydrolysis of stored TG in WAT. D-Trp34NPY remarkably increased the WAT LPL activity in the ad libitum-fed group, and tended to increase it in the pair-fed group by 2- to 3-fold. These changes were in accord with a previous report that chronic ICV infusion of NPY increased the LPL activity in WAT, even under the pair-fed condition (10). In contrast, HSL activity tended to be decreased in the ad libitum group and was significantly decreased in the pair-fed group. These observations in WAT suggest that Y5 activation accelerates the accumulation of TG in adipose tissue by stimulation of the uptake of plasma TG and the suppression of lipolysis in stored TG, as well as the stimulation of lipogenesis and TG secretion in liver, as mentioned before. The different levels of LPL and HSL activities between the ad libitum- and pair-fed groups were probably due to the different amounts of food intake.
D-Trp34NPY significantly decreased UCP-1 mRNA expression in BAT in both the ad libitum- and pair-fed groups. BAT is an important site of thermogenesis in rodents, and UCP-1 is a key mediator of thermogenesis in BAT. The decrease in UCP-1 mRNA expression in this experiment suggests that energy expenditure in BAT might be decreased by Y5 activation. It has been reported that centrally injected NPY decreased UCP-1 mRNA expression, sympathetic nerve activity, and thermogenesis in BAT (8, 9, 40). Hwa et al. (41) reported that ICV-injected Y5 selective agonist, D-[Trp32]NPY, decreased BAT thermogenesis and abdominal temperature in rats. The decrease of UCP-1 mRNA expression in this study is in agreement with the findings of Hwa et al. and suggest that the Y5 receptor modulates energy expenditure by controlling BAT thermogenesis in NPY-mediated obesity. Thus, decreased thermogenesis in BAT is some part of the mechanism of increased adiposity in the D-Trp34NPY-infused pair-fed group.
Because we observed an increase in adiposity without any change of body weight in the D-Trp34NPY-infused pair-fed mice, we further measured muscle weight and tissue TG and glycogen contents. Interestingly, in the pair-fed mice, muscle weight was slightly, but significantly, decreased by the D-Trp34NPY infusion, although the TG and glycogen contents were not reduced. This slight reduction of muscle weight may account for increased adiposity without a change in body weight observed in the D-Trp34NPY-infused pair-fed mice. The strong increase of lipid synthesis by D-Trp34NPY under the pair-fed condition might result in a decrease in lean mass. The imbalance of fat to lean mass, increasing adiposity, and decreasing lean mass imply the development of insulin resistance. Further studies are needed to elucidate the effects of Y5 activation on lean mass.
Herein, we have shown that chronic Y5 activation produces obesity due to increases in both energy intake and energy storage. In addition, the phenotype of Y5-mediated obesity is quite similar to that of NPY-induced obesity, which has been previously reported (5, 10, 11, 39, 42). Therefore, we conclude that the Y5 receptor plays a key role in energy homeostasis and may also play a key role in NPY-mediated obesity. However, there are some reports that Y5 antagonists had no effects on spontaneous feeding in normal and obese rats (23, 24). In addition, we have demonstrated that NPY-mediated feeding might be mainly regulated by the Y1 receptor (19, 22) and that Y1 antagonists also inhibit spontaneous feeding in rodents as well as body weight gain in Zucker fatty rats (18, 20, 21). Recently, participation of the Y2 receptor in feeding regulation has also been reported (43, 44). Therefore, NPY-mediated obesity might be regulated by multiple subtypes of NPY receptors, as in the case of feeding regulation, and physiological roles of each receptor in energy homeostasis are still controversial. Although further investigations are required to understand physiological and pathophysiological roles of the Y5 receptor in obesity, present data clearly demonstrate the possibility that the Y5 receptor is one of the key receptors in energy homeostasis.
| Acknowledgments |
|---|
| Footnotes |
|---|
Received December 9, 2002.
Accepted for publication January 17, 2003.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
M. Ito, A. Gomori, J. Suzuki, S. Tsujioka, M. Sasaki, M. Matsuda, M. A Bednarek, M. Ito, A. Ishihara, H. Iwaasa, et al. Antagonism of central melanin-concentrating hormone 1 receptor alleviates steatohepatitis in mice J. Endocrinol., August 1, 2008; 198(2): 309 - 315. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. T. Ruohonen, U. Pesonen, N. Moritz, K. Kaipio, M. Roytta, M. Koulu, and E. Savontaus Transgenic Mice Overexpressing Neuropeptide Y in Noradrenergic Neurons: A Novel Model of Increased Adiposity and Impaired Glucose Tolerance Diabetes, June 1, 2008; 57(6): 1517 - 1525. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Dark and K. M. Pelz NPY Y1 receptor antagonist prevents NPY-induced torporlike hypothermia in cold-acclimated Siberian hamsters Am J Physiol Regulatory Integrative Comp Physiol, January 1, 2008; 294(1): R236 - R245. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. M. Kamiji and A. Inui Neuropeptide Y Receptor Selective Ligands in the Treatment of Obesity Endocr. Rev., October 1, 2007; 28(6): 664 - 684. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Mashiko, A. Ishihara, H. Iwaasa, H. Sano, J. Ito, A. Gomori, Z. Oda, R. Moriya, H. Matsushita, M. Jitsuoka, et al. A Pair-Feeding Study Reveals That a Y5 Antagonist Causes Weight Loss in Diet-Induced Obese Mice by Modulating Food Intake and Energy Expenditure Mol. Pharmacol., February 1, 2007; 71(2): 602 - 608. [Abstract] [Full Text] [PDF] |
||||
![]() |
B Beck Neuropeptide Y in normal eating and in genetic and dietary-induced obesity Phil Trans R Soc B, July 29, 2006; 361(1471): 1159 - 1185. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Moriya, H. Sano, T. Umeda, M. Ito, Y. Takahashi, M. Matsuda, A. Ishihara, A. Kanatani, and H. Iwaasa RFamide Peptide QRFP43 Causes Obesity with Hyperphagia and Reduced Thermogenesis in Mice Endocrinology, June 1, 2006; 147(6): 2916 - 2922. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Ishihara, A. Kanatani, S. Mashiko, T. Tanaka, M. Hidaka, A. Gomori, H. Iwaasa, N. Murai, S.-i. Egashira, T. Murai, et al. A neuropeptide Y Y5 antagonist selectively ameliorates body weight gain and associated parameters in diet-induced obese mice PNAS, May 2, 2006; 103(18): 7154 - 7158. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Mizuarai, S. Miki, H. Araki, K. Takahashi, and H. Kotani Identification of Dicarboxylate Carrier Slc25a10 as Malate Transporter in de Novo Fatty Acid Synthesis J. Biol. Chem., September 16, 2005; 280(37): 32434 - 32441. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Takahashi, S. Mizuarai, H. Araki, S. Mashiko, A. Ishihara, A. Kanatani, H. Itadani, and H. Kotani Adiposity Elevates Plasma MCP-1 Levels Leading to the Increased CD11b-positive Monocytes in Mice J. Biol. Chem., November 21, 2003; 278(47): 46654 - 46660. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |