help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mashiko, S.
Right arrow Articles by Kanatani, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mashiko, S.
Right arrow Articles by Kanatani, A.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Medline Plus Health Information
*Obesity
Endocrinology Vol. 144, No. 5 1793-1801
Copyright © 2003 by The Endocrine Society

Characterization of Neuropeptide Y (NPY) Y5 Receptor-Mediated Obesity in Mice: Chronic Intracerebroventricular Infusion of D-Trp34NPY

Satoshi Mashiko, Akane Ishihara, Hisashi Iwaasa, Hideki Sano, Zenjun Oda, Junko Ito, Mariko Yumoto, Mayumi Okawa, Jun Suzuki, Takahiro Fukuroda, Makoto Jitsuoka, Nancy R. Morin, Douglas J. MacNeil, Lex H. T. Van der Ploeg, Masaki Ihara, Takehiro Fukami and Akio Kanatani

Tsukuba Research Institute (S.M., A.I., H.I., H.S., Z.O., J.I., M.Y., M.O., J.S., T.Fuku., M.J., M.I., T.Fuka., A.K.), Banyu Pharmaceutical Co., Ltd., Tsukuba 300-2611, Japan; and Merck Research Laboratories (N.R.M., D.J.M., L.H.T.V.d.P.), Merck \|[amp ]\| Co., Inc., Rahway, New Jersey 07065

Address all correspondence and requests for reprints to: Dr. Akane Ishihara, Tsukuba Research Institute, Banyu Pharmaceutical Co., Ltd., Okubo 3, Tsukuba 300-2611, Japan. E-mail: isihraan{at}banyu.co.jp.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
To clarify the role of the neuropeptide Y (NPY) Y5 receptor subtype in energy homeostasis, the effect of the intracerebroventricular infusion of a selective Y5 agonist, D-Trp34NPY, was investigated in C57BL/6J mice. Intracerebroventricular infusion of D-Trp34NPY (5 and 10 µg/d) produced hyperphagia and body weight gain, accompanied by increased adipose tissue weight, hypercholesterolemia, hyperinsulinemia, and hyperleptinemia. Oral administration of a selective Y5 antagonist at a dose of 100 mg/kg twice a day completely suppressed all of these D-Trp34NPY-induced changes, indicating that chronic activation of the Y5 receptor produces hyperphagia and obesity. In addition, D-Trp34NPY still resulted in an increase in adipose tissue weight accompanied by hyperleptinemia and hypercholesterolemia, although D-Trp34NPY-induced food intake was restricted by pair-feeding. Under the pair-fed condition, D-Trp34NPY decreased hormone-sensitive lipase activity in white adipose tissue and uncoupling protein-1 mRNA expression in brown adipose tissue. These findings indicate that Y5-mediated obesity may involve metabolic changes, such as decreased lipolysis and thermogenesis, as well as hyperphagia. Therefore, the Y5 receptor can play a key role in regulating energy homeostasis.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
NEUROPEPTIDE Y (NPY) IS a 36-amino acid polypeptide belonging to the pancreatic polypeptide (PP) family, which consists of NPY, peptide YY (PYY), and PP. Central administration of NPY powerfully stimulates food intake in a variety of species (1, 2, 3, 4, 5). Chronic administration of NPY produces continuous hyperphagia and remarkable body weight gain. In addition to its potent effect on feeding, NPY also has some anabolic effects on carbohydrate metabolism, brown fat thermogenesis, and white adipose tissue (WAT) lipid storage (6, 7, 8, 9, 10). Furthermore, some NPY-induced endocrine and metabolic changes are not completely reversed by pair-feeding, indicating that central NPY may induce peripheral endocrine and metabolic alterations via efferent routes, as well as hyperphagia (10, 11). These results indicate that NPY-mediated obesity is caused by both an increase in energy intake and a decrease in energy expenditure.

Physiological functions of NPY are evoked through the action of G protein-coupled receptors. At least six subtypes of NPY, PYY, and PP receptors have been identified. It has been reported that Y1, Y2, Y4, Y5, and y6 receptors are widely expressed in brain, and their distribution appears to be species specific. Among them, Y1, Y2, and Y5 are abundantly expressed in the hypothalamic area controlling energy homeostasis, and only Y2 receptor acts as an autoreceptor (12). Several lines of evidence show that both Y1 and Y5 receptor subtypes are involved in NPY-mediated obesity. The ability of some NPY-related peptides to stimulate food intake is well correlated to in vitro binding affinity for the Y5 receptor (13, 14) and peptide-based selective Y5 agonist stimulation of food intake (15, 16). On the other hand, the Y1 receptor may also have an important role in regulating food intake. Selective Y1 receptor antagonists suppressed NPY-induced and spontaneous food intake (17, 18, 19, 20, 21), and NPY-induced food intake was significantly suppressed in Y1-deficient mice (22). These data suggest that the orexigenic effect of NPY may be mediated by both Y1 and Y5 receptor subtypes. However, the involvement of the Y5 receptor in feeding regulation is still controversial, because there have been some reports that the Y5 antagonist has no effect on spontaneous food intake and the NPY-induced food intake was not suppressed in Y5-deficient mice (22, 23, 24).

In this study, to address the role of the Y5 receptor in the regulation of food intake and energy homeostasis, we investigated the chronic effects of a selective Y5 agonist in lean mice. Parker et al. (15) reported that one of the NPY analogs, D-Trp34NPY, was a potent and selective NPY Y5 receptor agonist, and markedly increased food intake in rats. However, little is known about chronic activation of the Y5 receptor. Recently, we developed a potent and selective Y5 antagonist, 3,3-dimethyl-9-(4,4-dimethyl-2,6-dioxocyclohexyl)- 1-oxo-1,2,3,4-tetrahydroxanthene, as previously described (25). The antagonist showed a high affinity for the rat Y5 receptor with a Ki value of 31 nM, whereas any significant affinity for 120 other receptors was not observed at 10 µM. In addition, the antagonist inhibited the Y5 selective agonist (bovine PP)-induced food intake in rats. Thus, we used the antagonist to make sure of specific activation of the Y5 receptor in the central nervous system. In the present study, we show that specific and chronic activation of the Y5 receptor, validated by structurally different Y5 selective agonists and antagonists, produces obesity in mice. We also examine the effect of the Y5 receptor stimulation on energy metabolism by using a pair-feeding study.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Materials
PYY and PP were purchased from Sigma (St. Louis, MO). Human NPY (hNPY) was purchased from Peptide Institute (Osaka, Japan). [125I]PYY and [125I]PP were obtained from NEN Life Science Products-DuPont (Boston, MA). The culture reagents were from Life Technologies, Inc. (Grand Island, NY). All other chemicals were of analytical grade. D-Trp34NPY (15) and 3,3-dimethyl-9-(4,4-dimethyl-2,6-dioxocyclohexyl)-1-oxo-1,2,3,4-tetrahydroxanthene (25) were synthesized in Banyu Pharmaceutical Co., Ltd. (Tsukuba, Japan), and [14C]triolein was purchased from NEN Life Science Products.

Expression of mouse receptors in COS-7 cells and receptor binding assays
The coding regions of mouse (m)Y1, mY2, mY4, mY5, and my6 (GenBank accession nos. Z18280, D86238, U40189, AF022948, and U58367, respectively) were cloned by PCR into the multiple cloning site of pCI-neo (Promega Corp., Madison, WI) with an optimal Kozac sequence, GCCGCCACC, before the ATG start codons. The nucleotide sequences of the resulting clones were confirmed to be free of PCR-induced errors with an ABI 373A automated sequencer (Perkin Elmer Corp., Norwalk, CT). DNA was transfected into COS-7 cells, membranes were prepared, binding reactions were performed, and the data were analyzed as described previously (26), except that artificial cerebrospinal fluid (CSF) buffer (Life Technologies, Inc., Bethesda, MD) was used as the binding buffer. Artificial CSF buffer contained 1.5 mM CaCl2, 4 mM KCl, 120 mM NaCl, 1 mM MgCl2, and 25 mM NaHCO3.

Animals
Male C57BL/6J mice (9–12 wk old; CLEA Japan Inc., Tokyo, Japan) were housed individually in plastic cages and were kept at 23 ± 2 C, 55 ± 15% relative humidity, and a light-dark cycle from 0700–1900 h. Water and regular chow (CE-2, CLEA Japan Inc.) were available ad libitum. All experimental procedures followed the Japanese Pharmacological Society Guideline for Animal Use.

Surgical procedure and experimental designs
Mice were anesthetized with sodium pentobarbital (80 mg/kg, ip, Dainabot, Tokyo, Japan), and a sterile brain infusion cannula (28 gauge, Alzet, Palo Alto, CA) was stereotaxically implanted into the right lateral ventricle. The stereotaxic coordinates used were 0.4 mm posterior to the bregma, 0.8 mm lateral to the midline, and 2.0 mm from the surface of the skull using a flat skull position. Cannulae were fixed to the skull with dental cement. The infusion cannula was connected to an osmotic minipump (model 2002, Alzet) filled with 10 mM PBS containing 0.05% BSA (PBS) with a polyvinylchloride tubing. The pump was implanted under the skin of the mouse’s back, and antibiotic (Cefamedin {alpha}, 50 mg/kg, Fujisawa Pharmaceutical Co., Ltd., Tokyo, Japan) was injected sc. In all experiments, mice were divided into groups to match average values of basal food intake and body weight. The placement of the cannula was confirmed at the end of the experiments by injection of 0.5% Evans blue dye.

Experiment 1. Intracerebroventricular (ICV) infusion of D-Trp34NPY in mice
After 7–14 d of postsurgery recovery, the pump was replaced with another (model 2001, Alzet) filled with D-Trp34NPY (1, 5, and 10 µg/d; n = 11 per group) or its vehicle (PBS; n = 6 per group) under ether anesthesia. Body weight and daily food intake were measured for 7 d.

Experiment 2. Effect of a Y5 antagonist on D-Trp34NPY-induced obesity
Animals were infused with 5 µg/d of D-Trp34NPY for 7 d using osmotic pumps. Vehicle or a Y5 antagonist at a dose of 100 mg/kg, twice a day, was orally administered by gavage from the day of pump change, and daily food intake and body weight were measured (n = 7–9 per group). The Y5 antagonist was suspended in 0.5% methylcellulose in distilled water. The administration was done 1 h before the beginning of the dark period after the measurement of body weight (evening treatment) and 1 h after the beginning of the light period (morning treatment).

Experiment 3. Pair-feeding study
Animals were fed 20 mg of pellet-type regular chow (dustless precision pellets, Bio-Serv Inc., Frenchtown, NJ) to simplify the measurement of food intake and to restrict food intake precisely in the pair-fed group. Mice were divided into three groups and ICV infused with D-Trp34NPY (5 µg/d) or PBS for 6 d using osmotic pumps (n = 11–12 per group). PBS- and one of the D-Trp34NPY-infused groups were allowed to eat ad libitum (PBS-infused control and ad libitum-fed group, respectively). Another group of mice infused with D-Trp34NPY was pair-fed the same amount as the PBS-infused control (pair-fed group). The amount of food was divided into four meals and given at 0800, 1200, 1800, and 2300 h to mimic normal feeding patterns (10).

At the end of the above experiments, mice were fasted overnight and euthanized by collecting whole blood under ether anesthesia. Plasma biochemical and lipidic parameters were measured. Epididymal adipose tissues and liver were excised and weighed.

Experiment 4. Pair-feeding study for measurement of enzyme activity and gene expression
To examine the Y5-mediated metabolic changes more precisely, we conducted another pair-feeding study to measure mRNA expression levels, enzyme activities, and the triglyceride (TG) and glycogen contents of selective tissues. Using a similar protocol as that in experiment 3, an ICV infusion of D-Trp34NPY and pair-feeding were done for 6 d (n = 11–12 per group). At the end of the experiment, mice were fasted 2 h, and blood, liver, WAT (epididymal, retroperitoneal, and mesenteric), brown adipose tissue (BAT), and muscle (quadriceps) were collected for measurement of mRNA expression levels, enzyme activities, and TG and glycogen contents.

Measurement of hormone and blood chemistry
Plasma glucose, TG, total cholesterol, high-density lipoprotein (HDL)-cholesterol, and non-HDL-cholesterol levels were measured using commercial kits [Determiner GL-E, L TGII, L TCII, L HDL-C, and L LDL-C (Kyowa Medex, Tokyo, Japan)]. Plasma free fatty acids (FFA) were measured using commercial kits [NEFA-HA testwako (II) (Wako Pure Chemical Industries, Ltd., Osaka, Japan)]. Insulin and leptin levels were measured by ELISA (Morinaga, Yokohama, Japan).

Measurement of lipoprotein lipase (LPL) and hormone-sensitive lipase (HSL) activities
Retroperitoneal adipose tissue (50 mg) was homogenized in 1 ml of 10 mM Tris, 0.25 M sucrose, 12 mM deoxycholate, and 1 mM EDTA (pH 7.4). The homogenate was centrifuged (12,000 x g for 20 min at 4 C). The fraction between the upper fat layer and the bottom sediment was removed and stored at -80 C until measurement. LPL and HSL activity was measured by hydrolysis of [14C]triolein, as described previously (27, 28). Thawed tissue homogenates (50 µl) were incubated under gentle agitation for 1 h at 28 C with 350 µl of a substrate mixture. The substrate mixture for LPL activity measurement consisted of 0.2 M Tris-HCl buffer (pH 8.6), which contained 0.04 MBq/ml [14C]triolein and 1.5 mM cold triolein emulsified in 5% gum arabic, as well as 1% fatty acid free BSA, 0.17 µM Apo CII (only for LPL activity), and either the presence or absence of 1 M NaCl. The substrate mixture for HSL activity measurement consisted of 0.2 M Tris-HCl buffer (pH 7.0), which contained 0.04 MBq/ml [14C]triolein and 1.5 mM cold triolein emulsified in 5% gum arabic, as well as 1% fatty acid free BSA and 0.25 M NaCl. After 1 h of incubation, the reaction was stopped by adding 5.2 ml methanol:chloroform:heptane (1.41:1.25:1), 50 µl [3H]oleic acid (0.5 kBq) as an internal standard for estimating recovery (29), and 1.75 ml potassium carbonate buffer (pH 10.5). The assay tubes were then shaken for 5 min and centrifuged at 2000 x g for 15 min at room temperature. A 3-ml sample of the aqueous upper phase was taken for double-label liquid scintillation counting (Perkin-Elmer Life Science, Inc., Boston, MA). LPL and HSL activities were expressed as micromoles of fatty acid produced per milligram of protein in 1 h. Protein content of the tissue extracts was measured by the BCA protein assay kit (Pierce Biotechnology, Rockford, IL).

Measurement of TG and glycogen contents
TG and glycogen contents were measured in liver and quadriceps. Total lipids in the liver and muscle were extracted by the procedure of Folch et al. (30). After drying, the extracts were dissolved in isopropanol, and the TG content in the samples was measured enzymatically using a commercial kit (Determiner L TG II, Kyowa Medex). Glycogen in liver and muscle was determined by use of the anthrone method (31). Tissue was extracted by boiling with 30% KOH; then ethanol was added to precipitate glycogen. The glycogen precipitate, dissolved in water, was measured by using anthrone.

TaqMan analysis
Oligonucleotide primers and TaqMan probes were designed using Primer Express version 1.5 (PE Applied Biosystems, Foster City, CA). Primers and probes used in this study were as follows: uncoupling protein (UCP)-1 (GenBank accession no. U63418), forward, GCAGATATCATCACCTTCCCG; reverse, CCTGGCCTTCACCTTGGAT; TaqMan probe, 5'-6FAM-TGGACACTGCCAAAGTCCGCCTTC-TAMRA-3'; UCP-2 (GenBank accession no. U69135), forward, TCCTGAAAGCCAACCTCATGA; reverse, CGATGACGGTGGTGCAGA; TaqMan probe, 5'-6FAM-AGATGACCTCCCTTGCCACTTCACTTCTG-TAMRA-3'; UCP-3 (GenBank accession no. AF053352), forward, GAAGATGGTGGCTCAGGAGG; reverse, AAGCTCCCAGACGCAGAAAG; TaqMan probe, 5'-6FAM-CCACGGCCTTCTACAAAGGATTTGTGC-TAMRA-3'; sterol regulatory element binding protein (SREBP)-1c (GenBank accession no. AB046200), forward, GTAGCGTCTGCACGCCCTA; reverse, CTTGGTTGTTGATGAGCTGGAG; TaqMan probe, 5'-6FAM-ACGGAGCCATGGATTGCACATTTGAAG-TAMRA-3'. A primer and VIC-labeled probe set for ß-actin were synthesized based on sequences by Niiya et al. (32). A primer and VIC-labeled probe set for 18s ribosomal RNA were purchased from PE Applied Biosystems.

Total RNA was isolated from the liver, mesenteric WAT, and BAT samples using ISOGEN reagent (Nippongene, Toyama, Japan).

TaqMan reverse transcription reagent (PE Applied Biosystems) was used for reverse transcriptase reactions. All reverse transcriptions were performed according to the manufacturer’s instruction. Each 40 µl of reverse transcriptase reaction mixture included 0.8 µg total RNA and random hexamers. At the same time, the negative control reactions (No-RT) for each RNA sample were performed in the absence of reverse transcriptase to assess genomic DNA contamination. Thereafter, all reactions were diluted 4-fold with distilled water and subjected to TaqMan assay.

ABI Prism 7700 Sequence Detector (PE Applied Biosystems) was used for the TaqMan assay according to the manufacturer’s instruction. Then, 0.5 µl of cDNA or No-RT control (equivalent to 2.5 ng total RNA) were used, respectively, per 25 µl of the reaction mixture (TaqMan Universal PCR Master Mix, PE Applied Biosystems). The concentrations of primers and probes were as follows: 18s rRNA, each forward and reverse primer, 50 nM, and probe, 200 nM; other cDNAs, each forward and reverse primer, 900 nM, and probe, 250 nM. The PCRs were a multiplex of a target and an internal control cDNA to standardize the amount of cDNA. The internal standards were adapted to 18s rRNA for liver, WAT, and BAT transcripts. The relative quantities of the transcripts were calculated from the average of triplicate reactions using a standard curve method.

Statistical analysis
Data are expressed as mean ± SEM. Body weight changes were compared between groups using repeated measure ANOVA coupled to a post hoc Bonferroni test. For food intake, blood parameters, tissue weights, and mRNA levels, two-way ANOVA coupled to a post hoc Bonferroni test was performed. P values below 0.05 were considered significant.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Affinity of peptide ligands at the mouse NPY receptors
The binding affinities of hNPY, D-Trp34NPY, and a Y5 antagonist were evaluated at the cloned mouse Y1, Y2, Y4, Y5, and y6 receptors expressed in COS-7 cells. Table 1Go presents the affinities of ligands at the cloned mouse NPY receptors in an artificial CSF buffer. D-Trp34NPY showed a high affinity for the Y5 receptor with a Ki value of 5.0 nM, which is a similar affinity to that of hNPY. D-Trp34NPY is more than 25-fold selective for Y5 over Y1, Y2, Y4, and y6. A Y5 antagonist showed a potent affinity for the mouse Y5 receptor with a Ki value of 44 nM, but did not show any significant affinities for other subtypes of mouse NPY receptors.


View this table:
[in this window]
[in a new window]
 
Table 1. Pharmacological profiles of hNPY, D-Trp34NPY, and the Y5 antagonist for mouse NPY receptors

 
Effect of chronically ICV-infused D-Trp34NPY
Chronic ICV infusion of D-Trp34NPY significantly increased body weight in a dose-dependent manner (Fig. 1Go). Body weight change at a dose of 5 µg/d was significant at d 4, and at a dose of 10 µg/d it was significant at d 2 (P < 0.05). Cumulative food intake and epididymal adipose tissue weight were also dose-dependently increased (Fig. 2Go). Table 2Go shows plasma lipid and biochemical parameters of D-Trp34NPY-infused mice. D-Trp34NPY significantly increased plasma total cholesterol, HDL-cholesterol, non-HDL-cholesterol, and TG levels. Plasma insulin and leptin levels were significantly increased in the D-Trp34NPY-infused mice, but plasma FFA and glucose levels were not affected by D-Trp34NPY infusion.



View larger version (23K):
[in this window]
[in a new window]
 
Figure 1. Body weight changes of C57BL/6J mice chronically ICV infused with D-Trp34NPY or vehicle for 7 d. D-Trp34NPY at doses of 1, 5, and 10 µg/d were chronically administered to the left lateral ventricle of the brain. Values are means ± SEM of 6–11 mice per group. #, P < 0.05; and ##, P < 0.01, vs. PBS-infused control group.

 


View larger version (26K):
[in this window]
[in a new window]
 
Figure 2. Seven-day cumulative food intake (A) and adipose tissue weight (B) in D-Trp34NPY-infused C57BL/6J mice. D-Trp34NPY at doses of 1, 5, and 10 µg/d were chronically administered to the left lateral ventricle of the brain for 7 d. Each bar represents means ± SEM of 6–11 mice per group. #, P < 0.05; and ##, P < 0.01, vs. PBS-infused control group.

 

View this table:
[in this window]
[in a new window]
 
Table 2. Plasma biochemical parameters of C57BL/6J mice infused with D-Trp34NPY (experiment 1)

 
Effect of a Y5-selective antagonist on D-Trp34NPY-induced obesity
Treatment of mice with a selective Y5 antagonist at a dose of 100 mg/kg twice a day suppressed D-Trp34NPY-induced body weight gain (P < 0.01; Fig. 3AGo). D-Trp34NPY-induced hyperphagia and the increase in adiposity were also suppressed by the antagonist treatment (Fig. 3Go, B and C). In addition, D-Trp34NPY-induced changes such as hypercholesterolemia, hyperinsulinemia, and hyperleptinemia were all ameliorated when the D-Trp34NPY-infused mice were treated with the Y5 antagonist. Independently, we confirmed that the Y5 antagonist at the dose of 100 mg/kg twice a day had no effect on spontaneous food intake and body weight in lean mice, and that no remarkable changes occurred in gross behavior tests at this dose and the respective vehicle (data not shown).



View larger version (23K):
[in this window]
[in a new window]
 
Figure 3. Body weight change (A), 7-d cumulative food intake (B), and adipose tissue weight (C) of D-Trp34NPY-infused C57BL/6J mice treated with a Y5 selective antagonist for 7 d. D-Trp34NPY at a dose of 5 µg/d was chronically administered to the left lateral ventricle of the brain. The Y5 antagonist was orally administered at a dose of 100 mg/kg twice a day. Values are means ± SEM of 7–9 mice per group. ##, P < 0.01 vs. PBS-infused control group. **, P < 0.01 vs. D-Trp34NPY-infused vehicle-treated control group.

 
Effect of pair-feeding on D-Trp34NPY-induced obesity
When D-Trp34NPY-induced hyperphagia was prevented by pair-feeding, D-Trp34NPY infusion did not produce a significant change in body weight compared with a PBS-infused control group (Fig. 4AGo). However, the adipose tissue weight in the D-Trp34NPY-infused pair-fed group was significantly greater than that of the PBS-infused group (P < 0.001; Fig. 4CGo). D-Trp34NPY-induced hypercholesterolemia and hypertriglyceridemia were not ameliorated by pair-feeding (Table 3Go). The plasma glucose level was significantly decreased in the D-Trp34NPY-infused pair-fed group (P < 0.05), but not changed in the ad libitum-fed group. Although the plasma insulin level was not changed, the plasma leptin level was significantly increased in the D-Trp34NPY-infused pair-fed group (P < 0.001).



View larger version (23K):
[in this window]
[in a new window]
 
Figure 4. Body weight change (A), 6-d cumulative food intake (B), and adipose tissue weight (C) of D-Trp34NPY-infused, ad libitum- or pair-fed C57BL/6J mice. D-Trp34NPY at a dose of 5 µg/d was chronically administered to the left lateral ventricle of the brain for 6 d. Values represent means ± SEM of 11–12 mice per group. ##, P < 0.01 vs. PBS-infused control group.

 

View this table:
[in this window]
[in a new window]
 
Table 3. Plasma biochemical parameters of D-Trp34NPY-infused, ad libitum-fed or pair-fed C57BL/6J mice (experiment 2)

 
Effect of D-Trp34NPY on LPL and HSL activities
In another set of animals fed ad libitum or pair-fed and compared with the PBS-infused control group, we measured two enzyme activities, LPL and HSL, that are related to energy metabolism. D-Trp34NPY significantly increased retroperitoneal adipose tissue weight in both the ad libitum and pair-fed mice compared with the PBS-infused mice (P < 0.001; Fig. 5AGo). LPL activity in the ad libitum-fed group was remarkably increased compared with the PBS-infused control group (P < 0.001; Fig. 5BGo). In the D-Trp34NPY-infused pair-fed group, a slight elevation of LPL activity was observed, although it was not statistically significant. D-Trp34NPY significantly decreased HSL activity compared with the PBS-infused control group in the pair-fed group (P < 0.05), but not in the ad libitum-fed group (Fig. 5CGo).



View larger version (20K):
[in this window]
[in a new window]
 
Figure 5. Adipose tissue weight (a), LPL (b), and HSL (c) activity of adipose tissue from D-Trp34NPY-infused, ad libitum- or pair-fed C57BL/6J mice. D-Trp34NPY at a dose of 5 µg/d was chronically administered to the left lateral ventricle of the brain for 6 d. Each bar represents means ± SEM of 11–12 mice per group. #, P < 0.05; ##, P < 0.01 vs. PBS-infused control group.

 
Effect of D-Trp34NPY and pair-feeding on UCP and SREBP mRNA expression levels
D-Trp34NPY treatment resulted in a significant decrease in UCP-1 mRNA levels in BAT in both ad libitum- and pair-fed mice (P < 0.01; Table 4Go). UCP-3 expression was significantly decreased only in the D-Trp34NPY-infused ad libitum-fed group (P < 0.001). There was no significant effect of the D-Trp34NPY treatment on BAT and WAT UCP-2 mRNA expression. We also measured expression levels of SREBP mRNA. Although SREBP-1a and SREBP-2 mRNA levels were not changed in either the D-Trp34NPY-infused ad libitum- or pair-fed groups, liver SREBP-1c mRNA was significantly increased in the D-Trp34NPY-infused ad libitum-fed mice (P < 0.001) and seemingly increased in the D-Trp34NPY-infused pair-fed group (P = 0.27). In WAT, no significant changes in the SREBP mRNA were observed after D-Trp34NPY treatment.


View this table:
[in this window]
[in a new window]
 
Table 4. Plasma biochemical parameters, UCP, and SREBP mRNA expression levels in D-Trp34NPY-infused, ad libitum- or pair-fed C57BL/6J mice (experiment 4)

 
Effect of D-Trp34NPY and pair-feeding on tissue glycogen and TG contents
ICV infusion of D-Trp34NPY significantly increased liver weight in the ad libitum group (P < 0.001), but not in the pair-fed group (Table 5Go). Liver glycogen content was significantly decreased only in the pair-fed group (P < 0.05), whereas liver TG content was increased in the D-Trp34NPY-infused ad libitum-fed mice compared with that in the PBS-infused mice (P < 0.001; Table 4Go). Only in the pair-fed group did the D-Trp34NPY treatment slightly, but significantly, decrease quadriceps weight (P < 0.001). Muscle glycogen content was not affected by D-Trp34NPY infusion. Muscle TG content was increased in the D-Trp34NPY-infused ad libitum group (P < 0.01; Table 5Go).


View this table:
[in this window]
[in a new window]
 
Table 5. Tissue weight, glycogen, and TG content of D-Trp34NPY-infused, ad libitum- or pair-fed C57BL/6J mice (experiment 4)

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
To clarify the role of the Y5 receptor subtype in energy homeostasis, we used a peptidic NPY Y5 selective agonist, D-Trp34NPY, and a selective nonpeptidic Y5 antagonist. ICV infusion of D-Trp34NPY produced remarkable and typical obesity in mice; the D-Trp34NPY-induced obesity was completely ameliorated by treatment with the selective Y5 antagonist. D-Trp34NPY, previously shown to be a potent and selective Y5 agonist for human and rat NPY receptors (15), is also a potent and selective ligand for mouse Y5 receptor (Table 1Go). In mice, D-Trp34NPY has no significant affinity for the Y2 or Y4 receptors and has greater than 25-fold higher affinity for Y5 than Y1 and y6. The nonpeptidic Y5 antagonist used here (25) is highly selective for the Y5 receptor with greater than 100-fold higher affinity for the Y5 receptor compared with other known NPY receptor subtypes. The lack of affinity for the Y1 receptor, which is considered one of the feeding receptors, is noteworthy to the interpretation of the results (Table 1Go). Moreover, the Y5 antagonist did not show any significant cross-reactivity with 120 other binding assays and 7 enzyme assays (adrenergic, dopaminergic, GABA-ergic, histaminergic, serotonergic receptors and so on), which are considered to be involved in feeding regulation (data not shown). Therefore, the current data obtained by the coadministration of a structurally distinct Y5 selective agonist and antagonist are enough to conclude that D-Trp34NPY-induced obesity is mediated via the Y5 receptor subtype. Thus, the Y5 receptor is one of the key receptors in energy homeostasis.

When D-Trp34NPY-induced hyperphagia was prevented by pair-feeding, which allowed mice access to the same amount of food consumed by PBS-infused mice, there was no increase in body weight. This result indicates that the increase in body weight is mainly due to hyperphagia through activation of the Y5 receptor. However, in contrast to treatment with the Y5 antagonist, the D-Trp34NPY-induced increase in adipose tissue weight was not prevented by pair-feeding, in agreement with the data that D-Trp34NPY at a dose of 1 µg/d ICV infusion tended to increase adipose tissue without hyperphagia (Fig. 2Go). Moreover, several obesity-related plasma parameters were still increased in the D-Trp34NPY-infused pair-fed group compared with the PBS-infused group. These data clearly indicate that the Y5 receptor mediates additional aspects of energy homeostasis along with feeding regulation.

Insulin is known to be an important hormonal factor influencing lipogenesis by increasing uptake of glucose and activating lipogenic and glycolytic enzymes. Chronic activation of the Y5 receptor led to an increase in the 2-h fasting plasma insulin level even in the pair-fed group. Previous studies have shown that acute central injection of NPY produces a transient increase in the plasma insulin level, indicating that insulin release might also be involved in NPY-mediated obesity (6, 7, 11, 33, 34). Our findings indicate that, at least in part, NPY-stimulated insulin release is caused by the activation of the Y5 receptor and suggest that increased plasma insulin might play one of the key roles in Y5-mediated obesity. To support this hypothesis, D-Trp34NPY significantly increased the expression of hepatic SREBP-1c mRNA in the ad libitum group and tended to increase it in the pair-fed group. SREBPs are transcription factors that regulate the expression of genes related to cholesterol and fatty acid metabolism (35, 36, 37), and SREBP-1c is thought to be a major mediator of insulin action (38). Furthermore, the D-Trp34NPY-infused pair-fed mice had a significant elevation of plasma TG level and a significant reduction of liver glycogen content. This may imply that D-Trp34NPY preferentially uses carbohydrates derived from diet for lipid synthesis, not for glycogen synthesis, and releases them as very low-density lipoprotein-TG. Thus, these changes support the hypothesis that Y5-mediated insulin secretion may evoke lipogenesis through the stimulation of the SREBP-1c pathway. However, it could be difficult to conclude from the present data whether these changes were direct or indirect effects through the activation of central Y5 receptor. Further investigation, such as comparison with acute effects of D-Trp34NPY, might be important.

Zarjevski et al. (10, 39) reported that the ICV administration of NPY resulted in a pronounced increase in insulin-stimulated glucose uptake by adipose tissue. It is noteworthy that the plasma glucose level was significantly decreased in the D-Trp34NPY-infused pair-fed group after overnight fasting. Together with increased adiposity in the D-Trp34NPY-infused pair-fed group, decreased plasma glucose might be explained by the increased uptake of glucose into WAT, as in the case of NPY. Enhanced insulin-stimulated glucose uptake by activation of the Y5 receptor may also contribute to the development of obesity.

We measured LPL and HSL activities in WAT to determine whether Y5 stimulation increases adiposity by increasing uptake of plasma TG or by decreasing the hydrolysis of stored TG in WAT. D-Trp34NPY remarkably increased the WAT LPL activity in the ad libitum-fed group, and tended to increase it in the pair-fed group by 2- to 3-fold. These changes were in accord with a previous report that chronic ICV infusion of NPY increased the LPL activity in WAT, even under the pair-fed condition (10). In contrast, HSL activity tended to be decreased in the ad libitum group and was significantly decreased in the pair-fed group. These observations in WAT suggest that Y5 activation accelerates the accumulation of TG in adipose tissue by stimulation of the uptake of plasma TG and the suppression of lipolysis in stored TG, as well as the stimulation of lipogenesis and TG secretion in liver, as mentioned before. The different levels of LPL and HSL activities between the ad libitum- and pair-fed groups were probably due to the different amounts of food intake.

D-Trp34NPY significantly decreased UCP-1 mRNA expression in BAT in both the ad libitum- and pair-fed groups. BAT is an important site of thermogenesis in rodents, and UCP-1 is a key mediator of thermogenesis in BAT. The decrease in UCP-1 mRNA expression in this experiment suggests that energy expenditure in BAT might be decreased by Y5 activation. It has been reported that centrally injected NPY decreased UCP-1 mRNA expression, sympathetic nerve activity, and thermogenesis in BAT (8, 9, 40). Hwa et al. (41) reported that ICV-injected Y5 selective agonist, D-[Trp32]NPY, decreased BAT thermogenesis and abdominal temperature in rats. The decrease of UCP-1 mRNA expression in this study is in agreement with the findings of Hwa et al. and suggest that the Y5 receptor modulates energy expenditure by controlling BAT thermogenesis in NPY-mediated obesity. Thus, decreased thermogenesis in BAT is some part of the mechanism of increased adiposity in the D-Trp34NPY-infused pair-fed group.

Because we observed an increase in adiposity without any change of body weight in the D-Trp34NPY-infused pair-fed mice, we further measured muscle weight and tissue TG and glycogen contents. Interestingly, in the pair-fed mice, muscle weight was slightly, but significantly, decreased by the D-Trp34NPY infusion, although the TG and glycogen contents were not reduced. This slight reduction of muscle weight may account for increased adiposity without a change in body weight observed in the D-Trp34NPY-infused pair-fed mice. The strong increase of lipid synthesis by D-Trp34NPY under the pair-fed condition might result in a decrease in lean mass. The imbalance of fat to lean mass, increasing adiposity, and decreasing lean mass imply the development of insulin resistance. Further studies are needed to elucidate the effects of Y5 activation on lean mass.

Herein, we have shown that chronic Y5 activation produces obesity due to increases in both energy intake and energy storage. In addition, the phenotype of Y5-mediated obesity is quite similar to that of NPY-induced obesity, which has been previously reported (5, 10, 11, 39, 42). Therefore, we conclude that the Y5 receptor plays a key role in energy homeostasis and may also play a key role in NPY-mediated obesity. However, there are some reports that Y5 antagonists had no effects on spontaneous feeding in normal and obese rats (23, 24). In addition, we have demonstrated that NPY-mediated feeding might be mainly regulated by the Y1 receptor (19, 22) and that Y1 antagonists also inhibit spontaneous feeding in rodents as well as body weight gain in Zucker fatty rats (18, 20, 21). Recently, participation of the Y2 receptor in feeding regulation has also been reported (43, 44). Therefore, NPY-mediated obesity might be regulated by multiple subtypes of NPY receptors, as in the case of feeding regulation, and physiological roles of each receptor in energy homeostasis are still controversial. Although further investigations are required to understand physiological and pathophysiological roles of the Y5 receptor in obesity, present data clearly demonstrate the possibility that the Y5 receptor is one of the key receptors in energy homeostasis.


    Acknowledgments
 
We thank Keiko Watanabe, Tomoko Iguchi, Akira Gomori, Ryuichi Moriya, Hiroko Matsusita, and Ryo Yoshimoto for technical assistance.


    Footnotes
 
Abbreviations: BAT, Brown adipose tissue; CSF, cerebrospinal fluid; FFA, free fatty acids; HDL, high-density lipoprotein; hNPY, human NPY; HSL, hormone-sensitive lipase; ICV, intracerebroventricular; LPL, lipoprotein lipase; m, mouse; NPY, neuropeptide Y; PP, pancreatic polypeptide; PYY, peptide YY; SREBP, sterol regulatory element binding protein; TG, triglyceride; UCP, uncoupling protein; WAT, white adipose tissue.

Received December 9, 2002.

Accepted for publication January 17, 2003.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Tatemoto K, Carlquisit M, Mutt V 1982 Neuropeptide Y: a novel brain peptide with structural similarities to peptide YY and pancreatic polypeptide. Nature 296:659–660[CrossRef][Medline]
  2. Tatemoto K 1982 Neuropeptide Y: complete amino acid sequence of the brain peptide. Proc Natl Acad Sci USA 79:5485–5489[Abstract/Free Full Text]
  3. Clark JT, Karla PS, Crowley WR, Karla SP 1984 Neuropeptide Y and human pancreatic polypeptide stimulate feeding behavior in rats. Endocrinology 115:427–429[Abstract/Free Full Text]
  4. Stanley BG, Leibowtz SF 1984 Neuropeptide Y: stimulation of feeding and drinking by injection into the paraventricular nucleus. Life Sci 35:2635–2642[CrossRef][Medline]
  5. Stanley BG, Kyrkouli SE, Lampert S, Leibowitz SF 1986 Neuropeptide Y chronically injected into the hypothalamus: a powerful neurochemical inducer of hyperphagia and obesity. Peptides 7:1189–1192[CrossRef][Medline]
  6. Marks JL, Waite K, Davies L 1996 Intracerebroventricular neuropeptide Y produces hyperinsulinemia in the presence and absence of food. Physiol Behav 60:685–692[Medline]
  7. Marks JL, Waite K 1996 Some acute effects of intracerebroventricular neuropeptide Y on insulin secretion and glucose metabolism in the rat. J Neuroendocrinol 8:507–513[CrossRef][Medline]
  8. Billington CJ, Briggs JE, Grace M, Levine AS 1991 Effects of intracerebroventricular injection of neuropeptide Y on energy metabolism. Am J Physiol 260:R321–R327
  9. Egawa M, Yoshimatsu H, Bray AG 1991 Neuropeptide Y suppresses sympathetic activity to interscapular brown adipose tissue in rats. Am J Physiol 260:R328–R334
  10. Zarjevski N, Cusin I, Vettor R, Rohner-Jeanrenaud F, Jeanrenaud B 1993 Chronic intracerebroventricular neuropeptide-Y administration to normal rats mimics hormonal and metabolic changes of obesity. Endocrinology 133:1753–1758[Abstract/Free Full Text]
  11. Sainsbury A, Rohner-Jeanrenaud F, Cusin I, Zakrzewska KE, Halban PA, Gaillard RC, Jeanrenaud B 1997 Chronic central neuropeptide Y infusion in normal rats: status of the hypothalamo-pituitary-adrenal axis, and vagal mediation of hyperinsulinaemia. Diabetologia 40:1269–1277[CrossRef][Medline]
  12. Parker E, Van Heek M, Stamford A 2002 Neuropeptide Y receptors as targets for anti-obesity drug development: perspective and current status. Eur J Pharmacol 440:173–187[CrossRef][Medline]
  13. Gerald C, Walker MW, Criscione I, Gustafson EL, Batzl-Hartmann C, Smith KE, Vaysse P, Durkin MM, Laz TM, Linemeyer DL, Schaffhauser AO, Whitebread S, Hofbauer KG, Taber RJ, Branchek TA, Weinshank RL 1996 A receptor subtype involved in neuropeptide-Y induced food intake. Nature 382:168–171[CrossRef][Medline]
  14. Wyss P, Stricker-Krongrad A, Brunner L, Miller J, Crossthwaite A, Whitebread S, Criscione L 1998 The pharmacology of neuropeptide Y (NPY) receptor-mediated feeding in rats characterizes better Y5 than Y1, but not Y2 or Y4 subtypes. Regul Pept 75–76:363–371
  15. Parker EM, Balasubramaniam A, Guzzi M, Mullins DE, Salisbury BG, Sheriff S, Witten MB, Hwa JJ 2000 [D-Trp34] neuropeptide Y is a potent and selective neuropeptide Y Y5 receptor agonist with dramatic effects on food intake. Peptides 21:393–399[CrossRef][Medline]
  16. Cabrele C, Langer M, Bader R, Wieland HA, Doods HN, Zerbe O, Beck-Sickinger AG 2000 The first selective agonist for the neuropeptide YY5 receptor increases food intake in rats. J Biol Chem 275:36043–36048[Abstract/Free Full Text]
  17. Kanatani A, Ishihara A, Asahi S, Tanaka T, Ozaki S, Ihara M 1996 Potent neuropeptide Y Y1 receptor antagonist, 1229U91: blockade of neuropeptide Y-induced and physiological food intake. Endocrinology 137: 3177–3182
  18. Ishihara A, Tanaka T, Kanatani A, Fukami T, Ihara M, Fukuroda T 1998 A potent neuropeptide Y antagonist, 1229U91, suppressed spontaneous food intake in Zucker fatty rats. Am J Physiol 43:R1500–R1504
  19. Kanatani A, Ito J, Ishihara A, Iwaasa H, Fukuroda T, Fukami T, Macneil DJ, Van der Ploeg LHT, Ihara M 1998 NPY-induced feeding involves the action of a Y1-like receptor in rodents. Regul Pept 75–76:409–415
  20. Kanatani A, Hata M, Mashiko S, Ishihara A, Okamoto O, Haga Y, Ohe T, Kanno T, Murai N, Ishii Y, Fukuroda T, Fukami T, Ihara M 2001 A typical Y1 receptor regulates feeding behaviors: effects of a potent and selective Y1 antagonist, J-115814. Mol Pharmacol 59:501–505[Abstract/Free Full Text]
  21. Ishihara A, Kanatani A, Okada M, Hidaka M, Tanaka T, Mashiko S, Gomori A, Kanno T, Hata M, Kanesaka M, Tominaga T, Sato N, Kobayashi M, Murai T, Watanabe K, Ishii Y, Fukuroda T, Fukami T, Ihara M 2002 Blockade of body weight gain and plasma corticosterone levels in Zucker fatty rats using an orally active neuropeptide Y Y1 antagonist. Br J Pharmacol 136:341–346[CrossRef][Medline]
  22. Kanatani A, Mashiko S, Murai N, Sugimoto N, Ito J, Fukuroda T, Fukami T, Morin N, MacNeil DJ, Van der Ploeg LHT, Saga Y, Nishimura S, Ihara M 2000 Role of the Y1 receptor in the regulation of neuropeptide Y-mediated feeding: comparison of wild-type, Y1 receptor-deficient, and Y5 receptor-deficient mice. Endocrinology 141:1011–1016[Abstract/Free Full Text]
  23. Kanatani A, Fukami T, Ishihara A, Ishi Y, MacNeil DJ, Van der Ploeg LHT, Ihara M, Anorexigenic effects of orally-active NPY antagonists: participation of Y1 and Y5 receptors in feeding behavior. 6th International NPY Conference, Sydney, Australia, 2001 (Abstract O.45)
  24. Turnbull AV, Ellershaw L, Masters DJ, Birtles S, Boyer S, Carrol D, Clarkson P, Loxham SJ, McAulay P, Teague JL, Foote KM, Pease JE, Block MH 2002 Selective antagonism of the NPY Y5 receptor does not have a major effect on feeding in rats. Diabetes 51:2441–2449[Abstract/Free Full Text]
  25. Kanatani A, Ishihara A, Iwaasa H, Nakamura K, Okamoto O, Hidaka M, Ito J, Fukuroda T, Macneil DJ, Van der Ploeg LHT, Ishii Y, Okabe T, Fukami T, Ihara M 2000 L-152, 804: orally active and selective neuropeptide Y Y5 receptor antagonist. Biochem Biophys Res Commun 27:169–173[CrossRef]
  26. Weinberg DH, Sirinathsinghji DJS, Tan CP, Shiao L, Morin N, Rigby MR, Heavens RH, Rapoport DR, Bayne ML, Cascieri MA, Strader CD, Linemeyer DL, MacNeil DJ 1996 Cloning and expression of a novel neuropeptide Y receptor. J Biol Chem 271:16435–16438[Abstract/Free Full Text]
  27. Shih MF, Taberner PV 1995 Selective activation of brown adipocyte hormone sensitive-lipase and cAMP production in the mouse by ß3-adrenoceptor agonists. Biochem Pharmacol 50:601–608[CrossRef][Medline]
  28. Picard F, Richard D, Huang Q, Deshaies Y 1998 Effects of leptin on adipose tissue lipoprotein lipase in the obese ob/ob mouse. Int J Obes 22:1088–1095
  29. Belfrage P, Vaughan M 1969 Simple liquid-liquid partition system for isolation of labeled oleic acid from mixtures with glycerides. J Lipid Res 10:341–344[Abstract]
  30. Folch J, Lees M, Stanley GHS 1957 A simple method for the isolation and purification of total lipids from animal tissues. J Biol Chem 226:497–509[Free Full Text]
  31. Carroll NH, Longley RW, Roe JH 1956 The determination of glycogen in liver and muscle by use of anthrone reagent. J Biol Chem 220:583–593[Free Full Text]
  32. Niiya T, Osawa H, Onuma H, Suzuki Y, Taira M, Yamada K, Makino H 2001 Activation of mouse phosphodiesterase 3B gene promoter by adipocyte differentiation in 3T3–L1 cells. FEBS Lett 505:136–140[CrossRef][Medline]
  33. Dunbar JC, Ergene E, Barraco RA 1992 Neuropeptide-Y stimulation of insulin secretion is mediated via nucleus tractus solitarius. Horm Metab Res 24:103–105[Medline]
  34. Wilding IPH, Kruszynska YT, Lambert PD, Bloom SR 1995 Acute effects of neuropeptide-Y injection on glucose-metabolism in fasted rats. Clin Sci (Lond) 89:543–548[Medline]
  35. Horton JD, Shimomura I, Brown MS, Hammer RE, Goldstein JL, Shimano H 1998 Activation of cholesterol synthesis in preference to fatty acid synthesis in liver and adipose tissue of transgenic mice overproducing sterol regulatory element-binding protein-2. J Clin Invest 101:2331–2339[Medline]
  36. Shimano H 2000 Sterol regulatory element-binding protein-1 as a dominant transcription factor for gene regulation of lipogenic enzymes in the liver. Trends Cardiovasc Med 10:275–278[CrossRef][Medline]
  37. Kersten S 2001 Mechanism of nutritional and hormonal regulation of lipogenesis. EMBO Rep 2:282–286[CrossRef][Medline]
  38. Foretz M, Guichard C, Ferre P, Foufelle F 1999 Sterol regulatory element binding protein-1c is a major mediator of insulin action on the hepatic expression of glucokinase and lipogenesis-related genes. Proc Natl Acad Sci USA 96:12737–12742[Abstract/Free Full Text]
  39. Zarjevski N, Cusin I, Vettor R, Rohner-Jeanrenaud F, Jeanrenaud B 1994 Intracerebroventricular administration of neuropeptide Y to normal rats has divergent effects on glucose utilization by adipose tissue and skeletal muscle. Diabetes 43:764–769[Abstract]
  40. Kotz CM, Wang CF, Briggs JE, Levine AS, Billington CJ 2000 Effect of NPY in the hypothalamic paraventricular nucleus on uncoupling proteins 1, 2, and 3 in the rat. Am J Physiol 278:R494–R498
  41. Hwa JJ, Witten MB, Williams P, Ghibaudi I, Gao J, Salisbury BG, Mullins D, Hamud F, Strader CD, Parker EM 1999 Activation of the NPY Y5 receptor regulates both feeding and energy expenditure. Am J Physiol 277:R1428–R1434
  42. Raposinho PD, Pierroz DD, Broqua P, White RB, Pedrazzini T, Aubert ML 2001 Chronic administration of neuropeptide Y into the lateral ventricle of C57BL/6J male mice produces an obesity syndrome including hyperphagia, hyperleptinemia, insulin resistance, and hypogonadism. Mol Cell Endocrinol 185:195–204[CrossRef][Medline]
  43. Naveilhan P, Hassani H, Canals JM, Ekstrand AJ, Larefalk A, Chhajlani V, Arenas E, Gedda K, Svensson L, Thoren P, Ernfors P 1999 Normal feeding behavior, body weight and leptin response require the neuropeptide Y Y2 receptor. Nat Med 5:1188–1193[CrossRef][Medline]
  44. Rachel LB, Michael AC, Caroline JS, Herbert H, Mark AC, Catherine LD, Alison MW, Audrey EB, Malcom JL, Mohammand AG, Roger DC, Stephen RB 2002 Gut hormone PYY3–36 physiologically inhibits food intake. Nature 418:650–654[CrossRef][Medline]



This article has been cited by other articles:


Home page
J EndocrinolHome page
M. Ito, A. Gomori, J. Suzuki, S. Tsujioka, M. Sasaki, M. Matsuda, M. A Bednarek, M. Ito, A. Ishihara, H. Iwaasa, et al.
Antagonism of central melanin-concentrating hormone 1 receptor alleviates steatohepatitis in mice
J. Endocrinol., August 1, 2008; 198(2): 309 - 315.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
S. T. Ruohonen, U. Pesonen, N. Moritz, K. Kaipio, M. Roytta, M. Koulu, and E. Savontaus
Transgenic Mice Overexpressing Neuropeptide Y in Noradrenergic Neurons: A Novel Model of Increased Adiposity and Impaired Glucose Tolerance
Diabetes, June 1, 2008; 57(6): 1517 - 1525.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
J. Dark and K. M. Pelz
NPY Y1 receptor antagonist prevents NPY-induced torporlike hypothermia in cold-acclimated Siberian hamsters
Am J Physiol Regulatory Integrative Comp Physiol, January 1, 2008; 294(1): R236 - R245.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
M. M. Kamiji and A. Inui
Neuropeptide Y Receptor Selective Ligands in the Treatment of Obesity
Endocr. Rev., October 1, 2007; 28(6): 664 - 684.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
S. Mashiko, A. Ishihara, H. Iwaasa, H. Sano, J. Ito, A. Gomori, Z. Oda, R. Moriya, H. Matsushita, M. Jitsuoka, et al.
A Pair-Feeding Study Reveals That a Y5 Antagonist Causes Weight Loss in Diet-Induced Obese Mice by Modulating Food Intake and Energy Expenditure
Mol. Pharmacol., February 1, 2007; 71(2): 602 - 608.
[Abstract] [Full Text] [PDF]


Home page
Phil Trans R Soc BHome page
B Beck
Neuropeptide Y in normal eating and in genetic and dietary-induced obesity
Phil Trans R Soc B, July 29, 2006; 361(1471): 1159 - 1185.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
R. Moriya, H. Sano, T. Umeda, M. Ito, Y. Takahashi, M. Matsuda, A. Ishihara, A. Kanatani, and H. Iwaasa
RFamide Peptide QRFP43 Causes Obesity with Hyperphagia and Reduced Thermogenesis in Mice
Endocrinology, June 1, 2006; 147(6): 2916 - 2922.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. Ishihara, A. Kanatani, S. Mashiko, T. Tanaka, M. Hidaka, A. Gomori, H. Iwaasa, N. Murai, S.-i. Egashira, T. Murai, et al.
A neuropeptide Y Y5 antagonist selectively ameliorates body weight gain and associated parameters in diet-induced obese mice
PNAS, May 2, 2006; 103(18): 7154 - 7158.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Mizuarai, S. Miki, H. Araki, K. Takahashi, and H. Kotani
Identification of Dicarboxylate Carrier Slc25a10 as Malate Transporter in de Novo Fatty Acid Synthesis
J. Biol. Chem., September 16, 2005; 280(37): 32434 - 32441.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Takahashi, S. Mizuarai, H. Araki, S. Mashiko, A. Ishihara, A. Kanatani, H. Itadani, and H. Kotani
Adiposity Elevates Plasma MCP-1 Levels Leading to the Increased CD11b-positive Monocytes in Mice
J. Biol. Chem., November 21, 2003; 278(47): 46654 - 46660.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mashiko, S.
Right arrow Articles by Kanatani, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mashiko, S.
Right arrow Articles by Kanatani, A.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Medline Plus Health Information
*Obesity


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals