help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tullis, K. M.
Right arrow Articles by Robins, D. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tullis, K. M.
Right arrow Articles by Robins, D. M.
Endocrinology Vol. 144, No. 5 1854-1860
Copyright © 2003 by The Endocrine Society

The Regulator of Sex-Limitation Gene, Rsl, Enforces Male-Specific Liver Gene Expression by Negative Regulation

Kathryn M. Tullis, Christopher J. Krebs, Janet Y. M. Leung and Diane M. Robins

Department of Human Genetics, University of Michigan Medical School, Ann Arbor, Michigan 48109-0618

Address all correspondence and requests for reprints to: Diane M. Robins, Department of Human Genetics, University of Michigan Medical School, Ann Arbor, Michigan 48109-0618. E-mail: drobins{at}umich.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Expression of a broad array of proteins is sexually dimorphic in rodent liver, dependent on sex-specific patterns of GH secretion. Mice carrying rsl (regulator of sex limitation) alleles, discovered as trans-acting loci affecting the mouse sex-limited protein (Slp) gene, reveal an additional axis in male-specific gene regulation. Slp expresses in adult males, but in rsl homozygous mice, Slp is also expressed in females. In this study, we examined congenic rsl strains to determine rsl’s site of action, breadth of targets, and interaction with hormonal induction. We show that rsl affects Slp in liver, but not kidney, and that Rsl acts on a spectrum of male-specific liver genes, including mouse urinary proteins and a cytochrome P450 expressed predominantly by males, Cyp 2d-9, but does not act on the female-prominent P450, Cyp 2a-4. Slp expression in hypophysectomized or Tfm/Y rsl mice reveals that Rsl action is independent of GH or androgen signaling. Further, parabiosis of Rsl and rsl mice does not alter expression patterns, consistent with rsl action being liver intrinsic. Finally, Slp expression initiates earlier in rsl mice, suggesting that Rsl operates before, as well as independently of, hormonal induction. This characterization suggests Rsl functions to repress transcription of a set of genes that have in common their hormonal induction in male liver, and thus accentuates sexual dimorphism of liver gene expression.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
AN INTRIGUING PARADIGM in which to dissect the complex interplay of hormonal, developmental, and tissue-specific control of gene expression is provided by sexual dimorphism in the liver (1). In rodents, distinct male and female patterns of hepatic gene expression occur for several cytochrome P450s that are involved in steroid and drug metabolism, as well as for some proteins that function in reproduction, directly via maintenance of pregnancy and indirectly via pheromone communication pathways (2). This sexual dimorphism initiates at puberty and is dependent on gonadal steroids acting on the pituitary to direct sex-specific patterns of GH release (3, 4, 5). The male GH secretory pattern has peaks of high amplitude with troughs of several hours in which GH is essentially undetectable in serum. In females, the pulses are more frequent and lower in amplitude, resulting in the continuous presence of GH. High peaks and long troughs of GH activate the transcription factor STAT5b, which induces the male-specific protein expression profile in liver (6, 7). In STAT5b null mice, it is apparent that the same signal that induces male-specific hepatic genes also represses female-specific liver genes in males (8). Thus, sex-specific patterns of gene expression are established and maintained by negative as well as positive regulatory mechanisms.

The mouse sex-limited protein (Slp) gene is also dimorphic in expression and allows genetic analysis based on the rich variety of cis- and trans-acting alleles existing in inbred mouse strains. Slp arose as a duplication of the complement component gene C4, with which it retains greater than 95% identity (9, 10). Unlike C4, Slp is normally expressed only in mature males, suggesting androgen dependence, and has diverged in function in the immune system (11, 12, 13). The androgen dependence of Slp occurs by the direct action of androgen receptor (AR) on the gene in kidney, but in liver androgen acts indirectly by controlling GH release from the pituitary (14, 15). Direct molecular measurements, and the existence of cis-acting Slp alleles with altered regulation, demonstrate that Slp’s induction is transcriptional (16, 17). Trans-acting mutations further clarify tissue-specific distinctions in Slp regulation. For example, AR-deficient mice (Ar-, or Tfm, testicular feminization) do not express Slp but can be made to do so in liver by pulsatile GH administration (14).

Evidence that repression as well as induction is required for sexually dimorphic Slp expression is found in mice homozygous for rsl (regulator of sex limitation) alleles. In these mice, Slp expression initiates in females, as well as in males, at puberty (18). Inbred strains of rsl mice (e.g. FM and PL/J) appear otherwise normal, and the loss of sex limitation of Slp is recessive to Rsl alleles. Measurement of Slp serum levels in congenic rsl strains indicates that Slp expression is increased in rsl males as well, by an amount similar to that observed in females (19). Because rsl is recessive and its effect is to increase expression of its target gene, it is likely that the Rsl gene product functions, at some level, to repress Slp synthesis. This repression appears to operate in both sexes but is overcome in males by hormonal induction at puberty.

As a prelude to our positional cloning of Rsl (20), we characterized the breadth of Rsl’s effects and how its mechanism of action interfaced with hormonal regulation. We found that Rsl affects Slp in liver but not kidney, suggesting tissue specificity of Rsl regulation. Further, female expression of other male-specific liver genes occurs in rsl mice, including mouse urinary proteins (MUPs) and members of the P450 family. Rsl regulation is independent of the hormonal induction of its target genes because homozygosity for rsl allows expression of Slp in mice lacking GH or androgen signaling (due to hypophysectomy or genetic deficiency, respectively). Further, Rsl action occurs before hormonal induction. In sum, this exploration reveals a novel repression conferred by Rsl that operates in both sexes on male-specific liver genes. While not itself hormone dependent, Rsl’s action serves to accentuate gender differences in hepatic gene expression in mice.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animals and treatments
B10.D2nSn/J and Tfm carrier mice were obtained from The Jackson Laboratory (Bar Harbor, ME). The congenic B10.D2.PL(1)-rsl and B10.D2.FM-rsl strains were a generous gift of Dr. Raymond Miller (Washington University). B10.D2.PL(1)-rsl mice were rederived by embryo transfer at the University of Michigan Transgenic Mouse Core Facility and maintained in the Department of Human Genetics animal facility. To generate rsl/Tfm mice, female carriers of Tfm (Ar-/Ar+) were crossed to B10.D2. PL(1)-rsl males. All agouti female progeny were typed by PCR for the Y chromosome with primers for the SRY gene: TGCAGCTCTACTCCAGTCTTG (forward) and AGATCTTGATTTTTAGTGTTX (reverse). XX females were crossed to B10.D2.PL(1)-rsl males. All F2 progeny were genotyped by PCR for the presence of the Y-chromosome and for rsl using D13Mit253 microsatellite markers as described (19).

All animal experimentation was performed in accord with the NIH Guidelines for Care and Use of Experimental Animals. Hypophysectomy was performed in the University of Michigan Laboratory for Animal Medicine, using protocols approved by the University Committee on Use and Care of Animals. Following surgery, survivors received 5% sucrose in their drinking water until they were killed 2–3 wk later. For parabiosis, Rsl and rslPL females were surgically conjoined at 6 wk of age using a modified Bunster-Meyer procedure (21). Following recovery, mice were fed ad libitum and housed for 3 wk. At the time the rats were killed, 200 µl of blood were collected from each heart and DNA isolated using the QIAmp Blood kit (QIAGEN, Valencia, CA). Thirty cycles of PCR using 32P-labeled primers for D13Mit253 were performed, and products were separated on an 8% sequencing gel and visualized by autoradiography.

Ribonuclease (RNase) protection assays
RNA was prepared as previously described (15) using the RNasol method (22). In cases where organs were pooled from several animals, multiple independent pools were examined; in most cases, individual animals were assessed, with at least three examined per point. Ten micrograms of total RNA were assayed per liver sample. To adjust for lower Slp expression in kidney where Slp is only expressed in the proximal convoluted tubules, compared with broader as well as more abundant expression in liver, 30 rather than 10 µg of RNA were assayed and autoradiogram exposures were for 3 d rather than 16 h. Synthesis of the Slp riboprobe and RNase protection were performed as described (23). Actin riboprobes were transcribed from the pTRI-B-actin plasmid (Ambion, Inc., Austin, TX) using the T7 promoter.

Northern blotting
RNA was denatured by heating in formaldehyde-formamide, fractionated through agarose gels containing 6% formaldehyde and transferred to Zetaprobe-GT membranes (Bio-Rad Laboratories, Inc., Hercules, CA). Filters were hybridized to a random-primed probe (Cyp 2d-9, Cyp 2a-4, RPL19) under standard conditions. For MUP detection, gene-specific oligonucleotides were end-labeled with 32P and hybridized in (5x sodium chloride/sodium citrate; 20 mM Na2HPO4; pH 7.2; 7% sodium dodecyl sulfate; 1x Denhardt’s) at 45 C and washed in 1x sodium chloride/sodium citrate at 45 C (24).

Probes for Northerns were as follows; MUP gene-specific oligonucleotide probes were synthesized by the University of Michigan DNA Core Facility. MUPs I and II: 5' GAGCACTCTTCATCTCTTACAGT; MUP III: 5' TCGCAGTCATTTCGGTGC (25). Cyp 2d-9, Cyp 2a-4, and RPL19 were synthesized by RT-PCR from B10.D2 liver mRNA using the following primers: Cyp 2d-9-5' AAGAATACCATAGACTCCAGA (forward) and 5' GTGGTCCGTGACCTGTTTGG (reverse); Cyp 2a-4-5' CTCTCTCATGAAGATCAGCC (forward) and 5' ATTGTGTTCCACTTTCTTGG (reverse): RPL19-5' CTGAAGGTCAAAGGGAATGTG (forward) and 5' GGACAGAGTCTTGATGATCTC (reverse). Identity of PCR products was confirmed by restriction enzyme mapping. Products were gel purified and subcloned into pGemTA (Promega Corp., Madison, WI) and a SacII-SalI fragment used as probe.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The effect of rsl on Slp expression is liver specific
The unusual presence of Slp protein in sera of female mice led to the initial description of the rsl phenotype (18). More recent analysis using congenic mouse strains showed that there is also about 50% more Slp in serum from male B10.D2.PL(1)-rsl (rslPL) than B10.D2 (Rsl) mice, an increment equivalent to the Slp levels observed in rslPL females (19). To determine the molecular basis of this increase, we examined Slp mRNA expression in liver, the primary source of serum Slp protein, and in kidney. RNase protection assays used a 200-nucleotide Slp riboprobe that also hybridizes to the homologous C4 but is cleaved at a central region of mismatch, producing fragments of 85 and 95 bases in length (see Fig. 1Go) (23). In Fig. 1Go, liver mRNA levels in B10.D2 mice, where Slp expression is limited to males, was compared with expression in the two congenic strains, B10.D2.PL-rsl and B10.D2.FM-rsl (referred to as rslPL and rslFM, respectively). Both these strains express Slp in females but at different levels, which is likely due to distinct rsl alleles originating from the different strains. Quantitation by PhosphorImager (Molecular Dynamics, Sunnyvale, CA) analysis of multiple independent experiments showed that rslPL female expression ranged from 45–60% of B10.D2 male levels. The rslFM female level was substantially less than the rslPL female level, but readily detected compared with Rsl females. PhosphorImager analysis also corroborated data from serum that Slp expression increases about 2-fold in rslPL compared with Rsl males. The increase in rsl gene expression in males is more evident for other targets (see below). In contrast to the marked effect on Slp, there was no effect on C4 (Fig. 1AGo), actin or RPL19 (see below), indicating target gene selectivity of rsl action.



View larger version (31K):
[in this window]
[in a new window]
 
Figure 1. rsl Affects Slp expression in mouse liver, but not kidney. RNA was isolated from tissues of three males and three females of homozygous B10.D2 (Rsl) mice and congenic B10.D2.PL(1)-rsl (rslPL) and B10.D2.FM-rsl (rslFM) strains, and assayed by RNase protection as in Materials and Methods. A, RNase protection assays were performed on 20 µg total liver RNA. Bands representing RNase-digested products of the riboprobe hybridized to Slp or C4 transcripts are indicated to the left of the autoradiogram. B, RNase protection assays were performed on 30 µg total RNA isolated from kidneys pooled from three each Rsl, rslPL, and rslFM mice of both sexes, with probes for both Slp, and actin, to control for loading.

 
In striking contrast to liver, there was no apparent effect of rsl on Slp expression in kidney (Fig. 1BGo). Females bearing either rsl allele did not show Slp expression greater than the few percent of male expression that also occurs in Rsl female kidney (23). Therefore, the rsl relief of sex limitation of Slp expression occurs in liver, but not in kidney, revealing a cell-specific control additional to distinctions in hormonal induction in these tissues.

The rsl pathway regulates MUPs as well as Slp, and male- but not female-specific P450s
The dramatic effect of the rsl alleles on Slp expression led us to question whether genes under similar hormonal control were also affected. We first examined members of the MUP (mouse urinary protein) gene family, which are thought to function as pheromone carriers upon excretion (26). Some MUPs are abundantly expressed in male liver, where, like Slp, their androgen dependence is GH-mediated (27). We probed Northern blots with oligonucleotides that distinguish members of this highly homologous family; one probe recognizes two male-specific RNAs (MUP I and II) and the other is specific for MUP III (24, 25). A single Northern filter, containing 10 µg total RNA per lane, except for 2 µg polyA+ RNA in the two leftmost lanes, was probed first for RPL19, a ribosomal protein mRNA, to allow normalization of samples, and then sequentially with the MUP oligonucleotides (Fig. 2Go). In the B10.D2 Rsl mice, MUPs I and II are 4-fold, and MUP III 12-fold, more abundant in males than females by PhosphorImager analysis. The rsl alleles in the congenic B10.D2 background increased MUP expression in females, and also clearly in males, as for Slp. Interestingly, there were differential effects on the different MUP genes. Comparing female to male expression within each strain, the rslFM allele appeared to more greatly affect MUP III than MUP I and II, whereas the rslPL allele more strongly effected MUPs I and II. These differences could be due to biological variation in MUP gene expression or to allelic variation in these strains.



View larger version (64K):
[in this window]
[in a new window]
 
Figure 2. Male-specific MUPs and Cyp 2d-9, but not the female-prominent Cyp 2a-4, express at higher levels in liver of rsl mice. Liver RNAs (pooled from three mice per sample) from the congenic Rsl, rslPL, and rslFM mice were fractionated on a 1% agarose denaturing gel. RNAs were transferred to a ZetaProbe (Bio-Rad Laboratories, Inc.) membrane, and the filter hybridized first with a probe for RPL19 to allow normalization of samples, and then hybridized sequentially with oligonucleotides complementary to MUP I and II, and MUP III, followed by cDNA probes for Cyp 2d-9 and then Cyp 2a-4. The first two lanes contain 2 µg poly A+ RNA (for greater visualization of female MUP expression) with 10 µg total RNA in the other lanes.

 
Other genes known to be sensitive to the pattern of GH secretion and expressed in sex-specific and strain-specific patterns in liver include several cytochrome P450s (3, 28). We found steroid 16{alpha}-hydroxylase (Cyp 2d-9) mRNA was present at a few-fold higher levels in male than female B10.D2 mice, using a probe derived by RT-PCR from the cDNA sequence (29) hybridized to the same Northern filter as previously (Fig. 2Go). In the rsl mice, both males and females showed increased levels of Cyp 2d-9 RNA (Fig. 2Go), suggesting this gene is also an rsl target. In contrast, the female-prominent Cyp 2a-4 gene, encoding 15{alpha}-hydroxylase, was unaffected by rsl. Therefore, Rsl targets appear to include male-specific but not female-specific hepatic genes.

Rsl regulation is not dependent on GH secretory pattern or amount
Characterization thus far suggested that Rsl intersects a regulatory pathway common to male-specific liver genes. A possible basis for the rsl phenotype was acquisition by these mice of an altered pattern of GH release. In particular, it was conceivable that rsl females secreted GH with a pulse pattern that induced the male-specific hepatic target genes. However, the male-specific GH pulse also represses expression of female-specific liver genes in males (8), and, as shown in Fig. 2Go, expression of female-specific Cyp 2a-4 was not reduced in female rsl mice. Further, GH pulsatile secretion in males accounts for their greater postpuberal size than females, as shown by partial dwarfing of male STAT5b null mice that cannot transduce the GH pulse signal (8). In contrast, there was no effect on growth in either sex of rsl mice: Rsl and rslPL mice were identical in sex-specific rate of growth and size attained (data not shown).

To test not only the secretory pattern but any involvement of GH in the rsl effect, mice were hypophysectomized and expression of the Slp target gene examined after 2 and 3 wk, by which time Slp is undetectable in wild-type hypophysectomized mice (14, 15). Male mice were used, in part to allow loss of Slp expression in kidney, where rsl had no impact (Fig. 1Go), to serve as an internal control for efficacy of pituitary ablation. In addition, reduction of GH was monitored after surgery by decreased MUP protein in urine assayed by SDS-PAGE (not shown), and after they were killed, by diminished IGF-I mRNA in liver (see Fig. 3Go). As shown in Fig. 3Go, Slp expression determined by RNase protection was absent 2 wk after hypophysectomy in Rsl mice, but in rslPL mice was sustained at about 20% of the intact male level (by PhosphorImager analysis), even 3 wk post surgery. Slp mRNA levels in kidney were depleted in all hypophysectomized animals used for analysis. Reduced levels of IGF-I mRNA were used to corroborate successful pituitary ablation because GH enhances IGF-I gene expression (30). In Rsl mice, IGF-I mRNA was decreased 2- to 3-fold 2 wk after surgery; in rsl mice, the IGF-I decline was substantially more dramatic. This suggested that in the absence of a pituitary factor, IGF-I was sustained to a greater extent in Rsl than rsl mice. Regardless of the relative difference in IGF-I level, reduction of IGF-I mRNA correlated with hypophysectomy. Hypophysectomy did not affect C4 or actin levels in either tissue. Therefore, the mechanism by which rsl alleles lead to Slp expression is not dependent on pulsatile GH secretion, and in fact, has no stringent requirement for any pituitary factor.



View larger version (20K):
[in this window]
[in a new window]
 
Figure 3. The rsl component of Slp expression does not require GH. Liver and kidney RNAs were prepared from individual mice that were intact (-) or 2 or 3 wk (2w, 3w) after hypophysectomy (Hx). Slp and C4 mRNAs were assayed by RNase protection as before, and IGF-I and actin were assayed similarly with probes described in Materials and Methods. Liver and kidney samples from the same mice are in the same lane order on the panels displaying the relevant protected fragments after RNase digestion.

 
Rsl regulation does not require AR or prominent circulating factors
Early description of the rsl phenotype showed that Slp was expressed in rsl mice even in the absence of androgen receptor (Tfm, Ar-; Ref. 18). This suggested that the rsl effect on Slp expression was independent of the normal hormonal induction of the gene, which depends on androgen to elicit pulsatile GH secretion in males (14). To confirm that rsl was androgen as well as GH independent, and to extend this observation to the molecular level in congenic strains, we generated Tfm/Y mice in the rslPL background, and examined liver Slp mRNA expression (Fig. 4Go). Among the parental and backcross second generation mice, Slp was expressed in all males and in females homozygous for rsl, as expected. Slp mRNA was also present at about 50% of the B10.D2 Rsl male level in livers of Tfm/Y mice homozygous for rsl, in contrast to no expression in Tfm/Y mice that have at least one Rsl allele. As expected, Slp was not expressed in kidney of Tfm/Y mice, whether homozygous or heterozygous for rsl (not shown). This confirms at the molecular level that the rsl component of Slp expression is independent of functional AR.



View larger version (49K):
[in this window]
[in a new window]
 
Figure 4. The rsl component of Slp expression is independent of AR function. RNase protections were performed on 20 µg of total RNA from livers of Rsl (B10.D2) and rslPL strains and individual progeny from the Tfm carrier (Rsl) X rslPL backcross (see Materials and Methods). The first four lanes are RNA samples from the parental strains. Backcross progeny in the right six lanes are either rsl homozygotes or Rsl/rsl heterozygotes, and 25% are Tfm/Y. Slp- and C4-protected fragments are indicated at left.

 
Ruling out GH and AR dependence of rsl lent support to the idea that rsl functions autonomously in the liver. To examine cell-intrinsic vs. -extrinsic activity of rsl, we tested for possible humoral transmission of a circulatory factor involved in rsl regulation in surgically conjoined animals. Parabiosis is a classic method to distinguish whether a syndrome is due to a defect in a signaling factor or in its receptor (31, 32). Fusing the circulatory systems of female Rsl and rsl mice might reveal whether Rsl in one could extinguish Slp expression in the other. Extinction of Slp would support a cell-extrinsic mode of Rsl action, whereas no change in Slp level in either female (absent in Rsl, present in rsl) would favor a liver-intrinsic mode of Rsl action. Two parabiont pairs were killed 3 wk after surgery and Slp mRNA assayed (Fig. 5Go). Whereas 2 wk suffice to eliminate Slp by hypophysectomy or castration in males, or to induce Slp in females treated with androgen, there was no change in Slp levels following parabiosis. Circulatory mixing was qualitatively demonstrated by the presence of cells of both genotypes in heart blood, using microsatellite markers that distinguish Rsl and rsl alleles. Whereas critical concentrations of a putative factor might be difficult to attain following parabiosis, particularly if such a factor is short-lived, this result nevertheless supports the idea that Rsl acts autonomously in the liver and is not dependent on long-lived circulatory factors readily transmissable in serum.



View larger version (46K):
[in this window]
[in a new window]
 
Figure 5. Slp expression is not altered following parabiosis. Rsl and rslPL females were surgically conjoined at 6 wk using the modified Bunster-Meyer proceedure and analyzed after 3 wk. A, Parabiont pair of a B10.D2 (Rsl) female (black) and a B10.D2.PL-rsl (rslPL) female (white); an arrow marks the suture line. B, RNase protection assays for Slp and C4 were performed as before on 20 µg of total RNA from the liver of each parabiont partner. C, Blood from each parabiont partner was collected from the heart at the time they were killed and DNA typed for the D13Mit253 microsatellite marker that distinguishes Rsl and rsl alleles. PCR products using 32P-primers were separated on an 8% sequencing gel and visualized by autoradiography.

 
Rsl action initiates before hormonal induction
Because rsl alleles are strictly recessive, and the homozygous phenotype is manifested by increased expression of target genes, Rsl most likely functions in gene repression. Thus, it is curious that in rsl mice, where repression is apparently lost, Slp expression is detected only in adults and not also in immature mice (18). To examine this in greater detail, we assayed Slp expression by RNase protection in livers of mice 2–8 wk of age (Fig. 6Go), using two to three mice per point, in each of two independent experiments. Slp mRNA was undetectable in Rsl females in these assays, as expected (not shown). Slp became evident at 5 wk of age in Rsl males, accumulating rapidly thereafter. There was no Slp mRNA at 2 wk in either sex of rsl mice, but by 3 wk of age, before weaning, Slp expression was apparent in both sexes, and attained maximal levels by 5 wk. When Slp mRNA was normalized to C4 levels, which do not vary with age, sex, or Rsl genotype, the rate of accumulation appeared similar in the two strains, but initiated at least 2 wk earlier in the rsl mice. This suggests that the repression normally enforced by Rsl, and revealed by Slp expression due to absence of repression in rsl mice, begins to act at around 3 wk, before the GH induction that occurs in males later in puberty. Thus Rsl is temporally, as well as mechanistically, independent of the hormonal induction of the male-specific liver genes.



View larger version (28K):
[in this window]
[in a new window]
 
Figure 6. Slp expression begins earlier in rsl than in Rsl mice. A, RNase protection assays were performed on 20 µg of total RNA from two to three livers of mice of each age, strain, and sex, as noted. The Slp-protected fragments are shown. The 6-wk rsl female time point was underloaded as judged by reduced C4 signal as well (not shown).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Rsl was discovered as a modifier locus for Slp gene regulation because mice homozygous for rsl variant alleles express sex-limited protein at puberty in females, as well as in males (18). Because rsl mice otherwise seem normal, we suspected that Rsl’s effect might be restricted to liver, rather than reflect a more pleiotropic hormonal defect, and that Rsl might affect the broad array of genes that, like Slp, are regulated in sexually dimorphic patterns in liver. Using mouse strains developed by Dr. Raymond Miller that are congenic for two different rsl alleles (19), we show here that Rsl is liver-restricted in action because Slp expression in kidney is unaffected, and acts on several male-specific, but not female-specific, hepatic genes. Further, the rsl regulation of male-specific liver genes is independent of their hormonal induction, initiating at an earlier stage in development and requiring neither pituitary function nor AR signaling. The critical role of Rsl in maintaining sexually dimorphic liver gene expression is only revealed by this characterization of rsl mice, in which female liver dimorphism is largely abolished. This exemplifies the value of mouse mutants in unveiling novel regulatory pathways.

The pathway in which Rsl acts can be grossly described from the present analysis, and is confirmed by our recent identification of the gene product as a KRAB zinc finger protein (20). Firstly, that pathway is directly involved in gene regulation. Noted as a trans-acting locus affecting Slp, Rsl affects the expression of a set of genes that, like Slp, are induced in male liver at puberty. In male kidney, expression of Slp is directly induced by androgen and its receptor, but in liver, Slp induction by androgen is indirect, exerted via gonadal control of pulsatile GH secretion from the pituitary (summarized in Fig. 7AGo; Refs. 14, 15). As shown in this study, homozygous rsl alleles lead to high levels of Slp mRNA in females, in liver but not in kidney. Similarly higher expression occurs in males as well as in females, for the spectrum of male-specific liver genes. Because rsl increases gene expression of the targets, and because there is no such increase in heterozygous Rsl/rsl mice, the wild-type Rsl likely functions, at some level, in repression of male-specific liver genes. The alternative, that rsl encodes an activator absent in Rsl mice, is unlikely because of the lack of effect in heterozygotes.



View larger version (27K):
[in this window]
[in a new window]
 
Figure 7. Summary of regulatory axes involved in male-specific Slp expression. A, Androgen induces Slp expression directly in kidney, although maximal expression requires GH and T3. In liver, androgen acts indirectly to induce male-specific gene expression, by eliciting pulsatile GH secretion from the pituitary. Rsl provides an additional control, independent of androgen or GH, that represses male-specific genes in liver in both sexes. B, At the mechanistic level, genes such as Slp that express predominantly in male liver are largely induced by pulsatile GH activation of the Stat5b pathway. As seen by increased target gene expression in rsl variant mice, Rsl repression and GH hormonal induction operate simultaneously in adults—loss of repression in rsl mice is additive to induced expression. Repression may or may not operate at a distinct regulatory site; it is shown here as intermediate to a hormone-responsive enhancer and the target gene’s promoter simply to allow visualization of the independent nature of these regulatory influences.

 
A second feature of the Rsl pathway supported by this study is that the repression of target gene expression acts directly at the transcriptional level (see Fig. 7BGo). Slp induction at puberty occurs by increased mRNA synthesis, as shown in nuclear run-on assays where Slp initiation in Rsl females is 1/50th the rate in males, paralleling steady-state RNA levels (17). In addition, some alleles of Slp are constitutively expressed due to recombination placing C4 regulatory sequences before Slp coding regions (16, 33). This implies that sequences required for male expression reside in the 5' flank, as corroborated by identification of an upstream enhancer responsive to androgen and binding sites for STAT5b, the transducer of the pulsatile GH signal (17, 34, 35). Thus, posttranscriptional effects, including message stabilization and translational control, are unlikely to account for expression in rsl mice. Further, a posttranscriptional mechanism for rsl action should produce detectable expression in Rsl/rsl mice, but this is not seen. Therefore, evidence suggests that Rsl dictates transcriptional repression of the set of genes that, in mice, are male specific in liver. Some promoter/enhancer elements appear to be common to male-specific hepatic genes, including some of the targets examined here (e.g. Refs. 17, 36, 37), and may be candidates for an Rsl "silencer" site.

A third intriguing feature of the Rsl pathway is that, although apparently critical for sexually dimorphic gene expression, Rsl itself does not appear dependent on either pituitary or androgen regulation. Although GH and AR are not required for Rsl regulation, there still may be some hormonal control involved in the effect. This could explain lower Slp levels sustained in rsl mice that are hypophysectomized compared with those that are Tfm/Y. Alternatively, strain differences in additional loci that modify Slp expression could influence this quantitative difference. In addition, the decrease in IGF-I expression following hypophysectomy is much greater in rsl than Rsl mice, suggesting a possible positive effect of Rsl on IGF-I level, but only in the presence of GH. As a test for unidentified hormones that might be required for Rsl regulation, we performed parabiosis to determine whether such factors could be exchanged through the circulation. Parabiosis is a classic means to distinguish whether a genetic defect resides in a hormone or its receptor, and provided a crucial foundation for the discovery of leptin (31, 38). The lack of alteration of Slp expression following parabiosis does not rule out any hormonal control, but is consistent with Rsl functioning in a liver-intrinsic manner.

A paradox is why target gene expression is not seen before puberty in rsl mice, where absence of repression seems sufficient to account for expression in adults. This suggests that Rsl itself may be regulated during maturation in some manner that is not dependent on the same factors that induce the target genes. This is supported by initiation of Slp expression very early in puberty in rsl mice, compared with relatively late in puberty in Rsl mice. Thus, the Rsl repression mechanism begins to operate well before hormonal induction of the target genes, and continues to operate simultaneously with induction in males. It may be that a general and global repression silences the target genes before puberty, and only once the general repression is removed can either specific induction or repression be observed.

The transcriptional repression dictated by Rsl operates on male-specific liver genes in both sexes, but is overridden by hormonal induction in males. In rsl mice, repression is relieved and target gene expression increases during puberty in both sexes, even without hormonal induction (as in female, Tfm, or hypophysectomized mice) and to an even greater extent in males where induction and lack of repression are additive. This demonstrates that Rsl normally functions to enforce and refine sexually dimorphic gene expression. Given the evolutionary conservation of genomes, particularly for regulatory networks, it is likely that Rsl has human counterparts, which may be involved in repression of a similar set of target genes. In humans, the P450s exhibit genetic and regulatory variation that may enter into many aspects of steroid and drug metabolism. Although sexually dimorphic expression of particular P450s is less well studied in humans than in rodents, there are numerous examples of drugs that are metabolized differently in men and women, as well as other aspects of liver pathology that differ between the sexes (39, 40, 41, 42). Rsl may shed light on these syndromes and also may be more broadly informative to liver function because it is the rodent target genes, and not Rsl itself, that is gender specific. These studies establish a foundation for future studies of Rsl, which may provide unique insights into basic mechanisms of tissue- and gene-specific transcriptional repression.


    Acknowledgments
 
The authors thank Dr. Raymond Miller for the generous gift of the rsl congenic mice and advice on the project. Dr. Richard Behringer encouraged us to try parabiosis, for which we thank Dr. Peter L. Smith for performing the surgery. Janet Hoff, with the support of Dr. Howard Rush, from the University of Michigan Laboratory of Animal Medicine, performed the hypophysectomy. We thank Drs. Eva Derman and Erin Schuetz for discussions on MUPs and sex-specific P450s, respectively, Jessica Schwartz for advice on GH regulation, and Ron Koenig and Ormond MacDougald for comments on the manuscript. Irina Elterman helped assay the developmental expression of Slp.


    Footnotes
 
K.T. was supported by NIH training grants to the Endocrine and Metabolism Division and the Reproductive Sciences Program of the University of Michigan. This work was supported by NIH Grants R01-DK-53998, P30-DK-34933, and P60-DK-20572.

Abbreviations: AR, Androgen receptor; C4, fourth component of complement; MUP, mouse urinary protein; RNase, ribonuclease; rsl, regulator of sex limitation; Slp, sex-limited protein.

Received December 23, 2002.

Accepted for publication January 28, 2003.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Gustafsson J-A, Mode A, Norstedt G, Skett P 1983 Sex steroid induced changes in hepatic enzymes. Ann Rev Physiol 45:51–60[CrossRef][Medline]
  2. Roy AK, Chatterjee B 1983 Sexual dimorphism in the liver. Ann Rev Physiol 45:37–50[CrossRef][Medline]
  3. Lund J, Zaphiropoulos PG, Mode A, Warner M, Gustafsson J-A 1991 Hormonal regulation of cytochrome P450 gene expression. Adv Pharmacol 22:325–354
  4. Mode A, Tollet P, Strom A, Legraverand C, Liddle C, Gustafsson J-A 1992 Growth hormone regulation of hepatic cytochrome P450 expression in the rat. Advan Enzyme Regul 32:255–263[CrossRef][Medline]
  5. Shapiro BH, Agrawal AK, Pampori NA 1995 Gender differences in drug metabolism regulated by growth hormone. Int J Biochem Cell Biol 27:9–20[CrossRef][Medline]
  6. Waxman DJ, Ram PA, Park S-H, Choi HK 1995 Intermittent plasma growth hormone triggers tyrosine phophorylation and nuclear translocation of a liver-expressed, STAT 5-related DNA binding protein. J Biol Chem 270:13262–13270[Abstract/Free Full Text]
  7. Gebert CA, Park SH, Waxman DJ 1997 Regulation of signal transducer and activator of transcription (STAT) 5b activation by the temporal pattern of growth hormone stimulation. Mol Endocrinol 11:400–414[Abstract/Free Full Text]
  8. Udy GB, Towers RP, Snell RG, Wilkins RJ, Park SH, Ram PA, Waxman DJ, Davey HW 1997 Requirement of STAT5b for sexual dimorphism of body growth rates and liver gene expression. Proc Natl Acad Sci USA 94:7239–7244[Abstract/Free Full Text]
  9. Shreffler DC 1982 MHC-linked complement components. In: Parham P, Strominger J, eds. Histocompatibility antigens: structure and function (receptors and recognition, Series B). London: Chapman and Hall; 187–219
  10. Chaplin DD, Woods DE, Whitehead AS, Goldberger G, Colten HR, Seidman JG 1983 Molecular map of the murine S region. Proc Natl Acad Sci USA 80:6947–6951[Abstract/Free Full Text]
  11. Ogata RT, Sepich DS 1985 Murine sex-limited protein: complete cDNA sequence and comparison with murine fourth complement component. J Immunol 135:4239–4244[Abstract]
  12. Hemenway C, Kalff M, Stavenhagen J, Walthall D, Robins DM 1986 Sequence comparison of the fourth component of complement (C4) and sex-limited protein (Slp). Nucleic Acids Res 14:2539–2554[Abstract/Free Full Text]
  13. Beurskens FJ, Tosi M, Shiroishi T, Robins DM, Carroll M, van Dijk H 2000 Mouse complement components C4 and Slp act synergistically in a homologous hemolytic C4 assay. Eur J Immunol 30:1507–1511[CrossRef][Medline]
  14. Georgatsou E, Bourgarel P, Meo T 1993 Male-specific expression of mouse sex-limited protein requires growth hormone, not testosterone. Proc Natl Acad Sci USA 90:3626–3630[Abstract/Free Full Text]
  15. Nelson SA, Robins DM 1997 Two distinct mechanisms elicit androgen-dependent expression of the mouse sex-limited protein gene. Mol Endocrinol 11:460–469[Abstract/Free Full Text]
  16. Stavenhagen JB, Loreni F, Hemenway C, Kalff M, Robins DM 1987 Molecular genetics of androgen-dependent and independent expression of mouse sex-limited protein. Mol Cell Biol 7:1716–1724[Abstract/Free Full Text]
  17. Varin-Blank N, Dondi E, Tosi M, Hernandez C, Boucontet L, Gotoh H, Shiroishi T, Moriwak K, Meo T 1998 Male-specific transcription initiation of the C4-Slp gene in mouse liver follows activation by STAT5. Proc Natl Acad Sci USA 95:8750–8755[Abstract/Free Full Text]
  18. Brown LJ, Shreffler DC 1980 Female expression of the H-2 linked sex-limited protein (Slp) due to non-H-2 genes. Immunogenetics 10:19–29[CrossRef][Medline]
  19. Jiang PP, Frederick K, Hansen TH, Miller RD 1996 Localization of the mouse gene releasing sex-limited expression of Slp. Proc Natl Acad Sci USA 93:913–917[Abstract/Free Full Text]
  20. Krebs CJ, Larkins L, Price R, Tullis K, Robins DM, The mouse Rsl gene encodes a KRAB zinc finger repressor protein critical for sexually dimorphic liver gene expression. Program of the 84th Annual Meeting of The Endocrine Society, San Francisco, CA, 2002, p 65 (Abstract OR 1-1)
  21. Bunster E, Meyer RK 1933 An improved method of parabiosis. Anat Rec 57:339–343[CrossRef]
  22. Chomczynski P, Sacchi N 1987 Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162:156–159[Medline]
  23. Cox BJ, Robins DM 1988 Tissue specific variation in C4 and Slp gene regulation. Nucl Acids Res 16:6857–6870[Abstract/Free Full Text]
  24. Shahan K, Denaro M, Gilmartin M, Shi Y, Derman E 1987 Expression of six mouse major urinary protein genes in the mammary, parotid, sublingual, submaxillary, and lachrymal glands and in the liver. Mol Cell Biol 7:1947–1954[Abstract/Free Full Text]
  25. Shahan K, Gilmartin M, Derman E 1987 Nucleotide sequences of liver, lachrymal, and submaxillary gland mouse major urinary protein mRNAs: mosaic structure and construction of panels of gene-specific synthetic oligonucleotide probes. Mol Cell Biol 7:1938–1946[Abstract/Free Full Text]
  26. Bacchini A, Gaetani E, Cavaggioni A 1992 Pheromone binding proteins of the mouse Mus musculus. Experientia 48:419–421[CrossRef][Medline]
  27. Johnson D, Al-Shawi R, Bishop JO 1995 Sexual dimorphism and growth hormone induction of murine pheromone-binding proteins. J Mol Endocrinol 14:21–34[Abstract/Free Full Text]
  28. MacLeod JN, Shapiro BH 1989 Growth hormone regulation of hepatic drug-metabolizing enzymes in the mouse. Biochem Pharmacol 38:1673–1677[CrossRef][Medline]
  29. Wong G, Itakura T, Kawajiri K, Skow L, Negishi M 1989 Gene family of male-specific testosterone 16{alpha}-hydroxylase (C-P-45016{alpha}) in mice. J Biol Chem 264:2920–2927[Abstract/Free Full Text]
  30. Matthews LS, Norstedt G, Palmiter RD 1986 Regulation of insulin-like growth factor I gene expression by growth hormone. Proc Natl Acad Sci USA 83:9343–9347[Abstract/Free Full Text]
  31. Coleman DL 1973 Effects of parabiosis of obese with diabetes and normal mice. Diabetologia 9:294–298[CrossRef][Medline]
  32. Harris RBS, Martin RJ, Bruch RC 1995 Dissociation between food intake, diet composition, and metabolism in parabiotic partners of obese rats. Am J Physiol 268:R874–R883
  33. Pattanakitsakul S, Nakayama K, Takahashi M, Nonaka M 1990 Three extra copies of a C4-related gene in H-2w7 mice are C4/Slp hybrid genes generated by multiple recombinational events. Immunogenetics 32:431–439[Medline]
  34. Adler AJ, Scheller A, Hoffman Y, Robins DM 1991 Multiple components of a complex androgen-dependent enhancer. Mol Endocrinol 5:1587–1596[Abstract/Free Full Text]
  35. Nelson SA, Robins DM 1997 Regulatory capacity of an androgen-specific enhancer of the mouse Slp gene in transgenic mice. Mol Cell Endocrinol 133:89–97[CrossRef][Medline]
  36. Johnson S, Harrison S, Pineda N, Heinlein C, Al-Shawi R, Bishop JO 1995 Localization of the response elements of a gene induced by intermittent growth hormone stimulation. J Mol Endocrinol 14:35–49[Abstract/Free Full Text]
  37. Yokomori N, Moore R, Negishi M 1995 Sexually dimorphic DNA demethylation in the promoter of the Slp (sex-limited protein) gene in mouse liver. Proc Natl Acad Sci USA 92:1302–1306[Abstract/Free Full Text]
  38. Considine RV, Caro JF 1996 Leptin: genes, concepts and clinical perspective. Horm Res 46:249–256[Medline]
  39. Lew KH, Ludwig EA, Milad MA, Donovan K, Middleton E, Ferry JJ, Jusko WJ 1993 Gender-based effects on methylprednisolone pharmacokinetics and pharmacodynamics. Clin Pharmacol Ther 54:402–414[Medline]
  40. Fontana RJ, Watkins PB 1995 Genetic predisposition to drug-induced liver disease. Gastroenterol Clin N Am 24:811–838[Medline]
  41. Asplin CM, Faria ADS, Carlsen EC, Vaccaro VA, Barr RE, Iranmanesh A, Lee MM, Veldhuis JD, Evans WS 1989 Alterations in the pulsatile mode of growth hormone release in men and women with insulin-dependent diabetes mellitus. J Clin Endocrinol Metab 69:239–245[Abstract/Free Full Text]
  42. Brooks BK, Levy MF, Jenning LW, Abbasoglu O, Vodapally M, Goldstein RM, Husberg BS, Gonwa T, Klintmalm GB 1996 Influence of donor and recipient gender on the outcome of liver transplantation. Transplantation 62:1784–1789[CrossRef][Medline]



This article has been cited by other articles:


Home page
Physiol. GenomicsHome page
C. J. Krebs, S. Khan, J. W. MacDonald, M. Sorenson, and D. M. Robins
Regulator of sex-limitation KRAB zinc finger proteins modulate sex-dependent and -independent liver metabolism
Physiol Genomics, June 1, 2009; 38(1): 16 - 28.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
J. S. Gilbert and M. J. Nijland
Sex differences in the developmental origins of hypertension and cardiorenal disease
Am J Physiol Regulatory Integrative Comp Physiol, December 1, 2008; 295(6): R1941 - R1952.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
M. G. Holloway, G. D. Miles, A. A. Dombkowski, and D. J. Waxman
Liver-Specific Hepatocyte Nuclear Factor-4{alpha} Deficiency: Greater Impact on Gene Expression in Male than in Female Mouse Liver
Mol. Endocrinol., May 1, 2008; 22(5): 1274 - 1286.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
J. S. Gilbert
Sex, Salt, and Senescence: Sorting Out Mechanisms of the Developmental Origins of Hypertension
Hypertension, April 1, 2008; 51(4): 997 - 999.
[Full Text] [PDF]


Home page
Physiol. GenomicsHome page
K. H. Clodfelter, G. D. Miles, V. Wauthier, M. G. Holloway, X. Zhang, P. Hodor, W. J. Ray, and D. J. Waxman
Role of STAT5a in regulation of sex-specific gene expression in female but not male mouse liver revealed by microarray analysis
Physiol Genomics, September 11, 2007; 31(1): 63 - 74.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
D. J. Waxman and C. O'Connor
Growth Hormone Regulation of Sex-Dependent Liver Gene Expression
Mol. Endocrinol., November 1, 2006; 20(11): 2613 - 2629.
[Abstract] [Full Text] [PDF]


Home page
Genome ResHome page
X. Yang, E. E. Schadt, S. Wang, H. Wang, A. P. Arnold, L. Ingram-Drake, T. A. Drake, and A. J. Lusis
Tissue-specific expression and regulation of sexually dimorphic genes in mice
Genome Res., August 1, 2006; 16(8): 995 - 1004.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
K. H. Clodfelter, M. G. Holloway, P. Hodor, S.-H. Park, W. J. Ray, and D. J. Waxman
Sex-Dependent Liver Gene Expression Is Extensive and Largely Dependent upon Signal Transducer and Activator of Transcription 5b (STAT5b): STAT5b-Dependent Activation of Male Genes and Repression of Female Genes Revealed by Microarray Analysis
Mol. Endocrinol., June 1, 2006; 20(6): 1333 - 1351.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
Z. Yu, N. Dadgar, M. Albertelli, A. Scheller, R. L. Albin, D. M. Robins, and A. P. Lieberman
Abnormalities of Germ Cell Maturation and Sertoli Cell Cytoskeleton in Androgen Receptor 113 CAG Knock-In Mice Reveal Toxic Effects of the Mutant Protein
Am. J. Pathol., January 1, 2006; 168(1): 195 - 204.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
C. A. Wiwi, M. Gupte, and D. J. Waxman
Sexually Dimorphic P450 Gene Expression in Liver-Specific Hepatocyte Nuclear Factor 4{alpha}-Deficient Mice
Mol. Endocrinol., August 1, 2004; 18(8): 1975 - 1987.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
D. J. Waxman and J. L. Celenza
Sexual dimorphism of hepatic gene expression: novel biological role of KRAB zinc finger repressors revealed
Genes & Dev., November 1, 2003; 17(21): 2607 - 2613.
[Full Text] [PDF]


Home page
Genes Dev.Home page
C. J. Krebs, L. K. Larkins, R. Price, K. M. Tullis, R. D. Miller, and D. M. Robins
Regulator of sex-limitation (Rsl) encodes a pair of KRAB zinc-finger genes that control sexually dimorphic liver gene expression
Genes & Dev., November 1, 2003; 17(21): 2664 - 2674.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tullis, K. M.
Right arrow Articles by Robins, D. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tullis, K. M.
Right arrow Articles by Robins, D. M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals