| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Department of Biochemistry (T.Y., T.M., K.Y., H.K., T.S., M.Y., T.K., Z.S., K.M.), Fukui Medical University, Fukui 910-1193, Japan; and Core Research for Evolutional Science and Technology (T.Y., T.M., K.Y., H.K., T.S., M.Y., T.K., K.M.), Japan Science and Technology Corporation, Tokyo 102-8666, Japan
Address all correspondence and requests for reprints to: Kaoru Miyamoto, Department of Biochemistry, Fukui Medical University Shimoaizuki, Matsuoka-cho, Fukui 910-1193, Japan. E-mail: kmiyamot{at}fmsrsa.fukui-med.ac.jp.
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
(8), serum/glucocorticoid-inducible kinase (9), and c-fos (10). Among these, gonadotropin-inducible ovarian transcription factors (GIOT1 and GIOT2), which are novel members of the C2-H2-type zinc finger protein family, were discovered by us using subtraction cloning (11). Although both family members have very similar amino acid sequences, some differences are evident. GIOT1, but not GIOT2, contains the krüppel-associated box-A domain at the N terminus, and this region is responsible for the transcriptional repressor activity. Although GIOT2 is expressed ubiquitously, GIOT1 appears to be predominantly expressed in steroidogenic cells, testicular Leydig cells, ovarian granulosa and theca cells, and in the adrenal as well as the pituitary gland to some extent. The nuclear receptor steroidogenic factor 1 (SF-1), also known as the adrenal 4 binding protein (Ad4BP), is essential for adrenal development and sexual differentiation (12, 13, 14, 15) and is expressed in the adrenal cortex, the gonads, pituitary gonadotrope cells, hypothalamus, and spleen (16, 17). SF-1 is an orphan member of the nuclear receptor superfamily and contains a characteristic zinc finger DNA-binding domain, an intervening hinge region, and a carboxy-terminal putative ligand-binding domain (18). SF-1 regulates the cell-specific expression of a variety of different proteins involved in steroidogenesis, reproduction, and male gonadal differentiation (18, 19). In ovarian granulosa cells, SF-1 regulates genes that encode the cytochrome P450 side cleavage chain enzyme (20), StAR (21), and aromatase (22) by binding to cAMP-response sequences. However, the mechanism(s) by which FSH leads to increased SF-1-dependent transcription is not fully understood. It has been shown that SF-1 mRNA levels are largely unaffected by FSH or agents that stimulate cAMP production (20, 23, 24, 25). SF-1-dependent transcriptional regulation by PKA may involve the posttranslational modification of SF-1 itself. Some reports have suggested that SF-1 is directly phosphorylated by PKA, although it has not been shown that PKA actually leads to the phosphorylation of SF-1 in vivo (22, 23). It has recently been reported that PKA increases the stability of SF-1 protein in transiently transfected cells, but the physiological relevance of this phenomenon has not yet been elucidated (26).
Another orphan nuclear receptor, Dax-1, has been shown to repress the transcriptional activity of SF-1. The human DAX-1 gene is located on the X chromosome at region p21, which, when duplicated, gives rise to XY females, a condition referred to as dosage-sensitive sex reversal. DAX-1 mutations are associated with the pathogenesis of adrenal hypoplasia congenita and hypogonadotropic hypogonadism (27, 28). The remarkable similarities between SF-1-null mice and humans with Dax-1 mutations in cases of adrenal hypoplasia congenita raise the possibility that SF-1 and Dax-1 function together as essential regulators of the hypothalamic-pituitary-steroidogenic axis. Indeed, full overlap exists between the sites of expression of the SF-1 and Dax-1 genes (29). Several investigators have shown that SF-1-mediated transactivation is inhibited by Dax-1 via its direct interaction with SF-1 (30, 31, 32) or through binding to single-stranded hairpin DNA structures (33).
In this study, we report on an investigation of mechanisms that regulate GIOT1 gene expression on FSH stimulation in rat granulosa cells. Our findings demonstrated that the synergistic action of cAMP response element (CRE) binding protein (CREB) and SF-1 and the rapid down-regulation of Dax-1 expression cause the acute induction of GIOT1 gene by FSH. Our results suggest that the release from the Dax-1-mediated transcriptional repression is at least one of the important mechanisms involved in the induction of SF-1 target genes in granulosa cells by FSH.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-32P ATP (110 TBq/mmol) and -32P dCTP (110 TBq/mmol) were obtained from Amersham Biosciences (Uppsala, Sweden). A protein assay kit was purchased from Bio-Rad Laboratories, Inc. (Hercules, CA). Anti-CREB (sc-186) and anti-Sp1 (sc-59) antibodies were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA).
Animals and cell culture
Granulosa cells were obtained from immature, Kwl:Wistar female rats (21 d old) that received an injection of 2 mg DES in 0.2 ml sesame oil once daily for 4 consecutive days. A granulosa cell culture was performed as described previously (11, 34). Briefly, the ovaries were excised, and granulosa cells were released by puncturing the follicles with a 26-gauge needle. At all times, the animals were treated according to NIH guidelines. Granulosa cells were collected by brief centrifugation and then cultured in Ham’s F-12/DMEM (vol/vol) supplemented with 1.1 g/liter NaHCO3, 50 mg/liter gentamycin sulfate, and 0.1% BSA on collagen-coated plates in a humidified atmosphere containing 5% CO2/95% air at 37 C.
Isolation and characterization of 5'-upstream of rat GIOT1 gene
The DNA walking kit (CLONTECH Laboratories, Inc., Palo Alto, CA) was used for the isolation of the 5'-upstream DNA fragment of the rat GIOT1 gene. Briefly, samples of rat genomic DNA were individually digested with five different restriction enzymes that recognize 6 bp and produce blunt ends. The digested DNA fragments were then separately adapter-ligated to produce five sets of DNA fragments with adapters at their ends. Each set of DNA fragments was amplified using an adapter-specific 5'-primer (GTAATACGACTCACTATAGGGC) and a rat GIOT1 gene-specific 3'-primer (TGCAGAGGTGGTTCCTAGCTGTCAA). A second PCR was performed using nested primers (the 5'-primer, ACTATAGGGCACGCGTGGT; and the 3'-primer, TGATTGGCGGTGACAGGAGCAACT). The PCR products from each set were analyzed on a 1% agarose gel. The 0.8-kb product was cloned into the pGEM-T Easy vector (Promega Corp.). The nucleotide sequences of two independent clones from each PCR product were determined from both ends by the dye terminator cycle sequencing method.
Primer extension analysis
A primer complementary to 59–84 bp of the cDNA (5'-CAACGAGGGTGCTGAGTACCTGGAA) was used as a primer for the extension reaction. The primer was end-labeled with T4 polynucleotide kinase and -32P ATP at 37 C for 30 min. Total RNA was prepared by the acid guanidinium thiocyanate extraction method (35) from immature rat ovaries primed with or without 30 IU of pregnant mare serum gonadotropin (PMSG) for 6 h or from immature rat lung. The 32P-labeled primer was mixed with (Fig. 1B
, lanes 2–4) or without (lane 1) 20 µg of total RNA in 20 µl of hybridization buffer [10 mM Tris-HCl (pH 8.0), 1 mM EDTA, 250 mM KCl) and denatured at 65 C for 1 h, after which the mixture was slowly cooled to room temperature. After the addition of 80 µl of the reverse transcriptase reaction mixture [25 mM Tris-HCl (pH 8.0), 90 mM KCl, 12 mM MgCl2, 12 mM dithiothreitol (DTT), 0.6 mM each deoxynucleoside triphosphate, 0.2 mM spermidine, and 400 U of Superscript II reverse transcriptase], the reaction was continued at 37 C for 1 h. The extended transcripts were recovered after RNA digestion with RNase A by phenol extraction and ethanol precipitation and were resolved on an 8% denaturing polyacrylamide gel. M13mp18 sequence ladders were coelectrophoresed in adjacent lanes as size markers, and the resulting gel was then dried and autoradiographed.
|
Cell culture, transient transfection, and luciferase assay
Rat granulosa cells were cultured as described previously (34) 24 h before transfection. Each reporter or effector plasmid and the pRL Renilla luciferase control vector (for normalization) was mixed with FuGENE 6 (Roche Molecular Biochemicals), and the resulting mixture was added to the cells. After 44 h of transfection, the cells were treated with or without ovine FSH (30 ng/ml).
F9 and NIH3T3 cells were maintained in DMEM containing 10% fetal bovine serum and antibiotics. Cells were dispensed into 24-well plates at 2.5 x 104 cells per well 24 h before transfection. DNA samples that contained each reporter plasmid and the pRL Renilla luciferase control vector (for normalization) with or without an expression plasmid were transfected using LipofectAMINE PLUS (Invitrogen). Cells were harvested 24 h after transfection. Luciferase activity was determined using a dual luciferase reporter assay system. Measurements were made using a Lumat LB9501 luminometer (Berthold Systems, Aliquippa, PA) in a single tube, with the first assay involving the firefly luciferase, followed by the Renilla luciferase assay. Firefly luciferase activities (relative light units) were normalized by Renilla luciferase activities.
EMSAs
Granulosa cells were cultured in 60-mm dishes containing 5 x 106 cells in 5 ml of medium, and FSH was added to the medium 24 h after plating. The cells were collected by a scraper 2 h after FSH treatment and washed with 10 ml of Tris-buffered saline. The resulting cells were suspended in 1 ml of Tris-buffered saline, transferred to an Eppendorf tube (Brinkmann Instruments, Inc., Westbury, NY), and pelleted by centrifugation at 1500 x g for 10 min at 4 C. Nuclei from granulosa cells were prepared by the method of Schreiber et al. (38) with minor modifications. The cell pellet was resuspended in 600 µl of cold buffer A [10 mM HEPES (pH 7.9), 10 mM KCl, 1 mM EDTA, 0.5 mM EGTA, 1 mM DTT, and 0.5 mM PMSF] by gentle pipetting. The cells were allowed to swell on ice for 15 min, after which 37.5 µl of a 10% solution of Nonidet P-40 were added, and the tube was vigorously vortexed for 10 sec. The homogenate was centrifuged at 15,000 x g for 5 min at 4 C. The supernatant, which contained cytoplasm and RNA, was removed; the nuclear pellet was resuspended in 40 µl of ice-cold buffer C [20 mM HEPES (pH 7.9), 0.4 M NaCl, 1 mM EDTA, 1 mM EGTA, 1 mM DTT, and 1 mM PMSF]; and the tube was vigorously shaken at 4 C for 15 min on a shaking platform. The mixture was then centrifuged for 15 min at 15,000 x g at 4 C, and the supernatant, which contained the nuclear extract, was used for EMSA.
Double-stranded DNA fragments were prepared by the annealing of complementary oligonucleotides. The sequences of the sense strands of the double-stranded oligonucleotides were: CREB, 5'-ctagACACATCTGACGTCAAGACG; CREBM, 5'-ctagACACATCTGTGGTCAAGACG; SF-1, 5'-ctagGACAAGCCTGTGACCTTTCT; and SF-1M, 5'-ctagGCAAGCCTGTGAaaTTTCT. A nuclear extract (10 µg proteins) was incubated for 30 min with a 32P-labeled oligonucleotide (0.1 ng) and unlabeled polydeoxyadenosine deoxythymidine or polydeoxyinosinic deoxycytidylic acid in buffer C. In the competition experiments, a 200-fold molar excess of unlabeled competitor DNAs was added. A supershift assay was performed by preincubating the nuclear extracts for 30 min with anti-CREB or anti-Ad4BP antiserum (kindly provided by Dr. Ken-ichirou Morohashi, National Institute of Basic Biology). After the binding reaction, the mixture was subjected to a 6% PAGE in 45 mM Tris-HCl, 45 mM boric acid, 1 mM EDTA at 200 V for 60 min, and the gel was then dried and autoradiographed. Autoradiographic bands were quantified by a fluoroimage analyzer (BAS2000, Fuji Photo Film Co., Ltd., Tokyo, Japan).
Northern blot analysis
Ten micrograms of total RNA were separated by electrophoresis on 1% formaldehyde agarose gels and subsequently transferred to a nylon membrane (Biodyne, ICN Biomedicals, Inc., Glen Cove, NY) followed by UV cross-linking. Each of the cDNA samples was labeled with -32P dCTP using the random primer labeling method and used as a probe. The blots were stripped and rehybridized to rat glyceraldehyde-3-phosphate dehydrogenase (GAPDH) to account for signal differences due to RNA loading.
Western blot analysis
For the determination of protein expression levels, granulosa cells were washed twice in ice-cold phosphate saline buffer and lysed in 50 mM Tris-HCl (pH 8.0) containing 1% Nonidet P-40, 0.1% sodium dodecyl sulfate, 0.5% deoxycholate, and 1 mM PMSF. The cell debris was removed by centrifugation at 15,000 x g at 4 C for 10 min, and supernatants were used as cell lysates. Proteins were quantified using a Bio-Rad Protein Assay kit. Equal amounts of protein (10 µg) were resolved by 12.5% SDS-PAGE and transferred onto polyvinylidene difluoride membranes. Western blot analysis of SF-1, Dax-1, and Sp1 was performed with each antiserum directed against Ad4BP/SF-1, Dax-1 (kindly provided by Dr. Ken-ichirou Morohashi, National Institute of Basic Biology), and Sp1. Enhanced chemiluminescence Western blot reagents (Amersham Pharmacia Biotech, Arlington Heights, IL) were used for detection.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
). These sequences are numbered relative to the transcription initiation site, which was determined by primer extension analysis (Fig. 1B). A number of putative binding elements for various transcription factors are present, including the conventional TATA box at -23.
To determine whether the GIOT1 5'-flanking region is able to direct the hormonal inducibility, a -806 to +6 fragment was ligated to a pGL3-Basic vector and was then transiently transfected into freshly prepared rat granulosa cells, followed by a 4-h incubation with FSH. As shown in Fig. 2, treatment with FSH had a marked effect (38-fold) on the induction of promoter activity. Thus, we conclude that the proximal -806 of the GIOT1 promoter contains hormone-response element(s).
|
A closer examination of this sequence revealed the presence of a perfect CRE (TGACGTCA) at position -224/-217 and an SF-1 site at position -142/-136 (TGACCTTT) identified as FSH response sequence in other promoters (Refs.20, 21, 22 ; Fig. 1A). Although the mutation of each site in the 282 fragment was significantly decreased (76% in CRE and 53% in SF-1 site), simultaneous mutation of both sites abrogated FSH responsiveness (92%) as well as in the 122 fragments (Fig. 3). Collectively, the 5'-deletion and site-directed mutagenesis studies define an important role for the CRE at -224/-217 and SF-1 site at -142/-136 in gonadotropin-stimulated GIOT1 gene expression.
|
, a probe containing the CRE at -224/-217 or that of SF-1 binding motif at -142/-136 formed two prominent shifted complexes (Fig. 4, lanes 1, 5, 9, and 13) that were competed by each unlabeled oligonucleotide containing homologous sequences (lanes 2, 6, 10, and 14) but not by unlabeled nucleotides containing mutated sequences that were used in the site-directed mutagenesis (lanes 3, 7, 11, and 15). Preincubation of the nuclear extracts with a polyclonal antiserum against CREB/activating transcription factor family members abolished the formation of the complexes (lanes 4 and 8). Similarly, anti-Ad4BP/SF-1 antibody completely abolished the formation of the lower major complex, although the formation of the upper minor complex was not affected (lanes 12 and 16). Intensities of the complex bands were not altered after the FSH treatment. These data demonstrate that a member of the CREB/activating transcription factor family binds to the -224/-217 region and that SF-1 is a major transcription factor that binds to the -142/-136 region of the rat GIOT1 gene promoter.
|
), the peptide inhibitor of PKA. A vector containing Neo or PKI mutant (PKIM) cDNA that cannot bind and inhibit the PKA-catalytic subunit was used as a control. Cotransfected PKI completely inhibited FSH-activated GIOT1 promoter activity in every construct, whereas Neo or PKIM had no effects.
|
, A and B). Although SF-1 and the catalytic subunit of PKA individually caused a modest stimulation of the GIOT1 promoter, dramatic synergistic effects were observed in the case of cotransfection. Synergistic activation was increased in proportion to the dose of the PKA or SF-1 expression constructs. This activity was completely abolished as the result of the mutation of the -142/-136 SF-1 site (Fig. 6C). These findings suggest that interactions between the SF-1 and PKA pathways occur in the GIOT1 promoter.
|
). The mutated form of SF-1 transactivated GIOT1 reporter gene equally as the wild-type form of SF-1 did in the presence of the catalytic subunit of PKA. Hammer et al. (39) reported that phosphorylation of Ser203 is mediated by the MAPK pathway and increases the transcriptional activity of SF-1. In some cells, cAMP activates the MAPK pathway via PKA, and the possibility that PKA acts indirectly through modulation of the MAPK pathway cannot be excluded. To examine this issue, an expression plasmid encoding SF-1 carrying a mutation in the MAPK phosphorylation site (Ser203Ala) was cotransfected with the catalytic subunit of PKA. However, mutation of the MAPK phosphorylation site in SF-1 had no effect on the ability of PKA to stimulate SF-1-dependent GIOT1 promoter activity. These results indicate that Ser430 or Ser203 is not essential for PKA-stimulated SF-1 transcriptional activity.
|
) and protein levels (Fig. 8B) remained nearly constant for at least 4 h after the FSH treatment. In contrast, Dax-1 mRNA and protein levels were markedly decreased within 2 h.
|
). The cotransfected SF-1 expression plasmids induced about a 2.6-fold increase in luciferase activity. Dax-1 strongly diminished the SF-1-mediated induction of GIOT1 promoter activity in a dose-dependent fashion. Five nanograms of Dax-1 plasmids nearly completely abolished SF-1-induced activity. Dax-1 had no effect on GIOT1 promoter activity in the absence of the SF-1 expression vector. Hence, Dax-1 represses the SF-1-dependent expression of GIOT1 gene. Finally, effects of Dax-1 overexpression on the GIOT1-promoter activity in granulosa cells were examined. As shown in Fig. 9B, cotransfection of the Dax-1 expression vector markedly suppressed the GIOT1-promoter activity under the FSH-stimulated condition (38%). Mutation of the SF-1 site in the GIOT1-promoter caused partial reduction of the promoter activity. At the same time, the Dax-1-mediated repression was not evident when the mutated promoter construct was used. These results indicate that Dax-1 represses the SF-1-dependent expression of GIOT1 gene in granulosa cells via the SF-1 binding site of GIOT1 promoter.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The SF-1 and cAMP pathways are involved in the regulation of a number of genes in the gonad and adrenal glands. In particular, the interaction of CREB- and SF-1-binding sites confers a high transcriptional activity (22, 40, 41, 42). Ito et al. (41) reported that in the inhibin- promoter, SF-1 directly interacts with CREB, leading to the recruitment of the CREB binding protein and an increased level of histone acetylation. CREB is phosphorylated at serine133 by PKA, and the interaction between SF-1 and phosphorylated CREB has been proposed as a mechanism for the synergism between the SF-1 and cAMP. This model could also be applied to the GIOT1 promoter, although the DNA-binding ability of CREB and SF-1 was not enhanced by FSH and about half of the intact activity remained even when the CREB-binding site was ablated. In addition, because not all SF-1-responsive genes contain CRE, it is entirely possible that other mechanism(s) exist. Our results indicate that the release from the Dax-1-mediated transcriptional repression by the down-regulation of its expression is at least one of the important mechanisms for inducing SF-1 target genes via the cAMP-PKA pathway. Recently, Osman et al. (43) reported that a similar mechanism is responsible for aldosterone biosynthesis in bovine adrenocortical cells by angiotensin II. There are several possible explanations for PKA leading to increased SF-1-dependent transcription in the GIOT1 promoter. One possibility is that the cAMP pathway leads to the phosphorylation of SF-1, thus increasing its transcriptional activity. Carlone and Richards (22, 39) reported that SF-1 is phosphorylated in granulosa cells on FSH stimulation. SF-1 is also phosphorylated by PKA in vitro (23), and the primary structure of SF-1 contains a putative PKA phosphorylation site Ser430 (44). However, mutation of this site has no effect on the SF-1-dependent GIOT1 promoter activity enhanced by PKA as Aesoy et al. (26) investigated in artificial reporter constructs. Hammer et al. (39) reported that phosphorylation of Ser203 is mediated by the MAPK pathway. In granulosa cells, FSH activates the MAPK pathway via PKA. However, mutation of the MAPK phosphorylation site (203S
A) in SF-1 had no effect on the ability of PKA to stimulate SF-1-dependent GIOT1 promoter activity. A recent study suggested that PKA increases the stability of SF-1 protein in transient transfected cells, but physiological relevance of this is unclear (26). This issue should be a subject for further investigation because SF-1-mediated transactivation is also enhanced by PKA in the Dax-1-deficient cells.
Dax-1 expression in granulosa cells varies with the follicle maturation stage and completely disappears when they differentiate into the corpus luteum (45, 46). Our results suggest that activation of the cAMP-PKA pathway by gonadotropins is responsible for this down-regulation. Dax-1 inhibits SF-1-mediated transactivation via a direct interaction with SF-1 (30, 31, 32) or through binding to single-stranded hairpin DNA structures (33). When granulosa cells differentiate into luteal cells by the actions of gonadotropins, the expression of StAR (22, 47), P450SCC (20, 25), and 3ß-hydroxysteroid dehydrogenase (48, 49), well-known SF-1 targets, is induced, and active steroidogenesis is initiated (5, 6). It is reasonable to assume that down-regulation of Dax-1 expression by gonadotropins is necessary for the functional differentiation (steroidogenic) to the corpus luteum. This assumption is supported by the findings that the ectopic expression of Dax-1 represses the expression of enzymes involved in steroidogenesis and inhibits the production of steroid hormone (43, 50).
Although the precise mechanism underlying the down-regulation of Dax-1 mRNA by FSH is not clear, an inhibition of Dax-1 gene transcription is likely responsible for this down-regulation; FSH did not accelerate the decay rate of mRNA under the condition of blockade of transcription (our unpublished data). To date, SF-1 (46, 51) and WT1 (52) have been reported to be implicated in the regulation of Dax-1 transcription. It is evident that SF-1 is important for the transcription of the Dax-1 gene in vivo. The expression of Dax-1 was significantly impaired in knock-out mice of the Ftz-f1 gene, which encodes SF-1 (46). However, the transcription of most SF-1 target genes, including GIOT1, is enhanced in granulosa cells on FSH-stimulation. We cannot explain this apparent discrepancy at this time. It is noteworthy, however, that the recently identified SF-1 site essential for Dax-1 expression in the developing gonad is not necessary in the adult gonad (51). Thus, SF-1 might not be involved in Dax-1 expression in the adult gonad. Although the involvement of WT-1 is also evident in the developing gonad, there is no evidence for this in adults. FSH also leads to the potent down-regulation of Dax-1 expression in cultured adult Sertoli cells, although it requires a longer time (8 h) and de novo protein synthesis (53). Therefore, the underlying mechanism is likely quite different from granulosa cells. Further studies will be necessary to understand the regulatory mechanisms of the Dax-1 gene expression.
In summary, we reported that the acute induction of the GIOT1 gene by gonadotropins is caused by the synergistic action of CREB and SF-1 and the rapid down-regulation of Dax-1 expression. We propose that a release from the Dax-1-mediated transcriptional repression can be applied to the transactivation of many other SF-1 target genes induced by gonadotropins. This should also be an important event in the differentiation of granulosa cells into steroidogenic luteal cells.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
Abbreviations: Ad4BP, Adrenal 4 binding protein; CRE, cAMP response element; CREB, CRE binding protein; DES, diethylstilbesterol; DTT, dithiothreitol; GAPDH, glyceraldehyde-3-phosphate dehydrogenase, GIOT, gonadotropin-inducible ovarian transcription factor; PKA, protein kinase A; PKI, protein kinase-inhibiting peptide; PKIM, PKI mutant; PMSG, pregnant mare serum gonadotropin; SF-1, steroidogenic factor 1; StAR, steroidogenic acutely regulatory protein.
Received October 15, 2002.
Accepted for publication January 28, 2003.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
promoter by steroidogenic factor-1 and cyclic adenosine 3', 5'-monophosphate. Mol Endocrinol 14:66–81
5-4 isomerase promoter by the transcription factor steroidogenic factor-1/adrenal 4-binding protein and phorbol ester. J Biol Chem 272:7960–7967 and the homeodomain protein distal-less 3 are required for placental-specific expression of the murine 3 ß-hydroxysteroid dehydrogenase VI gene, Hsd3b6. J Biol Chem 277:7945–7954This article has been cited by other articles:
 |
|
 |
|
  M. Kouzu-Fujita, Y. Mezaki, S. Sawatsubashi, T. Matsumoto, I. Yamaoka, T. Yano, Y. Taketani, H. Kitagawa, and S. Kato Coactivation of Estrogen Receptor {beta} by Gonadotropin-Induced Cofactor GIOT-4 Mol. Cell. Biol., January 1, 2009; 29(1): 83 - 92. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Yazawa, M. Uesaka, Y. Inaoka, T. Mizutani, T. Sekiguchi, T. Kajitani, T. Kitano, A. Umezawa, and K. Miyamoto Cyp11b1 Is Induced in the Murine Gonad by Luteinizing Hormone/Human Chorionic Gonadotropin and Involved in the Production of 11-Ketotestosterone, a Major Fish Androgen: Conservation and Evolution of the Androgen Metabolic Pathway Endocrinology, April 1, 2008; 149(4): 1786 - 1792. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Qiu, S. Yao, C. Hindmarch, V. Antunes, J. Paton, and D. Murphy Transcription Factor Expression in the Hypothalamo-Neurohypophyseal System of the Dehydrated Rat: Upregulation of Gonadotrophin Inducible Transcription Factor 1 mRNA Is Mediated by cAMP-Dependent Protein Kinase A J. Neurosci., February 28, 2007; 27(9): 2196 - 2203. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Stocco, C. Telleria, and G. Gibori The Molecular Control of Corpus Luteum Formation, Function, and Regression Endocr. Rev., February 1, 2007; 28(1): 117 - 149. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Saxena, R. Escamilla-Hernandez, L. Little-Ihrig, and A. J. Zeleznik Liver Receptor Homolog-1 and Steroidogenic Factor-1 Have Similar Actions on Rat Granulosa Cell Steroidogenesis Endocrinology, February 1, 2007; 148(2): 726 - 734. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Cui, W. Li, W. Liu, K. Yang, Y. Pang, and L. Haoran Production of Recombinant Orange-Spotted Grouper (Epinephelus coioides) Luteinizing Hormone in Insect Cells by the Baculovirus Expression System and Its Biological Effect Biol Reprod, January 1, 2007; 76(1): 74 - 84. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Yazawa, T. Mizutani, K. Yamada, H. Kawata, T. Sekiguchi, M. Yoshino, T. Kajitani, Z. Shou, A. Umezawa, and K. Miyamoto Differentiation of Adult Stem Cells Derived from Bone Marrow Stroma into Leydig or Adrenocortical Cells Endocrinology, September 1, 2006; 147(9): 4104 - 4111. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K.-H. Song, Y.-Y. Park, H. J. Kee, C. Y. Hong, Y.-S. Lee, S.-W. Ahn, H.-J. Kim, K. Lee, H. Kook, I.-K. Lee, et al. Orphan Nuclear Receptor Nur77 Induces Zinc Finger Protein GIOT-1 Gene Expression, and GIOT-1 Acts as a Novel Corepressor of Orphan Nuclear Receptor SF-1 via Recruitment of HDAC2 J. Biol. Chem., June 9, 2006; 281(23): 15605 - 15614. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Ragazzon, A.-M. Lefrancois-Martinez, P. Val, I. Sahut-Barnola, C. Tournaire, C. Chambon, J.-L. Gachancard-Bouya, R.-J. Begue, G. Veyssiere, and A. Martinez Adrenocorticotropin-Dependent Changes in SF-1/DAX-1 Ratio Influence Steroidogenic Genes Expression in a Novel Model of Glucocorticoid-Producing Adrenocortical Cell Lines Derived from Targeted Tumorigenesis Endocrinology, April 1, 2006; 147(4): 1805 - 1818. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Tsuchiya, M. Nakajima, S. Takagi, M. Katoh, W. Zheng, C. R Jefcoate, and T. Yokoi Binding of Steroidogenic Factor-1 to the Regulatory Region Might Not Be Critical for Transcriptional Regulation of the Human CYP1B1 Gene. J. Biochem., March 1, 2006; 139(3): 527 - 534. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F.-Q. Yu, C.-S. Han, W. Yang, X. Jin, Z.-Y. Hu, and Y.-X. Liu Activation of the p38 MAPK pathway by follicle-stimulating hormone regulates steroidogenesis in granulosa cells differentially J. Endocrinol., July 1, 2005; 186(1): 85 - 96. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Park, E. T. Maizels, Z. J. Feiger, H. Alam, C. A. Peters, T. K. Woodruff, T. G. Unterman, E. J. Lee, J. L. Jameson, and M. Hunzicker-Dunn Induction of Cyclin D2 in Rat Granulosa Cells Requires FSH-dependent Relief from FOXO1 Repression Coupled with Positive Signals from Smad J. Biol. Chem., March 11, 2005; 280(10): 9135 - 9148. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. Zheng and C. R. Jefcoate Steroidogenic Factor-1 Interacts with cAMP Response Element-Binding Protein to Mediate cAMP Stimulation of CYP1B1 via a Far Upstream Enhancer Mol. Pharmacol., February 1, 2005; 67(2): 499 - 512. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Jo and D. M. Stocco Regulation of Steroidogenesis and Steroidogenic Acute Regulatory Protein in R2C Cells by DAX-1 (Dosage-Sensitive Sex Reversal, Adrenal Hypoplasia Congenita, Critical Region on the X Chromosome, Gene-1) Endocrinology, December 1, 2004; 145(12): 5629 - 5637. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Saxena, R. Safi, L. Little-Ihrig, and A. J. Zeleznik Liver Receptor Homolog-1 Stimulates the Progesterone Biosynthetic Pathway during Follicle-Stimulating Hormone-Induced Granulosa Cell Differentiation Endocrinology, August 1, 2004; 145(8): 3821 - 3829. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Kajitani, T. Mizutani, K. Yamada, T. Yazawa, T. Sekiguchi, M. Yoshino, H. Kawata, and K. Miyamoto Cloning and Characterization of Granulosa Cell High-Mobility Group (HMG)-Box Protein-1, a Novel HMG-Box Transcriptional Regulator Strongly Expressed in Rat Ovarian Granulosa Cells Endocrinology, May 1, 2004; 145(5): 2307 - 2318. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Fayard, K. Schoonjans, J.-S. Annicotte, and J. Auwerx Liver Receptor Homolog 1 Controls the Expression of Carboxyl Ester Lipase J. Biol. Chem., September 12, 2003; 278(37): 35725 - 35731. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
