Endocrinology Vol. 144, No. 5 1920-1930
Copyright © 2003 by The Endocrine Society
Involvement of Cyclic Adenosine 5'-Monophosphate Response Element-Binding Protein, Steroidogenic Factor 1, and Dax-1 in the Regulation of Gonadotropin-Inducible Ovarian Transcription Factor 1 Gene Expression by Follicle-Stimulating Hormone in Ovarian Granulosa Cells
Takashi Yazawa,
Tetsuya Mizutani,
Kazuya Yamada,
Hiroko Kawata,
Toshio Sekiguchi,
Miki Yoshino,
Takashi Kajitani,
Zhangfei Shou and
Kaoru Miyamoto
Department of Biochemistry (T.Y., T.M., K.Y., H.K., T.S., M.Y., T.K., Z.S., K.M.), Fukui Medical University, Fukui 910-1193, Japan; and Core Research for Evolutional Science and Technology (T.Y., T.M., K.Y., H.K., T.S., M.Y., T.K., K.M.), Japan Science and Technology Corporation, Tokyo 102-8666, Japan
Address all correspondence and requests for reprints to: Kaoru Miyamoto, Department of Biochemistry, Fukui Medical University Shimoaizuki, Matsuoka-cho, Fukui 910-1193, Japan. E-mail: kmiyamot{at}fmsrsa.fukui-med.ac.jp.
 |
Abstract
|
|---|
Upon FSH stimulation, many genes are acutely induced in granulosa cells. Gonadotropin-inducible ovarian transcription factor 1 (GIOT1) represents a novel member of the group of transcriptional repressors that belong to one such gene. To investigate the mechanism of this transcriptional activation, a rat GIOT1 promoter region was isolated and subsequently ligated to a luciferase vector and transfected to freshly prepared granulosa cells. A luciferase reporter gene driven by 0.8 kb of the GIOT1 5'-flanking region was highly expressed in response to FSH. Deletion and mutational analyses indicated that two response elements, including a steroidogenic factor 1 (SF-1) site and a cAMP response element (CRE), are required for the activation of the gene by FSH. Gel shift experiments also indicated that SF-1 and CRE binding protein specifically bind to each site. To reveal the relationship between SF-1 and the cAMP-dependent protein kinase A pathway, cotransfection was performed using SF-1-deficient cells. Although SF-1 and the catalytic subunit of protein kinase A individually caused a modest stimulation of the GIOT1 promoter, dramatic synergistic effects were observed in the case of cotransfection. Although the amount of SF-1 remained unchanged in response to FSH in granulosa cells, Dax-1 expression immediately decreased. The ectopic expression of Dax-1 inhibited the SF-1-dependent GIOT1 promoter activity. These results suggest that the synergistic action of CRE binding protein and SF-1 and the rapid down-regulation of Dax-1 are responsible for the acute induction of GIOT1 gene by gonadotropin.
 |
Introduction
|
|---|
THE MATURATION OF ovarian follicles to a preovulatory stage requires the production of FSH by the pituitary gland (1, 2). Its cognate receptor is a member of the G protein-coupled seven-transmembrane receptor family and is coupled to adenylyl cyclase (3). The receptor is expressed exclusively on ovarian granulosa cells in female mammals (4). Most of the actions of FSH are mediated by cAMP formation and the activation of protein kinase A (PKA). FSH induces the rapid and acute expression of a number of genes for follicle maturation in granulosa cells (5, 6), including the steroidogenic acutely regulatory protein (StAR; Ref. 7), inhibin-
(8), serum/glucocorticoid-inducible kinase (9), and c-fos (10). Among these, gonadotropin-inducible ovarian transcription factors (GIOT1 and GIOT2), which are novel members of the C2-H2-type zinc finger protein family, were discovered by us using subtraction cloning (11). Although both family members have very similar amino acid sequences, some differences are evident. GIOT1, but not GIOT2, contains the krüppel-associated box-A domain at the N terminus, and this region is responsible for the transcriptional repressor activity. Although GIOT2 is expressed ubiquitously, GIOT1 appears to be predominantly expressed in steroidogenic cells, testicular Leydig cells, ovarian granulosa and theca cells, and in the adrenal as well as the pituitary gland to some extent.
The nuclear receptor steroidogenic factor 1 (SF-1), also known as the adrenal 4 binding protein (Ad4BP), is essential for adrenal development and sexual differentiation (12, 13, 14, 15) and is expressed in the adrenal cortex, the gonads, pituitary gonadotrope cells, hypothalamus, and spleen (16, 17). SF-1 is an orphan member of the nuclear receptor superfamily and contains a characteristic zinc finger DNA-binding domain, an intervening hinge region, and a carboxy-terminal putative ligand-binding domain (18). SF-1 regulates the cell-specific expression of a variety of different proteins involved in steroidogenesis, reproduction, and male gonadal differentiation (18, 19). In ovarian granulosa cells, SF-1 regulates genes that encode the cytochrome P450 side cleavage chain enzyme (20), StAR (21), and aromatase (22) by binding to cAMP-response sequences. However, the mechanism(s) by which FSH leads to increased SF-1-dependent transcription is not fully understood. It has been shown that SF-1 mRNA levels are largely unaffected by FSH or agents that stimulate cAMP production (20, 23, 24, 25). SF-1-dependent transcriptional regulation by PKA may involve the posttranslational modification of SF-1 itself. Some reports have suggested that SF-1 is directly phosphorylated by PKA, although it has not been shown that PKA actually leads to the phosphorylation of SF-1 in vivo (22, 23). It has recently been reported that PKA increases the stability of SF-1 protein in transiently transfected cells, but the physiological relevance of this phenomenon has not yet been elucidated (26).
Another orphan nuclear receptor, Dax-1, has been shown to repress the transcriptional activity of SF-1. The human DAX-1 gene is located on the X chromosome at region p21, which, when duplicated, gives rise to XY females, a condition referred to as dosage-sensitive sex reversal. DAX-1 mutations are associated with the pathogenesis of adrenal hypoplasia congenita and hypogonadotropic hypogonadism (27, 28). The remarkable similarities between SF-1-null mice and humans with Dax-1 mutations in cases of adrenal hypoplasia congenita raise the possibility that SF-1 and Dax-1 function together as essential regulators of the hypothalamic-pituitary-steroidogenic axis. Indeed, full overlap exists between the sites of expression of the SF-1 and Dax-1 genes (29). Several investigators have shown that SF-1-mediated transactivation is inhibited by Dax-1 via its direct interaction with SF-1 (30, 31, 32) or through binding to single-stranded hairpin DNA structures (33).
In this study, we report on an investigation of mechanisms that regulate GIOT1 gene expression on FSH stimulation in rat granulosa cells. Our findings demonstrated that the synergistic action of cAMP response element (CRE) binding protein (CREB) and SF-1 and the rapid down-regulation of Dax-1 expression cause the acute induction of GIOT1 gene by FSH. Our results suggest that the release from the Dax-1-mediated transcriptional repression is at least one of the important mechanisms involved in the induction of SF-1 target genes in granulosa cells by FSH.
 |
Materials and Methods
|
|---|
Materials
Diethylstilbesterol (DES) was purchased from Sigma (St. Louis, MO). Ovine FSH was obtained from the National Institutes of Health (NIH). The Bca BEST Labeling kit and Bca BEST Sequencing kit were purchased from Takara, Inc. (Shiga, Japan). A dual luciferase reporter assay system, pGEM-T Easy vector, pGL3-Basic, and pRL-SV vectors were purchased from Promega Corp. (Madison, WI). The QIAGEN plasmid kit was purchased from QIAGEN (Hilden, Germany). FuGENE-6 and Oligotex dT-30 super were obtained from Roche Molecular Biochemicals (Mannheim, Germany). The QuikChange site-directed mutagenesis kit was purchased from Stratagene (La Jolla, CA). Superscript II reverse transcriptase and LipofectoAMINE PLUS were purchased from Invitrogen (Carlsbad, CA).
-32P ATP (110 TBq/mmol) and
-32P dCTP (110 TBq/mmol) were obtained from Amersham Biosciences (Uppsala, Sweden). A protein assay kit was purchased from Bio-Rad Laboratories, Inc. (Hercules, CA). Anti-CREB (sc-186) and anti-Sp1 (sc-59) antibodies were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA).
Animals and cell culture
Granulosa cells were obtained from immature, Kwl:Wistar female rats (21 d old) that received an injection of 2 mg DES in 0.2 ml sesame oil once daily for 4 consecutive days. A granulosa cell culture was performed as described previously (11, 34). Briefly, the ovaries were excised, and granulosa cells were released by puncturing the follicles with a 26-gauge needle. At all times, the animals were treated according to NIH guidelines. Granulosa cells were collected by brief centrifugation and then cultured in Hams F-12/DMEM (vol/vol) supplemented with 1.1 g/liter NaHCO3, 50 mg/liter gentamycin sulfate, and 0.1% BSA on collagen-coated plates in a humidified atmosphere containing 5% CO2/95% air at 37 C.
Isolation and characterization of 5'-upstream of rat GIOT1 gene
The DNA walking kit (CLONTECH Laboratories, Inc., Palo Alto, CA) was used for the isolation of the 5'-upstream DNA fragment of the rat GIOT1 gene. Briefly, samples of rat genomic DNA were individually digested with five different restriction enzymes that recognize 6 bp and produce blunt ends. The digested DNA fragments were then separately adapter-ligated to produce five sets of DNA fragments with adapters at their ends. Each set of DNA fragments was amplified using an adapter-specific 5'-primer (GTAATACGACTCACTATAGGGC) and a rat GIOT1 gene-specific 3'-primer (TGCAGAGGTGGTTCCTAGCTGTCAA). A second PCR was performed using nested primers (the 5'-primer, ACTATAGGGCACGCGTGGT; and the 3'-primer, TGATTGGCGGTGACAGGAGCAACT). The PCR products from each set were analyzed on a 1% agarose gel. The 0.8-kb product was cloned into the pGEM-T Easy vector (Promega Corp.). The nucleotide sequences of two independent clones from each PCR product were determined from both ends by the dye terminator cycle sequencing method.
Primer extension analysis
A primer complementary to 5984 bp of the cDNA (5'-CAACGAGGGTGCTGAGTACCTGGAA) was used as a primer for the extension reaction. The primer was end-labeled with T4 polynucleotide kinase and
-32P ATP at 37 C for 30 min. Total RNA was prepared by the acid guanidinium thiocyanate extraction method (35) from immature rat ovaries primed with or without 30 IU of pregnant mare serum gonadotropin (PMSG) for 6 h or from immature rat lung. The 32P-labeled primer was mixed with (Fig. 1B
, lanes 24) or without (lane 1) 20 µg of total RNA in 20 µl of hybridization buffer [10 mM Tris-HCl (pH 8.0), 1 mM EDTA, 250 mM KCl) and denatured at 65 C for 1 h, after which the mixture was slowly cooled to room temperature. After the addition of 80 µl of the reverse transcriptase reaction mixture [25 mM Tris-HCl (pH 8.0), 90 mM KCl, 12 mM MgCl2, 12 mM dithiothreitol (DTT), 0.6 mM each deoxynucleoside triphosphate, 0.2 mM spermidine, and 400 U of Superscript II reverse transcriptase], the reaction was continued at 37 C for 1 h. The extended transcripts were recovered after RNA digestion with RNase A by phenol extraction and ethanol precipitation and were resolved on an 8% denaturing polyacrylamide gel. M13mp18 sequence ladders were coelectrophoresed in adjacent lanes as size markers, and the resulting gel was then dried and autoradiographed.

View larger version (68K):
[in this window]
[in a new window]
|
Figure 1. A, Nucleotide sequence of the 5'-flanking region of the rat GIOT1 gene. The transcription start site is indicated by an arrow, and the potential TATA box, CRE, and SF-1/Ad4 sites (bottom strand) are enclosed by boxes. A primer used for extension is underlined. The number corresponds to the number of bases from the transcription start site. B, Primer extension analysis of the rat GIOT1 transcription initiation site. A 32P-labeled primer was mixed with (lanes 24) or without (lane 1) 20 µg of total RNA prepared from immature rat: lung (lane 2) and ovary primed with PMSG (lane 4) or without PMSG (lane 3), respectively. Extension products were resolved on an 8% denaturing polyacrylamide gel. A dideoxy sequence ladder for M13mp18 DNA is shown for size determination. The size of the product is also shown, together with an arrow that indicates the product position. Primer extension analysis is representative of the three experiments.
|
|
Plasmids
All of the luciferase constructs contain the pGL3-Basic vector, which lacks both elements of the eukaryotic promoter and enhancer sequences. The deletion constructs of GIOT1 promoter (-282, -161, -122) were obtained by enzymatic digestion of a naturally occurring BstXI, VspI, and HincII restriction site in the -806-bp GIOT1 promoter. Site-directed mutants of the -282 GIOT1 promoter were obtained using the QuikChange Site-Directed Mutagenesis Kit: -282 GIOT1mutCRE, 5'-TCTGACCCTGCTGAGAAACACATCTGtgGTCAAGACGCCCAA used as a forward primer, and 5'-TTGGGCGTCTTGACcaCAGATGTGTTTCTCAGCAGGGTCAGA used as a reverse primer; -282GIOT1mutSF-1, 5'-AGGAACTGTGTCCTGTGAaaTTTCtgACATCCTGRCAACA used as a forward primer, and 5'-TGTTGACAGGATGTCAGAAAttTCACAGGACACAGTTCCT used as a reverse primer. All reporter plasmids were authenticated by DNA sequencing. RSV-protein kinase-inhibiting peptide (PKI) and RSV-PKImut vectors were provided by Dr. R. A. Maurer (Oregon Health and Science University, Portland, OR) (36). An expression vector for the catalytic subunit of protein kinase A was generously supplied by Dr. G. S. McKnight (University of Washington, Seattle, WA). The pCMX/Dax-1 vector was a generous gift from Dr. Ken-ichirou Morohashi (National Institute of Basic Biology, Okazaki, Japan). The expression vector for SF-1 (pcDNA/SF-1) has been described previously (37). Site-directed mutants of the SF-1 expression vector were obtained using the QuikChange Site-Directed Mutagenesis Kit: SF-1 430A, 5'-GTGGAGGTGCGGGCACTGgcCATGCAGGCCAAGGAGTATC used as a forward primer, and 5'-GATACTCCTTGGCCTGCATGgcCAGTGCCCGGCACCTCCAC used as a reverse primer; SF-1 203A, 5'-GTATCCAGAGCCCTACGCCgcCCCCCCTCAACAGCCAGG used as a forward primer, and 5'-CCTGGCTGTTGAGGGGGGgcGGCGTAGGGCTCTGGATAC used as a reverse primer.
Cell culture, transient transfection, and luciferase assay
Rat granulosa cells were cultured as described previously (34) 24 h before transfection. Each reporter or effector plasmid and the pRL Renilla luciferase control vector (for normalization) was mixed with FuGENE 6 (Roche Molecular Biochemicals), and the resulting mixture was added to the cells. After 44 h of transfection, the cells were treated with or without ovine FSH (30 ng/ml).
F9 and NIH3T3 cells were maintained in DMEM containing 10% fetal bovine serum and antibiotics. Cells were dispensed into 24-well plates at 2.5 x 104 cells per well 24 h before transfection. DNA samples that contained each reporter plasmid and the pRL Renilla luciferase control vector (for normalization) with or without an expression plasmid were transfected using LipofectAMINE PLUS (Invitrogen). Cells were harvested 24 h after transfection. Luciferase activity was determined using a dual luciferase reporter assay system. Measurements were made using a Lumat LB9501 luminometer (Berthold Systems, Aliquippa, PA) in a single tube, with the first assay involving the firefly luciferase, followed by the Renilla luciferase assay. Firefly luciferase activities (relative light units) were normalized by Renilla luciferase activities.
EMSAs
Granulosa cells were cultured in 60-mm dishes containing 5 x 106 cells in 5 ml of medium, and FSH was added to the medium 24 h after plating. The cells were collected by a scraper 2 h after FSH treatment and washed with 10 ml of Tris-buffered saline. The resulting cells were suspended in 1 ml of Tris-buffered saline, transferred to an Eppendorf tube (Brinkmann Instruments, Inc., Westbury, NY), and pelleted by centrifugation at 1500 x g for 10 min at 4 C. Nuclei from granulosa cells were prepared by the method of Schreiber et al. (38) with minor modifications. The cell pellet was resuspended in 600 µl of cold buffer A [10 mM HEPES (pH 7.9), 10 mM KCl, 1 mM EDTA, 0.5 mM EGTA, 1 mM DTT, and 0.5 mM PMSF] by gentle pipetting. The cells were allowed to swell on ice for 15 min, after which 37.5 µl of a 10% solution of Nonidet P-40 were added, and the tube was vigorously vortexed for 10 sec. The homogenate was centrifuged at 15,000 x g for 5 min at 4 C. The supernatant, which contained cytoplasm and RNA, was removed; the nuclear pellet was resuspended in 40 µl of ice-cold buffer C [20 mM HEPES (pH 7.9), 0.4 M NaCl, 1 mM EDTA, 1 mM EGTA, 1 mM DTT, and 1 mM PMSF]; and the tube was vigorously shaken at 4 C for 15 min on a shaking platform. The mixture was then centrifuged for 15 min at 15,000 x g at 4 C, and the supernatant, which contained the nuclear extract, was used for EMSA.
Double-stranded DNA fragments were prepared by the annealing of complementary oligonucleotides. The sequences of the sense strands of the double-stranded oligonucleotides were: CREB, 5'-ctagACACATCTGACGTCAAGACG; CREBM, 5'-ctagACACATCTGTGGTCAAGACG; SF-1, 5'-ctagGACAAGCCTGTGACCTTTCT; and SF-1M, 5'-ctagGCAAGCCTGTGAaaTTTCT. A nuclear extract (10 µg proteins) was incubated for 30 min with a 32P-labeled oligonucleotide (0.1 ng) and unlabeled polydeoxyadenosine deoxythymidine or polydeoxyinosinic deoxycytidylic acid in buffer C. In the competition experiments, a 200-fold molar excess of unlabeled competitor DNAs was added. A supershift assay was performed by preincubating the nuclear extracts for 30 min with anti-CREB or anti-Ad4BP antiserum (kindly provided by Dr. Ken-ichirou Morohashi, National Institute of Basic Biology). After the binding reaction, the mixture was subjected to a 6% PAGE in 45 mM Tris-HCl, 45 mM boric acid, 1 mM EDTA at 200 V for 60 min, and the gel was then dried and autoradiographed. Autoradiographic bands were quantified by a fluoroimage analyzer (BAS2000, Fuji Photo Film Co., Ltd., Tokyo, Japan).
Northern blot analysis
Ten micrograms of total RNA were separated by electrophoresis on 1% formaldehyde agarose gels and subsequently transferred to a nylon membrane (Biodyne, ICN Biomedicals, Inc., Glen Cove, NY) followed by UV cross-linking. Each of the cDNA samples was labeled with
-32P dCTP using the random primer labeling method and used as a probe. The blots were stripped and rehybridized to rat glyceraldehyde-3-phosphate dehydrogenase (GAPDH) to account for signal differences due to RNA loading.
Western blot analysis
For the determination of protein expression levels, granulosa cells were washed twice in ice-cold phosphate saline buffer and lysed in 50 mM Tris-HCl (pH 8.0) containing 1% Nonidet P-40, 0.1% sodium dodecyl sulfate, 0.5% deoxycholate, and 1 mM PMSF. The cell debris was removed by centrifugation at 15,000 x g at 4 C for 10 min, and supernatants were used as cell lysates. Proteins were quantified using a Bio-Rad Protein Assay kit. Equal amounts of protein (10 µg) were resolved by 12.5% SDS-PAGE and transferred onto polyvinylidene difluoride membranes. Western blot analysis of SF-1, Dax-1, and Sp1 was performed with each antiserum directed against Ad4BP/SF-1, Dax-1 (kindly provided by Dr. Ken-ichirou Morohashi, National Institute of Basic Biology), and Sp1. Enhanced chemiluminescence Western blot reagents (Amersham Pharmacia Biotech, Arlington Heights, IL) were used for detection.
 |
Results
|
|---|
In an attempt to identify the regulatory elements that control GIOT1 expression, we cloned and sequenced 0.8 kb of the GIOT1 5'-flanking region (Fig. 1A
). These sequences are numbered relative to the transcription initiation site, which was determined by primer extension analysis (Fig. 1B
). A number of putative binding elements for various transcription factors are present, including the conventional TATA box at -23.
To determine whether the GIOT1 5'-flanking region is able to direct the hormonal inducibility, a -806 to +6 fragment was ligated to a pGL3-Basic vector and was then transiently transfected into freshly prepared rat granulosa cells, followed by a 4-h incubation with FSH. As shown in Fig. 2
, treatment with FSH had a marked effect (38-fold) on the induction of promoter activity. Thus, we conclude that the proximal -806 of the GIOT1 promoter contains hormone-response element(s).

View larger version (14K):
[in this window]
[in a new window]
|
Figure 2. 5'-Deletion analysis of the -806/+6 GIOT1 promoter region. Progressive deletions of GIOT1 promoter are schematically illustrated in the left panel. Each vector (100 ng) was transfected by lipofection into freshly prepared rat granulosa cells. Cells without hormone treatment (open bars) and those treated with 30 ng/ml FSH (filled bars) were incubated for 4 h before preparing the extracts for luciferase assays. Luciferase activities were measured, and relative activities are shown. Data are the mean ± SEM values of at least triplicate assays.
|
|
We next performed 5'-deletion analyses to identify specific sequences that regulate FSH-induced promoter activity. Hormonal induction was retained, and the highest activity was exhibited in the construct that has been pruned down to -282 (62-fold). The FSH-induced promoter activity was markedly reduced by truncation of the upstream to -161 and nearly completely abolished by truncation to -122 (67% and 91%, respectively). These results indicate that the region between -282 and -122 contains at least two hormone response sequences.
A closer examination of this sequence revealed the presence of a perfect CRE (TGACGTCA) at position -224/-217 and an SF-1 site at position -142/-136 (TGACCTTT) identified as FSH response sequence in other promoters (Refs.20, 21, 22 ; Fig. 1A
). Although the mutation of each site in the 282 fragment was significantly decreased (76% in CRE and 53% in SF-1 site), simultaneous mutation of both sites abrogated FSH responsiveness (92%) as well as in the 122 fragments (Fig. 3
). Collectively, the 5'-deletion and site-directed mutagenesis studies define an important role for the CRE at -224/-217 and SF-1 site at -142/-136 in gonadotropin-stimulated GIOT1 gene expression.

View larger version (17K):
[in this window]
[in a new window]
|
Figure 3. Effect of mutation in the CRE and SF-1 site within the promoter region of GIOT1 gene. The mutant promoter constructs used are schematically drawn. Each vector (100 ng) was transfected by lipofection into freshly prepared rat granulosa cells. Cells without hormone treatment (open bars) and those treated with 30 ng/ml FSH (filled bars) were incubated for 4 h before preparing the extracts for luciferase assays. Luciferase activities were measured, and relative activities are shown. Data are the mean ± SEM values of at least triplicate assays.
|
|
To examine the issue of whether each region was able to bind to specific factor, nuclear extracts from rat granulosa cells cultured with or without FSH were prepared for use in gel mobility shift assays. As shown in Fig. 4
, a probe containing the CRE at -224/-217 or that of SF-1 binding motif at -142/-136 formed two prominent shifted complexes (Fig. 4
, lanes 1, 5, 9, and 13) that were competed by each unlabeled oligonucleotide containing homologous sequences (lanes 2, 6, 10, and 14) but not by unlabeled nucleotides containing mutated sequences that were used in the site-directed mutagenesis (lanes 3, 7, 11, and 15). Preincubation of the nuclear extracts with a polyclonal antiserum against CREB/activating transcription factor family members abolished the formation of the complexes (lanes 4 and 8). Similarly, anti-Ad4BP/SF-1 antibody completely abolished the formation of the lower major complex, although the formation of the upper minor complex was not affected (lanes 12 and 16). Intensities of the complex bands were not altered after the FSH treatment. These data demonstrate that a member of the CREB/activating transcription factor family binds to the -224/-217 region and that SF-1 is a major transcription factor that binds to the -142/-136 region of the rat GIOT1 gene promoter.

View larger version (81K):
[in this window]
[in a new window]
|
Figure 4. EMSA analyses using the CRE and SF-1 binding sites of the GIOT1 gene. Each end-labeled oligonucleotide was incubated with 10 µg of nuclear extracts from FSH-treated (FSH; lanes 58 and 1316) or FSH-untreated (Control; lanes 14 and 912) granulosa cells. Wild-type (+; lanes 2, 6, 10, and 14) or mutant (M; lanes 3, 7, 11, and 15) unlabeled-oligonucleotides (200-fold molar excess) were used as competitor DNAs. Where indicated, antiserum specific for CREB (lanes 4 and 8) or SF-1 (lanes 12 and 16) was included in the binding reaction as described in Materials and Methods. Arrows indicate the specific DNA-protein complexes.
|
|
Transcriptional cross-talk between the CRE and SF-1 pathways has been reported in several genes (22, 39, 40, 41). To assess the synergistic activation of the GIOT1 gene by SF-1 and the cAMP pathway, various GIOT1 promoter constructs were cotransfected with a vector expressing PKI cDNA (Fig. 5
), the peptide inhibitor of PKA. A vector containing Neo or PKI mutant (PKIM) cDNA that cannot bind and inhibit the PKA-catalytic subunit was used as a control. Cotransfected PKI completely inhibited FSH-activated GIOT1 promoter activity in every construct, whereas Neo or PKIM had no effects.

View larger version (20K):
[in this window]
[in a new window]
|
Figure 5. Effects of the PKA inhibitor on the activation of the GIOT1 promoter in granulosa cells by FSH. Cells were cotransfected with each reporter plasmid (100 ng) and 100 ng plasmid encoding the PKA inhibitor PKI or an inactive mutant of PKIM. Cells treated with or without FSH (30 ng/ml) were incubated for 4 h before preparing the extracts for luciferase assays. Luciferase activities were measured, and relative activities are shown. Data are the mean ± SEM values of at least triplicate assays.
|
|
To reveal the relationship between SF-1 and the cAMP-dependent protein kinase (PKA) pathway, the SF-1-expressing plasmid was next cotransfected with or without the PKA catalytic subunit expression vector in SF-1- and cAMP-PKA pathway-deficient mouse embryonal carcinoma F9 cells (Fig. 6
, A and B). Although SF-1 and the catalytic subunit of PKA individually caused a modest stimulation of the GIOT1 promoter, dramatic synergistic effects were observed in the case of cotransfection. Synergistic activation was increased in proportion to the dose of the PKA or SF-1 expression constructs. This activity was completely abolished as the result of the mutation of the -142/-136 SF-1 site (Fig. 6C
). These findings suggest that interactions between the SF-1 and PKA pathways occur in the GIOT1 promoter.

View larger version (27K):
[in this window]
[in a new window]
|
Figure 6. Dose-dependent effect of SF-1 and PKA on the synergistic activation in mouse embryonal carcinoma F9 cells. A, The -282 wild-type reporter was transfected into cells with or without a catalytic subunit of the PKA expression vector (100 ng) and increasing amounts of the SF-1 expression vector (0, 1, 5, 10 ng). The total amount of transfected plasmid was adjusted with an empty vector. B, The -282 wild-type reporter was transfected with or without the SF-1 expression vector (5 ng) and increasing amounts of a catalytic subunit of the PKA expression vector (0, 25, 50, 100 ng). The total amount of transfected plasmid was adjusted with an empty vector. C, The -282 and -122 wild-type or mutagenized reporters were transfected with a catalytic subunit of PKA expression vector (100 ng) and SF-1 expression vector (5 ng). Luciferase activities were measured, and relative activities are shown. Data are mean ± SEM values of at least triplicate assays.
|
|
However, the underlying mechanism(s) by which the activation of PKA leads to an increased expression of SF-1 target genes remains elusive. SF-1 contains several putative phosphorylation sites for different protein kinases. One possibility is that the cAMP-PKA pathway leads to the phosphorylation of SF-1, thus increasing its transcriptional activity. Using site-directed mutagenesis, we mutated the putative PKA site by substituting Ser430 for Ala and cotransfected with the catalytic subunit of PKA (Fig. 7
). The mutated form of SF-1 transactivated GIOT1 reporter gene equally as the wild-type form of SF-1 did in the presence of the catalytic subunit of PKA. Hammer et al. (39) reported that phosphorylation of Ser203 is mediated by the MAPK pathway and increases the transcriptional activity of SF-1. In some cells, cAMP activates the MAPK pathway via PKA, and the possibility that PKA acts indirectly through modulation of the MAPK pathway cannot be excluded. To examine this issue, an expression plasmid encoding SF-1 carrying a mutation in the MAPK phosphorylation site (Ser203Ala) was cotransfected with the catalytic subunit of PKA. However, mutation of the MAPK phosphorylation site in SF-1 had no effect on the ability of PKA to stimulate SF-1-dependent GIOT1 promoter activity. These results indicate that Ser430 or Ser203 is not essential for PKA-stimulated SF-1 transcriptional activity.

View larger version (20K):
[in this window]
[in a new window]
|
Figure 7. Effect of mutation in the potential PKA or MAPK phosphorylation site of SF-1 protein on the activity of the GIOT1 promoter in F9 cells. The -282 wild-type reporter was transfected with a catalytic subunit of PKA expression vector (100 ng) and each SF-1 expression vector (5 ng). Luciferase activities were measured, and relative activities are shown. Data are mean ± SEM values of at least triplicate assays.
|
|
SF-1 mRNA levels are largely unaffected by FSH or agents that stimulate cAMP production in granulosa cells. Because SF-1-mediated transactivation is inhibited by Dax-1 via a direct interaction with SF-1, the issue of whether Dax-1 gene expression is influenced by FSH and whether Dax-1 is able to inhibit the SF-1-dependent GIOT1 promoter activity was examined. Consistent with previous reports, SF-1 mRNA (Fig. 8A
) and protein levels (Fig. 8B
) remained nearly constant for at least 4 h after the FSH treatment. In contrast, Dax-1 mRNA and protein levels were markedly decreased within 2 h.

View larger version (47K):
[in this window]
[in a new window]
|
Figure 8. Regulation of SF-1 and Dax-1 mRNA (A) and protein (B) levels by FSH. Granulosa cells isolated from immature DES-primed rats were cultured and treated with FSH (30 ng/ml) for the indicated times, and the total RNA or protein was extracted. A, Northern analysis was performed using labeled SF-1, Dax-1, and GAPDH cDNA. A single blot was sequentially probed with SF-1, Dax-1, and GAPDH. B, Western blot analyses were performed with antibodies to Ad4BP/SF-1, Dax-1, and Sp1 using the same lysates.
|
|
To determine whether Dax-1 is able to inhibit the SF-1-dependent GIOT1 promoter activation, GIOT1-promoter constructs were cotransfected with the SF-1 expression vector, with and without the various amounts of Dax-1 expression vector in SF-1-/Dax-1-deficient mouse embryonic fibroblasts, NIH 3T3 cells (Fig. 9A
). The cotransfected SF-1 expression plasmids induced about a 2.6-fold increase in luciferase activity. Dax-1 strongly diminished the SF-1-mediated induction of GIOT1 promoter activity in a dose-dependent fashion. Five nanograms of Dax-1 plasmids nearly completely abolished SF-1-induced activity. Dax-1 had no effect on GIOT1 promoter activity in the absence of the SF-1 expression vector. Hence, Dax-1 represses the SF-1-dependent expression of GIOT1 gene. Finally, effects of Dax-1 overexpression on the GIOT1-promoter activity in granulosa cells were examined. As shown in Fig. 9B
, cotransfection of the Dax-1 expression vector markedly suppressed the GIOT1-promoter activity under the FSH-stimulated condition (38%). Mutation of the SF-1 site in the GIOT1-promoter caused partial reduction of the promoter activity. At the same time, the Dax-1-mediated repression was not evident when the mutated promoter construct was used. These results indicate that Dax-1 represses the SF-1-dependent expression of GIOT1 gene in granulosa cells via the SF-1 binding site of GIOT1 promoter.

View larger version (16K):
[in this window]
[in a new window]
|
Figure 9. Effects of Dax-1 expression on GIOT1 promoter activity. A, Effects of Dax-1 on SF-1- dependent GIOT1 promoter activity in NIH3T3 cells. Cells were transfected with the indicated GIOT1 promoter construct in the presence of increasing amounts (15 ng) of Dax-1 expression vector with SF-1 expression plasmid (5 ng). The total amount of transfected plasmid was adjusted with an empty vector. B, Effects of Dax-1 on the activation of the GIOT1 promoter in granulosa cells by FSH. Cells were cotransfected with reporter plasmid (100 ng) and 5 ng of the Dax-1 expression vector or with the empty vector. Extracts for luciferase assay were prepared from cells treated with or without FSH (30 ng/ml) for 4 h. Luciferase activities were measured, and relative activities are shown. Data are the mean ± SEM values of at least triplicate assays.
|
|
 |
Discussion
|
|---|
GIOT1 mRNA is acutely induced in cultured granulosa cells by FSH reaching maximal levels within 2 h (11). In this study, we explored the molecular mechanisms that regulate the nature of this expression of the GIOT1 gene. The synergistic action of CREB and SF-1 and rapid down-regulation of Dax-1 cause acute induction of GIOT1 gene by FSH via the cAMP-PKA pathway. It is noteworthy that the GIOT1 gene is expressed in the ovary, testis, adrenal gland, and pituitary, a pattern that largely coincides with the expression profile of SF-1 (16). Consistent with this pattern of tissue-specific expression, the GIOT1 promoter is most active in SF-1-expressing cells (data not shown). SF-1 is a transcription factor that belongs to the nuclear orphan receptor superfamily. It regulates the cell-specific expression of a number of genes involved in steroidogenesis, reproduction, and male gonadal differentiation (18, 19). The monometric form of SF-1 binds to its recognition elements, PyCAAGGPyPyPu and PuPuAGGTCA motifs. The latter has a 100% identity to the sequence in the GIOT1 promoter at positions -142/-136. Indeed, this site is occupied by SF-1 and probably determines the tissue-specific expression of the GIOT1 gene as well as FSH responsiveness. A consensus CRE sequence (TGACGTCA) also exists in the FSH-responsive region of the GIOT1 promoter and is occupied by CREB as in a variety of the cAMP-responsive genes.
The SF-1 and cAMP pathways are involved in the regulation of a number of genes in the gonad and adrenal glands. In particular, the interaction of CREB- and SF-1-binding sites confers a high transcriptional activity (22, 40, 41, 42). Ito et al. (41) reported that in the inhibin-
promoter, SF-1 directly interacts with CREB, leading to the recruitment of the CREB binding protein and an increased level of histone acetylation. CREB is phosphorylated at serine133 by PKA, and the interaction between SF-1 and phosphorylated CREB has been proposed as a mechanism for the synergism between the SF-1 and cAMP. This model could also be applied to the GIOT1 promoter, although the DNA-binding ability of CREB and SF-1 was not enhanced by FSH and about half of the intact activity remained even when the CREB-binding site was ablated. In addition, because not all SF-1-responsive genes contain CRE, it is entirely possible that other mechanism(s) exist. Our results indicate that the release from the Dax-1-mediated transcriptional repression by the down-regulation of its expression is at least one of the important mechanisms for inducing SF-1 target genes via the cAMP-PKA pathway. Recently, Osman et al. (43) reported that a similar mechanism is responsible for aldosterone biosynthesis in bovine adrenocortical cells by angiotensin II. There are several possible explanations for PKA leading to increased SF-1-dependent transcription in the GIOT1 promoter. One possibility is that the cAMP pathway leads to the phosphorylation of SF-1, thus increasing its transcriptional activity. Carlone and Richards (22, 39) reported that SF-1 is phosphorylated in granulosa cells on FSH stimulation. SF-1 is also phosphorylated by PKA in vitro (23), and the primary structure of SF-1 contains a putative PKA phosphorylation site Ser430 (44). However, mutation of this site has no effect on the SF-1-dependent GIOT1 promoter activity enhanced by PKA as Aesoy et al. (26) investigated in artificial reporter constructs. Hammer et al. (39) reported that phosphorylation of Ser203 is mediated by the MAPK pathway. In granulosa cells, FSH activates the MAPK pathway via PKA. However, mutation of the MAPK phosphorylation site (203S
A) in SF-1 had no effect on the ability of PKA to stimulate SF-1-dependent GIOT1 promoter activity. A recent study suggested that PKA increases the stability of SF-1 protein in transient transfected cells, but physiological relevance of this is unclear (26). This issue should be a subject for further investigation because SF-1-mediated transactivation is also enhanced by PKA in the Dax-1-deficient cells.
Dax-1 expression in granulosa cells varies with the follicle maturation stage and completely disappears when they differentiate into the corpus luteum (45, 46). Our results suggest that activation of the cAMP-PKA pathway by gonadotropins is responsible for this down-regulation. Dax-1 inhibits SF-1-mediated transactivation via a direct interaction with SF-1 (30, 31, 32) or through binding to single-stranded hairpin DNA structures (33). When granulosa cells differentiate into luteal cells by the actions of gonadotropins, the expression of StAR (22, 47), P450SCC (20, 25), and 3ß-hydroxysteroid dehydrogenase (48, 49), well-known SF-1 targets, is induced, and active steroidogenesis is initiated (5, 6). It is reasonable to assume that down-regulation of Dax-1 expression by gonadotropins is necessary for the functional differentiation (steroidogenic) to the corpus luteum. This assumption is supported by the findings that the ectopic expression of Dax-1 represses the expression of enzymes involved in steroidogenesis and inhibits the production of steroid hormone (43, 50).
Although the precise mechanism underlying the down-regulation of Dax-1 mRNA by FSH is not clear, an inhibition of Dax-1 gene transcription is likely responsible for this down-regulation; FSH did not accelerate the decay rate of mRNA under the condition of blockade of transcription (our unpublished data). To date, SF-1 (46, 51) and WT1 (52) have been reported to be implicated in the regulation of Dax-1 transcription. It is evident that SF-1 is important for the transcription of the Dax-1 gene in vivo. The expression of Dax-1 was significantly impaired in knock-out mice of the Ftz-f1 gene, which encodes SF-1 (46). However, the transcription of most SF-1 target genes, including GIOT1, is enhanced in granulosa cells on FSH-stimulation. We cannot explain this apparent discrepancy at this time. It is noteworthy, however, that the recently identified SF-1 site essential for Dax-1 expression in the developing gonad is not necessary in the adult gonad (51). Thus, SF-1 might not be involved in Dax-1 expression in the adult gonad. Although the involvement of WT-1 is also evident in the developing gonad, there is no evidence for this in adults. FSH also leads to the potent down-regulation of Dax-1 expression in cultured adult Sertoli cells, although it requires a longer time (8 h) and de novo protein synthesis (53). Therefore, the underlying mechanism is likely quite different from granulosa cells. Further studies will be necessary to understand the regulatory mechanisms of the Dax-1 gene expression.
In summary, we reported that the acute induction of the GIOT1 gene by gonadotropins is caused by the synergistic action of CREB and SF-1 and the rapid down-regulation of Dax-1 expression. We propose that a release from the Dax-1-mediated transcriptional repression can be applied to the transactivation of many other SF-1 target genes induced by gonadotropins. This should also be an important event in the differentiation of granulosa cells into steroidogenic luteal cells.
 |
Acknowledgments
|
|---|
We are grateful to Dr. Ken-ichirou Morohashi for providing plasmid and antisera. We also thank Dr. R. A. Maurer and Dr. G. S. McKnight for the generous gift of vectors, and Ms. Y. Inoue and Ms. M. Nakagawa for technical assistance.
 |
Footnotes
|
|---|
This work was supported in part by grants from Grant in Aid of Ministry of Science, Culture, Sports and Education, and Smoking Research Foundation.
Abbreviations: Ad4BP, Adrenal 4 binding protein; CRE, cAMP response element; CREB, CRE binding protein; DES, diethylstilbesterol; DTT, dithiothreitol; GAPDH, glyceraldehyde-3-phosphate dehydrogenase, GIOT, gonadotropin-inducible ovarian transcription factor; PKA, protein kinase A; PKI, protein kinase-inhibiting peptide; PKIM, PKI mutant; PMSG, pregnant mare serum gonadotropin; SF-1, steroidogenic factor 1; StAR, steroidogenic acutely regulatory protein.
Received October 15, 2002.
Accepted for publication January 28, 2003.
 |
References
|
|---|
- Richards JS 1980 Maturation of ovarian follicles: actions and interactions of pituitary and ovarian hormones on follicular cell differentiation. Physiol Rev 60:5189[Free Full Text]
- Kumar TR, Wang Y, Lu N, Matzuk MM 1997 Follicle stimulating hormone is required for ovarian follicle maturation but not male fertility. Nat Genet 15:201204[CrossRef][Medline]
- Burns KH, Matzuk MM 2002 Minireview: genetic models for the study of gonadotropin actions. Endocrinology 143:28232835[Abstract/Free Full Text]
- Hsueh AJ, Adashi EY, Jones PB, Welsh Jr TH 1984 Hormonal regulation of the differentiation of cultured ovarian granulosa cells. Endocr Rev 5:76127[Abstract/Free Full Text]
- Richards JS 1994 Hormonal control of gene expression in the ovary. Endocr Rev 15:725751[Abstract/Free Full Text]
- Richards JS 2001 Perspective: the ovarian folliclea perspective in 2001. Endocrinology 142:21842193[Free Full Text]
- Silverman E, Eimerl S, Orly J 1999 CCAAT enhancer-binding protein ß and GATA-4 binding regions within the promoter of the steroidogenic acute regulatory protein (StAR) gene are required for transcription in rat ovarian cells. J Biol Chem 274:1798717996[Abstract/Free Full Text]
- Turner IM, Saunders PT, Shimasaki S, Hillier SG 1989 Regulation of inhibin subunit gene expression by FSH and estradiol in cultured rat granulosa cells. Endocrinology 125:27902792[Abstract/Free Full Text]
- Alliston TN, Maiyar AC, Buse P, Firestone GL, Richards JS 1997 Follicle stimulating hormone-regulated expression of serum/glucocorticoid-inducible kinase in rat ovarian granulosa cells: a functional role for the Sp1 family in promoter activity. Mol Endocrinol 11:19341949[Abstract/Free Full Text]
- Pennybacker M, Herman B 1991 Follicle-stimulating hormone increases c-fos mRNA levels in rat granulosa cells via a protein kinase C-dependent mechanism. Mol Cell Endocrinol 80:1120[CrossRef][Medline]
- Mizutani T, Yamada K, Yazawa T, Okada T, Minegishi T, Miyamoto K 2001 Cloning and characterization of gonadotropin-inducible ovarian transcription factors (GIOT1 and -2) that are novel members of the (Cys)(2)-(His)(2)-type zinc finger protein family. Mol Endocrinol 15:16931705[Abstract/Free Full Text]
- Luo X, Ikeda Y, Parker KL 1994 A cell-specific nuclear receptor is essential for adrenal and gonadal development and sexual differentiation. Cell 77:481490[CrossRef][Medline]
- Ikeda Y, Luo X, Abbud R, Nilson JH, Parker KL 1995 The nuclear receptor steroidogenic factor 1 is essential for the formation of the ventromedial hypothalamic nucleus. Mol Endocrinol 9:478486[Abstract/Free Full Text]
- Sadovsky Y, Crawford PA, Woodson KG, Polish JA, Clements MA, Tourtellotte LM, Simburger K, Milbrandt J 1995 Mice deficient in the orphan receptor steroidogenic factor 1 lack adrenal glands and gonads but express P450 side-chain-cleavage enzyme in the placenta and have normal embryonic serum levels of corticosteroids. Proc Natl Acad Sci USA 92:1093910943[Abstract/Free Full Text]
- Shinoda K, Lei H, Yoshii H, Nomura M, Nagano M, Shiba H, Sasaki H, Osawa Y, Ninomiya Y, Niwa O, Morohashi, K, Li E 1995 Developmental defects of the ventromedial hypothalamic nucleus and pituitary gonadotroph in the Ftz-F1 disrupted mice. Dev Dyn 204:2229[Medline]
- Ikeda Y, Lala DS, Luo X, Kim E, Moisan MP, Parker KL 1993 Characterization of the mouse FTZ-F1 gene, which encodes a key regulator of steroid hydroxylase gene expression. Mol Endocrinol 7:852860[Abstract/Free Full Text]
- Morohashi K 1999 Gonadal and extragonadal functions of Ad4BP/SF-1: developmental aspects. Trends Endocrinol Metab 10:169173[CrossRef][Medline]
- Parker KL, Schimmer BP 1997 Steroidogenic factor 1: a key determinant of endocrine development and function. Endocr Rev 18:361377[Abstract/Free Full Text]
- Caron KM, Ikeda Y, Soo SC, Stocco DM, Parker KL, Clark BJ 1997 Characterization of the promoter region of the mouse gene encoding the steroidogenic acute regulatory protein. Mol Endocrinol 11:138147[Abstract/Free Full Text]
- Clemens JW, Lala DS, Parker KL, Richards JS 1994 Steroidogenic factor-1 binding and transcriptional activity of the cholesterol side-chain cleavage promoter in rat granulosa cells. Endocrinology 134:14991508[Abstract/Free Full Text]
- LaVoie HA, Garmey JC, Veldhuis JD 1999 Mechanisms of insulin-like growth factor I augmentation of follicle-stimulating hormone-induced porcine steroidogenic acute regulatory protein gene promoter activity in granulosa cells. Endocrinology 140:146153[Abstract/Free Full Text]
- Carlone DL, Richards JS 1997 Functional interactions, phosphorylation, and levels of 3', 5'-cyclic adenosine monophosphate-regulatory element-binding protein and steroidogenic factor 1 mediate hormone-regulated and constitutive expression of aromatase in gonadal cells. Mol Endocrinol 11:292304[Abstract/Free Full Text]
- Zhang P, Mellon SH 1996 The orphan nuclear receptor steroidogenic factor-1 regulates the cyclic adenosine 3', 5'-monophosphate-mediated transcriptional activation of rat cytochrome P450c17 (17-hydroxylase/c17-20 lyase). Mol Endocrinol 10:147158[Abstract/Free Full Text]
- Chau YM, Crawford PA, Woodson KG, Polish JA, Olson LM, Sadovsky Y 1997 Role of steroidogenic factor-1 in basal and 3', 5'-cyclic adenosine monophosphate mediated regulation of cytochrome P450 side-chain cleavage enzyme in the mouse. Biol Reprod 57:765771[Abstract]
- Mamluk R, Greber Y, Meidan R 1999 Hormonal regulation of messenger ribonucleic acid expression for steroidogenic factor-1, steroidogenic acute regulatory protein, and cytochrome P450 side-chain cleavage in bovine luteal cells. Biol Reprod 60:628634[Abstract/Free Full Text]
- Aesoy R, Mellgren G, Morohashi K, Lund J 2002 Activation of cAMP-dependent protein kinase increases the protein level of steroidogenic factor-1. Endocrinology 143:295303[Abstract/Free Full Text]
- Zanaria E, Muscatelli F, Bardoni B, Strom TM, Guioli S, Guo W, Lalli E, Moser C, Walker AP, McCabe ER, Meitinger T, Monaco AP, Sassone-Corsi P, Camerino G 1994 An unusual member of the nuclear hormone receptor superfamily responsible for X-linked adrenal hypoplasia congenita. Nature 372:635641[CrossRef][Medline]
- Muscatelli F, Strom TM, Walker AP, Zanaria E, Recan D, Meindl A, Bardoni B, Guioli S, Zehetner G, Rabl W, Schwarz HP, Kaplan J-C, Camerino G, Meitinger T, Monaco AP 1994 Mutations in the DAX-1 gene give rise to both X-linked adrenal hypoplasia congenita and hypogonadotropic hypogonadism. Nature 372:672676[CrossRef][Medline]
- Ikeda Y, Swain A, Weber TJ, Hentges KE, Zanaria E, Lalli E, Tamai KT, Sassone-Corsi P, Lovell-Badge R, Camerino G, Parker KL 1996 Steroidogenic factor 1 and Dax-1 colocalize in multiple cell lineages: potential links in endocrine development. Mol Endocrinol 10:12611272[Abstract/Free Full Text]
- Ito M, Yu R, Jameson JL 1997 DAX-1 inhibits SF-1-mediated transactivation via a carboxy-terminal domain that is deleted in adrenal hypoplasia congenita. Mol Cell Biol 17:14761483[Abstract]
- Crawford PA, Dorn C, Sadovsky Y, Milbrandt J 1998 Nuclear receptor DAX-1 recruits nuclear receptor corepressor N-CoR to steroidogenic factor 1. Mol Cell Biol 18:29492956[Abstract/Free Full Text]
- Nachtigal MW, Hirokawa Y, Enyeart-Van Houten DL, Flanagan JN, Hammer GD, Ingraham HA 1998 Wilms tumor 1 and Dax-1 modulate the orphan nuclear receptor SF-1 in sex-specific gene expression. Cell 93:445454[CrossRef][Medline]
- Zazopoulos E, Lalli E, Stocco DM, Sassone-Corsi P 1997 DNA binding and transcriptional repression by DAX-1 blocks steroidogenesis. Nature 390:311315[CrossRef][Medline]
- Yoshino M, Mizutani T, Yamada K, Tsuchiya M, Minegishi T, Yazawa T, Kawata H, Sekiguchi T, Kajitani T, Miyamoto K 2002 Early growth response gene-1 regulates the expression of the rat luteinizing hormone receptor gene. Biol Reprod 66:18131819[Abstract/Free Full Text]
- Chomczynski P, Sacchi N 1987 Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162:156159[Medline]
- Thomas J, Van Patten SM, Howard P, Day KH, Mitchell RD, Sosnick T, Trewhella J, Walsh DA, Maurer RA 1991 Expression in Escherichia coli and characterization of the heat-stable inhibitor of the cAMP-dependent protein kinase. J Biol Chem 266:1090610911[Abstract/Free Full Text]
- Mizutani T, Yamada K, Minegishi T, Miyamoto K 2000 Transcriptional regulation of scavenger receptor class B type I gene. J Biol Chem 275:2251222519[Abstract/Free Full Text]
- Schreiber E, Matthias P, Muller MM, Schaffner W 1989 Rapid detection of octamer binding proteins with mini-extracts, prepared from a small number of cells. Nucleic Acids Res 17:6419[Free Full Text]
- Hammer GD, Krylova I, Zhang Y, Darimont BD, Simpson K, Weigel NL, Ingraham HA 1999 Phosphorylation of the nuclear receptor SF-1 modulates cofactor recruitment: integration of hormone signaling in reproduction and stress. Mol Cell 3:521526[CrossRef][Medline]
- Carlone DL, Richards JS 1997 Evidence that functional interactions of CREB and SF-1 mediate hormone regulated expression of the aromatase gene in granulosa cells and constitutive expression in R2C cells. J Steroid Biochem Mol Biol 61:223231[CrossRef][Medline]
- Ito M, Park Y, Weck J, Mayo KE, Jameson JL 2000 Synergistic activation of the inhibin-
promoter by steroidogenic factor-1 and cyclic adenosine 3', 5'-monophosphate. Mol Endocrinol 14:6681[Abstract/Free Full Text]
- Manna PR, Dyson MT, Eubank DW, Clark BJ, Lalli E, Sassone-Corsi P, Zeleznik AJ, Stocco DM 2002 Regulation of steroidogenesis and the steroidogenic acute regulatory protein by a member of the cAMP response-element binding protein family. Mol Endocrinol 16:184199[Abstract/Free Full Text]
- Osman H, Murigande C, Nadakal A, Capponi AM 2002 Repression of DAX-1 and induction of SF-1 expression: two mechanisms contributing to the activation of aldosterone biosynthesis in adrenal glomerulosa cells. J Biol Chem 277:4125941267[Abstract/Free Full Text]
- Honda S, Morohashi K, Nomura M, Takeya H, Kitajima M, Omura T 1993 Ad4BP regulating steroidogenic P-450 gene is a member of steroid hormone receptor superfamily. J Biol Chem 268:74947502[Abstract/Free Full Text]
- Morohashi K, Iida H, Nomura M, Hatano O, Honda S, Tsukiyama T, Niwa O, Hara T, Takakusu A, Shibata Y, Omura T 1994 Functional difference between Ad4BP and ELP, and their distributions in steroidogenic tissues. Mol Endocrinol 8:643653[Abstract/Free Full Text]
- Kawabe K, Shikayama T, Tsuboi H, Oka S, Oba K, Yanase T, Nawata H, Morohashi K 1999 Dax-1 as one of the target genes of Ad4BP/SF-1. Mol Endocrinol 13:12671284[Abstract/Free Full Text]
- Sandhoff TW, Hales DB, Hales KH, McLean MP1998 Transcriptional regulation of the rat steroidogenic acute regulatory protein gene by steroidogenic factor 1. Endocrinology 139:48204831
- Leers-Sucheta S, Morohashi K, Mason JI, Melner MH 1997 Synergistic activation of the human type II 3ß-hydroxysteroid dehydrogenase/
5-
4 isomerase promoter by the transcription factor steroidogenic factor-1/adrenal 4-binding protein and phorbol ester. J Biol Chem 272:79607967[Abstract/Free Full Text]
- Peng L, Payne AH 2002 AP-2
and the homeodomain protein distal-less 3 are required for placental-specific expression of the murine 3 ß-hydroxysteroid dehydrogenase VI gene, Hsd3b6. J Biol Chem 277:79457954[Abstract/Free Full Text]
- Lalli E, Melner MH, Stocco DM, Sassone-Corsi P 1998 DAX-1 blocks steroid production at multiple levels. Endocrinology 139:42374243[Abstract/Free Full Text]
- Hoyle C, Narvaez V, Alldus G, Lovell-Badge R, Swain A 2002 Dax1 expression is dependent on steroidogenic factor 1 in the developing gonad. Mol Endocrinol 16:747756[Abstract/Free Full Text]
- Kim J, Prawitt D, Bardeesy N, Torban E, Vicaner C, Goodyer P, Zabel B, Pelletier J 1999 The Wilms tumor suppressor gene (WT1) product regulates Dax-1 gene expression during gonadal differentiation. Mol Cell Biol 19:22892299[Abstract/Free Full Text]
- Tamai KT, Monaco L, Alastalo TP, Lalli E, Parvinen M, Sassone-Corsi P 1996 Hormonal and developmental regulation of DAX-1 expression in Sertoli cells. Mol Endocrinol 10:15611569[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
T. Yazawa, Y. Inanoka, T. Mizutani, M. Kuribayashi, A. Umezawa, and K. Miyamoto
Liver Receptor Homolog-1 Regulates the Transcription of Steroidogenic Enzymes and Induces the Differentiation of Mesenchymal Stem Cells into Steroidogenic Cells
Endocrinology,
August 1, 2009;
150(8):
3885 - 3893.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Kouzu-Fujita, Y. Mezaki, S. Sawatsubashi, T. Matsumoto, I. Yamaoka, T. Yano, Y. Taketani, H. Kitagawa, and S. Kato
Coactivation of Estrogen Receptor {beta} by Gonadotropin-Induced Cofactor GIOT-4
Mol. Cell. Biol.,
January 1, 2009;
29(1):
83 - 92.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Yazawa, M. Uesaka, Y. Inaoka, T. Mizutani, T. Sekiguchi, T. Kajitani, T. Kitano, A. Umezawa, and K. Miyamoto
Cyp11b1 Is Induced in the Murine Gonad by Luteinizing Hormone/Human Chorionic Gonadotropin and Involved in the Production of 11-Ketotestosterone, a Major Fish Androgen: Conservation and Evolution of the Androgen Metabolic Pathway
Endocrinology,
April 1, 2008;
149(4):
1786 - 1792.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Qiu, S. Yao, C. Hindmarch, V. Antunes, J. Paton, and D. Murphy
Transcription Factor Expression in the Hypothalamo-Neurohypophyseal System of the Dehydrated Rat: Upregulation of Gonadotrophin Inducible Transcription Factor 1 mRNA Is Mediated by cAMP-Dependent Protein Kinase A
J. Neurosci.,
February 28, 2007;
27(9):
2196 - 2203.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Stocco, C. Telleria, and G. Gibori
The Molecular Control of Corpus Luteum Formation, Function, and Regression
Endocr. Rev.,
February 1, 2007;
28(1):
117 - 149.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Saxena, R. Escamilla-Hernandez, L. Little-Ihrig, and A. J. Zeleznik
Liver Receptor Homolog-1 and Steroidogenic Factor-1 Have Similar Actions on Rat Granulosa Cell Steroidogenesis
Endocrinology,
February 1, 2007;
148(2):
726 - 734.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Cui, W. Li, W. Liu, K. Yang, Y. Pang, and L. Haoran
Production of Recombinant Orange-Spotted Grouper (Epinephelus coioides) Luteinizing Hormone in Insect Cells by the Baculovirus Expression System and Its Biological Effect
Biol Reprod,
January 1, 2007;
76(1):
74 - 84.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Yazawa, T. Mizutani, K. Yamada, H. Kawata, T. Sekiguchi, M. Yoshino, T. Kajitani, Z. Shou, A. Umezawa, and K. Miyamoto
Differentiation of Adult Stem Cells Derived from Bone Marrow Stroma into Leydig or Adrenocortical Cells
Endocrinology,
September 1, 2006;
147(9):
4104 - 4111.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K.-H. Song, Y.-Y. Park, H. J. Kee, C. Y. Hong, Y.-S. Lee, S.-W. Ahn, H.-J. Kim, K. Lee, H. Kook, I.-K. Lee, et al.
Orphan Nuclear Receptor Nur77 Induces Zinc Finger Protein GIOT-1 Gene Expression, and GIOT-1 Acts as a Novel Corepressor of Orphan Nuclear Receptor SF-1 via Recruitment of HDAC2
J. Biol. Chem.,
June 9, 2006;
281(23):
15605 - 15614.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Ragazzon, A.-M. Lefrancois-Martinez, P. Val, I. Sahut-Barnola, C. Tournaire, C. Chambon, J.-L. Gachancard-Bouya, R.-J. Begue, G. Veyssiere, and A. Martinez
Adrenocorticotropin-Dependent Changes in SF-1/DAX-1 Ratio Influence Steroidogenic Genes Expression in a Novel Model of Glucocorticoid-Producing Adrenocortical Cell Lines Derived from Targeted Tumorigenesis
Endocrinology,
April 1, 2006;
147(4):
1805 - 1818.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Tsuchiya, M. Nakajima, S. Takagi, M. Katoh, W. Zheng, C. R Jefcoate, and T. Yokoi
Binding of Steroidogenic Factor-1 to the Regulatory Region Might Not Be Critical for Transcriptional Regulation of the Human CYP1B1 Gene.
J. Biochem.,
March 1, 2006;
139(3):
527 - 534.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F.-Q. Yu, C.-S. Han, W. Yang, X. Jin, Z.-Y. Hu, and Y.-X. Liu
Activation of the p38 MAPK pathway by follicle-stimulating hormone regulates steroidogenesis in granulosa cells differentially
J. Endocrinol.,
July 1, 2005;
186(1):
85 - 96.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Park, E. T. Maizels, Z. J. Feiger, H. Alam, C. A. Peters, T. K. Woodruff, T. G. Unterman, E. J. Lee, J. L. Jameson, and M. Hunzicker-Dunn
Induction of Cyclin D2 in Rat Granulosa Cells Requires FSH-dependent Relief from FOXO1 Repression Coupled with Positive Signals from Smad
J. Biol. Chem.,
March 11, 2005;
280(10):
9135 - 9148.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. Zheng and C. R. Jefcoate
Steroidogenic Factor-1 Interacts with cAMP Response Element-Binding Protein to Mediate cAMP Stimulation of CYP1B1 via a Far Upstream Enhancer
Mol. Pharmacol.,
February 1, 2005;
67(2):
499 - 512.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Jo and D. M. Stocco
Regulation of Steroidogenesis and Steroidogenic Acute Regulatory Protein in R2C Cells by DAX-1 (Dosage-Sensitive Sex Reversal, Adrenal Hypoplasia Congenita, Critical Region on the X Chromosome, Gene-1)
Endocrinology,
December 1, 2004;
145(12):
5629 - 5637.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Saxena, R. Safi, L. Little-Ihrig, and A. J. Zeleznik
Liver Receptor Homolog-1 Stimulates the Progesterone Biosynthetic Pathway during Follicle-Stimulating Hormone-Induced Granulosa Cell Differentiation
Endocrinology,
August 1, 2004;
145(8):
3821 - 3829.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Kajitani, T. Mizutani, K. Yamada, T. Yazawa, T. Sekiguchi, M. Yoshino, H. Kawata, and K. Miyamoto
Cloning and Characterization of Granulosa Cell High-Mobility Group (HMG)-Box Protein-1, a Novel HMG-Box Transcriptional Regulator Strongly Expressed in Rat Ovarian Granulosa Cells
Endocrinology,
May 1, 2004;
145(5):
2307 - 2318.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Fayard, K. Schoonjans, J.-S. Annicotte, and J. Auwerx
Liver Receptor Homolog 1 Controls the Expression of Carboxyl Ester Lipase
J. Biol. Chem.,
September 12, 2003;
278(37):
35725 - 35731.
[Abstract]
[Full Text]
[PDF]
|
 |
|