help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Di Nino, D. L.
Right arrow Articles by Linsenmayer, T. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Di Nino, D. L.
Right arrow Articles by Linsenmayer, T. F.
Endocrinology Vol. 144, No. 5 1979-1983
Copyright © 2003 by The Endocrine Society

Positive Regulation of Endochondral Cartilage Growth by Perichondrial and Periosteal Calcitonin

Dana L. Di Nino and Thomas F. Linsenmayer

Department of Anatomy and Cellular Biology, Tufts University Medical School, Boston, Massachusetts 02111

Address all correspondence and requests for reprints to: Thomas F. Linsenmayer, Department of Anatomy and Cellular Biology, Tufts University Medical School, 136 Harrison Avenue, Boston, Massachusetts 02111. E-mail: thomas.linsenmayer{at}tufts.edu.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results and Discussion
 References
 
Our previous studies showed that during the embryonic development of avian long bones, growth of the cartilaginous component is regulated by multiple factors secreted by the surrounding perichondrium (PC) and periosteum (PO). The activities of these factors—which include both positive and negative regulators—can be detected in conditioned media from PC and PO cell cultures. In the present study, we have obtained evidence suggesting that a positive regulator is the peptide hormone calcitonin (CT). By mass spectrometry of conditioned media, one of the components has a molecular mass of 3.4 kDa, the size of chicken CT. By RT-PCR the tissue and cell cultures contain mRNA for CT, and by immunohistochemistry the cells contain the protein. That the protein is normally secreted is suggested by further immunohistochemical analyses, which show that cells treated with monensin, a compound that blocks exocytosis, contain elevated intracellular CT. Functionally, the addition of CT to organ cultures of long bone rudiments effects increased growth in a manner similar to that of the PC- and PO-conditioned media. Taken together, these data suggest that secretion of CT by the PC and PO effects, in a paracrine manner, positive stimulation of growth in the underlying cartilage.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results and Discussion
 References
 
LONG BONES ARE formed from preexisting cartilage templates by endochondral ossification. During this process, chondrocytes progress through developmental stages of rapid proliferation, prehypertrophy/maturation, and hypertrophy before the cells are replaced by bone and marrow. Strict regulation of these stages of chondrocyte development is necessary to ensure the proper formation and growth of skeletal elements. A number of studies have shown the importance of negative regulation of cartilage growth (1, 2, 3, 4, 5), but much less is known concerning the potential role(s) that positive regulators/stimulators of cartilage growth may have on skeletal development.

Both positive and negative regulation of cartilage growth have been attributed, at least in part, to the perichondrium (PC) and periosteum (PO), the tissues that surround cartilage and bone, respectively. For example, in studies employing organ cultures of an embryonic chick leg bone, the tibiotarsus, we (4) observed that removal of the PC and PO before culture resulted in extended growth in the cartilaginous epiphysis, compared with that of the intact tibiotarsus. However, in the boney diaphysis, there was no detectable change in growth—a result we have observed in a number of studies. This elongation of cartilage growth in such PC/PO-free cultures was shown to be due to increases in both chondrocyte proliferation and hypertrophy. These observations, in themselves, suggested a role for the PC and PO in negatively regulating cartilage growth. More recently, we (5) observed that conditioned medium from PC and PO cell cultures, when mixed and added to PC/PO-free organ cultures, restored normal cartilage growth. Cartilage growth was not restored to normal lengths when either type of medium was used alone. This suggested that factors secreted by the PC and the PO act cooperatively in the negative regulation of cartilage growth, and that this regulation compensated precisely for removal of the endogenous PC and PO.

During the course of these studies on negative regulation by the PC and PO, we serendipitously observed that the PC and the PO also produce one or more factors that stimulate cartilage growth. However, unlike the negative regulation that requires a cooperative interaction of factors from both the PC and the PO, this positive stimulation of cartilage growth was effected by each of the tissues independently. When conditioned medium from either the PC or the PO cell cultures was added individually to the PC/PO-free organ cultures, instead of an inhibition of cartilage growth, the growth in either conditioned medium was greater than that in the control (serum-free) medium. These results, when taken together, suggest that the regulation of cartilage growth during limb development involves both stimulators and inhibitors emanating from the PC and PO. A corollary is that the negative regulation effected by the cooperative action of the two tissues acting together modulates, or overrides, the positive stimulation effected by each individually. However, this remains to be tested.

In the present study, we have obtained evidence that the positive regulator produced by the PC and the PO—or at least one positive regulator—is calcitonin (CT). CT is a peptide hormone (molecular mass = 3.4 kDa) produced primarily by the parafollicular cells in the thyroid, but it is also expressed in mammary tissue and pituitary tissue (6, 7, 8). CT is synthesized as a propeptide, procalcitonin, that is activated by amidation and proteolytic cleavage to release active CT (9). Classically, the main function of CT is to maintain calcium homeostasis during growth, pregnancy, and lactation (7, 10, 11). CT is secreted in response to high calcium levels in plasma (12) and prevents calcium release from bone resorption by osteoclasts (13, 14). In this way, CT acts as an antagonist of PTH (13, 14). In human serum, CT levels are highest during the first year of life, a time when rapid skeletal development and growth is occurring (15). To examine whether theses elevated levels of systemic CT might be involved in skeletal development, Burch and Corda (15) injected rats with CT and added CT to fetal pig scapula organ cultures. These treatments produced enlarged cartilages. Here, we present evidence consistent with CT being a positive regulator of cartilage growth and that, during endochondral bone development, the PC and PO are sources of the hormone, suggesting a local paracrine mechanism of action.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results and Discussion
 References
 
Perichondrial and periosteal cell cultures and collection of conditioned media
Separate cultures of perichondrial and periosteal cells were initiated without enzymatic digestion of the tissue, as previously described (5). Briefly, the tissues were dissected from stage 38 tibiotarsi and were cut into small pieces with a scalpel. The pieces were put into 60-mm tissue culture dishes with a small amount of complete medium [0.5 ml DMEM (Life Technologies, Inc., Gaithersburg, MD) plus 10% fetal calf serum (Hyclone Laboratories, Inc., Logan, UT) and penicillin and streptomycin (Life Technologies, Inc.)]. Cultures were maintained at 37 C in 7% CO2, with the daily addition of 0.5 ml of fresh medium. After 7–8 d in culture, the tissue pieces produced an outgrowth of fibroblastic cells. Any remaining tissue pieces were mechanically removed, and the monolayer of cells was passaged. For this, the cells were dissociated with 0.25% trypsin (3 min at 37 C). Cold complete medium was then added to the cells to inactivate the trypsin, and cells were collected by centrifugation and plated onto 60-mm Falcon tissue culture dishes (Fisher Scientific, Pittsburgh, PA) in complete medium.

Cells were grown to confluence (5–7 d) in complete medium. Once cells reached confluence, they were washed with Hanks’ buffered saline (Life Technologies, Inc.) and switched to serum-free DMEM with penicillin and streptomycin. After 18–24 h, the conditioned medium was collected, centrifuged to remove floating cells, and transferred into 15-ml tubes (Costar, Corning, NY). The conditioned medium was stored at 4 C.

Mass spectrometry
Samples of conditioned media were analyzed by the Proteomic Core Facility at the Cutaneous Biology Research Center, Massachusetts General Hospital/Harvard Medical School (Boston, MA). Mass spectrometry was performed on PC- and PO-conditioned media (see below) using the Ciphergen SELDI-based protein chip system, which is most sensitive in detecting proteins with a molecular mass between 2 and 20 kDa. The molecular masses observed from the mass spectrometry analysis were compared with known proteins using the SwissPro and Entrez databases.

cDNA synthesis
Total RNA was isolated from both secondary PC and PO cell cultures and embryonic PC and PO tissue with Trizol treatment (Life Technologies, Inc.). One microgram of RNA was used for cDNA synthesis along with Superscript reverse transcriptase (RT) buffer (Life Technologies, Inc.), 0.1 M dithiothreitol, 10 mM deoxynucleotide triphosphate mix, random hexamer primers, and Superscript RT enzyme (Life Technologies, Inc.). The mixture was incubated at 37 C for 1 h before adding ribonuclease H (Life Technologies, Inc.), then incubated for 20 min at 37 C, and an additional 5 min at 95 C before a quick chill on ice. Additional reactions lacking the RT enzyme were used as negative controls. cDNA was stored at -20 C until use.

RT-PCR
Primers for CT were generated by IDT, Inc. (Coralville, IA). The primers start at positions 197 (CTATTTCCAAACGCTGTG) and 631 (TGAAGAGCCTCGTCTAGATT), which would produce a PCR product of 454 bp. For PCR, 1 µl of cDNA was added to 1 µM primers, PCR buffer (QIAGEN, La Jolla, CA), 20 nM deoxynucleotide triphosphate mix, HotStar Taq enzyme (QIAGEN), and sterile distilled H2O. The 35 cycle reaction was run in a Gene AMP 9600 PCR machine (Perkin-Elmer, Foster City, CA). The reaction was analyzed on a 3% NuSieve agarose (BioWhittaker, Inc., Walkersville, MD) gel with ethidium bromide. Each PCR was added to 2x running buffer and compared with 400 ng of 100-bp marker and {varphi}X174 RF DNA/HaeIII fragments (Life Technologies, Inc.). The gel was imaged under UV light using the Eagle Eye gel scanner (Stratagene, La Jolla, CA).

Tibiotarsal organ cultures
Tibiotarsi were dissected from embryonic d 12, stage 38 chick embryos (16), and the surrounding tissue was removed. Because developmental variation of the long bone rudiments is observed even among carefully staged embryos (Ref. 17 and unpublished observations), the tibiotarsi from each embryo were maintained as an "experimental pair." In each pair, one tibiotarsus served as the untreated control, and the other was experimentally modified by adding 0.1–100 ng/ml CT.

In previous studies, we observed that when whole tibiotarsi were cultured, the cartilaginous ends underwent considerable curvature during growth. This, however, was diminished when only the tarsal 3/4 of the rudiment was used for culture. This facilitated subsequent measurements of the growth in length of the cartilage, so in the present study this was done. Each cartilage plus long bone shaft was placed on a piece of filter (Millipore Corp., Bedford, MA; HTTP4700) supported on a stainless steel mesh grid (Wire Mesh Corp., Los Angeles, CA) in an organ culture dish (Falcon). The cultures were maintained for 3 d (37 C; 7% CO2) in serum-free DMEM, with or without CT. The media were changed daily. During this culture period, we have observed that the cartilaginous elements of the tibiotarsi grow, but the boney tissues do not (4). The media were changed daily.

Analysis of organ cultures
To demarcate the border between the cartilage and the boney tissue, the organ culture rudiments were stained with 0.1% alizarin red (Fisher Scientific) in PBS for 7 min at room temperature. To facilitate penetration of the stain, the PC and PO were removed before staining. The length of the cartilaginous end was determined from digital micrographs taken with a RT-Spot camera (Diagnostic Instruments, Inc., Sterling Heights, MI) attached to a Leica Corp. (Bannockburn, IL) dissecting microscope. The length of each tarsal growth cartilage was measured along the midline of the cartilage, starting at the cartilage/bone border, and extending to the articular surface; quantification was obtained using the Image Pro computer program (Media Cybernetics, Carlsbad, CA). Such midline measurements compensate for any curvature of the cartilage that may occur during culture. For each experiment, the average cartilage length is presented, along with the error bars that represent the SE of the mean and P values from paired t tests.

Immunohistochemistry
Cell cultures.
Cells were grown on two-chamber slides (Falcon), with one chamber treated with 10 nM monensin (Sigma, St. Louis, MO). The slides were fixed with 4% paraformaldehyde in PBS at room temperature and permeabilized with methanol at -20 C. Background staining was reduced by treatment with 1% BSA (Sigma). The slides were incubated in primary rabbit-anti-Eel CT antibody (Phoenix Pharmaceuticals, Inc., Belmont, CA) for 45 min at 37 C. The antibody was visualized with goat-antirabbit IgG conjugated to rhodamine (Pierce Chemical Co., Rockford, IL). To amplify the signal two rounds of staining were done, as described previously (18). As a negative control, nonimmune rabbit serum was used instead of the primary antibody. Slides were coverslipped with 75% glycerin and 1 µg/ml Hoechst (Sigma). Digital images were captured with a RT-Spot camera attached to a Nikon (Kanagawa, Japan) fluorescence microscope.

Organ cultures.
The growth cartilage was dissected from the surrounding boney tissue, and was then labeled with a 5-bromo-2'-deoxy-uridine labeling reagent (BrdU, Roche Molecular Biochemicals, Indianapolis, IN) in serum-free DMEM at 37 C for 2.5 h. It was then fixed in 1x Histochoice (Amresco, Solon, OH) at room temperature, infiltrated with 8% sucrose (overnight at room temperature), followed by OCT (Tissue-Tek, Torrance, CA) embedding medium for 30 min before freezing at -80 C and storage at -20 C.

The cartilages were then analyzed histologically for cell proliferation (by BrdU incorporation) and hypertrophy (by type X collagen staining). In preliminary samples, we determined that the region that incorporated BrdU and the hypertrophic region (stained for type X) were widely separated from one another. Therefore, we could perform immunohistochemistry for both parameters on the same section, which facilitated subsequent analysis.

Ten-micrometer serial sections were cut using a cryostat (Microm HM560, Richard Allan, Kalamazoo, MI) and were placed on Biobond (Electron Microscopy Sciences, Fort Washington, PA) coated 12-spot microscope slides. The sections were examined and compared, and those that went through the midline of each cartilage (determined by the relationships of the cartilage and the advancing marrow cavity) were used in the subsequent analyses.

The sections were washed with PBS, and, to expose the BrdU epitope, were incubated in 2 N HCl (30 min, room temperature). They were washed three times with 50 mM NaCl and 100 mM Tris-HCl, pH 7.4 (Life Technologies, Inc.) for 20 min. To expose the type X collagen epitope within the matrix, the sections were then treated with 0.5% hyaluronidase (Sigma; 30 min at 37 C). Background staining was reduced by treatment with 1% BSA (Sigma; 5 min at room temperature).

The sections were then incubated with a 1:1 mixture of the primary antibodies for BrdU (G3G4, Developmental Studies Hybridoma Bank) and for collagen type X (X-AC9; Ref. 19). These antibodies were visualized with a secondary rhodamine conjugated goat antimouse IgG (Pierce Chemical Co.) and the slides were coverslipped with 75% glycerin and 1 µg/ml Hoechst (Sigma). Digital images were captured with a RT-Spot camera attached to a Nikon fluorescence microscope.

The ImagePro analysis program was employed to determine numbers of proliferative nuclei (BrdU labeled) and the total nuclei (Hoechst staining) in control and CT-treated cultures. The percentage of proliferative nuclei for each was calculated, and the data were subjected to further analysis of SD and standard t tests. This program was also used to determine the difference in areas of the hypertrophic zone (type X-collagen positive) between control and CT-treated cultures, and the data were analyzed using the within subjects t test.

All experiments involving chicken embryos were conducted according to accepted standards of humane animal care.


   Results and Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
References
 
As described in the Introduction, our previous results (4, 5) employing organ cultures of embryonic chicken tibiotarsi—either intact or from which the PC and PO have been removed (PC/PO-free) suggest: 1) that the PC and the PO negatively regulate cartilage growth; 2) that this negative regulation requires a cooperative interaction of diffusible factors produced by PC and PO cells; 3) that each of these cell types also produces a positive/stimulatory regulatory activity; and 4) that the positive regulatory activity from each cell type acts autonomously (i.e. it does not require an interaction with the other cell type). These studies also showed that the positive and the negative regulation by the PC and PO cells was mediated by secreted factors whose activities could be detected in conditioned media harvested from cultures of the cells.

To begin to identify these regulatory factor(s), we employed mass spectrometry to analyze the conditioned media from the PC and the PO cell cultures. One peak had a molecular mass of 3.4 kDa, a size that searches of SwissPro and Entrez protein databases revealed to be precisely that of the peptide hormone, chicken CT. The classic source of CT is the parafollicular cell of the thyroid, and functionally its best known action is in the systemic maintenance of calcium homeostasis (10). However, certain previous studies by others had suggested that systemic CT might be involved in cartilage growth (see Introduction and Ref. 15). We therefore examined further whether the protein detected in the conditioned media was PC and PO derived CT, and whether functionally CT showed stimulation of cartilage growth in a manner consistent with that of the PC and PO conditioned media.

By RT-PCR using primers for chicken CT, a product of the predicted size (454 bp) was obtained with mRNAs from freshly isolated PC and PO tissues (Fig. 1Go, tPC and tPO), and from cultures of both types of cells (Fig. 1Go, cPC and cPO). Likewise, the 454-bp band was obtained with a positive control, brain (BR), which contains a known source of CT, the pituitary, but little if any product was obtained with a negative control tissue, the corneal epithelium (CE). All reactions also included primers for an internal standard, G3PDH, which, in each, gave the predicted 210 bp product (Fig. 1Go). To verify that the 454-bp bands did represent CT, the bands from PC and PO cells were extracted, purified, and sequenced. The cDNA had a sequence identical to that of chicken CT mRNA.



View larger version (35K):
[in this window]
[in a new window]
  		Figure 1. RT-PCR analysis of CT expression by PC and PO. The 454-bp product for CT is detected in PC and PO tissues (lanes tPC and tPO) and PC and PO cell cultures (lanes cPC and cPO). Corneal epithelium (lane CE) served as a negative control, and brain (lane BR), which includes the pituitary served as a positive control. All reactions also contained primers for G3PDH (210-bp bands). The 454-bp bands from cPC, cPO, and BR were verified as representing chicken CT by sequencing.

 
We next examined whether CT protein is also present in the PC and PO cells, and if so is it secreted. For this, we performed immunohistochemistry to visualize the intracellular protein in cultured cells, and we compared cultures grown under normal conditions vs. ones in which secretion was blocked by treatment with monensin. Monensin is a sodium ionophore that prevents exocytosis and thus increases intracellular stores of secretory vacuoles containing products that are normally secreted (20). In untreated cultures, both types of cells showed intracellular staining for CT (Fig. 2Go, top panels, rhodamine signal). This staining was predominantly perinuclear (nuclei visualized by Hoechst staining) suggesting Golgi localization. In cells treated with monensin the intracellular signal for CT was greatly increased (Fig. 2Go, bottom panels) and had a vacuolar appearance—as predicted for a protein that normally undergoes secretion. The vacuolar location of much of this immunofluorescence was confirmed by visualization using Hoffman interference optics; the specificity of the fluorescence signal was verified by using nonimmune rabbit serum as the primary antibody, which gave a barely detectable diffuse fluorescence throughout the cell (data not shown).



View larger version (26K):
[in this window]
[in a new window]
  		Figure 2. Immunofluorescence micrographs of intracellular CT in PC and PO cells with and without monensin treatment, plus Hoechst staining for nuclei. In each panel the red, rhodamine signal is the CT and a blue, Hoechst signal shows the nuclei. Intracellular CT was detected in both cell types (top panels, untreated), and this was increased in cells that had been incubated with monensin (bottom panels, monensin treated). The staining has a vacuolar appearance, which upon monensin treatment becomes increased and more localized in the perinuclear region, as would be predicted for vacuolar secretory products being backed up in the Golgi apparatus.

 
To test whether CT functionally might serve as the positive stimulator of cartilage growth that is secreted by the PC and PO cells, PC/PO-free organ cultures were supplemented with synthetic chicken CT. First, however, we tested it on cultures in which the endogenous PC and PO were left intact. Our previous results (5) showed that when the conditioned medium from PC or PO cell cultures was tested on such intact cultures there was no effect on growth; most likely the endogenous PC and PO were secreting the factor(s) in sufficient quantity to effect maximum growth. Likewise, the addition of CT to such PC/PO-intact cultures showed no stimulation of growth (data not shown).

However, when CT was added to the PC/PO-free organ cultures (at concentrations from 0.1—100 ng/ml) it stimulated growth (Fig. 3Go, A and B). Increases in cartilage growth were observed at all concentrations, although at the two lower doses (0.1 and 1.0 ng/ml) the increases were not statistically significant. The higher doses (10 and 100 ng/ml) produced statistically significant increases that corresponded to an overall increase in length of 6.5%. This stimulation compared favorably with the 8% increase we observed previously with the PC or the PO-conditioned medium.



View larger version (39K):
[in this window]
[in a new window]
  		Figure 3. A, Photomicrograph of an organ culture pair in which one tibiotarsus was untreated (top), and the contralateral tibiotarsus was treated with10 ng/ml CT (bottom). The lines depict the midline measurements. B, Bar graph of cartilage growth in organ cultures of pairs of tibiotarsi from the same embryo in which one member of each pair was cultured with CT and the other served as a control. Cultures treated with 0.1 and 1 ng/ml CT grew to 4.24 mm and 4.19 mm, respectively, compared with the controls which averaged 4.15 mm and 4.13 mm. Cultures treated with 10 ng/ml CT, grew to 4.38 mm, compared with the controls that averaged 4.0 mm, and cultures treated with 100 ng/ml grew to 4.4 mm, compared with the untreated controls which averaged 4.15 mm. For organ culture pairs treated with 0.1 ng/ml, n = 20; for 1 ng/ml, n = 19; for 10 ng/ml, n = 12; for 100 ng/ml, n = 16. Error bars represent SEM. Paired t test analysis for organ culture pairs treated with 0.1 ng/ml, P > 0.1; for 1 ng/ml, P > 0.1; for 10 ng/ml, P < 0.05; for 100 ng/ml, P < 0.05.

 
Histological analyses of the cultures showed that the growth stimulation by CT involved increases in both the percentage of chondrocytes in the proliferative zone that incorporated BrdU (when given as a 2.5-h pulse), and in the size of the hypertrophic zone. These changes are illustrated in the micrographs of representative sections through the middle of the proliferative zone (Fig. 4AGo) and the hypertrophic zone (Fig 4BGo) of serially sectioned pairs (see Materials and Methods) of CT-treated and untreated tibiotarsi. As can be seen in Fig. 4AGo, the number of cells incorporating BrdU in the proliferative zone (which at this stage of development encompasses much of the epiphysis) was increased in the CT-treated cultures compared with the control cultures (untreated). The percentage of BrdU-positive nuclei in the CT-treated cultures was 26.6% ± 0.7% (mean ± SD) vs. 19.0% ± 1.4% for the untreated controls (n = 5; P < 0.00001).



View larger version (73K):
[in this window]
[in a new window]
  		Figure 4. Fluorescence micrographs of representative sections through the middle of the zones of proliferation (A) and hypertrophy (B) of cartilages from tibiotarsi cultured in control medium (untreated), or in medium to which CT (10 ng/ml) had been added (CT treated). A, BrdU incorporation in the entire proliferative zone of cartilages from tibiotarsal cultures that had been incubated for 2.5 h in BrdU before fixation. Note the large increase in the number of BrdU-positive cells in the cartilage from the CT-treated culture. B, Photomicrographs through the hypertrophic zone as identified by immunofluorescence for the hypertrophic cartilage-specific molecule type X collagen. MC demarcates the marrow cavity, showing that the section was through the midpoint of the cartilage. Note the increase in length, width, and overall area of the hypertrophic zone in the cartilage from the CT-treated culture (CT treated) compared with the control (untreated).

 
In Fig. 4BGo, the micrographs are of sections through the middle of the entire zone of hypertrophic cartilage (fluorescently immunostained for the hypertrophic cartilage specific extracellular matrix molecule type X collagen) and the advancing marrow cavity (designated as mc). In these micrographs it can be clearly seen that the CT treatment produced an increase in both the length and width of this zone—also previously observed by Burch and Corda (see Introduction and Ref. 15). To quantify this difference, the area of the hypertrophic zone of sections from pairs of control and CT-treated cultures was determined—with the sections of each member of a pair being matched in location with respect to the marrow cavity. The average increase in the CT-treated cultures vs. the control cultures (n = 5) was 19.2% ± 3.4% (mean ± SD), when analyzed by the within subject’s t test, P < 0.001.

Therefore, all of the results we have obtained with CT are consistent with it being the positive regulator of cartilage growth we observed to be produced by the PC and PO—or at least one of the regulators.

These results suggest that CT from the PC and PO, in its stimulation of cartilage growth, is acting locally to influence growth of the underlying cartilage (i.e. as a paracrine factor). This is in contrast to its well-characterized systemic effect on calcium homeostasis, resulting from its secretion by the parafollicular cells of the thyroid into the circulation. The levels of CT measured in human serum typically range from 20–40 pg/ml. This is considerably lower than the levels we tested in the PC/PO-free organ cultures (0.1–100 ng per ml). However, in the proposed paracrine function of the PC and PO-derived CT on the underlying cartilage, the local concentration at which the CT exists is completely unknown—and may in fact be extremely high.

To our knowledge, the evidence presented here is the first suggesting a paracrine mechanism exists for CT-mediated stimulation of cartilage growth. However, recently a similar mechanism involving the local production and utilization of CT has been proposed in the stimulation of growth of the mammary gland during pregnancy (7). In addition, receptors have been found in a number of tissues including brain, ovary, and testis (21). We do not yet know whether the growth response to CT we have detected in cartilage involves the presence of CT receptors on the chondrocytes. The chicken CT receptor has not been isolated or cloned, and at present this precludes such analyses. In addition, studies by others have reported effects of CT on osteoblasts, although there is no conclusive evidence for the receptor in this cell type (for review, see Ref. 22). Thus, the question of whether the paracrine signaling by the PC- and PO-derived CT on cartilage is receptor mediated will require further investigation.


   Acknowledgments
 
We are grateful to Dr. Alain Veil for conducting the mass spectrometry experiments. We thank Drs. Cindy Cai, John Fitch, and Maria Nurminskaya for their consultation and input in this study. We thank Dr. James Schwob for consultation on statistical analysis. We also thank Ms. Eileen Gibney for helpful critique of this manuscript.


   Footnotes
 
This work was supported by NIH Grant HD-23681.

Abbreviations: BrdU, 5-Bromo-2'-deoxy-uridine; CT, calcitonin; PC, perichondrium; PO, periosteum; RT, reverse transcriptase.

Received August 28, 2002.

Accepted for publication January 8, 2003.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 

  1. Vortkamp A, Lee K, Lanske B, Segre GV, Kronenberg HM, Tabin CJ 1996 Regulation of rate of cartilage differentiation by Indian hedgehog and PTH-related protein. Science 273:613–622[Abstract]
  2. Deng C, Wynshaw-Boris A, Zhou F, Kuo A, Leder P 1996 Fibroblast growth factor receptor 3 is a negative regulator of bone growth. Cell 84:911–921[CrossRef][Medline]
  3. Serra R, Karaplis A, Sohn P 1999 Parathyroid hormone-related peptide (PTHrP)-dependent and -independent effects of transforming growth factor b (TGF-b) on endochondral bone formation. J Cell Biol 145:783–794[Abstract/Free Full Text]
  4. Long FX, Linsenmayer TF 1998 Regulation of growth region cartilage proliferation and differentiation by perichondrium. Dev 125:1067–1073[Abstract]
  5. Di Nino DL, Long F, Linsenmayer TF 2001 Regulation of endochondral cartilage growth in the developing avian limb: cooperative involvement of perichondrium and periosteum. Dev Biol 240:433–442[CrossRef][Medline]
  6. Lasmoles F, Jullienne A, Desplan C, Milhaud G, Moukhtar MS 1985 Structure of chicken calcitonin preicted by partial nucleotide sequence of its precursor. FEBS Lett 180:113–116[CrossRef][Medline]
  7. Tverberg LA, Gustafson MG, Scott TL, Arzumanova IV, Provost ER, Yan AW, Rawie SA 2000 Induction of calcitonin and calcitonin receptor expression in rat mammary tissue during pregnancy. Endocrinology 141:3696–3702[Abstract/Free Full Text]
  8. Ren Y, Chien J, Sun YP, Shah GV 2001 Calcitonin is expressed in gonadotropes of the anterior pituitary gland: its possible role in paracrine regulation of lactotrope function. J Endocrinol 171:217–228[Abstract]
  9. Reinhart K, Karzai W, Meisner M 2000 Procalcitonin as a marker of the systemic inflammatory response to infection. Int Care Med 26:1193–1200[CrossRef][Medline]
  10. Root AW, Harrison HE 1976 Recent advances in calcium metabolism. I. Mechanisms of calcium homeostasis. J Pediatr 88:1–18[CrossRef][Medline]
  11. Karsenty G 1999 The genetic transformation of bone biology. Genes Dev 13:3037–3051[Free Full Text]
  12. Fischer JA, Born W 1985 Novel peptides from the calcitonin gene: expression, receptors, and biological function. Peptides 6S 3:265–271
  13. Gennari C 1999 Calcitonin, bone-active isoflavones and vitamin D metabolites. Osteoporosis Int 2(Suppl):S81–S90
  14. Rodan GA, Martin TJ 2000 Therapeutic approaches to bone diseases. Science 289:1508–1514[Abstract/Free Full Text]
  15. Burch W, Corda G 1985 Calcitonin stimulates maturation of mammalian growth plate cartilage. Endocrinology 116:1724–1728[Abstract/Free Full Text]
  16. Hamburger V, Hamilton HL 1951 A series of normal stages in the development of the chick embryo. J Morph 88:49–92[CrossRef]
  17. Lovitch D, Christianson ML 1997 Mineralization is more reliable in periosteum explants from size-selected chicken embryos [letter]. In Vitro Cell Dev Biol Anim 33:234–235[Medline]
  18. Linsenmayer TF, Fitch JM, Schmid TM 1988 Multiple-reaction cycling: a method for enhancement of the immunochemical signal of monoclonal antibodies. J Histochem Cytochem 36:1075–1078[Abstract]
  19. Schmid TM, Linsenmayer TF 1987 Type X collagen. In: Mayne R, Burgenson RE, eds. Structure and function of collagen types. Orlando, FL: Academic Press, Inc.; 223–259
  20. Ledger PW, Uchida N, Tanzer ML 1980 Immunocytochemical localization of procollagen and fibronectin in human fibroblasts: effects of the monovalent ionophore, monensin. J Cell Biol 87(3 Part 1):663–671
  21. Nakamura M, Morimoto S, Zhang Z, Utsunomiya H, Inagami T, Ogihara T, Kakudo K 2001 Calcitonin receptor gene polymorphism in Japanese women: correlation with body mass and bone density. Calc Tiss Intern 68:211–215[CrossRef]
  22. Zaidi M, Inzerillo AM, Moonga BS, Bevis PJR, Huang CLH 2002 Forty years of calcitonin—where are we now? A tribute to the work of Iain Macintyre, FRS. Bone 30:655–663[Medline]



This article has been cited by other articles:


Home page
 Biol. Reprod.Home page
S. M Krzysik-Walker, O. M Ocon-Grove, S. B Maddineni, G. L Hendricks III, and R. Ramachandran
Identification of Calcitonin Expression in the Chicken Ovary: Influence of Follicular Maturation and Ovarian Steroids
Biol Reprod, October 1, 2007; 77(4): 626 - 635.
[Abstract] [Full Text] [PDF]

Home page
 Poult. Sci.Home page
S. Simsa and E. M. Ornan
Endochondral Ossification Process of the Turkey (Meleagris gallopavo) During Embryonic and Juvenile Development
Poult. Sci., March 1, 2007; 86(3): 565 - 571.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Di Nino, D. L.
Right arrow Articles by Linsenmayer, T. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Di Nino, D. L.
Right arrow Articles by Linsenmayer, T. F.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals