help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Martinez, A.
Right arrow Articles by Lefrançois-Martinez, A.-M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Martinez, A.
Right arrow Articles by Lefrançois-Martinez, A.-M.
Endocrinology Vol. 144, No. 5 2111-2120
Copyright © 2003 by The Endocrine Society

Steroidogenic Factor-1 Controls the Aldose Reductase akr1b7 Gene Promoter in Transgenic Mice through an Atypical Binding Site

Antoine Martinez, Pierre Val, Isabelle Sahut-Barnola, Christelle Aigueperse, Georges Veyssière and Anne-Marie Lefrançois-Martinez

Centre National de la Recherche Scientifique, Unité Mixte de Recherche 6547, Génétique des Eucaryotes and Endocrinologie Moléculaire, Université Blaise Pascal, 63177 Aubière, France

Address all correspondence and requests for reprints to: Dr. Antoine Martinez, Centre National de la Recherche Scientifique, Unité Mixte de Recherche 6547, Génétique des Eucaryotes and Endocrinologie Moléculaire, Université Blaise Pascal, 63177 Aubière, France. E-mail: .


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Aldo-keto-reductase 1B7/mouse vas deferens protein (AKR1B7/MVDP) is expressed in rodent steroidogenic glands and in the mouse vas deferens. In steroidogenic organs, AKR1B7/MVDP scavenges isocaproaldehyde produced from the cholesterol side-chain cleavage reaction. Akr1b7/mvdp is responsive to ACTH in adrenals and to androgens in vas deferens. Using transgenic mice, we previously delimited the regulatory DNA sequences necessary for expression in both organs and identified by cell transfections, a cryptic steroidogenic factor-1 (SF-1) response element (SFRE) at -102 that overlaps a proximal androgen-responsive element. To address its in vivo functions in adrenals, we devised a transgenic mouse study using wild-type and mutant akr1b7 promoters driving the chloramphenol acetyltransferase reporter gene. Adrenal expression in adults was impaired in all lines mutant for -102 SFRE. This effect is linked to impaired SF-1 binding and not to impaired androgen receptor binding, because akr1b7 expression is not affected in adrenals of androgen receptor-defective Tfm mice. Triphasic developmental patterns of both AKR1B7 and wild-type transgene expression paralleled changes in SF-1 levels/binding activity; expression was maximal in late embryos, minimal in 6- to 15-d-old neonates, and thereafter progressively restored. Differences in developmental expression between wild-type and mutant transgenes revealed that requirement for the -102 SFRE appears stage specific, as its integrity is an absolute prerequisite for reinduction of gene expression after postnatal d 15. Further, mutation of this site did not affect transgene responsiveness to ACTH. These findings demonstrate a new function for SFRE in vivo, via influencing promoter sensibility to postnatal changes of SF-1 contents, in controlling promoter strength in adults without affecting adrenal targeting, hormonal control, or early gene expression.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
CHRONIC STIMULATION of steroid synthesis is achieved by pituitary hormones through the coordinate regulation of genes involved in cholesterol uptake (SR-B1 and steroidogenic acute regulatory protein) and in its conversion (cytochrome P450 hydroxylases and hydroxysteroid dehydrogenases) to hormonally active steroids (1, 2, 3). It was recently proposed by our group that in adrenocortical cells, the optimal capacity for steroid production may require in addition the coordinate hormonal regulation of the akr1b7/mvdp gene encoding an aldo-keto-reductase involved in detoxifying harmful aldehydes (isocaproaldehyde and 4-hydroxynonenal) generated by cytochrome P450 activities (4). Aldo-keto-reductase 1 B7/mouse vas deferens protein (AKR1B7/MVDP), initially described as an androgen-dependent marker specific to the mouse vas deferens (5), was shown to be expressed in steroidogenic cells of different rodents, i.e. in the zona fasciculata of adrenal glands and to a lesser extent in the gonads under the control of ACTH and LH, respectively (6, 7, 8, 9). In addition to species-specific features and tissue-specific hormonal regulations, akr1b7 gene expression is also developmentally controlled depending on its expression site. In mouse adrenal, akr1b7 expression starts around embryonic d 13.5 and follows the onset of glucocorticoid synthesis and zona fasciculata formation (10). After birth, its expression remains high until postnatal d 6, then decreases sharply during the adrenal hyporesponsive period until d 15, and finally perinatal levels are progressively restored in maturing animals (11). In the vas deferens, akr1b7 expression starts postnatally between 6 and 10 d of age and reaches adult-like values during puberty, following the increasing blood androgen content (12, 13).

Mechanisms controlling akr1b7 gene expression in the adrenal and the vas deferens have been dissected in vivo and in cultured cells. In transgenic mice, a 1.8-kb promoter fragment (-1804/+41) is necessary to recapitulate hormonal and developmental gene regulation in both organs, while a 0.5-kb promoter (-510/+41) is sufficient for adrenal expression (10, 11). In addition, a 3.5-kb intragenic fragment spanning intron 1 to intron 2 was shown to increase the percentage of expressing mouse lines when included in the transgenic constructs (11). Two sequences located at proximal region of the akr1b7 gene (-61 and -52) have been shown to bind CCAAT/enhancer-binding protein and Sp1 factors and to trigger ACTH/cAMP-dependent expression of the -121/+41 promoter in Y1 adrenocortical cells (14). However, maximal hormonal responsiveness in transfected Y1 cells requires further upstream (-510/-121) cAMP-responsive sequences as previously suggested by deletion analyses (14) and established by point mutations in the 0.5-kb promoter (15). Interestingly, our in vitro studies have revealed that the transcription factor steroidogenic factor-1 (SF-1) interacts and trans-activates the akr1b7 proximal (-121/+41) promoter through an atypical binding site located at -102 (14). This -102 SFRE (SF-1 response element) was shown to overlap a previously characterized functional proximal androgen-responsive element (AREp) extending from position -111 to -96 (16).

SF-1 exerts a pivotal role in endocrine development and regulates a large number of genes required for glucocorticoid production and hypothalamo-pituitary-gonadal axis function (17). However, the in vivo requirement for SF-1 in the regulation of its target genes remains little documented (18, 19, 20, 21) and has been hampered because of complete adrenal and gonad agenesis in SF-1 null mice (22).

To address, in vivo the function of this noncanonical SFRE for the control of akr1b7 gene in the adrenal cortex, we decided to employ transgenic mice in which wild-type or mutant promoters were used to drive the chloramphenol acetyltransferase (CAT) reporter gene.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Experimental animals
Animal studies were conducted in agreement with standards described by the NIH Guide for Care and Use of Laboratory Animals as well as with the local laws and regulations applicable to animal manipulations in France.

Preparation of protein for EMSA and Western blot analysis
The plasmids used for production of recombinant human androgen receptor (AR) DNA-binding domain (dbd) and human SF-1 expressed as glutathione-S-transferase (GST) fusion proteins were previously described (23, 24). Mouse SF-1 and liver receptor homolog-1 (LRH-1) proteins were in vitro translated with the TNT-Coupled Transcription/Translation System (Promega Corp., Lyon, France) using expression vectors pCMV5-mSF-1 and pCMX-mLRH-1 (provided by Dr. Keith L. Parker, Dallas, TX) and Dr. David J. Mangelsdorf (Dallas, TX), respectively.

Nuclear protein extracts of adrenocortical Y1 cells were performed as described previously (14). Whole adrenal protein extracts from developing mouse were obtained by homogenizing (glass-glass homogenizer) pooled organs from male B6D2 mice of the same age in 150 µl extraction buffer C [20 mM HEPES (pH 7.6), 0.42 M NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 0.5 mM dithiothreitol, 0.2% Nonidet P-40, and 25% glycerol] containing 0.5 mM phenylmethylsulfonylfluoride and protease inhibitors cocktail (Roche, Mannheim, Germany). Extracts were left on ice for 20 min and were centrifuged at 50,000 x g for 30 min, and the supernatants were used for Western blot analyses and EMSA. Densitometric analysis of the immunoreactive protein bands obtained in Western blots was performed using Molecular Analyst software (Bio-Rad Laboratories, Inc., Marnes la Coquette, France). For EMSA, the signals corresponding to SF-1-retarded complex and free probe were quantified using phosphorimager analysis (Bio-Rad Laboratories, Inc.).

The conditions for EMSA were previously described (14, 23). Anti-SF-1 antibody was purchased from Upstate Biotechnology, Inc. (Lake Placid, NY). Sequences of the sense strand of the oligonucleotides used in EMSA are: AREp (proximal androgen-responsive element), agcTTGACATGAAGTTCCTGTTCTCATGgtcga; AREpm (mutated proximal androgen-responsive element), TTGACATGAAGTTCCTtTTCTCATG; AREd (distal androgen-responsive element), TTAAAAGAACATGCTGCTCTAACCG; AREdm (mutated distal androgen-responsive element), GGTTAAAAGAAtATGCTtCTCTAACCGAG; 21-hydroxylase (21-OH), CCACAGATTCTCCAAGGCTGATGG (25); and LRH response element (LRH-RE) with XhoI overhangs, tcgagagtTCAAGGCCG (26). Core motifs are underlined, mutated bases within the core motifs are in lowercase letters, and the dinucleotide essential for SF-1 binding to AREp probe is shown in italics (14).

Construction of wild-type (wt) and mutant transgenes
The wt 0.5- and 1.8-kb transgene constructs renamed to simplify nomenclature were previously described as 0.5M- and 1.8M-CAT-Int transgenes (11): they contain the -510/+41 and -1804/+41 promoter fragments of the akr1b7/mvdp gene, respectively, driving the CAT/simian virus 40 reporter cassette fused to the 3.5-kb intronic fragment inserted downstream from the simian virus 40 polyadenylation signal. Point mutations were introduced separately into the AREp and AREd sequences within the 1.8-kb promoter using the Gene Editor kit (Promega Corp.). Mutant oligonucleotides (sense strand) are: AREpm, TGACATGAAGTTCCTtTTCTCATGCCC; and AREdm, GGTTAAAAGAAtATGCTtCTCTAACCGAG. The lacZ reporter cassette excised from the ß-galactosidase basic vector (CLONTECH Laboratories, Inc., Palo Alto, CA) was inserted instead of CAT in a construct driven by the -510/+41 promoter to obtain the wt 0.5-kb lacZ transgene (Fig. 1Go).



View larger version (35K):
[in this window]
[in a new window]
  		Figure 1. Maps of the transgene constructs. The 1.8-kb (-1804/+41) and 0.5-kb (-510/+41) promoter regions of the akr1b7 gene were fused to the CAT reporter gene together with a 3.5-kb intragenic fragment (introns 1 and 2) inserted downstream from the reporter polyadenylation signal and formed the wild-type 1.8- and 0.5-kb constructs (Ref. 11 ; see Materials and Methods). Binding sites for NF1 (-82 and -76), CCAAT/enhancer-binding protein (C/EBP; -61), and Sp1 (-52) factors are indicated (14 ). Three binding sites for SF-1 (SFRE) have been characterized, one proximal (-102) and two others in a more distal position (-458 and -503; Refs.14 15 ). The two AR-binding sites located at a distal (AREd) and at a proximal (AREp) position are represented by a horizontal oval shape together with their sequences. The AREp sequence overlaps the cryptic SF-1-binding site located at -102. Nucleotides important for SF-1 binding are boxed (14 ). Mutations (sequences shown in lowercase) were introduced into the distal AR-binding site or into the proximal AR/SF-1-binding site to form AREdm and AREpm constructs, respectively. For in situ localization of transgene expression, the 0.5-kb promoter was also linked to the lacZ reporter gene. The arrow shows the transcription start site (+1).

 
Production and analysis of transgenic mice
The CAT and lacZ transgenes were excised from plasmids by HindIII/SacI and XbaI/KpnI digestions, respectively, and the resulting linearized DNA was injected into fertilized B6D2 mouse eggs. Detection of transgenic founders and offspring, and determination of copy numbers were performed by Southern blotting (11). Lines expressing the wt CAT transgene, e.g. line 62 for the wt 0.5-kb construct and lines 28, 39, and 70 for the wt 1.8-kb construct were previously described (11). Six new lines expressing the wild-type CAT transgenes were analyzed: 3 of them contain the wt 0.5-kb promoter (lines 1, 5, and 12) and 3 other harbor the wt 1.8-kb promoter (lines 4, 14, and 15). Three (1, 13, and 24) and 4 (2, 5, 15, and 19) expressing lines were obtained for the AREdm and AREpm 1.8-kb mutant CAT transgenes, respectively. The transgene copy number in the genome of transgenic mice were ranged from 3–50 for the new wild-type constructs harboring either the 1.8- or 0.5-kb promoters, from 10–20 for AREdm, and from 5–60 for AREpm 1.8-kb mutant constructs. Finally, about 5 and 15 copies were found in the 2 transgenic mouse lines (1 and 9) expressing the wt 0.5-kb lacZ construct, respectively. Transgene (CAT assay) and endogenous gene (Western blot) expression analyses were performed as previously described (11), on F1 or F2 male mice, except for developmental studies in which F3 mice were used. The F3 mice received the transgene by outbreeding F2 homozygous mice with nontransgenic B6D2 mice.

Adrenal sectioning and in situ detection of gene expression
Transgenic mice (6 months old) expressing the wt 0.5-kb lacZ construct (lines 1 and 9) were killed by vertebral dislocation, and adrenals were immediately removed. Tissues were either mounted in OTC compound, followed by rapid freezing in isopentane, and stored at -70 C until use (ß-galactosidase histochemistry) or fixed in 75% ethanol/25% acetic acid for 1 h, dehydrated, and embedded in paraffin (AKR1B7 immunohistochemistry). Frozen sections (10 µm) were fixed for 15 min at 4 C with 0.2% glutaraldehyde in PBS/5 mM EGTA/2 mM MgCl2, washed twice for 10 min each time with PBS/2 mM MgCl2 and once with PBS/2 mM MgCl2 containing 0.01% sodium deoxycholate/0.02% Nonidet P-40, then stained overnight at 37 C in X-galactosidase solution (0.4 mg/ml 5-bromo-4-chloro-3-indolyl-ß-O-galactoside, 4 mM potassium ferrocyanide, 0.4 mM potassium ferricyanide, and 1 mM MgCl2 in PBS). Paraffin sections (6 µm) were dewaxed, exposed to either primary anti-AKR1B7/MVDP polyclonal antibody (11) diluted 1/100 in PBS/3% BSA or preimmune serum and incubated overnight at 4 C. Incubation with secondary antibody and peroxidase staining were performed according to the manufacturer’s instructions (Envision system HPRT, DAKO Corp., Carpinteria, CA).

Hormonal manipulation
For hormonal regulation studies, F1 or F2 transgenic male mice (8–12 wk old) were injected sc with dexamethasone acetate for 5 d (75 µg twice daily; Sigma-Aldrich Corp., St. Louis, MO), vehicle (sesame oil), or dexamethasone acetate (5 d) plus ACTH (1.2 U, im, daily; Synacthene, Novartis Pharma S.A., Rueil-Malmaison, France) for the last 2 d.

AR-deficient mice
Tfm mice were purchased from Dr. Peter Glenister (Mammalian Genetics Unit, Medical Research Council, Harwell, UK).


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
SF-1, LRH-1, and AR binding to the ARE sequence of the akr1b7 promoter
Our previous experiments revealed that SF-1 binds and trans-activates the akr1b7 proximal promoter (-121/+41) through the unusual -102 SFRE located within the downstream half-site of a well characterized AREp extending from -111 to -96 bp (Fig. 1Go) (14, 16). Two additional and more canonical SFREs have been partially characterized (15) within the akr1b7 promoter and stand at positions -503 and -458 (Fig. 1Go). EMSAs illustrate that, as shown previously (14), SF-1 interaction with AREp is sequence specific and cannot be generalized to other AR-binding sites. Indeed the complex formed with AREp probe in Y1 adrenocortical cells nuclear extracts was prevented by anti-SF-1 antibody and competed by unlabeled AREp oligonucleotide or high affinity SF-1-binding site from the 21-OH gene promoter, but not by an excess of a second ARE sequence (AREd) located upstream in the 5'-flanking region (-1186/-1172) (Fig. 2AGo).



View larger version (78K):
[in this window]
[in a new window]
  		Figure 2. SF-1 is the main binding factor interacting with the AREp of akr1b7 gene promoter in the adrenal. A, SF-1 binds to AREp/SFRE in Y1 adrenocortical cells nuclear extracts. Double-stranded oligonucleotide containing the overlapping sequences for AREp (-111/-96) and -102 SFRE of akr1b7 promoter (14 ) was 32P labeled (AREp/SFRE). Binding of nuclear proteins from Y1 adrenocortical cells (5 µg) to the radiolabeled AREp/SFRE probe was analyzed without (-) and with a 50-fold molar excess of unlabeled original probe, high affinity SF-1-binding site from the 21-OH gene promoter, or AREd (-1186/-1172) of the akr1b7 promoter or with anti-SF-1 polyclonal antibody (SF-1 Ab). B, LRH-1 binds weakly to AREp/SFRE. In vitro translation products for SF-1 or LRH-1 factors were incubated with AREp/SFRE probe. As a control illustrating LRH-1-binding complex mobility, a labeled oligonucleotide containing the LRH-RE of the rat CYP7A promoter (26 ) was incubated with in vitro translated LRH-1. The wt or mutated competitor oligonucleotides (molar excess indicated in parentheses) are shown on top of each lane. C, LRH-1-binding activity is undetectable in adrenal extracts. Whole cell protein extracts from adult mouse adrenals (10 µg) were incubated with LRH-RE probe. Incubations with in vitro translated (IVT) SF-1 or LRH-1 proteins were used as controls. The use of competitor oligonucleotides or antibody (SF-1 Ab) is indicated on top of each lane. Black and gray arrowheads indicate SF-1- and LRH-1-specific complexes, respectively. -, No competitor used; ns, nonspecific complexes. The asterisk points to a supershifted SF-1 complex.

 
Recent reports have stated that LRH-1, an orphan receptor closely related to SF-1, is able to bind and trans-activate promoters of genes encoding steroidogenic enzymes through binding to SF-1 sites (27, 28, 29). To test whether LRH-1 was also able to bind the -102 SFRE, we performed bandshift assays using in vitro translated proteins (Fig. 2BGo). As a positive control, typical LRH-1-binding activity was illustrated in Fig. 2BGo (right) by the slow-migrating complex formed with a probe corresponding to the LRH-RE of the rat CYP7A promoter (26). As expected, LRH-1 binding was competed either by an excess of unlabeled LRH-RE or 21-OH oligonucleotides. When AREp was used as a probe both SF-1 and LRH-1 translation products formed specific retarded bands (note that LRH-1 interaction looks very weak), which were competed away by unlabeled wild-type AREp sequence. Both complexes were no more competed by an excess of a mutant AREpm oligonucleotide. To assess the SF-1 vs. LRH-1-binding activities in adrenal extracts, EMSAs were conducted using the LRH-RE probe. As illustrated in Fig. 2CGo, both the in vitro translated mouse LRH-1 or SF-1 proteins bind specifically to the LRH-RE probe, but the two DNA-protein complexes exhibited a clear difference in mobility (LRH-1 factor forming the slowest migrating complex). The strong binding activity in mouse adrenal protein extracts was only caused by the presence of endogenous SF-1, as shown by the (fast) mobility of the DNA-protein complex and its sensibility to anti-SF-1 antibody. These data indicate that although the -102 SFRE was able to bind either SF-1 or LRH-1 factors, LRH-1-binding activity was undetectable in adrenal extracts. This confirms that, as previously suggested by RT-PCR analyses, this orphan receptor does not play a key role in the adrenal (28).

To further explore the SF-1 vs. AR interactions to the AREs of akr1b7 promoter, EMSAs were conducted using GST fusion proteins. Although recombinant SF-1 protein (GST-SF-1) was unable to form any complexes with AREd probe, incubation with the AREp probe led to the formation of a specific complex that was competed by wild-type AREp and 21-OH sequences, but not by a mutated AREpm oligonucleotide (Fig. 3Go). Conversely, both AREp and AREd sites were able to bind to recombinant AR (GST-ARdbd), and these interactions were no longer competed by an excess of mutated AREpm and AREdm sequences, respectively (Fig. 3Go). Incubation of mutated oligonucleotides (AREpm and AREdm) with either recombinant proteins was unable to form any DNA-protein complexes (not shown). These data indicate that SF-1 interacts with AREp, but not with AREd, whereas AR binds to both sites. At last, mutated AREpm or AREdm sequences can no longer bind both of these nuclear receptors.



View larger version (66K):
[in this window]
[in a new window]
  		Figure 3. Both SF-1 and AR bind to AREp, whereas only AR binds to AREd. Recombinant SF-1 or ARdbd fused to GST protein were incubated with either AREp/SFRE or AREd 32P-labeled oligonucleotides. The wt or mutated competitor oligonucleotides are shown on top of each lane. -, No competitor used; ns, nonspecific complexes. Black and open arrowheads point to GST-SF-1 and GST-ARdbd specific complexes, respectively.

 
Function of the proximal ARE/SFRE for adrenal expression in transgenic mice
To unravel the functional importance of these structurally related AREp and AREd sequences in the control of akr1b7 gene expression in vivo in the adrenal, we generated transgenic mice bearing the CAT gene driven by two lengths of wt (wt 1.8 and 0.5 kb) or mutagenized promoter fragments (AREpm or AREdm 1.8 kb; Fig. 1Go). Further, to localize more precisely the cells within the adrenal cortex that express the transgene, we created additional transgenic lines expressing the lacZ gene under control of the wt 0.5-kb promoter (Fig. 1Go). Representative patterns of CAT transgenes activities are illustrated in Fig. 4Go. As previously shown (11), wt 0.5- and 1.8-kb promoter fragments direct CAT expression in the adrenals and significant ectopic activity in both kidney and lung. Mutation of the AREd has no consequence on these expression patterns. By contrast, mutation of the -102 SFRE induced a marked and specific reduction of reporter gene expression in the adrenals. Location of transgene expression within the adrenal was examined in tissue sections by in situ ß-galactosidase staining. In two different transgenic mouse lines ß-galactosidase staining was confined to the zona fasciculata/reticularis of the adrenal cortex and was undetectable in the zona glomerulosa or in the medulla (Fig. 5Go). This observation is consistent with the expression pattern of the endogenous akr1b7 gene, as shown by the staining of adrenal sections with anti-AKR1B7 antibody (Fig. 5Go). To ascertain whether the -102 SFRE mutation leads to reproducible effects on the adrenal expression of the construct and to discriminate between these effects and the quantitative variability of transgene activity due to the influence of the integration site, we considered at least three transgenic lines expressing significant levels of CAT activity per each four constructs. As shown in Fig. 6Go, transgenic lines with mutated -102 SFRE have markedly reduced CAT gene expression in the adrenal compared with those bearing wild-type or AREd mutated transgenes.



View larger version (42K):
[in this window]
[in a new window]
  		Figure 4. Tissue-specific expression of the transgenes. Samples from homogenates of the indicated organs from one transgenic animal were assayed for CAT activity. The reactions were performed in the linear range using either 20 µg (wt -102 SFRE transgenes) or 200 µg (mutated -102 SFRE transgene) protein extracts from 8- to 12-wk-old male mice. Representative patterns of CAT activities mediated by the four transgene constructs are shown on autoradiograms (lines 62, 39, 1, and 19, respectively).

 


View larger version (125K):
[in this window]
[in a new window]
  		Figure 5. In situ localization of the wt 0.5-kb lacZ transgene and endogenous akr1b7 gene expression in adrenal glands. Adrenal sections from 6-month-old male transgenic mice were stained for ß-galactosidase activity (A, line 1; B, line 9) or for peroxidase activity after incubation with either anti-AKR1B7 polyclonal antibody (C, line 1) or preimmune serum (D, line 1). Adrenals for histochemical staining of lacZ reporter activity were cryosectioned (10 µm), and immunohistochemical staining of endogenous AKR1B7 was performed on paraffin sections (6 µm). G, Zona glomerulosa; F/R, zonae fasciculata/reticularis; M, medulla.

 


View larger version (31K):
[in this window]
[in a new window]
  		Figure 6. Analysis of transgene expression in the adrenals of transgenic mice lines. CAT-specific activity was measured in homogenates of adrenals from each mouse line expressing the transgene. For each construct, an individual transgenic line is represented ({diamondsuit}, wt 0.5 kb; {square}, wt 1.8-kb; {triangleup}, AREdm 1.8 kb; {circ}, AREpm 1.8 kb) and numbered (#). Each value is the mean of independent assays on at least three male mice (8–16 wk old) from the same line.

 
To evaluate a possible role for AR in the adrenal expression of the akr1b7 gene, we looked for AKR1B7 protein in the adrenals of AR-defective Tfm mice. Western blot analysis showed that AKR1B7 is expressed in similar amounts in Tfm mice and wt adrenals and thus is not influenced by AR in vivo (Fig. 7Go). We thus conclude that impaired adrenal gene expression in mice harboring the mutated -102 SFRE transgene is linked to impaired SF-1 binding and not to impaired AR binding.



View larger version (24K):
[in this window]
[in a new window]
  		Figure 7. Western blot analysis of AKR1B7 protein contents in adrenals of wt mice (wt) and of mutant Tfm mice lacking androgen receptor (Tfm 1 and 2). Detection was performed using 20 µg protein extracts from 8-wk-old males and monoclonal antibody as described previously (11 ).

 
Requirement of the proximal ARE/SFRE for developmental regulation in the adrenals
To determine whether mutation of the -102 SFRE can influence developmental programming of the akr1b7 gene, we compared the activity of wt and mutated -102 SFRE transgenes in developing transgenic mice. The consequences of the -102 SFRE mutation on developmental expression of the transgene were examined postnatally (Fig. 8AGo) and perinatally (Fig. 8BGo). As shown in Fig. 8AGo, during the postnatal period, adrenal expression of the AREdm 1.8-kb transgene (used as control) paralleled that of the endogenous akr1b7 gene and exhibited the classical triphasic pattern of ACTH-responsive genes. Early postnatal levels of expression of both the transgene and endogenous gene were high until d 6 (phase I), decreased strongly during the following adrenal hyporesponsive period until d 15 (phase II), and finally were progressively recovered in maturing animals (phase III). The same developmental expression profile had been previously observed for the wt 1.8-kb transgene (11), indicating that mutation of AREdm had no consequences on adrenal gene expression. As illustrated by postnatal changes in CAT activity in AREpm 1.8-kb transgenic mice (Fig. 8AGo, bottom), mutation of the -102 SFRE clearly impaired adrenal expression in adults of 60 and 90 d of age. Surprisingly, this low expression was not observed at all postnatal stages. Indeed, CAT activity reached about 10-fold adult values during the early postnatal stage through d 6 (phase I), began to drop during the hyporesponsive period between d 6 and 15 (phase II), but failed to be reinduced in maturing mice. To ascertain that mutation of the -102 SFRE was indeed less deleterious for akr1b7 promoter activity in early stages than in adulthood, we compared perinatal expression of the wt and mutated transgenes from embryonic d 16.5 (E16.5) of gestation to postnatal d 2 (pd2) (Fig. 8BGo). The expression of both the wt (1.8 kb) and -102 SFRE mutated transgenes (AREpm 1.8 kb) was easily detectable on E16.5, increased to reach a maximal value at birth, and then decreased by 50% on pd2. Importantly, at this age (pd2), the wt transgene exhibited an adulthood-like expression level, whereas the activity of the mutant was 7-fold higher than that in adults. Together these data show that although the -102 SFRE is involved in the overall strength of the akr1b7 promoter in the adrenals, its requirement is not constant during development and may be stage specific. Indeed, comparative analysis reveals that this SF-1 site 1) is not essential in early stages (phase I) until the hyporesponsive period (phase II), as wild-type and mutant transgenes exhibited similar expression patterns from E16.5 to pd15, and thereafter 2) becomes clearly necessary for reinduction of the akr1b7 gene expression observed during the third period.



View larger version (32K):
[in this window]
[in a new window]
  		Figure 8. Developmental regulation of the transgenes. Changes in CAT-specific activity during postnatal (A) and perinatal (B) development were analyzed using homogenates of pooled adrenals from (n) mice at the indicated ages. Male transgenic mice from line 1 of construct AREdm 1.8 kb, from line 14 of construct wt 1.8 kb, and from lines 2 and 19 of construct AREpm 1.8 kb were used in these experiments. Inset, Western blot illustrates the typical triphasic pattern of postnatal expression of the endogenous akr1b7 gene. I (early postnatal), II (hyporesponsive period), and III indicate the different phases that mark important changes in developmental expression.

 
We then asked whether levels of transgene and endogenous gene expression could be correlated to the adrenal SF-1 contents at different ages (Fig. 9Go). As shown by Western blot experiments (Fig. 9Go, A and C), adrenal concentrations of immunoreactive SF-1 varied during development; the highest SF-1 levels were found during the late embryonic period, decreased very strongly between birth and pd6, and thereafter reaccumulated progressively to reach embryonic-like levels between pd10 and pd15. As expected for a gene transcriptionally regulated by SF-1, AKR1B7 levels closely followed, with a foreseeable delay, those of SF-1 (Fig. 9CGo). Moreover, SF-1 binding activity was evaluated by EMSA using the same protein extracts as those used in Western blots (Fig. 9BGo). As previously shown in Fig. 2Go and confirmed here, the complex formed with the LRH-RE sequence in adrenal extracts corresponds only to the SF-1 monomer. The developmental regulation of SF-1-binding activity parallels SF-1 factor accumulation, with the exception of newborn mouse adrenal extracts, in which DNA-SF-1 complex was markedly reduced, representing less than 6% of the binding activity observed on E18.5 (Fig. 9CGo). We conclude from these data that a strong parallel exists between the variations in CAT transgene activity, akr1b7, and SF-1 expression in the adrenals of developing mice, indicating that the developmental regulation of akr1b7 expression might be governed by prior changes in SF-1 levels and/or binding activity.



View larger version (41K):
[in this window]
[in a new window]
  		Figure 9. SF-1 transcription factor displays a triphasic pattern of expression in developing mouse adrenals. Whole adrenal protein extracts from fetal (E16.5 and E18.5) and neonatal male mice (pd1 to pd 40) were analyzed for SF-1, AKR1B7, and ß-actin accumulation by Western blot (A) and for SF-1-binding activity by EMSA using an LRH-RE probe (B). Anti-SF-1 antibody and high affinity SF-1 oligonucleotide competitor (21-OH) were introduced in the EMSA reactions of the two last lanes, respectively. The black arrowhead indicates an SF-1-specific complex; the asterisk points to a supershifted SF-1 complex. The histogram (C) summarizes the quantitative changes in immunodetectable SF-1 and AKR1B7 proteins detected in Western blots (densitometric analysis) and SF-1-binding activity revealed by EMSA (phosphorimager). The number of mice per age group used for adrenal protein extracts is indicated in parentheses.

 
Requirement of the proximal ARE/SFRE for hormonal regulation in the adrenals
Previously, we have shown that CAT activity driven by the 0.5-kb promoter was sensitive to endogenous ACTH deprivation after dexamethasone injections (11). Here we show that reporter expression from the adrenals of mouse lines containing the wt 1.8- or 0.5-kb transgenes was decreased by treatment ensuring negative feedback of hypothalamic-pituitary-adrenal axis (dexamethasone) and conversely was dramatically induced by ACTH replacement (Fig. 10Go). Surprisingly, reporter expression directed by the mutant 1.8-kb promoter containing the mutated -102 SFRE responded very efficiently to ACTH. Note that the mutated transgene seems globally less sensitive to endogenous ACTH deprivation (2.5-fold vs. 2- and 7.2-fold decrease) and to ACTH replacement (46-fold vs. 149- and 880-fold increase) than the wt transgene. These results indicate that the -102 SFRE is not essential to ACTH regulation of the akr1b7 gene promoter.



View larger version (31K):
[in this window]
[in a new window]
  		Figure 10. Hormonal regulation of the transgenes. CAT-specific activity was determined in adrenal homogenates of male transgenic mice harboring either the wt 1.8-kb (lines 14 and 15) and 0.5-kb (lines 5 and 62) constructs or the mutated AREpm 1.8-kb construct (line 19). Eight-week-old mice were injected for 5 d with vehicle, dexamethasone alone (DEX 5d), or dexamethasone in combination with ACTH for the last 2 d (DEX 5d ACTH 2d). Each value is the mean of at least four mice analyzed ± SD.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
Using transgenic mice, we have demonstrated the requirement for a noncanonical binding site for SF-1, previously characterized in vitro (14), for expression of the akr1b7 gene in the adrenal in vivo. Indeed, a mutation known to prevent SF-1 binding to the -102 SFRE results in a drastic decrease in gene expression in all transgenic mouse lines tested. Interestingly, this SFRE is part of a bifunctional cis-acting element because it lies within a proximal binding site for AR (AREp) shown to ensure androgen responsiveness of the gene in vitro (16) and to be required for vas deferens expression in mouse (30). As AR protein was detected in significant amounts in mouse adrenal (31), impaired transgene expression may have resulted from the loss of AR, rather than SF-1 interaction. However, this is unlikely, because complete lack of AR in Tfm mouse adrenals did not impair AKR1B7 expression compared with that in wt mice. This clearly indicates that, at least in adrenals where SF-1 is present in large amounts, AR is unable to activate akr1b7 gene transcription in vivo. Recent reports have revealed a potential role of the orphan receptor LRH-1 in the regulation of gonadal steroidogenesis for essentially two reasons: first, LRH-1 was shown to trans-activate the promoters of steroidogenic genes in cotransfection experiments through binding to canonical recognition motifs for SF-1; and second, LRH-1 transcripts were accumulated at significant levels, particularly in the human ovary and also in the testis (27, 28). Although in vitro translated LRH-1 was able to bind weakly to the atypical -102 SFRE of akr1b7 gene promoter, no endogenous LRH-1 binding was detected in the protein extracts from mouse adrenals using the high affinity binding sequence (LRH-RE) from the CYP7A promoter (26). These data were in perfect agreement with the quantitative RT-PCR experiments of Siriani and colleagues (28), which showed that human adrenal expression of SF-1 was 900-fold greater than that seen for LRH-1. Thus, a decrease in gene expression in the mutated -102 SFRE transgene is the result of a loss of SF-1 interaction on the AREp sequence. Note that SF-1 interaction on the -102 SFRE within AREp is not due to a general property of AR binding sequences, because a structurally related upstream site, AREd, which is unable to bind SF-1 (Ref. 14 and present results), has no influence on transgene expression in the adrenal. Finally, supporting a major influence of SF-1 in vivo, the SF-1 levels/binding activity in developing mice follow a pattern similar to that of both the akr1b7 endogenous gene and transgenes (wt and AREdm 1.8 kb). Taken together, these data support the argument that akr1b7 is indeed a target gene for SF-1 in vivo and emphasize the coordinate regulation of steroidogenesis and of a gene detoxifying its by-products (4).

In addition to its role in targeting tissue-specific gene expression, SF-1 has been involved in hormonal stimulation of many genes (32, 33, 34, 35). Our data show unequivocally that the proximal -102 SFRE is not necessary for ACTH stimulation of akr1b7 gene, as the transgenes containing either mutated or wild-type -102 SFRE are similarly responsive to both negative feedback of the hypothalamic-pituitary-adrenal axis and ACTH replacement. Together these data indicate that the proximal SF-1-binding site is not essential for adrenal targeting of the akr1b7 gene, but, rather, influence promoter strength. Consequently, additional cis-acting elements may contribute to adrenal-specific expression and ACTH regulation of the gene. This is supported by both developmental studies and hormonal manipulations showing that mutation of the -102 SFRE does not preclude embryonic and early postnatal expression or ACTH induction of the gene. These results are in agreement with the recent identification of sequences accounting for species (rat vs. mouse) differences in tissue-specific control. Indeed, in the rat the absence of a proximal LINE-derived 77-bp insertion containing the overlapping -111 AREp/-102 SFRE, only affects vas deferens expression without abolishing ACTH-sensitive adrenal expression (30). Finally, we recently reported the identification and functional analysis of two conserved SF-1 binding sites located at more upstream positions (-458 and -503) that are essential for both basal and forskolin-induced activity of the 0.5-kb promoter in Y1 cells (15).

Recently, Hu and colleagues (21) examined the respective roles of two SF-1-binding sites in the regulation of CYP11A1 gene expression in transgenic mice. The main message of these in vivo studies is that these two SFREs are not functionally equivalent; the proximal one (-40) is absolutely required for the core promoter activity in the adrenal, whereas the distal site (-1600), the mutation of which is less deleterious, seems to be more specialized in hormonal response. Our data reveal a potential third type of element illustrated by the -102 SFRE of the akr1b7 gene that affects promoter strength without precluding tissue targeting or hormonal control. Interestingly, multiple SFREs are often found within regulatory regions of SF-1 target genes. Genetic evidence from patients with adrenal deficiencies due to heterozygous mutations in SF-1 locus and from SF-1 heterozygous (+/-) mice showing an impaired stress response indicate that this factor functions in a dose-dependent manner in both species (36, 37, 38, 39). As SF-1 acts as a quantitative regulator, one can hypothesize that the number (or the accessibility) of the different SFREs within a given gene will fine-tune when (development), where (tissue), and how (hormone responsiveness) this gene will be sensitive to SF-1 action. Interestingly, the possibility that a quantitative effect of SF-1 might be governed not only by the trans-acting factor levels, but also by the number (or the accessibility) of its cis-acting sequences (SFREs), is in good agreement with the SF-1 expression profile we observed in developing adrenals. Indeed, our data point out, for the first time, that immunoreactive SF-1 levels and binding activity to an SFRE are age dependent and displayed a pronounced triphasic pattern characterized by 1) a strong binding activity during the late embryonic period, 2) down-regulation from birth to pd10 (reaching a nadir on pd6), and 3) a progressive, but partial, recovery of embryonic values thereafter. This is consistent with our data concerning developmental effects of inactivation of the -102 SFRE, which turns the triphasic expression profile of the wt -102 SFRE transgenes (wt 1.8 kb and AREdm 1.8 kb) into a biphasic profile observed for the mutant construct (AREpm 1.8 kb). Indeed, mutation of the -102 SFRE impaired gene expression in transgenic mice from pd15 to adulthood without preventing early expression or ACTH responsiveness. The inability of this mutant promoter bearing two intact SFREs (-458 and -503) of three to recover early expression levels might reflect its weakened responsiveness to SF-1 activity found in mouse adrenals after pd15. Thus, the onset of SF-1 target gene expression during development (or after hormonal exposure) might be dependent not only on the SF-1 amounts, but also on the accessibility of some specialized SFREs.

In conclusion, using a transgenic approach we have shown that the promoter region of the akr1b7 gene is a particularly useful tool to examine in detail SFRE functions in vivo. This regulatory region, concentrating three SFREs within a short sequence (0.5 kb), gives us the opportunity to address in vivo the possibility that spatio-temporal and hormonal expression patterns of SF-1 target genes could be governed at least in part by a complex array of functionally distinct SF-1-binding sites. Finally, it is well established that during postnatal development of the rat there is a period from pd4 to pd14 during which adrenal steroidogenesis is unresponsive to ACTH (40). The biochemical nature of this hyporesponsiveness is poorly understood, but has been correlated to the coincident down-regulation of two genes that both displayed a triphasic pattern of expression: PBR (the peripheral-type mitochondrial benzodiazepine receptor), involved in cholesterol delivery to mitochondrial enzyme, and CYP1B1, a P450 cytochrome involved in metabolism of polycyclic aromatic hydrocarbons (41, 42). Whether the evidence of a coordinate and triphasic expression of SF-1 and akr1b7 genes in developing adrenals could favor the existence of a hyporesponsive period in mouse species remains to be explored.


   Acknowledgments
 
We thank Dr. J. M. Lobaccaro for critical reading of this manuscript, and A. De Haze for excellent technical assistance.


   Footnotes
 
This work was supported by the Centre National de la Recherche Scientifique and the Université Blaise Pascal.

Abbreviations: AKR1B7/MVDP, Aldo-keto-reductase 1 B7/mouse vas deferens protein; AR, androgen receptor; AREd, distal androgen- responsive element; AREdm, mutated distal androgen-responsive element; AREp, proximal androgen-responsive element; AREpm, mutated proximal androgen-responsive element; CAT, chloramphenol acetyltransferase; dbd, DNA-binding domain; E, embryonic day; GST, glutathione-S-transferase; LRH-1, liver receptor homolog-1; LRH-RE, LRH-1 response element; 21-OH, 21-hydroxylase; pd, postnatal day; SF-1, steroidogenic factor-1; SFRE, steroidogenic factor-1 response element; wt, wild-type.

Received August 7, 2002.

Accepted for publication January 30, 2003.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Waterman MR, Keeney DS 1996 Signal transduction pathways combining peptide hormones and steroidogenesis. Vit Horm 52:129–148[Medline]
  2. Stocco DM, Clark BJ 1996 Regulation of acute production of steroids in steroidogenic cells. Endocr Rev 17:221–244[Abstract/Free Full Text]
  3. Landschulz KT, Pathak RK, Rigoti A, Krieger M, Hobbs HH 1996 Regulation of scavenger receptor, class B, type I, a high density lipoprotein receptor, in liver and steroidogenic tissues of the rat. J Clin Invest 98:984–995[Medline]
  4. Lefrançois-Martinez AM, Tournaire C, Martinez A, Berger M, Daoudal S, Tritsch D, Veyssière G, Jean C 1999 Product of side-chain cleavage of cholesterol, isocaproaldehyde, is an endogenous specific substrate of mouse vas deferens protein, an aldose reductase-like protein in adrenocortical cells. J Biol Chem 274:32875–32880[Abstract/Free Full Text]
  5. Taragnat C, Berger M, Jean C 1988 Preliminary characterization, androgen-dependence and ontogeny of an abundant protein from mouse vas deferens. J Reprod Fertil 83:835–842[Abstract/Free Full Text]
  6. Lau ET, Cao D, Lin C, Chung SK, Chung SS 1995 Tissue-specific expression of two aldose reductase-like genes in mice: abundant expression of mouse vas deferens protein and fibroblast growth factor-regulated protein in the adrenal gland. Biochem J 312:609–615
  7. Aigueperse C, Martinez A, Lefrancois-Martinez AM, Veyssiere G, Jean CI 1999 Cyclic AMP regulates expression of the gene coding for a mouse vas deferens protein related to the aldo-keto reductase superfamily in human and murine adrenocortical cells. J Endocrinol 160:147–154[Abstract]
  8. Brockstedt E, Peters-Kottig M, Badock V, Hegele-Hartung C, Lessl M 2000 Luteinizing hormone induces mouse vas deferens protein expression in the murine ovary. Endocrinology 141:2574–2581[Abstract/Free Full Text]
  9. Martinez A, Aigueperse C, Val P, Dussault M, Tournaire C, Bd 2001 Physiological functions and hormonal regulation of mouse vas deferens protein (AKR1B7) in steroidogenic tissues. Chem Biol Interact 130–132:903–917
  10. Sahut-Barnola I, Lefrancois-Martinez AM, Jean C, Veyssiere G, Martinez A 2000 Adrenal tumorigenesis targeted by the corticotropin-regulated promoter of the aldo-keto reductase AKR1B7 gene in transgenic mice. Endocr Res 26:885–898[Medline]
  11. Martinez A, Lefrancois-Martinez AM, Manin M, Guyot S, Jean-Faucher C, Veyssiere G, Kahn A, Jean C 1999 5'-Flanking and intragenic sequences confer androgenic and developmental regulation of mouse aldose reductase-like gene in vas deferens and adrenal in transgenic mice. Endocrinology 140:1338–1348[Abstract/Free Full Text]
  12. Martinez A, Pailhoux E, Jean C 1991 Androgen dependence during development of the mouse vas deferens protein mRNA. Mol Cell Endocrinol 76:191–200[CrossRef][Medline]
  13. Manin M, Martinez A, Van Der Schueren B, Reynaert I, Jean C 2000 Acquisition of androgen-mediated expression of mouse vas deferens protein (MVDP) gene in cultured epithelial cells and in vas deferens during postnatal development. J Androl 21:641–650[Abstract]
  14. Aigueperse C, Val P, Pacot C, Darne C, Lalli E, Sassone-Corsi P, Veyssiere G, Jean C, Martinez A 2001 SF-1, C/EBPß, and ubiquitous transcription factors NF1 and Sp1 are required for regulation of the mouse aldose reductase-like gene (AKR1B7) expression in adrenocortical cells. Mol Endocrinol 15:93–111[Abstract/Free Full Text]
  15. Val P, Aigueperse C, Lefrançois-Martinez AM, Jean Cl, Veyssière G, Martinez A 2002 Role of three SF-1 binding sites in the expression of the MVDP/AKR1-B7 isocaproaldehyde reductase in Y1 cells. Endocr Res 28:527–533[CrossRef][Medline]
  16. Fabre S, Manin M, Pailhoux E, Veyssiere G, Jean C 1994 Identification of a functional androgen response element in the promoter of the gene for the androgen-regulated aldose reductase-like protein specific to the mouse vas deferens. J Biol Chem 269:5857–5864[Abstract/Free Full Text]
  17. Parker KL, Rice DA, Lala DS, Ikeda Y, Luo X, Wong M, Bakke M, Zhao L, Frigeri C, Hanley NA, Stallings N, Schimmer BP 2002 Steroidogenic factor 1: an essential mediator of endocrine development. Recent Prog Horm Res 57:19–36[Abstract/Free Full Text]
  18. Keri RA, Nilson JH 1996 A steroidogenic factor-1 binding site is required for activity of the luteinizing hormone ß subunit promoter in gonadotropes of transgenic mice. J Biol Chem 271:10782–10785[Abstract/Free Full Text]
  19. Giuili G, Shen WH, Ingraham HA 1997 The nuclear receptor SF-1 mediates sexually dimorphic expression of Mullerian inhibiting substance, in vivo. Development 124:1799–1807[Abstract]
  20. Arango NA, Lovell-Badge R, Behringer RR 1999 Targeted mutagenesis of the endogenous mouse Mis gene promoter: in vivo definition of genetic pathways of vertebrate sexual development. Cell 99:409–419[CrossRef][Medline]
  21. Hu MC, Hsu NC, Pai CI, Wang CK, Chung BC 2001 Functions of the upstream and proximal steroidogenic factor 1 (SF-1)-binding sites in the CYP11A1 promoter in basal transcription and hormonal response. Mol Endocrinol 15:812–818[Abstract/Free Full Text]
  22. Luo X, Ikeda Y, Parker KL 1994 A cell-specific nuclear receptor is essential for adrenal and gonadal development and sexual differentiation. Cell 77:481–490[CrossRef][Medline]
  23. Darne CH, Morel L, Claessens F, Manin M, Fabre S, Veyssière G, Rombauts W, Jean C 1997 Ubiquitous transcription factors NF1 and Sp1 are involved in the androgen activation of the mouse vas deferens protein promoter. Mol Cell Endocrinol 132:13–23[CrossRef][Medline]
  24. De Santa Barbara P, Bonneaud N, Boizet B, Desclozeaux M, Moniot B, Sudbeck P, Scherer G, Poulat F, Berta P 1998 Direct interaction of SRY-related protein SOX9 and steroidogenic factor 1 regulates transcription of the human anti-Müllerian hormone gene. Mol Cell Biol 18:6653–6665[Abstract/Free Full Text]
  25. Rice DA, Mouw AR, Bogerd AM, Parker KL 1991 A shared promoter element regulates the expression of three steroidogenic enzymes. Mol Endocrinol 5:1552–1561[Abstract/Free Full Text]
  26. Lu TT, Makishima M, Repa JJ, Schoonjans K, Kerr TA, Auwerx J, Mangelsdorf DJ 2000 Molecular basis for feedback regulation of bile acids synthesis by nuclear receptors. Mol Cell 6:507–515[CrossRef][Medline]
  27. Wang ZN, Bassett M, Rainey WE 2001 Liver receptor homologue-1 is expressed in the adrenal and can regulate transcription of 11ß-hydroxylase. J Mol Endocrinol 27:255–258[Abstract]
  28. Siriani R, Seely JB, Attia G, Stocco DM, Carr BR, Pezzi V, Rainey WE 2002 Liver receptor homologue-1 is expressed in human steroidogenic tissues and activates transcription of genes encoding steroidogenic enzymes. J Endocrinol 174:R13–R17
  29. Clyne CD, Speed CJ, Zhou J, Simpson ER 2002 Liver receptor homologue-1 (LRH-1) regulates expression of aromatase in preadipocytes. J Biol Chem 277:20591–20597[Abstract/Free Full Text]
  30. Val P, Martinez A, Sahut-Barnola I, Jean C, Veyssière G, Lefrançois-Martinez AM 2002 A 77-bp LINE-like sequence elicits androgen-dependent mvdp/akr1b7 expression in mouse vas deferens, but is dispensable for adrenal expression in rat. Endocrinology 143:3435–3448[Abstract/Free Full Text]
  31. Bentvelsen FM, McPhaul MJ, Wilson CM, Wilson JD, George FW 1996 Regulation of immunoreactive androgen receptor in the adrenal gland of the adult rat. Endocrinology 137:2659–2663[Abstract]
  32. Zhang P, Mellon SH 1996 The orphan nuclear receptor steroidogenic factor-1 regulates the cyclic adenosine 3',5'-monophosphate-mediated transcriptional activation of rat cytochrome P450c17 (17{alpha}-hydroxylase/c17–20 lyase). Mol Endocrinol 10:147–158[Abstract/Free Full Text]
  33. Liu Z, Simpson ER 1997 Steroidogenic factor 1 (SF-1) and SP1 are required for regulation of bovine CYP11A gene expression in bovine luteal cells and adrenal Y1 cells. Mol Endocrinol 11:127–137[Abstract/Free Full Text]
  34. Reinhart AJ, Williams SC, Clark BJ, Stocco DM 1999 SF-1 (steroidogenic factor-1) and C/EBPß (CCAAT/enhancer binding protein-ß) cooperate to regulate the murine StAR (steroidogenic acute regulatory) promoter. Mol Endocrinol 13:729–741[Abstract/Free Full Text]
  35. Lopez D, Sandhoff TW, McLean MP 1999 Steroidogenic factor-1 mediates cyclic 3',5'-adenosine monophosphate regulation of the high density lipoprotein receptor. Endocrinology 140:3034–3044[Abstract/Free Full Text]
  36. Achermann JC, Ito M, Ito M, Hindmarsh PC, Jameson JL 1999 A mutation in the gene encoding steroidogenic factor-1 causes XY sex reversal and adrenal failure in humans. Nat Genet 22:125–126[CrossRef][Medline]
  37. Biason-Lauber A, Schoenle EJ 2000 Apparently normal ovarian differentiation in a prepubertal girl with transcriptionally inactive steroidogenic factor 1 (NR5A1/SF-1) and adrenocortical insufficiency. Am J Hum Genet 67:1563–1568[CrossRef][Medline]
  38. Achermann JC, Ozisik G, Ito M, Orun UA, Harmanci K, Gurakan B, Jameson JL 2002 Gonadal determination and adrenal development are regulated by the orphan nuclear receptor steroidogenic factor-1, in a dose-dependent manner. J Clin Endocrinol Metab 87:1829–1833[Abstract/Free Full Text]
  39. Bland ML, Jamieson CA, Akana SF, Bornstein SR, Eisenhofer G, Dallman MF, Ingraham HA 2000 Haploinsufficiency of steroidogenic factor-1 in mice disrupts adrenal development leading to an impaired stress response. Proc Natl Acad Sci USA 97:14488–14493[Abstract/Free Full Text]
  40. Okimoto DK, Blaus A, Schmidt M, Gordon MK, Dent GW, Levine S 2002 Differential expression of c-fos and tyrosine hydroxylase mRNA in the adrenal gland of the infant rat: evidence for an adrenal hyporesponsive period. Endocrinology 143:1717–1725[Abstract/Free Full Text]
  41. Zilz A, Li H, Castello R, Papadopoulos V, Widmaier EP 1999 Developmental expression of the peripheral-type benzodiazepine receptor and the advent of steroidogenesis in rat adrenal glands. Endocrinology 140:859–864[Abstract/Free Full Text]
  42. Brake PB, Arai M, As-Sanie S, Jefcoate CR, Widmaier EP 1999 Developmental expression and regulation of adrenocortical cytochrome P4501B1 in the rat. Endocrinology 140:1676–1680



This article has been cited by other articles:


Home page
 EndocrinologyHome page
J. Tirard, J. Gout, A. M. Lefrancois-Martinez, A. Martinez, M. Begeot, and D. Naville
A Novel Inhibitory Protein in Adipose Tissue, the Aldo-Keto Reductase AKR1B7: Its Role in Adipogenesis
Endocrinology, May 1, 2007; 148(5): 1996 - 2005.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
B. Ragazzon, A.-M. Lefrancois-Martinez, P. Val, I. Sahut-Barnola, C. Tournaire, C. Chambon, J.-L. Gachancard-Bouya, R.-J. Begue, G. Veyssiere, and A. Martinez
Adrenocorticotropin-Dependent Changes in SF-1/DAX-1 Ratio Influence Steroidogenic Genes Expression in a Novel Model of Glucocorticoid-Producing Adrenocortical Cell Lines Derived from Targeted Tumorigenesis
Endocrinology, April 1, 2006; 147(4): 1805 - 1818.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
P. Val, C. Aigueperse, B. Ragazzon, G. Veyssiere, A.-M. Lefrancois-Martinez, and A. Martinez
Adrenocorticotropin/3',5'-Cyclic AMP-Mediated Transcription of the Scavenger akr1-b7 Gene in Adrenocortical Cells Is Dependent on Three Functionally Distinct Steroidogenic Factor-1-Responsive Elements
Endocrinology, February 1, 2004; 145(2): 508 - 518.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Martinez, A.
Right arrow Articles by Lefrançois-Martinez, A.-M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Martinez, A.
Right arrow Articles by Lefrançois-Martinez, A.-M.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals