This Article Abstract Full Text (PDF) Purchase Article View Shopping Cart Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Copyright Permission Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Hömme, M. Articles by Schaefer, F. Search for Related Content PubMed PubMed Citation Articles by Hömme, M. Articles by Schaefer, F. Pubmed/NCBI databases Gene GEO Profiles HomoloGene UniGene Compound via MeSH Substance via MeSH Hazardous Substances DB 1,25-DIHYDROXYCHOLECALCIFEROL DEXAMETHASONE PARATHYROID HORMONE Medline Plus Health Information Steroids

Vitamin D and Dexamethasone Inversely Regulate Parathyroid Hormone-Induced Regulator of G Protein Signaling-2 Expression in Osteoblast-Like Cells

Division of Pediatric Nephrology, Heidelberg University Children’s Hospital, 69120 Heidelberg, Germany

Address all correspondence and requests for reprints to: Dr. Franz Schaefer, Division of Pediatric Nephrology, University Children’s Hospital, Im Neuenheimer Feld 150, 69120 Heidelberg, Germany. E-mail: franz_schaefer{at}med.uni-heidelberg.de.

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion References

 
The PTH/PTHrP receptor stimulates both adenylate cyclase- and phospholipase C-dependent signaling pathways via different G proteins. The biological actions of PTH on bone are modified by steroid hormones. PTH induces expression of regulator of G protein signaling (RGS)-2, a putative preferential inhibitor of G_q-mediated phospholipase C activation. We investigated whether steroid hormones interfere with PTH signaling by modulating PTH-induced RGS-2 expression in osteoblast-like UMR 106-01 cells. PTH (1–34) rapidly and transiently induced expression of RGS-2 mRNA and protein via the cAMP/protein kinase A pathway within 30 min, with maximal protein abundance after 2 h. PTH-induced RGS-2 preferentially bound to G_q, compared with G_s protein. 1,25-(OH)₂D₃ pretreatment enhanced PTH-induced RGS-2 mRNA and protein accumulation, whereas dexamethasone preincubation had an attenuating effect. These effects were due to modulation of the RGS-2 gene transcription rate, which increased by 35% with 1,25-(OH)₂D₃ and decreased by 63% with dexamethasone pretreatment. RGS-2 mRNA half-life was not affected by either steroid. The transcriptional effects of dexamethasone and 1,25-(OH)₂D₃ were independent of PTH/PTHrP receptor activation and were not explained by effects on cAMP accumulation, cAMP response element-binding protein expression or phosphorylation, or the abundance of the osteoblast-specific transcription factor core-binding factor (CBFa1/Runx2), a known activator of RGS-2 expression. In conclusion, glucocorticoids and 1,25-(OH)₂D₃ inversely modulate PTH-induced RGS-2 gene transcription. Regulation of RGS-2 may constitute a novel mechanism by which steroids modulate signaling via the PTH/PTHrP receptor and other G protein-coupled receptors in bone.

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion References

 
PTH HAS COMPLEX actions on bone homeostasis. In pharmacological studies PTH exhibited both anabolic and catabolic effects, dependent on the temporal pattern of PTH delivery (1, 2). On binding to its G protein-coupled receptor, PTH can activate both the G_s-regulated adenylate cyclase and the G_q-regulated phospholipase C, resulting in the activation of cAMP/protein kinase A (PKA) as well as protein kinase C (PKC)/Ca²⁺ dependent cellular processes and transcriptional responses (3, 4). Important catabolic actions of PTH on osteoblasts are mediated via activation of the cAMP/PKA pathway, such as the suppression of osteoprotegerin, the induction of collagenase expression, and inhibition of the MAPK pathway (5, 6, 7). The biological effects of the activation of the PKC/Ca²⁺ signaling system by PTH are less well understood but may serve predominantly to activate proliferative and/or antiapoptotic processes (6, 8).

The relative activation of adenylate cyclase and phospholipase C on binding of PTH to its receptor critically depends on the duration and magnitude of activation of the G_s and G_q protein subunits. Recently a family of intracellular proteins has been identified that function as regulators of G protein signaling (RGS; Refs.9, 10, 11). These proteins bind to and accelerate the inactivation of G proteins by enhancing their GTPase activity (10). Because individual RGS proteins differ in their relative affinity to G_s, G_i, and G_q subunits and are expressed in tissue-specific patterns, these proteins may be responsible for the cell type-specific actions of many ligands of G protein-coupled receptors. Some of the 20 known mammalian members of this family appear to be regulated in response to G protein-mediated signaling events (11, 12). RGS-2 was recently identified as a bone-specific target gene of PTH (13, 14). RGS-2 expression is rapidly and transiently induced in response to PTH in osteoblasts via the PKA pathway (13, 14). RGS-2 may preferentially bind to and inactivate the G_q subunit, although the in vitro findings are still controversial (13, 15). Preliminary evidence suggests that the accumulation of the short-lived RGS-2 protein critically depends on the temporal pattern of PTH delivery (16). Hence, RGS-2 may play a key role in the differential regulation of osteoblast metabolism by PTH exposure dynamics.

Glucocorticoids and other steroid hormones are known to affect the susceptibility of osteoblasts to PTH by various mechanisms, mainly at the receptor level. Continuous incubation of UMR 106-01 rat osteoblastic cells with 1,25-(OH)₂D₃ for 24–72 h reduces PTH/PTHrP receptor mRNA abundance and PTH binding (17). PTH-induced cAMP accumulation was decreased and G_q/11 protein levels reduced in UMR 106 cells after preincubation with 1,25-(OH)₂D₃ (18), whereas treatment of ROS 17/2.8 rat osteoblastic cells with dexamethasone increased PTH/PTHrP receptor mRNA expression (19) and adenylate cyclase stimulation by PTH (20). Moreover, dexamethasone stimulates G_q/11 protein expression in UMR 106-01 cells (21). Estrogens and androgens exert major anticatabolic actions on bone. Estradiol (E2) attenuates PTH-induced inhibition of osteoblast proliferation in vitro, possibly via stimulation of IGF-1 (22). In addition, estrogen and testosterone inhibit PTH-stimulated osteoclast-like cell formation (23, 24). Pretreatment of human osteoblast-like SaOS-2 cells with androgens inhibited PTH-induced cAMP accumulation (25).

In the work presented here, we tested the hypothesis that steroids might also regulate PTH receptor-mediated signaling by modulating PTH-induced RGS-2 expression.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion References

 
Materials
Recombinant human PTH (1–34) and bovine PTH (3–34) were purchased from Bachem (Heidelberg, Germany). Actinomycin D, cycloheximide, dexamethasone, dihydrotestosterone (DHT), E2, and forskolin were obtained from Sigma-Aldrich Corp. (Munich, Germany) and 1,25-(OH)₂D₃ from Calbiochem (San Diego, CA). RGS-2 antiserum was a gift from Kirk M. Druey (NIH, Bethesda, MD), ß-actin monoclonal antibody was obtained from Abcam (Cambridge, UK), and cAMP response element-binding protein (CREB), phospho-CREB, and horseradish peroxidase-conjugated (antirabbit, antimouse) antibodies were purchased from Cell Signaling Technology (Frankfurt, Germany). CBFa1/Runx2/AML-3 antibody (Santa Cruz, Heidelberg, Germany) was kindly provided by J. Hess (German Cancer Research Center, Heidelberg, Germany).

Cell culture
UMR 106-01 rat osteoblast-like osteosarcoma cells (kindly provided by David Feldman, Stanford University, Palo Alto, CA.) were grown in 75 cm² cell culture flasks at 37 C in humidified 5% CO₂ atmosphere in MEM (with Earle’s salts) supplemented with 10% fetal bovine serum, 100 U/ml penicillin/streptomycin, and 10 mM HEPES. Cells were passaged every 3–4 d, and experiments were performed using cells from passage 15–22. Subconfluent cultures were kept in serum-free medium, with or without addition of effector substances, for 24 h before stimulation with PTH, forskolin, or phorbol-12-myristate-13-acetate (PMA).

cAMP generation assay
Cells were plated in 24-well plates and allowed to grow until 80–90% confluence. After 24-h preincubation with indicated substances or serum-free medium, medium was removed and replaced by serum-free medium containing 1 mM 3-isobutyl-1-methylxanthine with/without PTH. After 10 min of incubation, medium was removed, and reaction was stopped by adding 500 µl of 100% ethanol. After incubation at 4 C for 4 h, ethanol was transferred into 1.5-ml tubes and dried under N₂-atmosphere at 37 C. The pellet was dissolved in cAMP buffer and stored at -20 C. A cAMP-RIA was performed with a commercially available kit (Immundiagnostik, Bensheim, Germany). Briefly, 50 µl of sample were mixed with 20 µl ³H-cAMP (50,000 cpm) and 20 µl cAMP-binding protein, centrifuged for 1 min at 1000 x g, and incubated overnight at 4 C. One hundred microliters charcoal were added, incubated for 2 min at room temperature, and centrifuged (15 min 2500 x g). One hundred microliters of the supernatant were mixed with 250 µl scintillation cocktail and analyzed in a ß-counter.

Multiplex RT-PCR
After incubation with indicated substances, total RNA was isolated using Rneasy mini columns (QIAGEN, Hilden, Germany), checked for integrity on an agarose gel, and quantified photometrically. One microgram total RNA was reverse transcribed using oligo(dT)/random hexamer primers (10:1). Multiplex PCR amplification was performed by using cDNA template, target primer pairs (RGS-2 forward: GGAAGACCCGTTTGAGCTAC; RGS-2 reverse: TTTCCTTGCTTTTGAGGACAG), and a mixture of 18S rRNA primers/competimers (Ambion, Inc., Austin, TX). Amplification was performed in a GeneAmp PCR System 2400 (Applied Biosystems, Weiterstadt, Germany) using the following protocol: initial 10 min preheating at 95 C (enzyme activation), followed by 30 cycles of 30 sec at 94 C (denaturation), 45 sec at 57 C (annealing), and 30 sec at 72 C (extension). The amplified products (RGS-2: 281 bp; 18S: 488 bp) were separated on a 2% agarose gel and visualized by ethidium bromide staining and UV transillumination. The resulting products were within the linear logarithmic phase of amplification. Routine control reactions performed by omitting reverse transcriptase or cDNA template showed no reaction product. ODs were analyzed using the Molecular Analyst computer program (Bio-Rad Laboratories, Inc., Vilbert Lourmat, France). Results were normalized with respect to the density of the multiplexed 18S rRNA product.

Ribonuclease protection assay
PCR amplification products were cloned into BP bluescript II KS vectors and in vitro transcribed using ³²P-labeled uridine 5-triphosphate. Twenty micrograms (or 50 ng for detection of 18S rRNA) total RNA were hybridized with the radiolabeled antisense riboprobes at 45 C overnight. The free probe was RNase digested followed by proteinase K treatment. After phenolization and ethanol precipitation, hybrids were diluted in RNA loading buffer and separated on a sequencing gel. The gel was dried on a paper (Whatman, distributed by Biometra, Göttingen, Germany) and incubated together with an x-ray film overnight in a cassette with intensifying screens at -80 C. Protected bands were quantified densitometrically and normalized against 18S rRNA bands.

Real-time RT-PCR-based nuclear run-on transcription assay
Cells from 175-cm² culture flasks were scraped into ice-cold PBS, nuclei were isolated, and assay was performed as described earlier (26). Briefly, cells were lysed in 200 µl buffer A [10 mM HEPES, 1.5 mM MgCl₂, 10 mM KCl, 500 µM dithiothreitol (DTT), 500 µM phenylmethylsulfonyl fluoride (PMSF), 10 µg/ml aprotinin, 10 µg/ml leupeptin]. Lysate was centrifuged, and the crude nuclear pellet was resuspended in 10 ml ice-cold buffer B (15 mM HEPES, 60 mM KCl, 3 mg/ml sucrose, 100 µM EDTA and EGTA, 1 mM DTT, 500 µM spermidine, 150 µM spermine, 500 µM PMSF, 2 µg/ml leupeptin, 0.5% Triton X-100). Nuclei were pelleted at 700 x g for 10 min at 4 C, gently resuspended in 10 ml buffer C (15 mM HEPES, 60 mM KCl, 3 mg/ml BSA, 300 mM sucrose, 100 µM EDTA and EGTA, 1 mM DTT, 500 µM spermidine, 150 µM spermine, 500 µM PMSF, 2 µg/ml leupeptin, and 5 mM MgAc), and repelleted again. The final nuclear pellets were resuspended in 230 µl storage buffer (40% glycerol, 75 mM HEPES, 60 mM KCl, 15 mM NaCl, 5 mM MgAc, 100 µM EDTA and EGTA, 1 mM DTT, 500 µM spermidine, 150 µM spermine, 2 µg/ml aprotinin and leupeptin), frozen in liquid nitrogen, and stored at -70 C.

To perform nuclear run-on transcription, nuclei were thawed on ice, and 160 µl of the suspension were incubated for 15 min at 22 C with 160 µl of 2x reaction buffer (20% glycerol, 100 mM KCl, 10 mM MgCl₂, 4.5 mM DTT, 1.2 mM ATP, 0.6 mM uridine 5-triphosphate, GTP, CTP, 80 U/ml RNase inhibitor, 500 µM spermidine, and 150 µM spermine). After digestion with Dnase 1 and proteinase K, total RNA was extracted, quantified, and reverse transcribed as indicated above. To determine the transcription rate of RGS-2, real time RT-PCR was performed using the Abi Prism 7000 real-time PCR system (Applied Biosystems, Darmstadt, Germany) with specific primers for 18S (forward: AGTTGGTGGAGCGATTTGTC; reverse: GCTGAGCCAGTTCAGTGTAGC) and primers specific for nascent, unspliced heterogeneous nuclear RGS-2 RNA (hnRNA) [forward: TTAAGCATCGGTCTGTACCATTGA (corresponding to intron 4); reverse: GCAGCCACTTGTAGCCTCTTG (corresponding to exon 5)] and Universal Mastermix (PE Applied Biosystems) with SYBR green to detect PCR products at the end of each amplification step. To eliminate interbatch variability, all cDNAs were amplified in a single run. Serial dilutions of an arbitrary cDNA pool were used to establish a standard curve. Relative quantities of RNA levels were determined accounting for amplification efficacy using the software provided with the PCR system. RGS-2 hnRNA levels were normalized to corresponding 18S quantities determined within the same run. Reverse transcription RNA controls, in which the cDNA synthesis step was omitted, and controls without template did not show a detectable amplification product.

Western immunoblotting
Cells incubated with indicated substances were washed once with cold PBS containing 100 mM Na₃VO₄ and scraped in 50 µl ice-cold lysis buffer (20 mM Tris-HCl, pH 8.0; 150 mM NaCl; 1% Triton X) containing a cocktail of proteinase and phosphatase inhibitors (20 mM NaF, 2 mM EDTA, 1 mM EGTA, 1 mM Na₃VO₄, 1 mM PMSF, 10 µg/ml leupeptin, 10 µg/ml aprotinin, 3 mM benzamidine), vortexed, and centrifuged for 15 min at 15,000 x g. The protein content of the supernatants was measured using the Bradford method (protein assay kit, Bio-Rad Laboratories, Inc., Munich, Germany). Fifty micrograms of protein were separated on polyacrylamide gels at 200 V for 45 min and blotted onto nitrocellulose membranes (105 V, 90 min). After blocking for 1 h in Tris-buffered saline with Tween 20 (10 mM Tris, pH 7.4, 138 mM NaCl, 0.05% Tween-20) containing 5% nonfat dry milk, blots were incubated with primary antibodies at 4 C overnight. Blots were washed three times for 15 min with Tris-buffered saline with Tween 20, incubated with horseradish peroxidase-conjugated secondary antibody for 1 h at room temperature, and washed again three times. Immune complexes were detected using enhanced chemiluminescence (Amersham Pharmacia Biotech, Freiburg, Germany). Blots were exposed to x-ray films (Kodak, Stuttgart, Germany), and protein bands were quantified densitometrically.

Immunoprecipitation
Cell lysis for immunoprecipitation was performed in 600 µl radioimmunoprecipitation assay buffer (1x PBS, 1% Nonidet P-40, 0.5% sodium deoxycholate, 0.1% SDS, 1 mM Na₃VO₄, 1 mM PMSF, 10 µg/ml leupeptin, 10 µg/ml aprotinin, 3 mM benzamidine). Cell lysates were homogenized by passing through a 20-gauge needle and syringe several times and centrifuged at 16,000 x g for 10 min. The supernatant was then incubated with 2 µl of the indicated antibodies on a shaker for 2 h at 4 C. Twenty microliters protein A/G agarose beads were added. After overnight incubation, lysates were centrifuged at 1000 x g for 10 min at 4 C. The pellets were washed four times with PBS, resuspended in electrophoresis buffer, and immunoblotted as described above.

Statistics
All experiments were performed at least three times, and samples were usually run in duplicate to account for technical and biological variability within and between experiments. ANOVA or t tests followed by Newman-Keuls testing were used to compare experimental groups as appropriate. Data are given as mean ± SD.

	Results

Top Abstract Introduction Materials and Methods Results Discussion References

 
Regulation of RGS-2 expression by PTH in UMR 106-01 cells
Continuous incubation of the UMR 106-01 cells with PTH induced a dose-dependent, rapid, and transient expression of RGS-2. RGS-2 mRNA and protein both became detectable within 30 min (Fig. 1). The abundance of RGS-2 mRNA and protein was maximal after 1 and 2 h, respectively, and decreased markedly during continued incubation with PTH after 4–6 h. RGS-2 expression dose dependently increased, even at excessively high concentrations (between 10^-7 M and 10^-5 M) (Fig. 2). Using the RGS-2 antiserum established by Sullivan et al. (27), we consistently observed two strong independent protein bands induced by PTH, one at a size of approximately 28 kDa and the second band at about 30 kDa. Previous observations detecting RGS-2 protein in HEK293T cells (27) or rat brain homogenates (28) showed only a single band of about 25–30 kDa. Whether the observed second band is an osteoblast-specific splice variant or a phosphorylated RGS-2 molecule remains to be determined.

View larger version (23K): [in this window] [in a new window]   Figure 1. Time-dependent RGS-2 mRNA and protein abundance. After 24-h serum starvation, cells were treated with 10-7M PTH (1–34) and harvested after different incubation times. A, The mRNA abundance measured by multiplex RT-PCR from 30 min to 6 h. B, Protein abundance.

View larger version (14K): [in this window] [in a new window]   Figure 2. Dose dependency of PTH-induced RSGS-2 expression in UMR 106-01 cells. After 24 h of serum starvation, cells were treated with indicated doses of PTH for 2 h. A, The mRNA (multiplex RT-PCR products). B, Protein abundance.

In agreement with previous mRNA studies (13, 14), we were able to demonstrate on the protein level that RGS-2 expression is induced exclusively via the cAMP/PKA signaling pathway in osteoblasts and other osteoblast-like cell lines. PTH-induced RGS-2 accumulation was reduced by 70% by cotreatment with H89, a PKA inhibitor (Fig. 3). In contrast, the PKC activator PMA did not induce RGS-2 expression, and coincubation of PTH with the PKC inhibitor bisindolylmaleimide did not reduce PTH-induced RGS-2 protein abundance. Furthermore, PTH (3–34), a fragment that binds to the PTH receptor and activates the PKC/Ca²⁺ but not the cAMP/PKA pathway, does not induce RGS-2 expression (Fig. 3).

View larger version (27K): [in this window] [in a new window]   Figure 3. Influence of different signaling pathways on PTH-induced RGS-2 expression. Cells were incubated with substances indicated at the bottom. Cells were lysed and Western blot was performed. A, SFM: serum-free medium control; PTH: incubation with 10-7 M PTH (1–34) for 2 h; PMA: 2-h incubation with 1 µM PMA; PTH + H89: coincubation of PTH (3–34) (10-7 M) and H89 (20 µM) for 2 h; PTH (3–34): incubation with 10-7 M PTH (3–34) for 2 h. B, Cells were incubated for 2 h with 10-7 M PTH. PTH + BIS: Cotreatment of PTH and bisindolylmaleimide (10-7 M) for the last 30 min of incubation.

RGS-2 preferentially binds to G_q subunits in vivo

View larger version (38K): [in this window] [in a new window]   Figure 4. RGS-2 binds preferentially to Gq. Cells were treated for indicated times with 10-7 M PTH. Cell lysates were incubated with antibodies against Gq or Gs, precipitated with protein A/G-agarose beads (IP). Western immunoblot (IB) was performed with indicated antibodies. A, Concentration control: whole-cell lysates, compared with precipitated Gq/Gs bands. B, Time-dependent RGS-2 binding to Gq/Gs

View larger version (31K): [in this window] [in a new window]   Figure 5. Effects of dexamethasone and 1,25-(OH)2D3 preincubation on PTH- and forskolin-induced RGS-2 expression. Cells were preincubated for 24 h with serum-free medium (SFM), 10-7M1,25-(OH)2D3 (1 25 ), or dexamethasone (Dexa). A, mRNA expression. After treatment with 10-7M PTH for 2 h, RNA was isolated and RGS-2 mRNA content was measured by ribonuclease protection assay. B, Protein expression. After incubation with forskolin or PTH for 1.5 h (10-7 M), cells were lysed in protein lysis buffer and separated on a denaturing gel. Western immunoblot was performed using RGS-2 antiserum. Blots were stripped and ß-actin antibody was used as a loading control.

Effect of 1,25-(OH)₂D₃ and dexamethasone on PTH-induced RGS-2 mRNA synthesis
RT-PCR-based nuclear run-on assays were performed to investigate the effect of 1,25-(OH)₂D₃ or dexamethasone pretreatment on the rate of RGS-2 gene transcription induced by PTH. By using a forward primer corresponding to an intronic sequence of the RGS-2 gene, we measured newly transcribed, unspliced hnRNA. RNA isolated from nuclei not treated with PTH did not show an amplification product of RGS-2 hnRNA. Preincubation of the cells with 1,25-(OH)₂D₃ enhanced PTH-induced RGS-2 hnRNA expression by 35%, whereas dexamethasone pretreatment suppressed RGS-2 hnRNA synthesis by 63% (Fig. 6).

View larger version (37K): [in this window] [in a new window]   Figure 6. Effects of dexamethasone and 1,25-(OH)2D3 preincubation on PTH-induced RGS-2 mRNA transcription rate. Cells were grown in 175-cm2 flasks and preincubated for 24 h with serum-free medium or indicated substances before they were treated with 10-7 M PTH for 1.5 h. Nuclei were isolated, nuclear run-on assayed, and real-time RT-PCR performed.

View larger version (11K): [in this window] [in a new window]   Figure 7. Half-life of RGS-2 mRNA. Cells were incubated with serum-free medium alone (A), 1,25-(OH)2D3 (B), or dexamethasone (C) for 24 h followed by incubation with PTH for 2 h (10-7 M) and treated with actinomycin D (5 mg/liter) for different times. No significant differences were observed between experimental groups.

View larger version (41K): [in this window] [in a new window]   Figure 8. Effects of dexamethasone and 1,25-(OH)2D3 preincubation on PTH-induced cAMP accumulation (A) and CREB phosphorylation (B). Cells were grown until subconfluency and preincubated for 24 h with serum-free medium or indicated substances. A, After incubation with PTH for 10 min (10-7M) in medium containing 3-isobutyl-1-methylxanthine, cAMP was measured as indicated in Materials and Methods. B, Cells were incubated with 10-7M PTH for 20 and 60 min, and phosphorylation of CREB was determined by Western immunoblot using a phosphorylation site-specific antibody.

Effect of 1,25-(OH)₂D₃ and dexamethasone on CBFa-1 protein abundance
To further examine the possible mechanism responsible for altered RGS-2 transcription, we investigated the abundance of CBFa-1/Runx2 protein, an osteoblast-specific transcription factor known to bind to the RGS-2 promoter. The abundance of CBFa1 protein in nuclear extracts was not altered by preincubation with either substance (Fig. 9).

View larger version (18K): [in this window] [in a new window]   Figure 9. Effects of dexamethasone and 1,25-(OH)2D3 pretreatment on CBFa1/Runx2 protein abundance. Cells were incubated for 24 h with serum-free medium or indicated substances. CBFa1 protein was detected in nuclear extracts by Western immunoblotting.

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion References

We observed a rapid and transient induction of RGS-2 protein expression by PTH evoked by a cAMP/PKA mediated mechanism in UMR 106-01 osteoblast-like cells, confirming and extending to the protein level previous mRNA findings in primary murine and rat osteoblasts and rodent osteoblast-like cell lines (14, 29, 30). These data lend further support to the notion that RGS-2 functions as an immediate-early PTH response gene in bone.

In view of the dual activation of G_s- and G_q-mediated signaling pathways by the PTH receptor (3, 31), it was of interest to study whether RGS-2 exhibits binding selectivity to one of these G proteins. In vitro studies have yielded discrepant results: Whereas Heximer et al. (15) observed severalfold higher binding affinity of RGS-2 to G_q, Ko et al. (13) observed binding of GST-RGS2 expressed in Escherichia coli bacteria to both G proteins. Thirunavukkarasu et al. (30) found 55% reduction of PTH-induced cAMP accumulation in UMR 106 cells overexpressing RGS-2, but G protein-independent adenylate cyclase stimulation by forskolin had the same effect. The latter finding is compatible with an additional direct effect of RGS-2 on adenylate cyclase (32). Functional effects of RGS-2 on PTH-induced G_q-mediated signaling have not been evaluated to date. We used immunoprecipitation to monitor G protein-binding specificity of RGS-2 following stimulation by PTH in vivo. We were able to demonstrate intense binding of RGS-2 protein to G_q, which was maximal after 90 min and already decreasing after 2 h of PTH exposure. Binding of RGS-2 to G_s appeared much weaker but showed similar temporal dynamics. The observed time course of G protein binding is in keeping with the recent observation that the binding affinity of RGS-2 is highest when G proteins are in the transitional state and diminishes when the G proteins return to their inactive state (13). Our results suggest that the interaction of RGS-2 with G proteins is indeed transient and already vanishing when the maximal abundance of RGS-2 protein is reached.

The main aim of the present study was to investigate whether known steroidal effectors of osteoblast metabolism might regulate PTH actions by modulating RGS-2 expression.

Whereas RGS-2 expression was not directly induced by dexamethasone or various steroid hormones, pretreatment with 1,25-(OH)₂D₃ markedly increased and dexamethasone moderately decreased PTH-induced RGS-2 mRNA and protein expression. These effects were specific inasmuch as preincubation with other steroid hormones did not affect PTH-induced RGS-2 expression. 1,25-(OH)₂D₃ and dexamethasone have been demonstrated to affect the stability of certain mRNA transcripts (19, 33). We ruled out the possibility of posttranscriptional modes of action by actinomycin D chase experiments, which showed no effect of 1,25-(OH)₂D₃ or dexamethasone on RGS-2 half-life. In subsequent nuclear run-on experiments we were able to demonstrate a clear stimulatory effect of 1,25-(OH)₂D₃, and an inhibitory effect of dexamethasone, on the rate of RGS-2 gene transcription induced by a given dose of PTH.

The observed reciprocal effects of 1,25-(OH)₂D₃ and dexamethasone on transcriptional activity of the RGS-2 gene were not mediated by regulation of PTH receptor abundance or function because they were also present when the PTH receptor was bypassed by direct stimulation of adenylate cyclase with forskolin. Moreover, extended exposure to 1,25-(OH)₂D₃ has previously been shown to suppress, and dexamethasone to stimulate, PTH receptor expression and signaling in osteoblasts (17, 18, 19, 20). In concordance with these findings, we observed slightly diminished PTH-induced cAMP levels after 1,25-(OH)₂D₃ and a slight stimulation with dexamethasone. The consequences of such receptor-related effects, which were of borderline significance with the dose and exposure time used in our experiments, would, if anything, have resulted in modifications of PTH-dependent gene expression opposite to those observed.

Further downstream the activation pathway, the abundance and PTH-induced phosphorylation of CREB, the major nuclear transcription factor activated by PKA, was found unaltered. This leaves the possibility that transcription factors other than CREB are inversely regulated by either of the two steroids. The recently characterized promoter region of the RGS-2 gene apparently does not contain consensus vitamin D3 or glucocorticoid-responsive elements (30). However, three osteoblast-specific (OSE2) elements have been identified that serve as consensus binding sites for CBFa1/Runx2, an essential factor for osteoblast differentiation and function (34, 35). Dexamethasone suppresses CBFa1 protein abundance and DNA-binding activity by a posttranscriptional mechanism in primary rat, but not human or mouse, osteoblasts (36, 37). In the UMR 106-01 osteoblast-like cells used here, we observed no change in nuclear CBFa1 protein concentration following dexamethasone incubation. Furthermore, CBFa1 gene and protein expression was found either positively or negatively regulated by 1,25(OH)₂D₃ in primary human osteoblasts and different rodent osteoblast cell lines, respectively, depending on duration of exposure and the state of differentiation (38, 39). We observed no effect of 1,25-(OH)₂D₃ exposure for 24 h on nuclear CBFa1 protein abundance in UMR 106–01 cells, in accordance with findings in primary rat osteoblasts (37).

The apparently lacking regulation of CBFa1 on the protein level does not entirely rule out modulating actions of dexamethasone or 1,25-(OH)₂D₃ because the DNA-binding and transactivating capacity of CBFa1 is also affected by posttranslational mechanisms such as protein phosphorylation (40, 41). Besides the OSE2 elements, a CCAAT box was identified in the murine, rat, and human RGS-2 promoter sequence. The ß and isoforms of the CCAAT/enhancer-binding protein (C/EBP) family have recently been shown to synergize with CBFa1 in stimulating bone-specific protein expression (42). 1,25-(OH)₂D₃ induces C/EBP-ß and - expression in primary rat osteoblasts (42), and glucocorticoids either up- or down-regulate C/EBP isoforms in different cell types (43). In preliminary experiments we observed constitutive, unregulated C/EBP-ß and - mRNA expression in UMR 106 cells (data not shown) but cannot exclude posttranscriptional regulation of these factors by dexamethasone or 1,25-(OH)₂D₃. Modulation of translational efficiency, protein-protein interactions, cellular localization, and phosphorylation-mediated changes in DNA-binding activity, activation potential, and nuclear localization have recently been described for several C/EBPs (43, 44). Finally, other as-yet-unidentified nuclear proteins binding to the RGS-2 promoter may be involved in the reciprocal regulation of RGS-2 expression by glucocorticoids and vitamin D.

In summary, we have demonstrated that glucocorticoids and vitamin D inversely regulate PTH-induced RGS-2 expression via a transcriptional mechanism. Taken together with the observed preferential binding of RGS-2 to the G_q subunit, regulation of RGS-2 constitutes a novel mechanism by which steroids can modulate cellular responses to signals mediated via G protein-coupled receptors.

	Footnotes

 
This work was supported by Research Grant 112/98 from the Faculty of Medicine, University of Heidelberg (to C.P.S.). M.H. was recipient of a scholarship from the Deutsche Forschungsgemeinschaft (DFG) (Graduiertenkolleg Experimentelle Nieren-und Kreislaufforschung).

Abbreviations: C/EBP, CCAAT/enhancer-binding protein; CREB, cAMP response element-binding protein; DHT, dihydrotestosterone; DTT, dithiothreitol; E2, estradiol; hnRNA, heterogeneous nuclear RGS-2 RNA; PKA, protein kinase A; PKC, protein kinase C; PMA, phorbol-12-myristate-13-acetate; PMSF, phenylmethylsulfonyl fluoride; RGS, regulator of G protein signaling.

Received December 17, 2002.

Accepted for publication March 5, 2003.

	References

Top Abstract Introduction Materials and Methods Results Discussion References

 

1. Schmitt CP, Hessing S, Oh J, Weber L, Ochlich P, Mehls O 2000 Intermittent administration of parathyroid hormone (1–37) improves growth and bone mineral density in uremic rats. Kidney Int 57:1484–1492[CrossRef][Medline]
2. Tam CS, Heersche JNM, Murray TM, Parsons JA 1982 Parathyroid hormone stimulates the bone apposition rate independently of its resorptive action: differential effects of intermittent and continuous administration. Endocrinology 110:506–512[Abstract]
3. Abou-Samra AB, Jüppner H, Force T, Freeman MW, Kong XF, Schipani E, Urena P, Richards J, Bonventre JV, Potts JT, Kronenberg HM, Segre GV 1992 Expression cloning of a common receptor for parathyroid hormone and parathyroid hormone-related peptide from rat osteoblast-like cells: a single receptor stimulates intracellular accumulation of both cAMP and inositol trisphosphates and increases intracellular free calcium. Proc Natl Acad Sci USA 89:2732–2736[Abstract/Free Full Text]
4. Dunlay R, Hruska K 1990 PTH receptor coupling to phospholipase C is an alternate pathway of signal transduction in bone and kidney. Am J Physiol 258:F223–F231
5. Halladay DL, Miles RR, Thirunavukkarasu K, Chandrasekhar S, Martin TJ, Onyia JE 2002 Identification of signal transduction pathways and promoter sequences that mediate parathyroid hormone 1–38 inhibition of osteoprotegerin gene expression. J Cell Biochem 84:1–11[CrossRef]
6. Swarthout JT, D’Alonzo RC, Selvamurugan N, Partridge NC 2002 Parathyroid hormone-dependent signaling pathways regulating genes in bone cells. Gene 282:1–17[Medline]
7. Verheijen MHG, Defize LHK 2001 Parathyroid hormone inhibits mitogen-activated protein kinase activation in osteosarcoma cells via a protein kinase A-dependent pathway. Endocrinology 136:3331–3337
8. Swarthout JT, Doggett TA, Lemker JL, Partridge NC 2001 Stimulation of extracellular signal-regulated kinases and proliferation in rat osteoblastic cells by parathyroid hormone is protein kinase C-dependent. J Biol Chem 276:7586–7592[Abstract/Free Full Text]
9. Dohlmann HG, Thorner J 1997 RGS proteins and signaling by heterotrimeric G proteins. J Biol Chem 272:3871–3874[Free Full Text]
10. Druey KM 2001 Bridging with GAPs: receptor communication through RGS proteins. Sci STKE 104:1–7
11. Berman DM, Gilman AG 1998 Mammalian RGS proteins: barbarians at the gate. J Biol Chem 273:1269–1272[Free Full Text]
12. Druey KM, Blumer K, Kang VH, Kehrl JH 1996 Inhibition of G-protein-mediated MAP kinase activation by a new mammalian gene family. Nature 379:742–746[CrossRef][Medline]
13. Ko JK, Choi KH, Kim IS, Jung EK, Park DH 2001 Inducible RGS2 is a cross-talk regulator for parathyroid hormone signaling in rat osteoblast-like UMR106 cells. Biochem Biophys Res Commun 287:1025–1033[CrossRef][Medline]
14. Miles RR, Sluka JP, Santerre RF, Hale LV, Bloem L, Boguslawski G, Thirunavukkarasu K, Hock JM, Onyia JE 2000 Dynamic regulation of RGS2 in bone: potential new insights into parathyroid hormone signaling mechanisms. Endocrinology 141:28–36[Abstract/Free Full Text]
15. Heximer SP, Srinivasa SP, Bernstein LS, Bernard JL, Linder ME, Hepler JR, Blumer KJ 1999 G protein selectivity is a determinant of RGS2 function. J Biol Chem 274:34253–34259[Abstract/Free Full Text]
16. Hömme M, Schmitt CP, Mehls O, Schaefer F 2002 Differential regulation of RGS2 by constant and oscillating PTH-concentrations. Pediatr Nephrol:C123 (Abstract)
17. Gonzales EA, Martin KJ 1996 Coordinate regulation of PTH/PTHrP receptors by PTH and calcitriol in UMR 106-01 osteoblast-like cells. Kidney Int 50:63–70[Medline]
18. Mortensen BM, Lund HW, Jablonski G, Paulssen RH, Gordeladze JO 1995 Direct effects of vitamin D₃ analogues on G-protein mediated signalling systems in rat osteosarcoma cells and rat pituitary adenoma cells. Biosci Rep 15:135–150[CrossRef][Medline]
19. Yaghoobian J, Drüeke TB 1998 Regulation of the transcription of parathyroid-hormone/parathyroid-hormone related peptide receptor mRNA by dexamethasone in ROS 17/2.8 osteosarcoma cells. Nephrol Dial Transplant 13:580–586[Abstract/Free Full Text]
20. Rodan SB, Fisher MK, Egan JJ, Epstein PM, Rodan GA 1984 The effect of dexamethasone on parathyroid hormone stimulation of adenylate cyclase in ROS 17/2.8 cells. Endocrinology 115:951–958[Abstract]
21. Cheung R, Mitchell J 2002 Mechanisms of regulation of G₁₁ protein by dexamethasone in osteoblastic UMR106-01 cells. Am J Physiol Endocrinol Metab 282:E24–E30
22. Nasu M, Sugimoto T, Kaji H, Chihara K 2000 Estrogen modulates osteoblast proliferation and function regulated by parathyroid hormone in osteoblastic SaOS-2 cells: role of insulin-like growth factor (IGF)-1 and IGF-binding protein-5. J Endocrinol 167:305–313[Abstract]
23. Kaji H, Sugimoto T, Kanatani M, Nasu M, Chihara K 1996 Estrogen blocks parathyroid hormone (PTH)-stimulated osteoclast-like cell formation by selectively affecting PTH-responsive cyclic adenosine monophosphate pathway. Endocrinology 137:2217–2224[Abstract]
24. Chen Q, Kaji H, Sugimoto T, Chihara K 2001 Testosterone inhibits osteoclast formation stimulated by parathyroid hormone through androgen receptor. FEBS Lett 491:91–93[CrossRef][Medline]
25. Fukayama S, Tashjian AH 1989 Direct modulation by androgens of the response of human bone cells (SaOS-2) to human parathyroid hormone and PTH-related protein. Endocrinology 125:1789–1794[Abstract]
26. Hildebrandt AL, Neufer PD 2000 Exercise attenuates the fasting-induced transcriptional activation of metabolic genes in skeletal muscle. Am J Physiol Endocrinol Metab 278:E1078–E1086
27. Sullivan BM, Harrison-Lavoie J, Marshansky V, Lin HY, Kehrl JH, Ausiello DA, Brown D, Druey KM 2000 RGS4 and RGS2 bind coatomer and inhibit COPI association with Golgi membranes and intracellular transport. Mol Biol Cell 11:3155–3168[Abstract/Free Full Text]
28. Taymans JM, Wintmolders C, Riele TE, Jurzak M, Groenewegen HJ, Leysen JE, Langlois X 2002 Detailed localization of regulator of G protein signaling 2 messenger ribonucleic acid and protein in the rat brain. Neuroscience 114:39–53[CrossRef][Medline]
29. Tsingotjidou A, Nervina JM, Pham L, Bezouglaia O, Tetradis S 2002 Parathyroid hormone induces RGS-2 expression by a cyclic adenosine 3', 5'-monophosphate-mediated pathway in primary neonatal murine osteoblasts. Bone 30:677–684[Medline]
30. Thirunavukkarasu K, Halladay DL, Miles RR, Geringer CD, Onyia JE 2002 Analysis of regulator of G-protein signaling-2 (RGS-2) expression and function in osteoblastic cells. J Cell Biochem 85:837–850[CrossRef][Medline]
31. Flühmann B, Zimmermann U, Muff R, Bilbe G, Fischer JA, Born W 1998 Parathyroid hormone responses of cyclic AMP-, serum- and phorbol ester-responsive reporter genes in osteoblast-like UMR-106 cells. Mol Cell Endocrinol 139:89–98[CrossRef][Medline]
32. Sinnarajah S, Dessauer CW, Srikumar D, Chen J, Yuen J, Yilma S, Dennis JC, Morrison EE, Vodyanoy V, Kehrl JH 2001 RGS2 regulates signal transduction in olfactory neurons by attenuating activation of adenylyl cyclase III. Nature 409:1051–1055[CrossRef][Medline]
33. Gonzales EA, Disthabanchong S, Kowalewski R, Martin KJ 2002 Mechanisms of regulation of EGF receptor gene expression by calcitriol and parathyroid hormone in UMR 106–01 cells. Kidney Int 61:1627–1634[CrossRef][Medline]
34. Merriman HL, van Wijnen AJ, Hiebert S, Bidwell JP, Fey E, Lian J, Stein J, Stein GS 1995 The tissue-specific nuclear matrix protein, NMP-2, is a member of the AML/CBF/PEBP2/runt domain transcription factor family: interactions with the osteocalcin gene promoter. Biochemistry 34:13125–13132[CrossRef][Medline]
35. Mundlos S, Otto F, Mundlos C, Mulliken JB, Aylsworth AS, Albright S, Lindhout D, Cole WG, Henn W, Knoll JHM, Owen MJ, Mertelsmann R, Zabel BU, Olsen BR 1997 Mutations involving the transcription factor cbfa1 cause cleidocranial dysplasia. Cell 89:773–779[CrossRef][Medline]
36. Chang DJ, Ji C, Kim KK, Casinghino S, McCarthy TL, Centrella M 1998 Reduction in transforming growth factor ß receptor I expression and transcription factor CBFa1 on bone cells by glucocorticoid. J Biol Chem 273:4892–4896[Abstract/Free Full Text]
37. Prince M, Banerjee C, Javed A, Green J, Lian JB, Stein GS, Bodine PVN, Komm BS 2001 Expression and regulation of Runx2/cbfa1 and osteoblast phenotypic markers during the growth and differentiation of human osteoblasts. J Cell Biochem 80:424–440[CrossRef][Medline]
38. Drissi H, Pouliot A, Koolloos C, Lian JB, Stein JL, van Wijnen AJ 2002 1, 25-(OH)₂-vitamin D3 suppresses the bone-related runx2/cbfa1 gene promoter. Exp Cell Res 274:323–333[CrossRef][Medline]
39. Viereck V, Siggelkow H, Tauber S, Raddatz D, Schutze N, Hüfner M 2002 Differential regulation of cbfa1/runx2 and osteocalcin gene expression by vitamin D3, dexamethasone, and local growth factors in primary human osteoblasts. J Cell Biochem 86:348–356[CrossRef][Medline]
40. Xiao G, Jiang D, Gopalakrishnan R, Franceschi RT 2002 Fibroblast growth factor 2 induction of the osteocalcin gene requires MAPK activity and phosphorylation of the osteoblast transcription factor, cbfa1/runx2. J Biol Chem 277:36181–36187[Abstract/Free Full Text]
41. Ziros PG, Rojas Gil A-P, Georgapoulos T, Habeos I, Kletsas D, Basdra EK, Papavavassiliou AG 2002 The bone-specific transcriptional regulator cbfa1 is a target of mechanical signals in osteoblastic cells. J Biol Chem 277:23934–23941[Abstract/Free Full Text]
42. Gutierrez S, Javed A, Tennant DK, van Rees M, Montecino M, Stein GS, Stein JL, Lian JB 2002 CCAAT/enhancer-binding proteins (c/ebp) ß and activate osteocalcin gene transcription and synergize with Runx2 at the C/EBP element to regulate bone-specific expression. J Biol Chem 277:1316–1323[Abstract/Free Full Text]
43. Ramji DP, Foka P 2002 CCAAT/enhancer-binding proteins: structure, function and regulation. Biochem J 365:561–575[Medline]
44. Berg T, Cassel TN, Schwarze PE, Nord M 2002 Glucocorticoids regulate the CCSP and CYP2B1 promoters via C/EBPß and in lung cells. Biochem Biophys Res Commun 293:907–912[CrossRef][Medline]

This article has been cited by other articles:

				S. Ciarmatori, D. Kiepe, A. Haarmann, U. Huegel, and B. Tonshoff Signaling mechanisms leading to regulation of proliferation and differentiation of the mesenchymal chondrogenic cell line RCJ3.1C5.18 in response to IGF-I J. Mol. Endocrinol., April 1, 2007; 38(4): 493 - 508. [Abstract] [Full Text] [PDF]

				D. G. Romero, M. W. Plonczynski, E. P. Gomez-Sanchez, L. L. Yanes, and C. E. Gomez-Sanchez RGS2 Is Regulated by Angiotensin II and Functions as a Negative Feedback of Aldosterone Production in H295R Human Adrenocortical Cells Endocrinology, August 1, 2006; 147(8): 3889 - 3897. [Abstract] [Full Text] [PDF]

				J. Hoogendam, E. Parlevliet, R. Miclea, C. W. G. M. Lowik, J. M. Wit, and M. Karperien Novel Early Target Genes of Parathyroid Hormone-Related Peptide in Chondrocytes Endocrinology, June 1, 2006; 147(6): 3141 - 3152. [Abstract] [Full Text] [PDF]

				D. Kiepe, S. Ciarmatori, A. Haarmann, and B. Tonshoff Differential expression of IGF system components in proliferating vs. differentiating growth plate chondrocytes: the functional role of IGFBP-5 Am J Physiol Endocrinol Metab, February 1, 2006; 290(2): E363 - E371. [Abstract] [Full Text] [PDF]

				D. Kiepe, S. Ciarmatori, A. Hoeflich, E. Wolf, and B. Tonshoff Insulin-Like Growth Factor (IGF)-I Stimulates Cell Proliferation and Induces IGF Binding Protein (IGFBP)-3 and IGFBP-5 Gene Expression in Cultured Growth Plate Chondrocytes via Distinct Signaling Pathways Endocrinology, July 1, 2005; 146(7): 3096 - 3104. [Abstract] [Full Text] [PDF]

				M. Homme, C. P. Schmitt, O. Mehls, and F. Schaefer Mechanisms of Mitogen-Activated Protein Kinase Inhibition by Parathyroid Hormone in Osteoblast-Like Cells J. Am. Soc. Nephrol., November 1, 2004; 15(11): 2844 - 2850. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Purchase Article View Shopping Cart Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Copyright Permission Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Hömme, M. Articles by Schaefer, F. Search for Related Content PubMed