| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Department of Internal Medicine, Erasmus Medical Center, 3000 DR Rotterdam, The Netherlands
Address all correspondence and requests for reprints to: George Kuiper, Ph.D., Department of Internal Medicine, Room Ee 502, Erasmus Medical Center, Dr. Molewaterplein 40, 3015 GD Rotterdam, The Netherlands. E-mail: g.kuiper{at}erasmusmc.nl.
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
In rodents and humans, D3 activity was found in brain, skin, (failing) heart, placenta, uterus, and several fetal tissues such as liver and brain (6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18). In Xenopus laevis tadpoles, D3 activity is present in limb buds, retina, and tail in various stages of development (19, 20). Also in various other species, such as chicken and fish, D3 activity is present in brain, liver, and skin (21, 22, 23). Recently very high levels of D3 activity were described in infantile hemangiomas causing severe hypothyroidism (24).
Thyroid hormone is a major physiological regulator of brain development. The presence of D3 in organs such as the brain is thought to play a role in the local fine-regulation of intracellular T3 levels, whereas its presence in placenta, uterus, and fetal organs may protect fetal brain tissue against premature exposure to T3 during early stages of development (2, 10, 11, 12, 13, 16, 17, 25, 26, 27, 28, 29).
The D3 protein is a selenoprotein, containing a selenocysteine residue (SeC) in the catalytic center (30, 31, 32, 33, 34, 35, 36). Complementary DNAs from several species that code for the D3 protein have been isolated, and they contain a UGA stop codon within the open reading frame that is translated as SeC (32, 33, 34, 35, 36). The presence of an SeC insertion sequence element in the 3'-UTR of the mRNA is essential for SeC incorporation at the UGA codon, which otherwise would function as a stop codon (37).
The catalytic mechanism of D3 seems to be different from that of D1 but similar to that of D2 enzyme. Outer-ring deiodination of T4 or rT3 by D1 enzyme exhibits ping-pong (bi)substrate kinetics with T4 or rT3 and the thiol-containing cofactor as cosubstrates (38, 39). The D2 and D3 enzymes exhibit sequential reaction kinetics, suggesting that T4 and the thiol-containing cofactor must interact with the enzyme simultaneously before reaction takes place (7, 18, 38, 40). The SeC residue in the catalytic center is essential for maximal catalytic efficiency of deiodinases (32, 33, 40, 41, 42). In D1, mutation of SeC to leucine or alanine eliminates deiodinase activity, whereas its mutation to cysteine (Cys) raises the apparent Michaelis constant (Km) for rT3 3-fold and reduces the substrate-turnover number about 100-fold (41). Remarkably, in D2 mutation of SeC to Cys raises the apparent Km for T4 about 1000-fold, whereas the substrate-turnover number is reduced only 10-fold (40, 42). For D3 it was shown that substitution of SeC with leucine eliminates deiodinase activity, whereas substitution with Cys (D3Cys) reduced enzyme activity (32, 33). However, the D3Cys protein was not further characterized with regard to substrate interaction, substrate turnover number, and catalytic mechanism.
The present studies were undertaken to elucidate the functional role of the SeC residue in the catalytic center of D3 protein in more detail. We have examined effects of the SeC144 to Cys (D3Cys) or SeC144 to Ala (D3Ala) mutation in human D3 protein on substrate and cofactor interaction as well as on the substrate turnover number.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Site-directed mutagenesis
A human D3 expression vector (pcDNA3-D3) containing a 1.9-kb insert including 35 nucleotides of the 5'-untranslated region (nucleotides 185-2066 in Ref. 34) was used as template for site-directed mutagenesis via the circular mutagenesis procedure, followed by selection for mutants by DpnI digestion (45). Overlapping sense and antisense primers containing the nucleotide changes needed to produce the SeC144Cys D3 mutant cDNA.
The (sense 5' TTCGGAAGCTGCACCTGCCCACCGTTCATGGCG) and SeC144Ala mutant cDNA (sense 5'TTCGGAAGCTGCACCGCACCACCGTTCATGGCG) were used in circular mutagenesis reactions with 50 ng plasmid template and 2 U P. furiosus DNA polymerase (45). The cycling protocol consisted of 30 sec at 95 C, 1 min at 55 C, 14 min at 68 C for 18 cycles using a model 480 PCR machine (Perkin-Elmer, Norwalk, CT). The reaction products were incubated with 10 U DpnI enzyme for 2 h at 37 C and immediately transformed to competent E. coli XL-10 cells according to manufacturer’s instructions. Plasmid DNA isolated from up to four clones was sequenced on a model 310 DNA sequencer (ABI, Foster City, CA) to verify that the desired mutation had been generated and no spurious mutations had occurred during amplification (46). Plasmids were maintained in E. coli DH5
cells and purified with QIAfilter cartridges (QIAGEN, Hilden, Germany).
During sequencing of the wt D3 cDNA, we noted that codon 53 encodes glutamine instead of lysine as previously reported (Ref. 34 ; GenBank accession no. S79854). A more recent GenBank entry (XM007250) also describes a glutamine residue at codon 53.
Expression of D3 protein
The wt and mutant D3 enzymes were expressed in COS-1 cells or human embryonic kidney (HEK)-293 cells (65-cm2 dishes) after diethylaminoethyl-dextran-mediated transfection of the expression vectors (40, 47). COS-1 cells were grown in DMEM-Ham’s F-12 medium containing 10% fetal calf serum (Life Technologies, Inc.) and 40 nM sodium selenite. Two days after transfection, the cells were rinsed with PBS and collected in 0.25 ml 0.1 M phosphate (pH 7.2), 2 mM EDTA buffer; sonicated; aliquoted; and stored at -80 C.
Assay of IRD activity in cell homogenates
This assay is based on the determination of product formation (125I-labeled T2 or rT3) by reverse-phase HPLC analysis of reaction mixtures containing outer-ring-labeled T3 or T4 (1, 17).
Incubations contained about 200,000 cpm labeled T3 or T4 with varying amounts of unlabeled substrate (T3 or T4) and cell homogenate (5–10 µg protein) in a final volume of 0.1 ml P100E2 buffer (0.1 M phosphate, pH 7.2; 2 mM EDTA) and varying amounts of DTT (0.1–30 mM). In some experiments a pH profile was obtained using 0.1 M phosphate, 2 mM EDTA buffers of pH 6.0–8.0. Mixtures were incubated for 60 min at 37 C, whereafter the reaction was stopped by addition of 0.1 ml ice-cold methanol. After centrifugation, 0.1 ml was mixed with 0.1 ml 0.02 M ammonium acetate (pH 4.0), and 0.1 ml (equivalent to 25-µl reaction volume) of the mixture was applied to a 250 x 4.6 mm Symmetry C18 column connected to an Alliance HPLC system (Waters Chromatography Division, Millipore Corp., Milford, MA) and eluted with a 15-min linear gradient of acetonitrile (28–42%) in 0.02 M ammonium acteate (pH 4) at a flow rate of 1.2 ml/min. Radioactivity in the eluate was monitored online using a Radiomatic A-500 flow scintillation detector (Packard, Meriden, CT).
Homogenate protein was adjusted to limit substrate consumption to less than 30%. Enzymatic deiodination was corrected for nonenzymatic deiodination by determining the amount of 125I-labeled T2 or rT3 formed in blank incubations with homogenates of nontransfected cells.
Assay of IRD activity in intact transfected COS cells
COS cells were cultured in 6-well plates (10 cm2/well) and transfected with 0.2 or 2 µg plasmid per well as described (40). One day after transfection, cell monolayers were washed with serum-free DMEM/F12 medium and cultured for an additional 24 h in serum-free DMEM/F12 supplemented with 40 nM sodium selenite, to which was added [3',5'-125I]T4 or [3'-125I]T3 (1 x 106 cpm/ml) plus 1–1000 nM unlabeled T4 or T3. After 20–24 h the medium was harvested and extracted with ice-cold methanol (1:1). After centrifugation, the extract was mixed with 0.02 M ammoniumacetate (pH 4), and 0.1 ml of the mixture was analyzed with the same HPLC system as described. The column was eluted with a 20-min gradient of 24–29% acetonitrile followed by a 6-min gradient of 29–50% acetonitrile in 0.02 M ammonium acetate (pH 4). This gradient provides improved separation of sulfated iodothyronines from nonsulfated iodothyronines.
Polyclonal antiserum production and Western blotting
Polyclonal antisera were raised in rabbits by Eurogentec SA (Herstal, Belgium) after conjugation of the synthetic peptide (C)RYDEQLHGARPRRV (human D3 amino acid residues 265–278) to keyhole limpet hemocyanin. Antiserum (designated 677) from the final bleed was used without further purification.
COS cell homogenates (20–30 µg protein) were separated on 12% SDS-PAGE gels in the Mini-Protean II cel (Bio-Rad Laboratories, Inc., Hercules, CA) according to the manufacturer’s instructions. After electrophoresis the gels were positioned on nitrocellulose membranes (Hybond-C pure, Amersham Pharmacia Biotech) and placed in a minitransblot cell (Bio-Rad Laboratories, Inc.) filled with buffer (25 mM Tris-HCl, pH 8.3; 150 mM glycine; and 20% vol/vol methanol). The transfer was performed for 1 h at 100 V.
Membranes were blocked with 5% (wt/vol) nonfat milk in PBS with 0.1% Tween 20 (PBS-Tween) for 1 h at 37 C and thereafter incubated with antiserum 677 at a 1:500 dilution in 5% (wt/vol) milk in PBS-Tween overnight at 8 C. Blots were washed 2 x 15 min with 5% (wt/vol) milk in PBS-Tween and 2 x 15 min with PBS-Tween, followed by incubation with peroxidase-conjugated secondary antibody (A0545, 1:16,000, Sigma) in 5% (wt/vol) milk in PBS-Tween for 2 h. After washing as described, the blot was developed with a homemade chemiluminescence system (48) consisting of 0.7 µM p-coumaric acid, 1.25 mM luminol, and 0.01% hydrogen peroxide in 0.1 M Tris HCl (pH 8.5), and exposed to Hyperfilm ECL film (Amersham) for 5–15 min.
To compare the relative amounts of enzyme expressed between wild-type and mutant D3, the mutant enzyme was diluted in cell lysate derived from nontransfected COS cells. The density of the D3 bands was quantified by densitometry.
Affinity labeling of D1 and D3 protein with BrAc[125I]T3
BrAc[125I]T3 (1500 mCi/µmol) was synthesized as described (44), and HPLC analysis demonstrated that the purity was at least 85% with unreacted [125I]T3 as the main contaminant. Unlabeled BrAcT3 was also analyzed by HPLC and found to be more than 90% pure. The concentration was determined by mixing with a T3 internal standard and online monitoring of the eluates with a photodiode array detector, taking into account that the molar extinction coefficient of BrAcT3 is very close to that of T3 in the far UV (49).
Solutions of BrAc[125I]T3 (200,000 cpm, 0.06 pmol) in ethanol were pipetted into microcentrifuge tubes, and the solvent was evaporated by a stream of nitrogen. After addition of 25 µl P100E2D10 (0.1 M sodium phosphate; 2 mM EDTA; 10 mM DTT, pH 7.2) and vortexing, the cell homogenates (100–150 µg protein) were added in a total volume of 50 µl P100E2D10. The mixtures were incubated for 10–20 min on ice, at room temperature or 37 C. Reactions were terminated by addition of SDS-PAGE gel-loading buffer, and samples were analyzed by SDS-PAGE (12% gel) followed by autoradiography to BioMax MS film (Kodak, Rochester, NY) at -70 C with intensifying screen (50, 51, 52).
Alternatively, the reactions were terminated by the addition of ice-cold methanol. After centrifugation the protein-free supernatant was mixed with 0.1% trifluoracetic acid (pH 2) and analyzed with the same HPLC system as described. The column was eluted with a 20-min gradient of 40–60% acetonitrile in 0.1% trifluoracetic acid. Retention times for BrAc-iodothyronines were determined by incubation of BrAc[125I]T3 and BrAc[125I]T2 with homogenates of nontransfected COS cells in P100E2D10 buffer and HPLC analysis as described.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and 2, and Table 1).
|
|
|
). The D3 protein exhibits sequential reaction kinetics as was shown previously (7, 18), suggesting that T3 and the thiol-containing cofactor must interact with the enzyme simultaneously before reaction takes place. In the presence of 10 mM DTT, the Km of T3 was 5-fold higher for the D3Cys enzyme than for the D3wt enzyme, whereas the maximal velocity (Vmax) increased about 25-fold (Table 1). The D3Ala enzyme was inactive. When T4 was used as substrate, the Km was 50–100 times higher for the D3Cys enzyme than for the D3wt enzyme at DTT concentrations of 1 mM or higher. In the case of T4, Vmax increased only 8-fold (Fig. 2 and Table 1). The Vmax/Km ratios were calculated as a measure of the efficiency by which the D3wt and D3Cys enzyme deiodinate the substrates T3 and T4. The D3wt enzyme deiodinates T3 and T4 with equal efficiency as reflected in the similar Vmax/Km ratios. In contrast, the D3Cys enzyme strongly prefers T3 above T4 because the Vmax/Km ratio for T3 is 40-fold higher. In the absence of DTT, no deiodination of T3 or T4 could be measured by D3wt or D3Cys enzyme. Maximal enzyme activity was observed at 10 mM DTT, whereas at higher DTT concentrations (>30 mM), the activity was reduced (not shown). No outer-ring deiodination of T3, T4, or rT3 by D3wt or D3Cys enzyme was detected.
Selenoenzymes such as thioredoxin reductase, glutathione peroxidase, formate dehydrogenase, and iodothyronine deiodinases are inhibited by organic gold compounds and IAc (1, 2, 3, 4, 5, 53, 54, 55, 56). GTG or aurothioglucose is a competitive inhibitor of T3 deiodination by D3 (34). Under the conditions used (1 nM T3, 10 mM DTT), the IC50 value for inhibition by GTG of D3wt enzyme was about 1 µM. Interestingly, the D3Cys enzyme is not insensitive to GTG, although the IC50 value increased to about 30 µM (Fig. 3). Under the same experimental conditions, both the D3wt and D3Cys enzymes were essentially insensitive to IAc (IC50 > 1 mM).
|
), no shift to more alkaline pH values for D3Cys enzyme was observed, despite the different pK values (5.2 vs. 9.0) of the selenol and sulfhydryl moieties in free SeC and Cys (57, 58).
|
). Comparison of the densities of the approximately 34-kDa D3 protein band indicated that the amount of D3Cys protein is 40- to 50-fold greater than the amount of D3wt protein. Also, the amount of D3Ala protein expressed was about 50-fold greater than D3wt protein (not shown). Using an estimate that 50-fold higher quantities of D3Cys protein are expressed relative to D3wt protein and using the Vmax values obtained (Table 1), our results indicated that the substrate turnover number of D3Cys enzyme is 2-fold reduced for T3 and 6-fold reduced for T4 deiodination, compared with D3wt enzyme.
|
The deiodination of T3 (1 nM [125I]T3, 10 mM DTT) could be completely inhibited with BrAcT3, indicating that BrAcT3 interacts with the D3 enzyme. The IC50 values were about 3 nM for D3wt enzyme and about 30 nM for D3Cys enzyme (not shown). After incubation of homogenates with BrAc[125I]T3 followed by SDS-PAGE, a labeled protein of 34 kDa was observed in homogenates containing D3Cys protein and a weakly labeled protein of the same molecular size was present in homogenates containing D3wt protein. Especially after prolonged autoradiography, a weakly labeled protein with slightly higher molecular mass than D3 was visible in homogenates of nontransfected COS cells (Fig. 6A). The D3Ala protein could not be labeled with BrAcT3, despite the fact that the expression level is equally high as that of D3Cys protein. This indicates that deiodinase activity is essential for labeling with BrAcT3 and probably the SeC144 or Cys144 residues are the targets for labeling by BrAcT3. The same affinity labeling experiments were done with homogenates of HEK-293 cells transfected with D3wt or D3Cys vectors. The activity of D3wt in HEK cell homogenates was 1.5-fold higher than in COS cell homogenates. The results of the labeling experiments with HEK cell homogenates were similar to those with COS cell homogenates. Both for COS and HEK cell homogenates, about 0.5% of the added BrAc[125I]T3 was incorporated into D3wt protein and about 1.5% in D3Cys protein as determined by SDS-PAGE followed by counting of radioactivity in gel slices. Altogether the labeling of D3 protein was weak, compared with that of rat D1 protein. Given the intense labeling of D1 protein, it is unlikely that COS cell proteins interfere with the labeling of D3 by BrAcT3 (Fig. 6A).
|
). Apart from D3 in COS or HEK cell homogenates, D3 in human placental microsomes also caused inner-ring deiodination of BrAcT3. Neither inner-ring nor outer-ring deiodination of BrAc[125I]T3 by D1 or D2 enzymes could be detected (not shown). Attempts to reduce the inner-ring deiodination of BrAcT3 by lowering the DTT concentration to 0.1 mM or 1 mM instead of 10 mM increased incorporation of radioactivity in the various proteins but did not increase the relative incorporation of radioactivity in D3 protein as analyzed by SDS-PAGE (not shown). Because of the rather weak labeling of D3, a reliable estimation of D3 content by saturation analysis was not possible. Under the most favorable conditions (1 mM DTT at 37 C), 0.5% of the added BrAc[125I]T3 was incorporated into D3wt protein and about 2% in D3Cys protein. By comparison, 6% of the added BrAc[125I]T3 was incorporated into rat D1wt protein.
Deiodination by wild-type D3, D3Cys, and D3Ala protein in intact cells
The D3Cys enzyme is active in vitro in the presence of excess iodothyronine substrate and DTT. An important question is whether the same is true under in situ conditions using intact transfected COS cells. In intact cells the free substrate concentration available to the enzyme might be lower because of limited cellular uptake as well as binding of iodothyronine substrate to cytosolic iodothyronine-binding proteins or membranes (1, 2).
When D3wt or D3Cys enzyme were expressed in COS cells, addition of increasing amounts of unlabeled T3 did not result in saturation of the fractional deiodination of [125I]T3 (Fig. 7A). The D3Ala protein was inactive, whereas the percentage deiodination of T3 by D3wt and D3Cys protein were similar. In control experiments, it was established that nontransfected COS cells sulfate [125I]T2, and therefore the sum of [125I]T2 and [125I]T2SO4 was used to calculate the percentage deiodination of T3.
|
). In contrast, the fractional deiodination of [125I]T4 by D3wt and D3Cys enzyme was not saturable. The saturation of the fractional deiodination of T4 by D2 at high medium T4 concentrations indicated that cellular T4 uptake did not limit its deiodination, whereas in the case of D3, uptake of T4 apparently did limit deiodination. In this regard it is important to note that the in vitro Km values of D2wt and D3wt for T4 are similar (4–5 nM). The intracellular concentration of D3 might be higher than that of available T4. Attempts to reduce the expression level of D3 enzyme by transfecting 10-fold lower amounts of plasmid DNA (0.2 µg/well instead of 2 µg/well) gave similar results, i.e. no saturation of the deiodination of [125I]T4 by medium T4 concentrations of up to 1 µM. |
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The SeC residue in the catalytic center is essential for maximal catalytic efficiency of deiodinases and other selenoenzymes such as glutathione peroxidase, formate dehydrogenase, and thioredoxin reductase (40, 41, 42, 54, 55, 56, 58, 59). Substitution of Cys for SeC has quite variable results, possibly because of different catalytic mechanisms used by D1, D2, and D3. The D1 enzyme exhibits ping-pong (bi)substrate kinetics, whereas the D2 and D3 enzymes exhibit sequential reaction kinetics (7, 18, 38, 40, 41, 60). In D1 mutation of SeC to Cys raises the Km for rT3 only 3-fold but reduces the substrate turnover number 100-fold (41). The SeC residue in the catalytic center of D1 is thought to function as the iodine acceptor, and the selenenyl iodide intermediate is the target for reaction with propylthiouracil (38, 39, 60, 61). The thiol group of Cys is a much weaker nucleophile than the selenol group of SeC, thus explaining the strongly reduced efficiency of formation of the sulfenyl iodide intermediate and therefore the reduced turnover of the D1Cys enzyme.
Both for D2 and D3, substitution of SeC by Cys results in a limited decrease in turnover of the substrate T4 but a marked increase in the Km for T4. In D2 the Km increased 1000-fold and the T4 turnover was reduced 10-fold (40, 42). In this study the D3Cys enzyme has a 6-fold reduced turnover of T4 and a 100-fold increased Km for T4. We proposed a catalytic model for D2 in which the SeC residue exerts a nucleophilic attack to the 2'-position of T4, thus forming an intermediate complex between the SeC residue and T4 (40). Subsequent steps involve the abstraction of iodonium by DTT (or another thiol group containing cofactor) providing a D2/T3 complex that will yield T3 and the unmodified enzyme. So in this model the activated substrate is directly reduced by the cofactor, whereas in the case of D1, the SeI intermediate is reduced by cofactor. This model of reductive dehalogenation of T4 by D2 might also apply to D3 enzyme. In that case it would involve a nucleophilic attack to the 2-position of T4. In this model the lower nucleophilicity of the SH group in Cys, compared with the SeH group in SeC would result in a less favorable formation of the intermediate between T4 and D2 or D3 enzyme, which is reflected in the 1000-fold (D2) or 100-fold (D3) increased Km for T4.
The decreased catalytic activity of D1 and D2 mutant enzymes in which Cys substitutes for SeC has been attributed to the reduced dissociation of the sulfhydryl group at physiological pH and thus to the diminished nucleophilic character of the catalytic center, compared with the wild-type enzymes (41, 42). By comparing the actual pH activity profiles of D3 wt and D3Cys enzyme, no shift to more alkaline pH values for D3Cys enzyme was observed, despite the different pK values (5 vs. 9) of the selenol and sulfhydryl moieties (57). So the pH dependence of D3 activity is not simply accounted for by the dissociation of the nucleophilic group (selenol or sulfhydryl) in the catalytic center. For thioredoxin reductase the pH optimum shifted from 7 to 9 for the mutant enzyme in which the penultimate SeC was substituted by Cys (58). For other selenoenzymes such as glutathione peroxidase and formate dehydrogenase such big pH shifts for the Cys mutant enzymes were not observed (54, 55, 56), perhaps because these enzymes display rather broad pH optima around 8.5. It is remarkable that the pH optimum for D3 is close to 7 (6.7–7.1) and D3 activity is strongly reduced at pH 8, especially with T4 as substrate.
The selenol or sulfhydryl group might interact with side groups of other amino acid residues in the catalytic center. These interactions could stimulate deprotonation of the selenol or sulfhydryl group at physiological pH. A so-called catalytic triad involving tryptophane and glutamine residues stimulating SeC deprotonation has been described for glutathione peroxidase (55, 62). For D1 the formation of an essential imidazolium-selenolate ion pair was postulated on the basis of experiments with histidine-directed reagents, pH-dependent kinetic properties, and site-directed mutagenesis studies (1, 63, 64). The existence of a catalytic triad or an imidazolium-selenolate ion pair in D3 enzyme is speculative at the moment and needs further investigation.
The D3Cys enzyme is sensitive to GTG, and the IC50 value is about 30-fold higher than that of D3wt enzyme. This increase mirrors the change in sensitivity toward GTG of native vs. D1Cys or D2Cys enzymes, which resulted in 100-fold higher inhibitory constant values (Ki) for GTG (42, 60). For both D1 and D3 enzymes, GTG is a competitive inhibitor, implying that GTG interacts directly with the conserved catalytic center (34, 60). However, this does not explain the differential sensitivity toward GTG of the deiodinases, with D1 being the most sensitive and D3 the least sensitive (65). Also, the reduced sensitivity to GTG of D3Cys enzyme does not necessarily imply that inhibition by GTG is selective for the SeC residue in the catalytic center. Other Cys residues outside the catalytic center might be involved as well.
BrAc[125I]T3 has proven to be a useful affinity label for D1, allowing specific identification of the enzyme in microsomal fractions of liver and kidney (44, 50, 66). Affinity labeling with BrAc[125I]T3 was also used for the quantitation of D1 enzyme expression levels by saturation analysis, allowing estimation of the D1 substrate turnover number in microsomal preparations and homogenates of transfected cells (41, 50). With regard to affinity labeling of D3 with BrAcT3 results have been confusing (51, 52, 67). Initial experiments with brain and placenta microsomes revealed a good correlation between affinity labeling of a 32-kDa protein (p32) and inactivation of D3 by unlabeled BrAcT3 (51, 52). However, when p32 was also detected in tissues with low or undetectable D3 activity and p32 labeling was not prevented by substrates of D3, it was concluded that p32 does not represent D3 protein (51, 52). An alternative explanation for the inconsistencies might be that in one-dimensional SDS-PAGE, the low abundance D3 protein comigrates with an abundant p32 protein not related to D3 (52, 67).
Despite the ambiguous results with respect to affinity labeling of native D3 with BrAcT3, we decided to try to label recombinant D3 in COS or HEK cell homogenates. Although D3 activity was inactivated with BrAcT3, we were not able to use affinity labeling with BrAc[125I]T3 as a reliable method to quantify the D3 content of homogenates. The labeling intensity of D3wt and D3Cys protein was low, certainly when compared with D1wt protein labeled under the same experimental conditions. Possible explanations are: 1) BrAc[125I]T3 is degraded after coupling to D3, leading to a loss of radioactivity bound to D3; 2) the amount of D3 present in the homogenates is too low to allow sufficient incorporation of BrAc[125I]T3; 3) BrAcT3 blocks the interaction of T3 with D3 but does not react covalently with D3 because of unfavorable positioning toward a nucleophilic amino acid (SeC) in the catalytic center; and 4) inner-ring deiodination of BrAcT3 by D3 and the BrAcT2 and/or BrAcT1 thus formed do not label D3 enzyme. We found evidence for the last possibility, although the alternatives cannot be excluded. Because of the inner-ring deiodination, it is clear that BrAcT3 is not optimal as affinity label for D3 protein, and improved affinity label(s) should be developed. In contrast to our results, Salvatore et al. (34) described affinity labeling with BrAc[125I]T3 and quantitation by saturation analysis of D3 in homogenates of HEK-293 cells. Inner-ring deiodination of BrAcT3 by D3 enzyme was not investigated.
From the intact cell deiodination experiments, it is clear that D3Cys enzyme is active in situ in the presence of endogenous cofactor, just as D3wt enzyme. The intracellular actual free substrate concentrations are unknown, so detailed kinetic studies are not possible. The lack of saturability of the fractional T4 deiodination by D3 in contrast to D2 could be explained if the D3 expression level is higher than that of D2. The much longer half-life of D3, compared with D2 protein (68), could result in a higher D3 expression level.
As shown in the present work, the replacement of SeC by Cys results in reduced substrate turnover by D3 enzyme in particular with T4. Moreover, when SeC was replaced by Ala the result was complete loss of catalytic activity. These results suggest a role for the SeC residue that is catalytic rather than structural. In fact, the SeC residue is essential for efficient deiodination at physiological substrate concentrations. Additional mutagenesis experiments need to be performed to identify residues (histidine?) that might be involved in interaction(s) with the SeC residue. Increased insight in the catalytic mechanism of D3 could form the basis for the design of D3 specific inhibitors and/or affinity labels.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
Abbreviations: BrAcT3, N-Bromoacetyl-T3; BrAc[125I]T2, N-bromo-acetyl-T2; BrAc[125I]T3, N-bromoacetyl-T3; Cys, cysteine; D1, deiodinases type I; D2, type II; D3, type III; DTT, dithiothreitol; GTG, gold thioglucose; HEK, human embryonic kidney; IAc, iodoacetate; IRD, inner-ring deiodination; Km, Michaelis constant; SeC, selenocysteine; Vmax, maximal velocity.
Received January 16, 2003.
Accepted for publication March 3, 2003.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  D. L. St. Germain, V. A. Galton, and A. Hernandez Defining the Roles of the Iodothyronine Deiodinases: Current Concepts and Challenges Endocrinology, March 1, 2009; 150(3): 1097 - 1107. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. C. H. Friesema, J. Jansen, J.-w. Jachtenberg, W. E. Visser, M. H. A. Kester, and T. J. Visser Effective Cellular Uptake and Efflux of Thyroid Hormone by Human Monocarboxylate Transporter 10 Mol. Endocrinol., June 1, 2008; 22(6): 1357 - 1369. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Jansen, E. C. H. Friesema, M. H. A. Kester, C. E. Schwartz, and T. J. Visser Genotype-Phenotype Relationship in Patients with Mutations in Thyroid Hormone Transporter MCT8 Endocrinology, May 1, 2008; 149(5): 2184 - 2190. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. C. H. Friesema, G. G. J. M. Kuiper, J. Jansen, T. J. Visser, and M. H. A. Kester Thyroid Hormone Transport by the Human Monocarboxylate Transporter 8 and Its Rate-Limiting Role in Intracellular Metabolism Mol. Endocrinol., November 1, 2006; 20(11): 2761 - 2772. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Alkemade, E. C Friesema, G. G Kuiper, W. M Wiersinga, D. F Swaab, T. J Visser, and E. Fliers Novel neuroanatomical pathways for thyroid hormone action in the human anterior pituitary. Eur. J. Endocrinol., March 1, 2006; 154(3): 491 - 500. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. E. Handy, G. Hang, J. Scolaro, N. Metes, N. Razaq, Y. Yang, and J. Loscalzo Aminoglycosides Decrease Glutathione Peroxidase-1 Activity by Interfering with Selenocysteine Incorporation J. Biol. Chem., February 10, 2006; 281(6): 3382 - 3388. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Boelen, J. Kwakkel, A. Alkemade, R. Renckens, E. Kaptein, G. Kuiper, W. M. Wiersinga, and T. J. Visser Induction of Type 3 Deiodinase Activity in Inflammatory Cells of Mice with Chronic Local Inflammation Endocrinology, December 1, 2005; 146(12): 5128 - 5134. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Alkemade, E. C. Friesema, U. A. Unmehopa, B. O. Fabriek, G. G. Kuiper, J. L. Leonard, W. M. Wiersinga, D. F. Swaab, T. J. Visser, and E. Fliers Neuroanatomical Pathways for Thyroid Hormone Feedback in the Human Hypothalamus J. Clin. Endocrinol. Metab., July 1, 2005; 90(7): 4322 - 4334. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. W. J. S. Wassen, W. Klootwijk, E. Kaptein, D. J. Duncker, T. J. Visser, and G. G. J. M. Kuiper Characteristics and Thyroid State-Dependent Regulation of Iodothyronine Deiodinases in Pigs Endocrinology, September 1, 2004; 145(9): 4251 - 4263. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. A. Shepherdley, W. Klootwijk, K. W. Makabe, T. J. Visser, and G. G. J. M. Kuiper An Ascidian Homolog of Vertebrate Iodothyronine Deiodinases Endocrinology, March 1, 2004; 145(3): 1255 - 1268. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. G. J. M. Kuiper, F. Wassen, W. Klootwijk, H. van Toor, E. Kaptein, and T. J. Visser Molecular Basis for the Substrate Selectivity of Cat Type I Iodothyronine Deiodinase Endocrinology, December 1, 2003; 144(12): 5411 - 5421. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
