help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kuiper, G. G. J. M.
Right arrow Articles by Visser, T. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kuiper, G. G. J. M.
Right arrow Articles by Visser, T. J.
Endocrinology Vol. 144, No. 6 2505-2513
Copyright © 2003 by The Endocrine Society

Substitution of Cysteine for Selenocysteine in the Catalytic Center of Type III Iodothyronine Deiodinase Reduces Catalytic Efficiency and Alters Substrate Preference

George G. J. M. Kuiper, Willem Klootwijk and Theo J. Visser

Department of Internal Medicine, Erasmus Medical Center, 3000 DR Rotterdam, The Netherlands

Address all correspondence and requests for reprints to: George Kuiper, Ph.D., Department of Internal Medicine, Room Ee 502, Erasmus Medical Center, Dr. Molewaterplein 40, 3015 GD Rotterdam, The Netherlands. E-mail: g.kuiper{at}erasmusmc.nl.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Human type III iodothyronine deiodinase (D3) catalyzes the conversion of T4 to rT3 and of T3 to 3, 3'-diiodothyronine (T2) by inner-ring deiodination. Like types I and II iodothyronine deiodinases, D3 protein contains selenocysteine (SeC) in the highly conserved core catalytic center at amino acid position 144. To evaluate the contribution of SeC144 to the catalytic properties of D3 enzyme, we generated mutants in which cysteine (D3Cys) or alanine (D3Ala) replaces SeC144 (D3wt). COS cells were transfected with expression vectors encoding D3wt, D3Cys, or D3Ala protein. Kinetic analysis was performed on homogenates with dithiothreitol as reducing cofactor. The Michaelis constant of T3 was 5-fold higher for D3Cys than for D3wt protein. In contrast, the Michaelis constant of T4 increased 100-fold. The D3Ala protein was enzymatically inactive. Semiquantitative immunoblotting of homogenates with a D3 antiserum revealed that about 50-fold higher amounts of D3Cys and D3Ala protein are expressed relative to D3wt protein. The relative substrate turnover number of D3Cys is 2-fold reduced for T3 and 6-fold reduced for T4 deiodination, compared with D3wt enzyme. Studies in intact COS cells expressing D3wt or D3Cys showed that the D3Cys enzyme is also active under in situ conditions. In conclusion, the SeC residue in the catalytic center of D3 is essential for efficient inner-ring deiodination of T3 and in particular T4 at physiological substrate concentrations.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
T4, THE MAIN secretory product of the thyroid gland, undergoes enzymatic outer-ring deiodination in peripheral tissues to T3 catalyzed by the deiodinases type I (D1) and type II (D2) as well as inner-ring deiodination (IRD) to rT3 catalyzed by the deiodinase type III (D3; Refs. 1, 2, 3, 4). In fact, D3 is the major T4 and T3 inactivating enzyme by catalyzing the conversion of T4 to rT3 and T3 to T2 by IRD (1, 2, 3, 4, 5).

In rodents and humans, D3 activity was found in brain, skin, (failing) heart, placenta, uterus, and several fetal tissues such as liver and brain (6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18). In Xenopus laevis tadpoles, D3 activity is present in limb buds, retina, and tail in various stages of development (19, 20). Also in various other species, such as chicken and fish, D3 activity is present in brain, liver, and skin (21, 22, 23). Recently very high levels of D3 activity were described in infantile hemangiomas causing severe hypothyroidism (24).

Thyroid hormone is a major physiological regulator of brain development. The presence of D3 in organs such as the brain is thought to play a role in the local fine-regulation of intracellular T3 levels, whereas its presence in placenta, uterus, and fetal organs may protect fetal brain tissue against premature exposure to T3 during early stages of development (2, 10, 11, 12, 13, 16, 17, 25, 26, 27, 28, 29).

The D3 protein is a selenoprotein, containing a selenocysteine residue (SeC) in the catalytic center (30, 31, 32, 33, 34, 35, 36). Complementary DNAs from several species that code for the D3 protein have been isolated, and they contain a UGA stop codon within the open reading frame that is translated as SeC (32, 33, 34, 35, 36). The presence of an SeC insertion sequence element in the 3'-UTR of the mRNA is essential for SeC incorporation at the UGA codon, which otherwise would function as a stop codon (37).

The catalytic mechanism of D3 seems to be different from that of D1 but similar to that of D2 enzyme. Outer-ring deiodination of T4 or rT3 by D1 enzyme exhibits ping-pong (bi)substrate kinetics with T4 or rT3 and the thiol-containing cofactor as cosubstrates (38, 39). The D2 and D3 enzymes exhibit sequential reaction kinetics, suggesting that T4 and the thiol-containing cofactor must interact with the enzyme simultaneously before reaction takes place (7, 18, 38, 40). The SeC residue in the catalytic center is essential for maximal catalytic efficiency of deiodinases (32, 33, 40, 41, 42). In D1, mutation of SeC to leucine or alanine eliminates deiodinase activity, whereas its mutation to cysteine (Cys) raises the apparent Michaelis constant (Km) for rT3 3-fold and reduces the substrate-turnover number about 100-fold (41). Remarkably, in D2 mutation of SeC to Cys raises the apparent Km for T4 about 1000-fold, whereas the substrate-turnover number is reduced only 10-fold (40, 42). For D3 it was shown that substitution of SeC with leucine eliminates deiodinase activity, whereas substitution with Cys (D3Cys) reduced enzyme activity (32, 33). However, the D3Cys protein was not further characterized with regard to substrate interaction, substrate turnover number, and catalytic mechanism.

The present studies were undertaken to elucidate the functional role of the SeC residue in the catalytic center of D3 protein in more detail. We have examined effects of the SeC144 to Cys (D3Cys) or SeC144 to Ala (D3Ala) mutation in human D3 protein on substrate and cofactor interaction as well as on the substrate turnover number.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Materials
Nonradioactive iodothyronines were obtained from Henning (Berlin, Germany) or Calbiochem (San Diego, CA). [3'-125I]T3 (2000 mCi/µmol) and [3',5'-125I]T4 (1200 mCi/µmol) were either obtained from Amersham Pharmacia Biotech (Little Chalfont, Buckinghamshire, UK) or prepared by radioiodination of 3,5-T2 and 3,3',5-T3, respectively, using the chloramine-T method as described (43). Before each experiment, the radiolabeled iodothyronines were purified on Sephadex LH-20 columns. Radioactively labeled N-bromoacetyl-T3 (BrAc[125I]T3) and N-bromo-acetyl-T2 (BrAc[125I]T2) were synthesized from bromoacetylchloride and [3'-125I]T3 or [3'-125I]T2 as described (44). Nonradioactive N-bromo-acetyl-T3 (BrAcT3) was obtained from Henning. Gold thioglucose (GTG) and iodoacetate (IAc) were obtained from Sigma (St. Louis, MO). Dithiotreitol (DTT) was obtained from ICN Biochemicals Inc. (Costa Mesa, CA). Pyrococcus furiosus thermostable DNA polymerase and DpnI restriction endonuclease were obtained from Promega Corp. (Madison, WI). XL-10 ultracompetent Escherichia coli cells were obtained from Stratagene (La Jolla, CA). Synthetic oligonucleotides were ordered from Invitrogen-Life Technologies, Inc. (Glasgow, UK).

Site-directed mutagenesis
A human D3 expression vector (pcDNA3-D3) containing a 1.9-kb insert including 35 nucleotides of the 5'-untranslated region (nucleotides 185-2066 in Ref. 34) was used as template for site-directed mutagenesis via the circular mutagenesis procedure, followed by selection for mutants by DpnI digestion (45). Overlapping sense and antisense primers containing the nucleotide changes needed to produce the SeC144Cys D3 mutant cDNA.

The (sense 5' TTCGGAAGCTGCACCTGCCCACCGTTCATGGCG) and SeC144Ala mutant cDNA (sense 5'TTCGGAAGCTGCACCGCACCACCGTTCATGGCG) were used in circular mutagenesis reactions with 50 ng plasmid template and 2 U P. furiosus DNA polymerase (45). The cycling protocol consisted of 30 sec at 95 C, 1 min at 55 C, 14 min at 68 C for 18 cycles using a model 480 PCR machine (Perkin-Elmer, Norwalk, CT). The reaction products were incubated with 10 U DpnI enzyme for 2 h at 37 C and immediately transformed to competent E. coli XL-10 cells according to manufacturer’s instructions. Plasmid DNA isolated from up to four clones was sequenced on a model 310 DNA sequencer (ABI, Foster City, CA) to verify that the desired mutation had been generated and no spurious mutations had occurred during amplification (46). Plasmids were maintained in E. coli DH5{alpha} cells and purified with QIAfilter cartridges (QIAGEN, Hilden, Germany).

During sequencing of the wt D3 cDNA, we noted that codon 53 encodes glutamine instead of lysine as previously reported (Ref. 34 ; GenBank accession no. S79854). A more recent GenBank entry (XM007250) also describes a glutamine residue at codon 53.

Expression of D3 protein
The wt and mutant D3 enzymes were expressed in COS-1 cells or human embryonic kidney (HEK)-293 cells (65-cm2 dishes) after diethylaminoethyl-dextran-mediated transfection of the expression vectors (40, 47). COS-1 cells were grown in DMEM-Ham’s F-12 medium containing 10% fetal calf serum (Life Technologies, Inc.) and 40 nM sodium selenite. Two days after transfection, the cells were rinsed with PBS and collected in 0.25 ml 0.1 M phosphate (pH 7.2), 2 mM EDTA buffer; sonicated; aliquoted; and stored at -80 C.

Assay of IRD activity in cell homogenates
This assay is based on the determination of product formation (125I-labeled T2 or rT3) by reverse-phase HPLC analysis of reaction mixtures containing outer-ring-labeled T3 or T4 (1, 17).

Incubations contained about 200,000 cpm labeled T3 or T4 with varying amounts of unlabeled substrate (T3 or T4) and cell homogenate (5–10 µg protein) in a final volume of 0.1 ml P100E2 buffer (0.1 M phosphate, pH 7.2; 2 mM EDTA) and varying amounts of DTT (0.1–30 mM). In some experiments a pH profile was obtained using 0.1 M phosphate, 2 mM EDTA buffers of pH 6.0–8.0. Mixtures were incubated for 60 min at 37 C, whereafter the reaction was stopped by addition of 0.1 ml ice-cold methanol. After centrifugation, 0.1 ml was mixed with 0.1 ml 0.02 M ammonium acetate (pH 4.0), and 0.1 ml (equivalent to 25-µl reaction volume) of the mixture was applied to a 250 x 4.6 mm Symmetry C18 column connected to an Alliance HPLC system (Waters Chromatography Division, Millipore Corp., Milford, MA) and eluted with a 15-min linear gradient of acetonitrile (28–42%) in 0.02 M ammonium acteate (pH 4) at a flow rate of 1.2 ml/min. Radioactivity in the eluate was monitored online using a Radiomatic A-500 flow scintillation detector (Packard, Meriden, CT).

Homogenate protein was adjusted to limit substrate consumption to less than 30%. Enzymatic deiodination was corrected for nonenzymatic deiodination by determining the amount of 125I-labeled T2 or rT3 formed in blank incubations with homogenates of nontransfected cells.

Assay of IRD activity in intact transfected COS cells
COS cells were cultured in 6-well plates (10 cm2/well) and transfected with 0.2 or 2 µg plasmid per well as described (40). One day after transfection, cell monolayers were washed with serum-free DMEM/F12 medium and cultured for an additional 24 h in serum-free DMEM/F12 supplemented with 40 nM sodium selenite, to which was added [3',5'-125I]T4 or [3'-125I]T3 (1 x 106 cpm/ml) plus 1–1000 nM unlabeled T4 or T3. After 20–24 h the medium was harvested and extracted with ice-cold methanol (1:1). After centrifugation, the extract was mixed with 0.02 M ammoniumacetate (pH 4), and 0.1 ml of the mixture was analyzed with the same HPLC system as described. The column was eluted with a 20-min gradient of 24–29% acetonitrile followed by a 6-min gradient of 29–50% acetonitrile in 0.02 M ammonium acetate (pH 4). This gradient provides improved separation of sulfated iodothyronines from nonsulfated iodothyronines.

Polyclonal antiserum production and Western blotting
Polyclonal antisera were raised in rabbits by Eurogentec SA (Herstal, Belgium) after conjugation of the synthetic peptide (C)RYDEQLHGARPRRV (human D3 amino acid residues 265–278) to keyhole limpet hemocyanin. Antiserum (designated 677) from the final bleed was used without further purification.

COS cell homogenates (20–30 µg protein) were separated on 12% SDS-PAGE gels in the Mini-Protean II cel (Bio-Rad Laboratories, Inc., Hercules, CA) according to the manufacturer’s instructions. After electrophoresis the gels were positioned on nitrocellulose membranes (Hybond-C pure, Amersham Pharmacia Biotech) and placed in a minitransblot cell (Bio-Rad Laboratories, Inc.) filled with buffer (25 mM Tris-HCl, pH 8.3; 150 mM glycine; and 20% vol/vol methanol). The transfer was performed for 1 h at 100 V.

Membranes were blocked with 5% (wt/vol) nonfat milk in PBS with 0.1% Tween 20 (PBS-Tween) for 1 h at 37 C and thereafter incubated with antiserum 677 at a 1:500 dilution in 5% (wt/vol) milk in PBS-Tween overnight at 8 C. Blots were washed 2 x 15 min with 5% (wt/vol) milk in PBS-Tween and 2 x 15 min with PBS-Tween, followed by incubation with peroxidase-conjugated secondary antibody (A0545, 1:16,000, Sigma) in 5% (wt/vol) milk in PBS-Tween for 2 h. After washing as described, the blot was developed with a homemade chemiluminescence system (48) consisting of 0.7 µM p-coumaric acid, 1.25 mM luminol, and 0.01% hydrogen peroxide in 0.1 M Tris HCl (pH 8.5), and exposed to Hyperfilm ECL film (Amersham) for 5–15 min.

To compare the relative amounts of enzyme expressed between wild-type and mutant D3, the mutant enzyme was diluted in cell lysate derived from nontransfected COS cells. The density of the D3 bands was quantified by densitometry.

Affinity labeling of D1 and D3 protein with BrAc[125I]T3
BrAc[125I]T3 (1500 mCi/µmol) was synthesized as described (44), and HPLC analysis demonstrated that the purity was at least 85% with unreacted [125I]T3 as the main contaminant. Unlabeled BrAcT3 was also analyzed by HPLC and found to be more than 90% pure. The concentration was determined by mixing with a T3 internal standard and online monitoring of the eluates with a photodiode array detector, taking into account that the molar extinction coefficient of BrAcT3 is very close to that of T3 in the far UV (49).

Solutions of BrAc[125I]T3 (200,000 cpm, 0.06 pmol) in ethanol were pipetted into microcentrifuge tubes, and the solvent was evaporated by a stream of nitrogen. After addition of 25 µl P100E2D10 (0.1 M sodium phosphate; 2 mM EDTA; 10 mM DTT, pH 7.2) and vortexing, the cell homogenates (100–150 µg protein) were added in a total volume of 50 µl P100E2D10. The mixtures were incubated for 10–20 min on ice, at room temperature or 37 C. Reactions were terminated by addition of SDS-PAGE gel-loading buffer, and samples were analyzed by SDS-PAGE (12% gel) followed by autoradiography to BioMax MS film (Kodak, Rochester, NY) at -70 C with intensifying screen (50, 51, 52).

Alternatively, the reactions were terminated by the addition of ice-cold methanol. After centrifugation the protein-free supernatant was mixed with 0.1% trifluoracetic acid (pH 2) and analyzed with the same HPLC system as described. The column was eluted with a 20-min gradient of 40–60% acetonitrile in 0.1% trifluoracetic acid. Retention times for BrAc-iodothyronines were determined by incubation of BrAc[125I]T3 and BrAc[125I]T2 with homogenates of nontransfected COS cells in P100E2D10 buffer and HPLC analysis as described.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Analysis of mutant D3 enzymes in vitro
To define the role of SeC144 with regard to the catalytic properties of D3 enzyme, we generated mutants in which cysteine (D3Cys) or alanine (D3Ala) replaced SeC144. The substitution of cysteine for SeC essentially replaces the selenium of SeC with sulfur. Alanine was chosen as a control because it has an inert side chain. COS cells were transfected with expression vectors encoding the D3wt, D3Cys, or D3Ala enzymes, and kinetic analysis with T3 or T4 was performed on homogenates in the presence of 0.3–10 mM DTT (Figs. 1Go and 2Go, and Table 1Go).



View larger version (14K):
[in this window]
[in a new window]
  		Figure 1. Lineweaver-Burk plots of T3 deiodination at various DTT concentrations catalyzed by D3wt (A), D3Cys (B), and D3 in human placenta microsomes (C). Each data point is the average of closely agreeing duplicate determinations, and the experiment was performed twice on different homogenates with similar results.

 


View larger version (16K):
[in this window]
[in a new window]
  		Figure 2. Lineweaver-Burk plots of T4 deiodination at various DTT concentrations catalyzed by D3wt (A) or D3Cys (B) enzyme. Each data point is the average of closely agreeing duplicate determinations, and the experiment was performed twice.

 

View this table:
[in this window]
[in a new window]
  		Table 1. Kinetic characteristics of D3 enzymes

 
For the D3wt and D3Cys enzyme as well as D3 activity of human placenta microsomes, Lineweaver-Burk plots of T3 deiodination at varying reducing cofactor (DTT) concentrations yielded a set of intersecting lines (Fig. 1Go). The D3 protein exhibits sequential reaction kinetics as was shown previously (7, 18), suggesting that T3 and the thiol-containing cofactor must interact with the enzyme simultaneously before reaction takes place. In the presence of 10 mM DTT, the Km of T3 was 5-fold higher for the D3Cys enzyme than for the D3wt enzyme, whereas the maximal velocity (Vmax) increased about 25-fold (Table 1Go). The D3Ala enzyme was inactive. When T4 was used as substrate, the Km was 50–100 times higher for the D3Cys enzyme than for the D3wt enzyme at DTT concentrations of 1 mM or higher. In the case of T4, Vmax increased only 8-fold (Fig. 2Go and Table 1Go). The Vmax/Km ratios were calculated as a measure of the efficiency by which the D3wt and D3Cys enzyme deiodinate the substrates T3 and T4. The D3wt enzyme deiodinates T3 and T4 with equal efficiency as reflected in the similar Vmax/Km ratios. In contrast, the D3Cys enzyme strongly prefers T3 above T4 because the Vmax/Km ratio for T3 is 40-fold higher. In the absence of DTT, no deiodination of T3 or T4 could be measured by D3wt or D3Cys enzyme. Maximal enzyme activity was observed at 10 mM DTT, whereas at higher DTT concentrations (>30 mM), the activity was reduced (not shown). No outer-ring deiodination of T3, T4, or rT3 by D3wt or D3Cys enzyme was detected.

Selenoenzymes such as thioredoxin reductase, glutathione peroxidase, formate dehydrogenase, and iodothyronine deiodinases are inhibited by organic gold compounds and IAc (1, 2, 3, 4, 5, 53, 54, 55, 56). GTG or aurothioglucose is a competitive inhibitor of T3 deiodination by D3 (34). Under the conditions used (1 nM T3, 10 mM DTT), the IC50 value for inhibition by GTG of D3wt enzyme was about 1 µM. Interestingly, the D3Cys enzyme is not insensitive to GTG, although the IC50 value increased to about 30 µM (Fig. 3Go). Under the same experimental conditions, both the D3wt and D3Cys enzymes were essentially insensitive to IAc (IC50 > 1 mM).



View larger version (11K):
[in this window]
[in a new window]
  		Figure 3. Effect of GTG on T3 deiodination (1 nM T3, 10 mM DTT) by D3wt and D3Cys enzyme.

 
The decreased catalytic activity of D1 and D2 mutant enzymes in which Cys substitutes for SeC has been attributed to the reduced dissociation (deprotonation) of the sulfydryl moiety at physiological pH and thus to the diminished nucleophilic character of the catalytic center (41, 42). By comparing the actual pH profiles of D3wt and D3Cys enzyme (Fig. 4Go), no shift to more alkaline pH values for D3Cys enzyme was observed, despite the different pK values (5.2 vs. 9.0) of the selenol and sulfhydryl moieties in free SeC and Cys (57, 58).



View larger version (24K):
[in this window]
[in a new window]
  		Figure 4. Effect of pH on deiodinase activity of D3wt or D3Cys enzyme in the presence of 1 nM T3 or T4 (closed symbols) and in the presence of 10 nM T3 or T4 (open symbols). Each point is the mean of closely agreeing duplicate determinations, and the experiment was performed twice with similar results. The curves were obtained by fitting the data points to a hyperbolic function and the pH optimum was calculated.

 
Quantitation of D3 enzymes and estimation of substrate turnover number
To quantitate the effect of the substitution of Cys for SeC on the substrate turnover number, it is necessary to estimate the absolute or relative expression levels of protein. We performed semiquantitative Western blotting using a D3 antiserum on homogenates of COS cells expressing D3wt or D3Cys protein (Fig. 5Go). Comparison of the densities of the approximately 34-kDa D3 protein band indicated that the amount of D3Cys protein is 40- to 50-fold greater than the amount of D3wt protein. Also, the amount of D3Ala protein expressed was about 50-fold greater than D3wt protein (not shown). Using an estimate that 50-fold higher quantities of D3Cys protein are expressed relative to D3wt protein and using the Vmax values obtained (Table 1Go), our results indicated that the substrate turnover number of D3Cys enzyme is 2-fold reduced for T3 and 6-fold reduced for T4 deiodination, compared with D3wt enzyme.



View larger version (51K):
[in this window]
[in a new window]
  		Figure 5. Quantitation of the relative amounts of D3wt and D3Cys protein by Western blotting. COS cell homogenates were subjected to immunoblot analysis as described in Materials and Methods. Migration distances of molecular mass markers are indicated (kilodaltons). To compare the relative amount of protein expressed between D3wt and D3Cys, the homogenates containing D3Cys were diluted in homogenates from mock-transfected COS cells. The D3wt selenoprotein was expressed approximately 50-fold less well than the D3Cys mutant.

 
To calculate the absolute substrate turnover number of D3, it is necessary to determine the quantity of the transiently expressed protein. BrAc[125I]T3 has proven to be a very useful affinity label of D1 protein, and saturation analysis of the progressive labeling of D1 protein with increasing concentrations of BrAcT3 allowed the determination of D1 expression levels (41, 50). We therefore decided to investigate the possibility of using BrAc[125I]T3 to specifically label D3 protein in COS cell homogenates.

The deiodination of T3 (1 nM [125I]T3, 10 mM DTT) could be completely inhibited with BrAcT3, indicating that BrAcT3 interacts with the D3 enzyme. The IC50 values were about 3 nM for D3wt enzyme and about 30 nM for D3Cys enzyme (not shown). After incubation of homogenates with BrAc[125I]T3 followed by SDS-PAGE, a labeled protein of 34 kDa was observed in homogenates containing D3Cys protein and a weakly labeled protein of the same molecular size was present in homogenates containing D3wt protein. Especially after prolonged autoradiography, a weakly labeled protein with slightly higher molecular mass than D3 was visible in homogenates of nontransfected COS cells (Fig. 6AGo). The D3Ala protein could not be labeled with BrAcT3, despite the fact that the expression level is equally high as that of D3Cys protein. This indicates that deiodinase activity is essential for labeling with BrAcT3 and probably the SeC144 or Cys144 residues are the targets for labeling by BrAcT3. The same affinity labeling experiments were done with homogenates of HEK-293 cells transfected with D3wt or D3Cys vectors. The activity of D3wt in HEK cell homogenates was 1.5-fold higher than in COS cell homogenates. The results of the labeling experiments with HEK cell homogenates were similar to those with COS cell homogenates. Both for COS and HEK cell homogenates, about 0.5% of the added BrAc[125I]T3 was incorporated into D3wt protein and about 1.5% in D3Cys protein as determined by SDS-PAGE followed by counting of radioactivity in gel slices. Altogether the labeling of D3 protein was weak, compared with that of rat D1 protein. Given the intense labeling of D1 protein, it is unlikely that COS cell proteins interfere with the labeling of D3 by BrAcT3 (Fig. 6AGo).



View larger version (39K):
[in this window]
[in a new window]
  		Figure 6. A, Labeling patterns obtained after reaction of COS cell homogenates (100–150 µg protein) containing D3wt, D3Cys, or D1wt or control homogenates with BrAc [125I]T3 in the presence of 10 mM DTT at 4 C, 20 C, or 37 C. Migration distances of molecular mass markers are indicated (kilodaltons). B, HPLC analysis of metabolites recovered from incubation of BrAc[125I]T3 with D3wt enzyme, D3Cys enzyme, or human placenta microsomes in P100E2D10 at 37 C. Retention times are 11 min for BrAcT3, 9 min for BrAcT2, and 3–4 min for T3 and T2. The peak at 7 min most likely represents BrAc[125I]T1, although this reference compound was not synthesized. The pattern obtained with D1wt enzyme or D2wt enzyme was similar to that obtained with homogenate from nontransfected (control) COS cells (not shown).

 
Another possible explanation for the differential labeling of D1 and D3 might be degradation or deiodination of BrAcT3 by the D3 enzyme. In a series of experiments, the labeling reactions were terminated by addition of ice-cold methanol. The protein-free supernatants were subsequently analyzed by reverse-phase HPLC (see Materials and Methods). The HPLC analysis revealed a shift of radioactivity to more polar components, most likely as a consequence of inner-ring deiodination of BrAc[125I]T3 to BrAc[125I]T2 and BrAc[125I]T1 by D3wt and D3Cys enzyme (Fig. 6BGo). Apart from D3 in COS or HEK cell homogenates, D3 in human placental microsomes also caused inner-ring deiodination of BrAcT3. Neither inner-ring nor outer-ring deiodination of BrAc[125I]T3 by D1 or D2 enzymes could be detected (not shown). Attempts to reduce the inner-ring deiodination of BrAcT3 by lowering the DTT concentration to 0.1 mM or 1 mM instead of 10 mM increased incorporation of radioactivity in the various proteins but did not increase the relative incorporation of radioactivity in D3 protein as analyzed by SDS-PAGE (not shown). Because of the rather weak labeling of D3, a reliable estimation of D3 content by saturation analysis was not possible. Under the most favorable conditions (1 mM DTT at 37 C), 0.5% of the added BrAc[125I]T3 was incorporated into D3wt protein and about 2% in D3Cys protein. By comparison, 6% of the added BrAc[125I]T3 was incorporated into rat D1wt protein.

Deiodination by wild-type D3, D3Cys, and D3Ala protein in intact cells
The D3Cys enzyme is active in vitro in the presence of excess iodothyronine substrate and DTT. An important question is whether the same is true under in situ conditions using intact transfected COS cells. In intact cells the free substrate concentration available to the enzyme might be lower because of limited cellular uptake as well as binding of iodothyronine substrate to cytosolic iodothyronine-binding proteins or membranes (1, 2).

When D3wt or D3Cys enzyme were expressed in COS cells, addition of increasing amounts of unlabeled T3 did not result in saturation of the fractional deiodination of [125I]T3 (Fig. 7AGo). The D3Ala protein was inactive, whereas the percentage deiodination of T3 by D3wt and D3Cys protein were similar. In control experiments, it was established that nontransfected COS cells sulfate [125I]T2, and therefore the sum of [125I]T2 and [125I]T2SO4 was used to calculate the percentage deiodination of T3.



View larger version (16K):
[in this window]
[in a new window]
  		Figure 7. In situ deiodination at varying T3 (A) and T4 (B) medium concentrations. COS cells were transfected with D3wt, D3Ala, or D3Cys (A) and D3wt, D3Cys, or D2wt (B) expression vectors, and 24 h post transfection intact cell deiodination was analyzed as described in Materials and Methods.

 
When D2 enzyme was expressed in COS cells, addition of increasing amounts of unlabeled T4 resulted in the complete saturation of [125I]T4 deiodination, as reflected by a decrease of [125I]T3 release into the medium (40) (Fig. 7BGo). In contrast, the fractional deiodination of [125I]T4 by D3wt and D3Cys enzyme was not saturable. The saturation of the fractional deiodination of T4 by D2 at high medium T4 concentrations indicated that cellular T4 uptake did not limit its deiodination, whereas in the case of D3, uptake of T4 apparently did limit deiodination. In this regard it is important to note that the in vitro Km values of D2wt and D3wt for T4 are similar (4–5 nM). The intracellular concentration of D3 might be higher than that of available T4. Attempts to reduce the expression level of D3 enzyme by transfecting 10-fold lower amounts of plasmid DNA (0.2 µg/well instead of 2 µg/well) gave similar results, i.e. no saturation of the deiodination of [125I]T4 by medium T4 concentrations of up to 1 µM.


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
The aim of the present study was to investigate the role of the SeC residue in the catalytic center of D3 protein. Replacing the SeC residue with alanine inactivated the D3 enzyme, as was previously also described for D1 (41) and D2 enzymes (40, 42). Substitution of cysteine for SeC did not eliminate D3 activity but reduced the turnover number 2-fold for T3 and 6-fold for T4 deiodination. In addition, the Km for T3 increased 5-fold, whereas the Km for T4 increased 100-fold in comparison with D3wt enzyme.

The SeC residue in the catalytic center is essential for maximal catalytic efficiency of deiodinases and other selenoenzymes such as glutathione peroxidase, formate dehydrogenase, and thioredoxin reductase (40, 41, 42, 54, 55, 56, 58, 59). Substitution of Cys for SeC has quite variable results, possibly because of different catalytic mechanisms used by D1, D2, and D3. The D1 enzyme exhibits ping-pong (bi)substrate kinetics, whereas the D2 and D3 enzymes exhibit sequential reaction kinetics (7, 18, 38, 40, 41, 60). In D1 mutation of SeC to Cys raises the Km for rT3 only 3-fold but reduces the substrate turnover number 100-fold (41). The SeC residue in the catalytic center of D1 is thought to function as the iodine acceptor, and the selenenyl iodide intermediate is the target for reaction with propylthiouracil (38, 39, 60, 61). The thiol group of Cys is a much weaker nucleophile than the selenol group of SeC, thus explaining the strongly reduced efficiency of formation of the sulfenyl iodide intermediate and therefore the reduced turnover of the D1Cys enzyme.

Both for D2 and D3, substitution of SeC by Cys results in a limited decrease in turnover of the substrate T4 but a marked increase in the Km for T4. In D2 the Km increased 1000-fold and the T4 turnover was reduced 10-fold (40, 42). In this study the D3Cys enzyme has a 6-fold reduced turnover of T4 and a 100-fold increased Km for T4. We proposed a catalytic model for D2 in which the SeC residue exerts a nucleophilic attack to the 2'-position of T4, thus forming an intermediate complex between the SeC residue and T4 (40). Subsequent steps involve the abstraction of iodonium by DTT (or another thiol group containing cofactor) providing a D2/T3 complex that will yield T3 and the unmodified enzyme. So in this model the activated substrate is directly reduced by the cofactor, whereas in the case of D1, the SeI intermediate is reduced by cofactor. This model of reductive dehalogenation of T4 by D2 might also apply to D3 enzyme. In that case it would involve a nucleophilic attack to the 2-position of T4. In this model the lower nucleophilicity of the SH group in Cys, compared with the SeH group in SeC would result in a less favorable formation of the intermediate between T4 and D2 or D3 enzyme, which is reflected in the 1000-fold (D2) or 100-fold (D3) increased Km for T4.

The decreased catalytic activity of D1 and D2 mutant enzymes in which Cys substitutes for SeC has been attributed to the reduced dissociation of the sulfhydryl group at physiological pH and thus to the diminished nucleophilic character of the catalytic center, compared with the wild-type enzymes (41, 42). By comparing the actual pH activity profiles of D3 wt and D3Cys enzyme, no shift to more alkaline pH values for D3Cys enzyme was observed, despite the different pK values (5 vs. 9) of the selenol and sulfhydryl moieties (57). So the pH dependence of D3 activity is not simply accounted for by the dissociation of the nucleophilic group (selenol or sulfhydryl) in the catalytic center. For thioredoxin reductase the pH optimum shifted from 7 to 9 for the mutant enzyme in which the penultimate SeC was substituted by Cys (58). For other selenoenzymes such as glutathione peroxidase and formate dehydrogenase such big pH shifts for the Cys mutant enzymes were not observed (54, 55, 56), perhaps because these enzymes display rather broad pH optima around 8.5. It is remarkable that the pH optimum for D3 is close to 7 (6.7–7.1) and D3 activity is strongly reduced at pH 8, especially with T4 as substrate.

The selenol or sulfhydryl group might interact with side groups of other amino acid residues in the catalytic center. These interactions could stimulate deprotonation of the selenol or sulfhydryl group at physiological pH. A so-called catalytic triad involving tryptophane and glutamine residues stimulating SeC deprotonation has been described for glutathione peroxidase (55, 62). For D1 the formation of an essential imidazolium-selenolate ion pair was postulated on the basis of experiments with histidine-directed reagents, pH-dependent kinetic properties, and site-directed mutagenesis studies (1, 63, 64). The existence of a catalytic triad or an imidazolium-selenolate ion pair in D3 enzyme is speculative at the moment and needs further investigation.

The D3Cys enzyme is sensitive to GTG, and the IC50 value is about 30-fold higher than that of D3wt enzyme. This increase mirrors the change in sensitivity toward GTG of native vs. D1Cys or D2Cys enzymes, which resulted in 100-fold higher inhibitory constant values (Ki) for GTG (42, 60). For both D1 and D3 enzymes, GTG is a competitive inhibitor, implying that GTG interacts directly with the conserved catalytic center (34, 60). However, this does not explain the differential sensitivity toward GTG of the deiodinases, with D1 being the most sensitive and D3 the least sensitive (65). Also, the reduced sensitivity to GTG of D3Cys enzyme does not necessarily imply that inhibition by GTG is selective for the SeC residue in the catalytic center. Other Cys residues outside the catalytic center might be involved as well.

BrAc[125I]T3 has proven to be a useful affinity label for D1, allowing specific identification of the enzyme in microsomal fractions of liver and kidney (44, 50, 66). Affinity labeling with BrAc[125I]T3 was also used for the quantitation of D1 enzyme expression levels by saturation analysis, allowing estimation of the D1 substrate turnover number in microsomal preparations and homogenates of transfected cells (41, 50). With regard to affinity labeling of D3 with BrAcT3 results have been confusing (51, 52, 67). Initial experiments with brain and placenta microsomes revealed a good correlation between affinity labeling of a 32-kDa protein (p32) and inactivation of D3 by unlabeled BrAcT3 (51, 52). However, when p32 was also detected in tissues with low or undetectable D3 activity and p32 labeling was not prevented by substrates of D3, it was concluded that p32 does not represent D3 protein (51, 52). An alternative explanation for the inconsistencies might be that in one-dimensional SDS-PAGE, the low abundance D3 protein comigrates with an abundant p32 protein not related to D3 (52, 67).

Despite the ambiguous results with respect to affinity labeling of native D3 with BrAcT3, we decided to try to label recombinant D3 in COS or HEK cell homogenates. Although D3 activity was inactivated with BrAcT3, we were not able to use affinity labeling with BrAc[125I]T3 as a reliable method to quantify the D3 content of homogenates. The labeling intensity of D3wt and D3Cys protein was low, certainly when compared with D1wt protein labeled under the same experimental conditions. Possible explanations are: 1) BrAc[125I]T3 is degraded after coupling to D3, leading to a loss of radioactivity bound to D3; 2) the amount of D3 present in the homogenates is too low to allow sufficient incorporation of BrAc[125I]T3; 3) BrAcT3 blocks the interaction of T3 with D3 but does not react covalently with D3 because of unfavorable positioning toward a nucleophilic amino acid (SeC) in the catalytic center; and 4) inner-ring deiodination of BrAcT3 by D3 and the BrAcT2 and/or BrAcT1 thus formed do not label D3 enzyme. We found evidence for the last possibility, although the alternatives cannot be excluded. Because of the inner-ring deiodination, it is clear that BrAcT3 is not optimal as affinity label for D3 protein, and improved affinity label(s) should be developed. In contrast to our results, Salvatore et al. (34) described affinity labeling with BrAc[125I]T3 and quantitation by saturation analysis of D3 in homogenates of HEK-293 cells. Inner-ring deiodination of BrAcT3 by D3 enzyme was not investigated.

From the intact cell deiodination experiments, it is clear that D3Cys enzyme is active in situ in the presence of endogenous cofactor, just as D3wt enzyme. The intracellular actual free substrate concentrations are unknown, so detailed kinetic studies are not possible. The lack of saturability of the fractional T4 deiodination by D3 in contrast to D2 could be explained if the D3 expression level is higher than that of D2. The much longer half-life of D3, compared with D2 protein (68), could result in a higher D3 expression level.

As shown in the present work, the replacement of SeC by Cys results in reduced substrate turnover by D3 enzyme in particular with T4. Moreover, when SeC was replaced by Ala the result was complete loss of catalytic activity. These results suggest a role for the SeC residue that is catalytic rather than structural. In fact, the SeC residue is essential for efficient deiodination at physiological substrate concentrations. Additional mutagenesis experiments need to be performed to identify residues (histidine?) that might be involved in interaction(s) with the SeC residue. Increased insight in the catalytic mechanism of D3 could form the basis for the design of D3 specific inhibitors and/or affinity labels.


   Acknowledgments
 
We thank Hans van Toor for synthesis of radiolabeled iodothyronines and Ronald van der Wal for DNA sequencing. The wild-type hD3 clone was kindly provided by Dr. P. Reed Larsen (Thyroid Division, Department of Medicine, Brigham and Women’s Hospital and Harvard Medical School, Boston, MA).


   Footnotes
 
This work was supported by The Netherlands Organization for Scientific Research (Grant 903-40-194) and the Quality of Life Research program of the European Union (FP5 Grant QLG3-CT-2000-00930).

Abbreviations: BrAcT3, N-Bromoacetyl-T3; BrAc[125I]T2, N-bromo-acetyl-T2; BrAc[125I]T3, N-bromoacetyl-T3; Cys, cysteine; D1, deiodinases type I; D2, type II; D3, type III; DTT, dithiothreitol; GTG, gold thioglucose; HEK, human embryonic kidney; IAc, iodoacetate; IRD, inner-ring deiodination; Km, Michaelis constant; SeC, selenocysteine; Vmax, maximal velocity.

Received January 16, 2003.

Accepted for publication March 3, 2003.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Köhrle J 2002 Iodothyronine deiodinases. Methods Enzymol 347:125–167[Medline]
  2. Bianco AC, Salvatore D, Gereben B, Berry MJ, Larsen PR 2002 Biochemistry, cellular and molecular biology, and physiological roles of the iodothyronine selenodeiodinases. Endocr Rev 23:38–89[Abstract/Free Full Text]
  3. St. Germain DL, Galton VA 1997 The deiodinase family of selenoproteins. Thyroid 7:655–668[Medline]
  4. Visser TJ 1996 Pathways of thyroid hormone metabolism. Acta Med Austriaca 23:10–16[Medline]
  5. Visser TJ, Schoenmakers CH 1992 Characteristics of type III iodothyronine deiodinase. Acta Med Austriaca 19:18–20
  6. Kaplan MM, Yaskoski KA 1980 Phenolic and tyrosyl ring deiodination of iodothyronines in rat brain homogenates. J Clin Invest 66:551–562
  7. Kaplan M, Visser TJ, Yaskoski KA, Leonard JL 1983 Characterisation of iodo-thyronine tyrosyl ring deiodination by rat cerebral cortical microsomes. Endocrinology 112:35–42[Medline]
  8. Fay M, Roti E, Fang SL, Wright G, Braverman LE, Emerson CH 1984 The effects of propylthiouracil, iodothyronines, and other agents on thyroid hormone metabolism in human placenta. J Clin Endocrinol Metab 58:280–286[Abstract]
  9. Galton VA, McCarthy PT, St. Germain DL 1991 The ontogeny of iodothyronine deiodinase systems in liver and intestine of the rat. Endocrinology 128:1717–1722[Abstract]
  10. Galton VA, Martinez E, Hernandez A, St. Germain EA, Bates JM, St. Germain DL 1999 Pregnant rat uterus expresses high levels of the type 3 iodothyronine deiodinase. J Clin Invest 103:979–987[Medline]
  11. Bates JM, St. Germain DL, Galton VA 1999 Expression profiles of the three iodothyronine deiodinases, D1, D2, and D3 in the developing rat. Endocrinology 140:844–851[Abstract/Free Full Text]
  12. Tu HM, Legradi G, Bartha T, Salvatore D, Lechan RM, Larsen PR 1999 Regional expression of the type 3 iodothyronine deiodinase messenger ribonucleic acid in the rat central nervous system and its regulation by thyroid hormone. Endocrinology 140:784–790[Abstract/Free Full Text]
  13. Santini F, Pinchera A, Ceccarini G, Castagna M, Rosellini V, Mammoli C, Montanelli L, Zucchi V, Chopra IJ, Chiovato L 2001 Evidence for a role of the type III iodothyronine deiodinase in the regulation of 3, 5, 3'-triiodothyronine content in the human central nervous system. Eur J Endocrinol 144:577–583[Abstract]
  14. Stulp MR, de Vijlder JJ, Ris-Stalpers C 1998 Placental iodothyronine deiodinase III and II ratios, mRNA expression compared to enzyme activity. Mol Cell Endocrinol 142:67–73[CrossRef][Medline]
  15. Wassen FWJS, Schiel AE, Kuiper GGJM, Kaptein E, Bakker O, Visser TJ, Simonides WS 2002 Induction of thyroid hormone-degrading deiodinase in cardiac hypertrophy and failure. Endocrinology 143:2812–2815[Free Full Text]
  16. Richard K, Hume R, Kaptein E, Sanders JP, van Toor H, de Herder WW, den Hollander JC, Krenning EP, Visser TJ 1998 Ontogeny of iodothyronine deiodinases in human liver. J Clin Endocrinol Metab 83:2868–2874[Abstract/Free Full Text]
  17. Koopdonk-Kool JM, de Vijlder JJM, Veenboer GJM, Ris-Stalpers C, Kok JH, Vulsma T, Boer K, Visser TJ 1996 Type II and type III deiodinase activity in human placenta as a function of gestational age. J Clin Endocrinol Metab 81:2154–2158[Abstract]
  18. Campos-Barros A, Hoell T, Musa A, Sampaolo S, Stoltenburg G, Pinna G, Eravci M, Meinhold H, Baumgartner A 1996 Phenolic and tyrosyl ring iodo-thyronine deiodination and thyroid hormone concentrations in the human central nervous system. J Clin Endocrinol Metab 81:2179–2185[Abstract]
  19. Huang H, Marsh-Armstrong N, Brown DD 1999 Metamorphosis is inhibited in transgenic Xenopus leavis tadpoles that overexpress type III deiodinase. Proc Natl Acad Sci USA 96:962–967[Abstract/Free Full Text]
  20. Marsh-Armstrong N, Huang H, Remo BF, Liu TT, Brown DD 1999 Asymmetric growth and development of the Xenopus leavis retina during metamorphosis is controlled by type III deiodinase. Neuron 24:871–878[CrossRef][Medline]
  21. Verhoelst CHJ, Vandenborne K, Severi T, Bakker O, Zandieh Doulabi B, Leonard JL, Kühn ER, van der Geyten S, Darras VM 2002 Specific detection of type III iodothyronine deiodinase protein in chicken cerebellar Purkinje cells. Endocrinology 143:2700–2707[Abstract/Free Full Text]
  22. Mol KA, van der Geyten S, Darras VM, Visser TJ, Kühn ER 1997 Characterization of iodothyronine outer ring and inner ring deiodinase activities in the blue tilapia, Oreochromis aureus. Endocrinology 138:1787–1793[Abstract/Free Full Text]
  23. Frith SD, Eales JG 1996 Thyroid hormone deiodination pathways in brain and liver of rainbow trout, Oncorhynchus mykiss. Gen Comp Endocrinol 101:323–332[CrossRef][Medline]
  24. Huang SA, Tu HM, Harney JW, Venihaki M, Butte AJ, Kozakewich HP, Fishman SJ, Larsen PR 2000 Severe hypothyroidism caused by type 3 iodo-thyronine deiodinase in infantile hemangiomas. N Engl J Med 343:185–189[Free Full Text]
  25. St. Germain DL 1999 Development effects of thyroid hormone: the role of deiodinases in regulatory control. Biochem Soc Trans 27:83–88[Medline]
  26. Darras VM, Hume R, Visser TJ 1999 Regulation of thyroid hormone metabolism during fetal development. Mol Cell Endocrinol 151:37–47[CrossRef][Medline]
  27. Morreale de Escobar G, Obregón MJ, Escobar del Rey F 2000 Is neuropsychological development related to maternal hypothyroidism or to maternal hypothyroxinemia? J Clin Endocrinol Metab 85:3975–3987[Abstract/Free Full Text]
  28. Escamez MJ, Guadano-Ferraz A, Cuadrado A, Bernal J 1999 Type 3 iodo-thyronine deiodinase is selectively expressed in areas related to sexual differentiation in the newborn rat brain. Endocrinology 140:5443–5446[Abstract/Free Full Text]
  29. Bernal J 2002 Action of thyroid hormone in brain. J Endocrinol Invest 25:268–288[Medline]
  30. Ramauge M, Pallud S, Esfandiari A, Gavaret J-M, Lennon A-M, Pierre M, Courtin F 1996 Evidence that type III iodothyronine deiodinase in rat astrocyte is a selenoprotein. Endocrinology 137:3021–3025[Abstract]
  31. Bates JM, Spate VL, Morris JS, St. Germain DL, Galton VA 2000 Effects of selenium deficiency on tissue selenium content, deiodinase activity, and thyroid hormone economy in the rat during development. Endocrinology 141:2490–2500[Abstract/Free Full Text]
  32. St. Germain DL, Schwartzman RA, Croteau W, Kanamori A, Wang Z, Brown DD, Galton VA 1994 A thyroid hormone-regulated gene in Xenopus laevis encodes a type III iodothyronine 5-deiodinase. Proc Natl Acad Sci USA 91:7767–7771 (correction 91:11282)[Free Full Text]
  33. Croteau W, Whittemore SL, Schneider MJ, St. Germain DL 1995 Cloning and expression of a cDNA for a mammalian type III iodothyronine deiodinase. J Biol Chem 270:16569–16575[Abstract/Free Full Text]
  34. Salvatore D, Low SC, Berry M, Maia AL, Harney JW, Croteau W, St. Germain DL, Larsen PR 1995 Type 3 iodothyronine deiodinase: cloning, in vitro expression, and functional analysis of the placental selenoenzyme. J Clin Invest 96:2421–2430
  35. Van der Geyten S, Sanders JP, Kaptein E, Darras VM, Kühn ER, Leonard JL, Visser TJ 1997 Expression of chicken hepatic type I and type III iodothyronine deiodinases during embryonic development. Endocrinology 138:5144–5152[Abstract/Free Full Text]
  36. Sanders JP, van der Geyten S, Kaptein E, Darras VM, Kühn ER, Leonard JL, Visser TJ 1999 Cloning and characterization of type III iodothyronine deiodinase from the fish Oreochromis niloticus. Endocrinology 140:3666–3673[Abstract/Free Full Text]
  37. Tujebajeva RM, Copeland PR, Xu XM, Carlson BA, Harney JW, Driscoll DM, Hatfield DL, Berry MJ 2000 Decoding apparatus for eukaryotic selenocysteine insertion. EMBO Rep 1:158–163[CrossRef][Medline]
  38. Visser TJ, Leonard JL, Kaplan M, Larsen PR 1982 Kinetic evidence suggesting two mechanisms for iodothyronine 5'-deiodination in rat cerebral cortex. Proc Natl Acad Sci USA 79:5080–5084[Abstract/Free Full Text]
  39. Du Mont W-W, Mugesh G, Wismach C, Jones PG 2001 Reactions of organo-selenenyl iodides with thiourea drugs: an enzyme mimetic study on the inhibition of iodothyronine deiodinase. Angew Chem Int Ed Engl 40:2486–2489[CrossRef][Medline]
  40. Kuiper GGJM, Klootwijk W, Visser TJ 2002 Substitution of cysteine for a conserved alanine residue in the catalytic center of type II iodothyronine deiodinase alters interaction with reducing cofactor. Endocrinology 143:1190–1198[Abstract/Free Full Text]
  41. Berry MJ, Maia AL, Kieffer JD, Harney JW, Larsen PR 1992 Substitution of cysteine for selenocysteine in type 1 iodothyronine deiodinase reduces the catalytic efficiency of the protein but enhances its translation. Endocrinology 131:1848–1852[Abstract]
  42. Buettner C, Harney JW, Larsen PR 2000 The role of selenocysteine 133 in catalysis by the human type 2 iodothyronine deiodinase. Endocrinology 141:4606–4612[Abstract/Free Full Text]
  43. Visser TJ, Docter R, Hennemann G 1977 Radioimmunoassay of reverse triiodothyronine. J Endocrinol 73:395–399[Medline]
  44. Mol JA, Docter R, Kaptein E, Jansen G, Hennemann G, Visser TJ 1984 Inactivation and affinity labeling of rat liver iodothyronine deiodinase with N-bromoacetyl-3, 3', 5-triiodothyronine. Biochem Biophys Res Commun 124:475–483[CrossRef][Medline]
  45. Sambrook J, Russell DW 2001 In vitro mutagenesis using double-stranded DNA templates: selection of mutants with DpnI. In: Molecular cloning, a laboratory manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press; 1319–1325
  46. Sheibani N, Frazier WA 1997 Miniprep DNA isolation for automated sequencing of multiple samples. Anal Biochem 250:117–119[CrossRef][Medline]
  47. Gluzman Y 1981 SV40-transformed simian cells support the replication of early SV40 mutants. Cell 23:175–182[CrossRef][Medline]
  48. Schneppenheim R, Budde U, Dahlmann N, Rautenberg P 1991 Luminography—a new highly sensitive visualization method for electrophoresis. Electrophoresis 12:367–372[CrossRef][Medline]
  49. Cahnmann HJ, Gonsalves E, Ito Y, Fales HM, Sokoloski EA 1992 Synthesis and properties of N-bromoacetyl-L-thyroxine. Anal Biochem 204:344–350[CrossRef][Medline]
  50. Schoenmakers CHH, Pigmans IGAJ, Visser TJ 1992 Species differences in liver type I iodothyronine deiodinase. Biochim Biophys Acta 1121:160–166[CrossRef][Medline]
  51. Schoenmakers CHH, Pigmans IGAJ, Visser TJ 1995 Investigation of type I and type III iodothyronine deiodinases in rat tissues using N-bromoacetyl-iodothyronine affinity labels. Mol Cell Endocrinol 107:173–180[CrossRef][Medline]
  52. Schoenmakers CH, Pigmans IG, Kaptein E, Darras VM, Visser TJ 1993 Reaction of the type III iodothyronine deiodinase with the affinity label N-bromoacetyl-triiodothyronine. FEBS Lett 335:104–108[CrossRef][Medline]
  53. Gromer S, Arscott LD, Williams CH, Schirmer RH, Becker K 1998 Human placenta thioredoxin reductase—isolation of the selenoenzyme, steady state kinetics, and inhibition by therapeutic gold compounds. J Biol Chem 273:20096–20101[Abstract/Free Full Text]
  54. Rocher C, Lalanne J-L, Chaudiere J 1992 Purification and properties of a recombinant sulfur analog of murine selenium-glutathione peroxidase. Eur J Biochem 205:955–960[Medline]
  55. Maiorino M, Aumann K-D, Brigelius-Flohe R, Doria D, van den Heuvel J, McCarthy J, Roveri A, Ursini F, Flohé L 1995 Probing the presumed catalytic triad of selenium-containing peroxidases by mutational analysis of phospholipid hydroperoxide glutathione peroxidases. Biol Chem Hoppe Seyler 376:651–660[Medline]
  56. Axley MJ, Böck A, Stadtman TC 1991 Catalytic properties of an Escherichia coli formate dehydrogenase mutant in which sulfur replaces selenium. Proc Natl Acad Sci USA 88:8450–8454[Abstract/Free Full Text]
  57. Huber RE, Criddle RS 1967 Comparison of the chemical properties of selenocysteine and selenocystine with their sulfur analogs. Arch Biochem Biophys 122:164–173[CrossRef][Medline]
  58. Zhong L, Holmgren A 2000 Essential role of selenium in the catalytic activities of mammalian thioredoxin reductase revealed by characterization of recombinant enzymes with selenocysteine mutations. J Biol Chem 275:18121–18128[Abstract/Free Full Text]
  59. Lee SR, Bar-Noy S, Kwon J, Levine RL, Stadtman TC, Rhee SG 2000 Mammalian thioredoxin reductase: oxidation of the C-terminal cysteine-selenocysteine active site forms a thioselenide, and replacement of selenium with sulfur markedly reduces catalytic activity. Proc Natl Acad Sci USA 97:2521–2526[Abstract/Free Full Text]
  60. Berry M, Kieffer JD, Harney JW, Larsen PR 1991 Selenocysteine confers the biochemical properties characteristic of the type I iodothyronine deiodinase. J Biol Chem 266:14155–14158[Abstract/Free Full Text]
  61. Mugesh G, du Mont WW, Wismach C, Jones PG 2002 Biomimetic studies on iodothyronine deiodinase intermediates: modeling the reduction of selenenyl iodide by thiols. Chem Biochem 3:440–447
  62. Ren B, Huang W, Akesson B, Ladenstein R 1997 The crystal structure of seleno-glutathione peroxidase from human plasma at 2.9 Å resolution. J Mol Biol 268:869–885[CrossRef][Medline]
  63. Mol JA, Docter R, Hennemann G, Visser TJ 1984 Modification of rat liver 5'-deiodinase activity with diethylpyrocarbonate and rose bengal: evidence for an active site histidine residue. Biochem Biophys Res Commun 120:28–36[CrossRef][Medline]
  64. Berry MJ 1992 Identification of essential histidine residues in rat type I iodothyronine deiodinase. J Biol Chem 267:18055–18059[Abstract/Free Full Text]
  65. Hennemann G, Visser TJ 1997 Thyroid hormone synthesis, plasma membrane transport, and metabolism. Handbook Exp Pharmacol 128:76–117
  66. Köhrle J, Rasmussen UB, Ekenbarger DB, Alex S, Rokos H, Hesch RD, Leonard JL 1990 Affinity labeling of rat liver and kidney type I 5'-deiodinase. J Biol Chem 265:6155–6163[Abstract/Free Full Text]
  67. Santini F, Chopra IJ, Hurd RE, Solomon DH, Chua Teco GN 1992 A study of the characteristics of the rat placental iodothyronine 5-monodeiodinase: evidence that it is distinct from the rat hepatic iodothyronine 5'-monodeiodinase. Endocrinology 130:2325–2332[Abstract]
  68. Baqui M, Botero D, Gereben B, Curcio C, Harney JW, Salvatore D, Sorimachi K, Larsen PR, Bianco AC 2003 Human type 3 iodothyronine selenodeiodinase is located in the plasma membrane and undergoes rapid internalization to endosomes. J Biol Chem 278:1206–1211[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 Mol. Endocrinol.Home page
E. C. H. Friesema, J. Jansen, J.-w. Jachtenberg, W. E. Visser, M. H. A. Kester, and T. J. Visser
Effective Cellular Uptake and Efflux of Thyroid Hormone by Human Monocarboxylate Transporter 10
Mol. Endocrinol., June 1, 2008; 22(6): 1357 - 1369.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
J. Jansen, E. C. H. Friesema, M. H. A. Kester, C. E. Schwartz, and T. J. Visser
Genotype-Phenotype Relationship in Patients with Mutations in Thyroid Hormone Transporter MCT8
Endocrinology, May 1, 2008; 149(5): 2184 - 2190.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Endocrinol.Home page
E. C. H. Friesema, G. G. J. M. Kuiper, J. Jansen, T. J. Visser, and M. H. A. Kester
Thyroid Hormone Transport by the Human Monocarboxylate Transporter 8 and Its Rate-Limiting Role in Intracellular Metabolism
Mol. Endocrinol., November 1, 2006; 20(11): 2761 - 2772.
[Abstract] [Full Text] [PDF]

Home page
 Eur J EndocrinolHome page
A. Alkemade, E. C Friesema, G. G Kuiper, W. M Wiersinga, D. F Swaab, T. J Visser, and E. Fliers
Novel neuroanatomical pathways for thyroid hormone action in the human anterior pituitary.
Eur. J. Endocrinol., March 1, 2006; 154(3): 491 - 500.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
D. E. Handy, G. Hang, J. Scolaro, N. Metes, N. Razaq, Y. Yang, and J. Loscalzo
Aminoglycosides Decrease Glutathione Peroxidase-1 Activity by Interfering with Selenocysteine Incorporation
J. Biol. Chem., February 10, 2006; 281(6): 3382 - 3388.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
A. Boelen, J. Kwakkel, A. Alkemade, R. Renckens, E. Kaptein, G. Kuiper, W. M. Wiersinga, and T. J. Visser
Induction of Type 3 Deiodinase Activity in Inflammatory Cells of Mice with Chronic Local Inflammation
Endocrinology, December 1, 2005; 146(12): 5128 - 5134.
[Abstract] [Full Text] [PDF]

Home page
 J. Clin. Endocrinol. Metab.Home page
A. Alkemade, E. C. Friesema, U. A. Unmehopa, B. O. Fabriek, G. G. Kuiper, J. L. Leonard, W. M. Wiersinga, D. F. Swaab, T. J. Visser, and E. Fliers
Neuroanatomical Pathways for Thyroid Hormone Feedback in the Human Hypothalamus
J. Clin. Endocrinol. Metab., July 1, 2005; 90(7): 4322 - 4334.
[Abstract]