help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by van den Hurk, M. J. J.
Right arrow Articles by Jenks, B. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by van den Hurk, M. J. J.
Right arrow Articles by Jenks, B. G.
Endocrinology Vol. 144, No. 6 2524-2533
Copyright © 2003 by The Endocrine Society

Expression and Characterization of the Extracellular Ca2+-Sensing Receptor in Melanotrope Cells of Xenopus laevis

M. J. J. van den Hurk, D. T. W. M. Ouwens, W. J. J. M. Scheenen, V. Limburg, H. Gellekink, M. Bai, E. W. Roubos and B. G. Jenks

Department of Cellular Animal Physiology (M.J.J.V.D.H., D.T.W.M.O., W.J.J.M.S., V.L., H.G., E.W.R., B.G.J.), Institute of Cellular Signalling, Nijmegen Institute for Neurosciences, University of Nijmegen, 6525 ED Nijmegen, The Netherlands; and Endocrine-Hypertension Division (M.B.), Brigham and Women’s Hospital, Boston, Massachusetts 02115

Address all correspondence and requests for reprints to: M. J. J. van den Hurk, Department of Cellular Animal Physiology, University of Nijmegen, Toernooiveld 1, 6525 ED Nijmegen, The Netherlands. E-mail: mavdhurk{at}sci.kun.nl.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The extracellular Ca2+-sensing receptor (CaR) is expressed in many different organs in various species, ranging from mammals to fish. In some of these organs, this G protein-coupled receptor is involved in the control of systemic Ca2+ homeostasis, whereas in other organs its role is unclear (e.g. in the pituitary gland). We have characterized the CaR in the neuroendocrine melanotrope cell of the intermediate pituitary lobe of the South African clawed toad Xenopus laevis. First, the presence of CaR mRNA was demonstrated by RT-PCR and in situ hybridization. Then it was shown that activation of the CaR by an elevated extracellular Ca2+ concentration and different CaR-activators, including L-phenylalanine and spermine, stimulates both Ca2+ oscillations and secretion from the melanotrope. Furthermore, it was revealed that activation of the receptor stimulates Ca2+ oscillations through opening of voltage-operated Ca2+ channels in the plasma membrane of the melanotropes. Finally, it was shown that the CaR activator L-phenylalanine could induce the biosynthesis of proopiomelanocortin in the intermediate lobe. Thus, in this study it is demonstrated that the CaR is present and functional in a defined cell type of the pituitary gland, the amphibian melanotrope cell.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
THE EXTRACELLULAR Ca2+-SENSING receptor (CaR) is a G protein-coupled receptor, originally cloned from bovine parathyroid cells (1), which plays an important role in the maintenance of the systemic Ca2+ homeostasis. Through this receptor the extracellular Ca2+ concentration ([Ca2+]e) can act as an extracellular first messenger that controls target organs that are involved in regulation of the [Ca2+]e, such as the parathyroid, thyroid, kidney, skeleton, and intestine (2). Interestingly, the CaR is also expressed in cells that do not have well established roles in the control of the [Ca2+]e, such as cells of the pancreas, lens, brain, and pituitary gland (2). In many of these cell types, the physiological role of the CaR is unclear. In the adult rat, the CaR is present in numerous regions of the brain at various degrees of expression (3, 4, 5). The highest expression levels are found in the subfornical organ, olfactory bulb, hippocampus, hypothalamus, and cerebellum (4). Brain expression of the CaR is not restricted to neurons because the receptor also occurs in oligodendrocytes, microglia, and astrocytes (6, 7, 8).

In the pituitary gland, expression of the CaR has been shown in nerve terminals of the pars nervosa (PN; Ref. 3), unidentified cells of the pars distalis (5, 9), and pituitary tumor cell lines such as murine ACTH-secreting AtT-20 cells and human GH-secreting pituitary adenomas (10, 11, 12). Recently it was reported that elevated [Ca2+]e has cell-specific effects on intracellular Ca2+ levels and hormone secretion in somatotropes, lactotropes, and gonadotropes (13), but whether these effects are due to activation of the CaR is unclear. Thus, a definite identification and functional characterization of the CaR in an identified pituitary cell type has not yet been accomplished.

To investigate the presence and functioning of the CaR in a specific cell type of the pituitary gland, we studied the melanotrope cell of the pituitary pars intermedia of the South African clawed toad Xenopus laevis. Xenopus melanotropes produce and release {alpha}-melanophore-stimulating hormone ({alpha}-MSH), which enables this amphibian to adapt its skin color to the gray intensity of its background (for review, see 14). The secretion of {alpha}-MSH is driven by spontaneously occurring Ca2+ oscillations, which are generated at the plasma membrane by opening of voltage-operated Ca2+ channels (15, 16). Secretion from this neuroendocrine transducer cell is regulated by various factors, both neuropeptides and classical neurotransmitters (14). In addition, we found that the secretory activity of the melanotrope cell is particularly sensitive to the concentration of extracellular Ca2+, an observation that prompted us to examine whether the cell possesses the CaR. In the present study, we first established with RT-PCR, using primers designed on the Xenopus CaR gene sequence (M. Bai, unpublished observations), that cells of the Xenopus neurointermediate lobe express the CaR. Using in situ hybridization, we further showed that this expression occurs in intermediate lobe melanotropes. Finally, the actions of this receptor on Ca2+ signaling dynamics and biosynthetic and secretory processes in this cell were studied.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animals
Young adult (aged 6 months) X. laevis were bred and reared under standard conditions in the aquatic facility of our Department of Animal Physiology, University of Nijmegen. Before the experiments, the animals were adapted to a white or black background for 3 wk, under constant illumination, at 22 C. All experiments were carried out under the guidelines of the Dutch law concerning animal welfare.

RNA extraction and cDNA synthesis
Freshly dissected neurointermediate lobes (NILs) and pars distalis (PD) of the pituitary gland were individually collected in 500 µl ice-cold Trizol (Life Technologies, Inc., Paisley, UK) and homogenized by sonification. After chloroform extraction and isopropyl alcohol precipitation, RNA was dissolved in 30 µl RNase-free H2O. Total RNA was measured with a biophotometer (Vaudaux-Eppendorf AG, Basel, Switzerland). First-strand cDNA synthesis was performed with 1 µg RNA and 5 mU/µl random primers (Roche, Mannheim, Germany) at 70 C for 10 min, followed by double-strand synthesis in strand buffer (Life Technologies, Inc.) with 10 mM dithiothreitol, 20 U Rnasin (Promega Corp., Madison, WI), 0.5 mM deoxynucleotide triphosphates (dNTPs; Roche), and 100 U Superscript II reverse transcriptase (Life Technologies, Inc.) at 37 C for 75 min and 95 C for 10 min.

PCR
PCR was performed in a total volume of 25 µl in a buffer solution containing 5 µl template cDNA, 3 mM MgCl2, 0.625 U FastStart Taq DNA polymerase (Roche), 0.25 mM dNTPs (Roche), and 0.3 mM of each primer. Primers for the CaR were designed on the basis of the X. laevis sequence (Bai, M., unpublished observations). The following primer pair (Biolegio, Malden, The Netherlands) was used: forward primer 5'-AGAGCTCAGAAGAAGGGAGA-'3, reverse primer 5'-TTAGGAGTCGGCTTGATGAG-'3 (product size: 450 bp). The optimum temperature cycling protocol was determined to be 95 C for 10 min followed by 40 reaction cycles of 95 C for 30 sec, 58 C for 30 sec, and 72 C for 2 min, using a programmable thermal cycler (Mastercycler gradient, Eppendorf, Hamburg, Germany). After PCR, the reaction products were run on a 2% agarose gel and visualized with ethidium bromide to check the length of the amplified DNA.

Real-time quantitative PCR
Real-time quantitative PCR was performed in a total volume of 25 µl in a buffer solution containing 5 µl template cDNA, 1x SYBR Green buffer (Applied Biosystems, Foster City, CA), 3 mM MgCl2, 0.625 U AmpliTaq Gold (Applied Biosystems), 0.2 mM dNTPs (Applied Biosystems), and 0.6 µM of each primer. For the CaR the same primer set as for RT-PCR was used. Primers for the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were designed using Vector NTI Suite (InforMax, Bethesda, MD) and PrimerExpress (Applied Biosystems) software based on the Xenopus cDNA sequence (accession no. U41753) for GAPDH. The following primer pair (Biolegio) was used: 5'-GCCGTGTATGTGGTGGAATCT-3' and 5'-AAGTTGTCGTTGATGACCTTTGC-3' (product size: 230 bp). The optimum temperature cycling protocol was determined to be 95 C for 10 min followed by 40 reaction cycles of 95 C for 15 sec and 60 C for 1 min, using a 5700 GeneAmp PCR system (Applied Biosystems). For each reaction, the cycle threshold (Ct) was determined, i.e. the cycle number at which fluorescence was detected above an arbitrary threshold (0.8). At this threshold Ct values are within the exponential phase of the amplification. To compare the relative amounts of CaR mRNA in NILs from black- vs. white-adapted animals, Ct values were normalized to those for GAPDH by subtracting the Ct values for the CaR from the Ct values for GAPDH.

In situ hybridization
The 450-bp PCR fragment was subcloned in a pGEMT plasmid (Promega Corp.) to generate mRNA probes. After linearization of the plasmid with SalI or NcoI (Roche), digoxigenin (DIG)-uridine 5-triphosphate-labeled antisense and sense probes were prepared as run-off transcripts, using SP6 and T7 RNA polymerases (Roche), respectively. The sequence of the X. laevis CaR sense probe was the following: 5'-AGAAGAAGGGAGACATTATACTGGGTGGGCTTTTCCCCATACAT TTCGGGGTGGCTTCCAAGGACGAG GATCTGGAATCAAGGCCTGAATC ACTTGAGTGTGTCCGATACAATT TCCGTGGATTTCGCTGGTTGAAGG CAATGATCTTTGCTATAGA GGAAATTAACAGC TCCCCTACACTCCTC CCCAACATCACTCTG GGCTACAGAATCTT TGACACGTGCAA CACAGTATCCAAGG CTCTAGAGGCCACCCTCAGCTTTG TAGCTCAGAATAAAATTGACT CCCTAAATCTGGATGA GTTCTGTAATTGTTCAGAGC ATATGCCCTCCACAATTGC CGTGGTAGGAGCCACAGGAT CCGGCGTTTCCACTGCAGTGGCA AATCTGCTTGGACTCTTTC ACATTCCTCAGGTTAGTTACGCCT CATCAAGCCGCACTCCTAAACA-3'.

Brains and pituitary glands were dissected and fixed in Bouin’s fixative, dehydrated through a graded series of ethanol, treated with xylene, and embedded in paraplast. Tissue sections (7 µm) were mounted on poly-L-lysine-coated slides, deparaffinated in xylene, and rehydrated in isopropanol and ethanol. Tissue penetration was enhanced by incubation in 0.1% pepsin in 0.2 N HCl for 15 min at 37 C. After fixation in 3.7% formaldehyde in PBS for 5 min and incubation in 1% hydroxyl ammonium chloride for 15 min, tissue sections were dehydrated in 100% ethanol and air dried. Hybridization was performed overnight at 55 C in hybridization buffer containing 10% sodium dextran sulfate, 50% formamide, 4x sodium chloride citrate (SCC) buffer (1x SCC: 0.15 M NaCl, 15 mM sodium citrate; pH 7.0), 1x Denhardt’s, and 200 µg/ml yeast tRNA, with 450 ng/ml sense or antisense DIG-labeled CaR RNA probe. After stringency washes in 2x SCC, 1x SCC, 0.5x SCC for 30 min and 0.1x SCC for 30 min at 37 C, the sections were rinsed for 10 min in Tris-buffered saline (TBS) buffer (100 mM Tris, 150 mM NaCl, pH 7.5), blocked in blocking solution consisting of 2% normal goat serum (homemade), 1% BSA (Sigma, St. Louis, MO) in TBS for 30 min, and incubated in alkaline phosphatase (AP)-conjugated sheep anti-DIG Fab fragments (1:500; Roche) in blocking solution for 16 h at 4 C. After three washes of 10 min in TBS and one wash of 5 min in AP buffer (100 mM Tris, 100 mM NaCl, 50 mM MgCl2, pH 9.5), sections were stained in 350 µg/ml 4-nitro blue tetrazolium chloride (Roche) and 175 µg/ml X-phosphate (Roche) in AP buffer until color development was sufficient.

Cell preparation
Animals were anesthetized with a solution containing 1 g/liter MS222 (Sigma) and 1.5 g/liter NaHCO3. Blood cells were removed by perfusion with Xenopus Ringer’s solution (112 mM NaCl, 2 mM KCl, 2 mM CaCl2, 15 mM Ultral-HEPES, 2 mg/ml glucose, pH 7.4) containing 0.25 mg/ml MS222. NILs were dissected and collected in 1 ml X. laevis Leibovitz’s culture medium (XL15) [containing 67% Leibovitz’s culture medium, (Life Technologies, Inc.), 10 mg/ml kanamycin (Life Technologies, Inc.), 10 mg/ml antibiotic/antimitotic (Life Technologies, Inc.), 2 mM CaCl2, 10 mM glucose, pH 7.4]. After washing four times with XL15, NILs were incubated for 45 min in 1 ml Ringer’s solution without CaCl2, containing 0.25% trypsin (Life Technologies, Inc.). For Ca2+ oscillation studies, trypsin action was stopped by adding 9 ml XL15 containing 10% fetal calf serum (FCS; Life Technologies, Inc.). For secretion studies trypsin action was stopped by adding 9 ml lysine-free XL15 containing 10% dialyzed FCS. Cells were dispersed by gentle trituration using a siliconized Pasteur’s pipette. The suspension was filtered through nylon gauze (pore size 58 µm) to remove undissociated tissue, and cells were collected by centrifugation (50 g, 10 min). For Ca2+ oscillation studies, the pellet was resuspended in XL15, and the cells were pipetted onto the middle of a LabTek chambered coverglass (Nalge Nunc International, Naperville, IL) coated with poly-L-lysine. For secretion studies, the pellet was resuspended in lysine-free XL15 containing 250 µCi 3H-lysine (Amersham, Buckinghamshire, UK), and the cells were pipetted onto a Ø15 mm coverglass (Menzel-Gläser, Braunschweig, Germany) coated with poly-L-lysine. After the cells had been allowed to attach for 1 h, they were cultured for 2 d at 22 C in a humidified atmosphere in XL15/10% FCS for Ca2+ oscillation studies and in lysine-free XL15 containing 10% dialyzed FCS for secretion studies.

Secretion studies
Following 2 d of incubation, 3H-lysine-labeled cells were rinsed four times in Ringer’s solution containing 2 mg/ml glucose, 0.3 mg/ml BSA, and 1 µg/ml ascorbic acid. The coverslips were transferred to 4-well culture dishes (Nunclon, Roskilde, Denmark) and superfused with Ringer’s solution for at least 1.5 h before measurements. Ringer’s solution was pumped over the cells at a rate of 0.5 ml/h. At specific time points, L-phenylalanine (Merck, Darmstadt, Germany), D-phenylalanine (Sigma), spermine (Sigma), and nickel chloride (Acros Organics, Geel, Belgium) were added to the superfusion medium, following the protocol given in Results. Fractions of 2 min were collected, 160 µl scintillation fluid (Optiphase Supermix, Wallac, Inc., Loughborough, UK) was added, and the amount of scintillation was measured with a 1450 MicroBeta liquid scintillation ß-counter (Wallac, Inc.). Data were collected with MicroBeta software (Wallac, Inc.) and further processed in Excel (Microsoft Corp., Redmond, WA). The average amount of radioactivity in the first 20 fractions was set at 100%, and the amount of radioactivity of all other fractions was expressed relative to this value. The values of the separate experiments were averaged and plotted against time. The area under the peak was integrated with Origin 6.0 (Microcal Software Inc., Northampton, MA). It has previously been shown that about 30–50% of the radioactivity in the superfusate is unincorporated 3H-lysine, and approximately 50–70% reflects the secretion of radiolabeled proopiomelanocortin (POMC)-derived peptides (17).

Ca2+ oscillation studies
Following 3 d of incubation, cells were washed with Ringer’s solution and subsequently loaded for 30 min with 20 µM fura-2 AM (Molecular Probes, Inc., Eugene, OR) and 1 µM Pluronic F127 (Molecular Probes, Inc.) in Ringer’s solution. After loading, the cells were again washed with Ringer’s solution, placed under an inverted microscope (Axiovert 135 TV, Zeiss, Göttingen, Germany), and connected to a superfusion system. Ringer’s solution was pumped over the cells at a rate of 0.6 ml/min. At specific time points, L-phenylalanine, D-phenylalanine, spermine, and nickel chloride were added to the superfusion medium, following the protocol given in Results. The cells were magnified using an x40 oil-immersion objective (Fluar, Zeiss) and areas of interest were selected. For Ca2+ measurements, every 6 sec the fura-2 probe was alternately excited with light of 340 and 380 nm during 50 msec. The excitation light (340/380 nm) was generated by a 150-W Xenon lamp (UXL S150, Ushio, Cypress, CA) connected to a monochromator (Polychrome IV, Till Photonics, Martinred, Germany). The emission light was filtered (Photonics LP440 filter) and collected with a monochrome digital camera (Coolsnap fx, Roper Scientific, Tucson, AZ). Data were collected with Metafluor imaging software (Universal Imaging Corp., Downingtown, PA) and further processed in Origin 6.0 (Microcal Software Inc.). Changes in intracellular Ca2+ concentrations were measured as changes in the ratio of 340/380 nm fluorescence intensity.

POMC biosynthesis studies
After dissection, NILs were collected in XL15 culture medium, rinsed several times, and then incubated in 4-well culture dishes (Nunclon), each containing 0.5 ml incubation medium, for 3 d at 22 C. For the control lobes, incubation medium consisted of XL15 with 10% FCS. For the experimental groups, 1 µM neuropeptide Y (NPY; Bachem, Basel, Switzerland) was added to the incubation medium. Media were refreshed every day. On the second day, 5 mM L-phenylalanine was added to the incubation medium of one experimental group. After 24 h, all lobes were pulse labeled in 10 µl Ringer’s solution containing 10 µCi 3H-lysine in a 72-well plate (Nunclon) for 15 min. NILs were washed and lysed by boiling in sample buffer for 10 min. Proteins were separated on a 12% SDS-polyacrylamide gel using 20% of each lobe extract. Gels were fixed in 40% methanol and 10% acetic acid, saturated in 100% dimethylsulfoxide, and treated with 2% 2,5-diphenyloxazol in dimethylsulfoxide for visualization of radioactivity, followed by exposure to x-ray film (Eastman Kodak Co., Rochester, NY). Signals were quantified with a GS-700 densitometer (Bio-Rad Laboratories, Inc., Hercules, CA) using Molecular Analyst software (Bio-Rad Laboratories, Inc.).

Statistics
Quantitative data were analyzed by a t test ({alpha} = 5%) using Excel software (Microsoft Corp.).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Expression of CaR mRNA in melanotrope cells of the pars intermedia
RT-PCR and in situ hybridization were used to assess the specific expression of CaR mRNA in the pituitary gland of X. laevis. RT-PCR with a primer set specific for the Xenopus CaR yielded a product with the expected size of 450 bp in both the NIL and PD (Fig. 1Go). The sequence given in Materials and Methods confirmed that this product indeed represented the CaR. In situ hybridization with the antisense CaR mRNA probe showed staining in most of the melanotrope cells of the pars intermedia, whereas no staining was found in the PN (Fig. 2Go, C and E). In the PD some endocrine cells showed strong staining, whereas others showed moderate or no staining (Fig. 2DGo). Furthermore, neurons of the preoptic nucleus of the diencephalon were strongly stained (Fig. 2Go, A and B). With the sense CaR mRNA probe, no staining was found.



View larger version (55K):
[in this window]
[in a new window]
 
Figure 1. Expression of CaR mRNA in the pituitary gland of black-adapted X. laevis. Agarose gel electrophoresis shows the reaction products of RT-PCR performed on total RNA from two NILs (lane 1 and 2) and two PDs (lane 3 and 4), with primers specific for the Xenopus CaR.

 


View larger version (196K):
[in this window]
[in a new window]
 
Figure 2. In situ hybridization of CaR mRNA in the brain (A and B) and in the pituitary gland; PI, pars intermedia (C and E), and PD (D) of X. laevis. Bars: A, C, and D, 50 µm; B, 30 µm; and E, 20 µm.

 
To investigate whether the degree of expression of the CaR can be affected during physiological adaptations of X. laevis, we used real-time quantitative RT-PCR to determine whether there is a difference in mRNA levels of the CaR between NILs from white- and black-adapted animals. The Ct values for the CaR were normalized to the Ct values for the housekeeping protein GAPDH. No significant difference was found between the normalized Ct values for the CaR in NILs of white-adapted animals ({Delta}Ct = 8.08 ± 0.20; n = 3), compared with black-adapted ones ({Delta}Ct = 8.14 ± 0.24; n = 3).

Effect of changes in the [Ca2+]e on secretion and Ca2+ oscillations
Because Xenopus melanotropes express the CaR (see above), it was determined whether changes in the [Ca2+]e, which is 1–2 mM in the blood of amphibians (18), affect the level of hormone secretion by these cells. The control level of secretion (average value of the first 20 fractions) was set at 100%. Elevating the [Ca2+]e from 2 mM to 3 mM or 5 mM stimulated secretion, as appeared from integrating the area under the peak and expressing this release as a percentage per sampling fraction (Fig. 3Go). Compared with control level, the stimulatory effect by 5 mM Ca2+ (+84.0% ± 12.1%) was higher than that of 3 mM Ca2+ (+50.3% ± 3.6%; P < 0.05; n = 4). In contrast, when the [Ca2+]e was lowered from 2 mM to 1 mM or 0.5 mM, secretion was inhibited (Fig. 3Go). The inhibitory effect of 0.5 mM Ca2+ (-60.4% ± 2.2%) was stronger than that of 1 mM Ca2+ (-33.1% ± 3.1%; P < 0.01; n = 4). Similarly, compared with control level, the maximal stimulation of secretion under 5 mM Ca2+ (+125.7% ± 36.6%) was higher than that of 3 mM Ca2+ (+34.2% ± 3.6%; P < 0.05; n = 4), and the maximal inhibition by 0.5 mM Ca2+ (-37.6% ± 0.6%) was stronger than that by 1 mM Ca2+ (-25.0% ± 1.5%; P < 0.01; n = 4).



View larger version (17K):
[in this window]
[in a new window]
 
Figure 3. Effects of changing the [Ca2+]e from 2 mM to 5 mM, 3 mM, 1 mM, or 0.5 mM on the release of radioactivity from 3H-lysine-labeled melanotropes of black-adapted X. laevis. The average amount of radioactivity in the first 20 fractions was set at 100%, and the amount of radioactivity of all other fractions was expressed relative to this value. The values of the separate experiments were averaged and plotted against time. Mean values - SEM of separate superfusion experiments are shown (n = 4).

 
Also, the effects of changes in the [Ca2+]e on intracellular Ca2+ oscillations were studied. The melanotrope cells showed considerable heterogeneity in their responses to the changes in the [Ca2+]e. Elevating the [Ca2+]e from 2 mM to 3 mM strongly stimulated the frequency of the oscillations in 89% of the cells, with an average increase of +69.3% ± 13.6% (P < 0.01; n = 17; Fig. 4Go), whereas in two cells broader oscillations were induced. When the [Ca2+]e was elevated from 2 mM to 5 mM, an initial transient increase followed by a plateau of elevated Ca2+ signaling or broader oscillations was induced in 92% of the cells (n = 35; Fig. 4Go), whereas in 8% of the cells, the frequency of the oscillations was stimulated, with an average increase of +63.6% ± 16.0% (P < 0.01, n = 3). Lowering the [Ca2+]e from 2 mM to 1 mM, decreased the frequency of the oscillations in 67% of the cells, with an average decrease of -21.6% ± 5.1% (P < 0.01; n = 12; Fig. 4Go). In addition, in two cells the amplitude of the oscillations was lowered, in two other cells oscillations were narrower, and in two cells no effect was observed. When the [Ca2+]e was lowered from 2 mM to 0.5 mM, oscillations were completely or nearly completely abolished in nine cells (Fig. 4Go). In these cells, only changes in the basal Ca2+ levels were seen. In two other cells, the frequency of the oscillations was decreased.



View larger version (39K):
[in this window]
[in a new window]
 
Figure 4. Effect of changing the [Ca2+]e from 2 mM to 5 mM, 3 mM, 1 mM, or 0.5 mM on the Ca2+ oscillations of dispersed melanotropes of black-adapted X. laevis. For each treatment the result of a representative cell is shown. Changes in intracellular Ca2+ concentrations were measured as changes in the ratio of 340/380 nm fluorescence intensity.

 
CaR activators stimulate secretion and Ca2+ oscillations
To further test the specific involvement of the CaR in regulating secretion and Ca2+ dynamics of the melanotropes, the action of different activators of the CaR was examined. The CaR can be activated allosterically by calcimimetics (R-467, NPS Pharmaceuticals, Inc., Salt Lake City, UT) and L-phenylalanine, in the presence of extracellular Ca2+ at millimolar levels (19, 20). Furthermore, other CaR activators are polyamines, such as spermine and neomycin (21). Different concentrations of L-phenylalanine and spermine were added to melanotropes in the presence of 2 mM CaCl2. L-Phenylalanine had no effect on radiolabeled peptide secretion at a concentration of 5 x 10-6 M, but increasing the concentration to 5 x 10-5 M and 5 x 10-4 M stimulated secretion in a dose-dependent way by 13.6% ± 0.6% and 25.7% ± 2.2%, respectively (Fig. 5AGo). Further increasing the concentration to 5 x 10-3 M and 5 x 10-2 M had no additional stimulatory effect on secretion, indicating that 5 x 10-4 M L-phenylalanine was evoking a maximal response. Furthermore, it has been shown that the amino acids have a stereo selective effect on the CaR in which the L-form is more effective in activating the CaR than the D-form (19). Indeed, in the presence of 2 mM, Ca2+ addition of 0.5 mM L-phenylalanine to melanotropes had a stronger maximal stimulatory effect on peptide secretion (40.4% ± 2.6%) than addition of 0.5 mM D-phenylalanine (17.8% ± 0.6%; P < 0.01; n = 4; Fig. 5BGo). Also spermine had a dose-dependent stimulatory effect on peptide secretion (Fig. 5CGo). The minimum effective concentration of spermine was 5 x 10-6 M and led to a stimulation of 21.2% ± 2.9%. Further increasing the concentration to 5 x 10-5 M and 5 x 10-4 M stimulated secretion by 42.6% ± 2.7% and 110.7% ± 24.3%, respectively. Increasing the concentration further to 5 x 10-3 M resulted in an extremely high response (~900%; not shown). Immediately after administration of the higher concentrations of L-phenylalanine or spermine to the melanotropes secretion was decreased and did not fully return afterward to basal level (Fig. 5Go).



View larger version (28K):
[in this window]
[in a new window]
 
Figure 5. Effects of CaR activators on the release of radioactivity from 3H-lysine-labeled melanotropes of black-adapted X. laevis. A, Effect of different concentrations of L-phenylalanine. B, Effects of 0.5 mM L- and D-phenylalanine. C, Effect of different concentrations of spermine. The average amount of radioactivity in the first 20 fractions was set at 100%, and the amount of radioactivity of all other fractions was expressed relative to this value. Mean values - SEM of separate superfusion experiments are shown (n = 4).

 
In Ca2+ imaging studies, the addition of 0.5 mM L-phenylalanine to the melanotropes induced an initial Ca2+ transient followed by a plateau of elevated Ca2+ signaling or broader oscillations in the 15 cells that were studied (Fig. 6AGo). Similarly, 0.5 mM spermine induced an initial Ca2+ transient followed by a plateau of elevated Ca2+ signaling or broader oscillations in 15 cells (Fig. 6CGo), whereas in two cells the frequency of the oscillations was stimulated. Returning to normal Ringer’s solution reintroduced Ca2+ oscillations after a delay of about 5 min. At a concentration of 0.5 mM D-phenylalanine had no effect on Ca2+ oscillations (Fig. 6BGo).



View larger version (35K):
[in this window]
[in a new window]
 
Figure 6. Effects of 0.5 mM L-phenylalanine (A), 0.5 mM D-phenylalanine (B), and 0.5 mM spermine (C) on the Ca2+ oscillations of dispersed Xenopus melanotropes. For each treatment the result of a representative cell is shown. Changes in intracellular Ca2+ concentrations were measured as changes in the ratio of 340/380-nm fluorescence intensity.

 
CaR activators stimulate secretion and Ca2+ oscillations through VOCCs
To investigate whether activation of the CaR stimulates Ca2+ oscillations by stimulating the opening of voltage-operated Ca2+ channels (VOCCs) in the plasma membrane, the effects of elevating [Ca2+]e and administering the CaR activators L-phenylalanine and spermine were studied in the presence of the nonselective VOCC-blocker Ni2+. This analysis included the effects on both melanotrope cell secretion and Ca2+ oscillations. On adding Ni2+ to melanotropes, secretion was immediately inhibited by about 60% (Fig. 7Go, A–C). This in fact represents a complete inhibition of regulated secretion because it has been shown that the absence of Ca2+ influx by blocking VOCC leads to a complete elimination of regulated exocytosis in Xenopus melanotropes (22). Under Ni2+ inhibition, treatment of melanotropes with elevated [Ca2+]e or L-phenylalanine had no effect on secretion, whereas both treatments had strong stimulatory effects in matched control experiments (Fig. 7Go, A and B). In contrast, the stimulatory action of spermine seen in control experiments was not completely reduced under Ni2+ inhibition (Fig. 7CGo). Ca2+ oscillations immediately disappeared upon addition of Ni2+ to melanotropes and treatment of melanotropes with elevated [Ca2+]e, L-phenylalanine, or spermine did not restore the Ca2+ oscillations (Fig. 8Go).



View larger version (22K):
[in this window]
[in a new window]
 
Figure 7. Effects of 5 mM calcium (A), 0.5 mM L-phenylalanine (L-phe; B), and 0.5 mM spermine (C) on the release of radioactivity from 3H-lysine-labeled melanotropes of black-adapted X. laevis inhibited by 5 mM nickel. The average amount of radioactivity in the first 20 fractions was set at 100%, and the amount of radioactivity of all other fractions was expressed relative to this value. The values of the separate experiments were averaged and plotted against time. Mean values - SEM of separate superfusion experiments are shown (n = 4).

 


View larger version (41K):
[in this window]
[in a new window]
 
Figure 8. Effects of 5 mM calcium (A), 0.5 mM L-phenylalanine (L-phe; B), and 0.5 mM spermine (C) on the Ca2+ oscillations of dispersed Xenopus melanotropes inhibited by 5 mM nickel. For each treatment, the result of a representative cell is shown. Changes in intracellular Ca2+ concentrations were measured as changes in the ratio of 340/380-nm fluorescence intensity.

 
The CaR activator L-phenylalanine stimulates POMC biosynthesis
We investigated whether the CaR is able to stimulate the biosynthesis of POMC, the precursor protein of {alpha}-MSH. Melanotrope cells of black-adapted animals are synthesizing POMC at a maximal high rate. To be able to show a possible stimulatory effect of L-phenylalanine on POMC biosynthesis, NILs of black-adapted animals were first inhibited by NPY (23). Subsequently, NILs were incubated with 5 mM L-phenylalanine for 24 h. Following 3H-lysine incorporation and SDS-PAGE, two protein bands with molecular masses of 38.2 and 37.3 kDa were observed (Fig. 9AGo) that represent the protein products of the two POMC genes, POMC-A and POMC-B (24). Incubation of NILs with 1 µM NPY resulted in a 7-fold decrease in POMC biosynthesis, compared with control lobes (Fig. 9BGo). Incubation of NPY-treated NILs with 5 mM L-phenylalanine for 24 h slightly stimulated POMC biosynthesis (Fig. 9BGo). Statistical analysis showed that the amount of 3H-lysine-labeled POMC in the L-phenylalanine and NPY-treated NILs (5.6 ± 0.6) was significantly higher than in the NPY-treated NILs (3.2 ± 0.5; P < 0.01; n = 6).



View larger version (30K):
[in this window]
[in a new window]
 
Figure 9. Effect of L-phenylalanine (L-phe) on POMC biosynthesis of NILs inhibited by NPY. The autoradiography (A) and corresponding OD (B) of 3H-lysine incorporation in POMC in extracts of NILs from black-adapted animals (control) after incubation with 1 µM NPY or 1 µM NPY + 5 mM L-phe (NPY+L-phe) are shown. Bars represent mean value of OD after background subtraction + SEM of 3H-lysine-labeled protein bands exposed to a film. OD is expressed as arbitrary units (a.u.) and represents the amount of POMC biosynthesis. Asterisk indicates statistically significant difference (P < 0.01; n = 6).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Changes in [Ca2+]e alter the secretory activity of numerous endocrine cells. Several of these endocrine cells are able to sense changes in the [Ca2+]e by expressing a cell-surface CaR that links the changes in the [Ca2+]e to changes in hormone secretion (2). A number of studies have demonstrated a wide distribution of the CaR in various types of endocrine cells, such as cells of the parathyroid, C cells of the thyroid, {alpha}- and ß-cells of the pancreas, G cells of the stomach, and unspecified cells of the anterior pituitary (for review see Ref. 2). However, the presence of a CaR in melanotrope cells of the pituitary gland has not been established so far. In this study we show by RT-PCR and in situ hybridization that the CaR is also expressed in melanotrope cells of the pars intermedia and in some as-yet-unidentified cells of the PD as well as in the brain of the amphibian X. laevis.

The melanotrope cells of the pars intermedia of X. laevis differ morphologically and physiologically among different states of background adaptation. Melanotropes of black-adapted animals are highly active cells that produce and secrete {alpha}-MSH and therefore contain a well developed biosynthetic apparatus. In contrast, melanotrope cells of white-adapted animals are inactive and produce only low levels of {alpha}-MSH (14). Several studies already demonstrated that the expression levels of certain proteins differ between these states of background adaptation. Several genes are up-regulated in melanotropes in black-adapted animals, compared with white-adapted animals, such as the POMC genes A and B (25) and genes involved in the biosynthesis and regulated release of POMC-derived peptides, such as the POMC cleavage enzyme prohormone convertase 2 (26) and the synaptosomal-associated protein of 25 kDa (27). In contrast, mRNA of the NPY1 receptor has been shown to be more abundant in melanotropes in white-adapted than in black-adapted animals (28). In the present study, we found no significant difference in the amounts of CaR mRNA between NILs from black- and white-adapted animals. This suggests that the expression of this receptor is not under control of the background adaptation process. Whether there is also no difference in the expression of the CaR at the protein level between the different adaptation states needs investigation.

The CaR is known to modulate hormone secretion from various types of endocrine cells. In some of these cells, the CaR inhibits secretion of hormones, such as PTH in parathyroid chief cells (1). In other endocrine cell types, the CaR stimulates hormone release, such as calcitonin in the thyroid C cells (29), gastrin in G cells of the stomach (30), and insulin in pancreatic ß-cells (31). In the pituitary gland, the CaR might potentially regulate hormone secretion because changes in [Ca2+]e are known to alter GH and prolactin release in somatotropes and lactotropes, respectively (13), a phenomenon also demonstrated for pituitary tumor cell lines secreting GH and ACTH (10, 11, 12). In the present study, it was investigated whether changes in the [Ca2+]e have an effect on the secretion of radiolabeled peptides from Xenopus melanotropes. Indeed, elevated [Ca2+]e appears to stimulate the secretory process and lower the [Ca2+]e inhibits secretion, in a dose-dependent way.

In Xenopus melanotropes intracellular Ca2+ signaling is in the form of Ca2+ oscillations, which are generated at the plasma membrane through influx of Ca2+ via {omega}-conotoxin-sensitive VOCCs (32, 33). These oscillations drive the secretion of POMC-derived peptides (15, 16). Therefore, it was investigated whether changes in the [Ca2+]e have an effect on the Ca2+ oscillations in Xenopus melanotropes. In line with the effects on secretion, we showed that in Xenopus melanotropes elevated [Ca2+]e stimulates and lowered [Ca2+]e inhibits Ca2+ oscillations in a dose-dependent way. It is interesting to note that in recent studies with HEK cells transfected with the CaR, elevated [Ca2+]e stimulates and lowered [Ca2+]e inhibits Ca2+ oscillations (34, 35).

The effects of an elevated [Ca2+]e on secretion and Ca2+ oscillations of Xenopus melanotropes can be due to activation of the CaR but could also involve other mechanisms. One possibility is that an elevated [Ca2+]e gives an increased driving force of extracellular Ca2+ across the plasma membrane. As a result, the increased Ca2+ influx might stimulate exocytosis of an increased number of secretory granules. Furthermore, an increased Ca2+ influx might affect Ca2+ oscillations and/or secretion by influencing intracellular enzymes that are sensitive to changes of the intracellular [Ca2+], such as Ca2+/calmodulin protein kinase II (36), adenylyl cyclase (37), and guanylyl cyclase (38). Another possibility is that elevated [Ca2+]e exerts its effect on secretion and Ca2+ oscillations by affecting channels in the plasma membrane that respond to changes in the [Ca2+]e, such as cyclic nucleotide-gated channels (39), Na+ channels (40), and ether-à-go-go-related gene K+ channels (41). To confirm the involvement of the CaR in Ca2+-dependent melanotrope secretion, we studied the effect of two different, specific CaR activators, viz. L-phenylalanine (19, 20) and the polyamine spermine (21). It was demonstrated that both receptor activators stimulate secretion and Ca2+ oscillations, suggesting the presence of a functional CaR in the membrane of these cells and its involvement in the control of Ca2+ oscillation-mediated secretion.

Previous studies have shown that the intracellular Ca2+ oscillations drive the secretion from melanotropes (15, 16). Therefore, it is expected that stimulation of the Ca2+ oscillations would result in a corresponding stimulation of secretion. However, we found that a 20-min administration of 5 mM calcium or the CaR activators L-phenylalanine and spermine to melanotropes induced a stimulatory effect on peptide secretion that is transitory, and the stimulatory effect on the Ca2+ oscillations remains steady during this period. This phenomenon could be due to depletion of a readily releasable pool of secretory granules. We also found that immediately after administration of the CaR activators L-phenylalanine and spermine to melanotropes, secretion was decreased. This phenomenon may be due to desensitization of the CaR as a result of stimulation with a CaR activator. Figure 7Go shows that the stimulatory effect on secretion during the second pulse with 5 mM calcium, L-phenylalanine, or spermine is lower than that of the first pulse. Therefore, it is possible that after multiple pulses with a CaR activator, the CaR becomes less sensitive to the [Ca2+]e in the medium, resulting in a lower level of secretion.

We also investigated the mechanism that underlies the activation of Ca2+ oscillations in Xenopus melanotropes by elevated [Ca2+]e and the CaR activators L-phenylalanine and spermine. In theory, the intracellular [Ca2+] can be increased by two mechanisms (42). First, extracellular Ca2+ can flow into the cytosol by opening of Ca2+ channels in the plasma membrane. Second, Ca2+ can be released into the cytosol from intracellular Ca2+ stores like the endoplasmic reticulum or mitochondria. Previous studies have shown that, in Xenopus melanotropes, Ca2+ oscillations are generated by influx of Ca2+ through opening of {omega}-conotoxin-sensitive VOCCs in the plasma membrane (33). Elevated [Ca2+]e and L-phenylalanine appear to be unable to stimulate Ca2+ influx or secretion when VOCCs have been blocked with Ni2+. This finding indicates that in Xenopus melanotropes the CaR stimulates secretion and Ca2+ oscillations by increasing the influx of extracellular Ca2+ into the cytosol through VOCCs.

It is well established that secretion from melanotropes depends on the presence of Ca2+ oscillations (15, 16). The observation that the CaR activator spermine is still able to stimulate secretion under Ni2+ inhibitions, in the absence of any effect on Ca2+ oscillations, suggests that the stimulatory effect of spermine on secretion under Ni2+-inhibited conditions is a nonphysiological effect, probably not involving the CaR. In contrast, the fact that L-phenylalanine did not stimulate secretion nor Ca2+ oscillations under Ni2+ inhibition, together with the finding that D-phenylalanine had only little effect on secretion and Ca2+ oscillations, indicates that L-phenylalanine is a suitable activator of the CaR in Xenopus melanotropes. This study indicates that L-phenylalanine, besides stimulating secretion, may also promote the biosynthesis of POMC. It is interesting to note that, in mouse pituitary AtT-20PL cells, POMC mRNA expression is up-regulated by polyamine CaR agonists (43).

The question arises as to the physiological significance of the CaR in melanotrope cells of the pars intermedia of X. laevis. Melanotropes and various other cell types that express the CaR, such as ß-cells of the pancreas (31), keratinocytes of the skin (44), epithelial cells of the lens (45), and certain neurons in the brain (3), are seemingly uninvolved in the control of systemic Ca2+ homeostasis. Therefore, melanotrope cells may respond to local changes in the [Ca2+]e rather than to changes in the systemic [Ca2+]. In the pars intermedia, the extracellular space between melanotropes is poorly vascularized and consists of a system of intercellular spaces filled with extracellular fluid (46). Melanotrope cells release their peptidergic secretory material into this extracellular space and because the space is relatively small, it is possible that transient, local increases in the [Ca2+]e have an effect on the cells. Two mechanisms to promote such an increase of the local [Ca2+]e nearby the melanotrope cell can be envisaged. First, Ca2+-ATPases in the plasma membrane may pump large amounts of Ca2+ into the extracellular space (47). Second, during secretion by exocytosis, secretory granules, which contain high concentrations of Ca2+ (up to 125 mM; Ref. 48), release Ca2+ together with peptide hormones into the extracellular space. In either case, the local increase in [Ca2+]e may activate the CaR of the melanotrope cell to further increase its secretory activity. It has recently been shown that agonist-evoked elevation of the [Ca2+]e through such a mechanism activates the CaR of neighboring cells (49). In this way, the CaR may mediate a universal form of intercellular communication that allows cells to be informed about Ca2+ signaling and/or secretory status among neighboring cells. This mechanism might be helpful to let a population of individual endocrine cells act as one integrative unit.

In conclusion, it has been demonstrated that melanotrope cells of X. laevis express mRNA encoding for the CaR and activation of this receptor by elevated [Ca2+]e or CaR activators stimulates secretion and Ca2+ oscillations through opening of VOCCs in the plasma membrane. To our knowledge, this is the first study that identifies and characterizes the action of the CaR in an identified cell type of the pituitary gland, the melanotrope. Therefore, it contributes to the understanding of the functional significance of the presence of the CaR in endocrine cells.


    Acknowledgments
 
The authors are grateful to Ron J. C. Engels for animal care and Peter M. J. M. Cruijsen and Frouwke Kuijpers for technical assistance.


    Footnotes
 
Abbreviations: AP, Alkaline phosphatase; [Ca2+]e, extracellular Ca2+ concentration; CaR, Ca2+-sensing receptor; Ct, cycle threshold; DIG, digoxigenin; dNTP, deoxynucleotide triphosphate; FCS, fetal calf serum; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; {alpha}-MSH, {alpha}-melanophore-stimulating hormone; NIL, neurointermediate lobe; NPY, neuropeptide Y; PD, pars distalis; POMC, proopiomelanocortin; PN, pars nervosa; SCC, sodium chloride citrate; TBS, Tris-buffered saline; VOCC, voltage-operated Ca2+ channel; XL15, Xenopus laevis Leibovitz’s culture medium.

Received January 6, 2003.

Accepted for publication February 21, 2003.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Brown EM, Gamba G, Riccardi D, Lombardi M, Butters R, Kifor O, Sun A, Hediger MA, Lytton J, Hebert SC 1993 Cloning and characterization of an extracellular Ca2+-sensing receptor from bovine parathyroid. Nature 366:575–580[CrossRef][Medline]
  2. Brown EM, MacLeod RJ 2001 Extracellular calcium sensing and extracellular calcium signaling. Physiol Rev 81:239–297[Abstract/Free Full Text]
  3. Ruat M, Molliver ME, Snowman AM, Snyder SH 1995 Calcium sensing receptor: molecular cloning in rat and localization to nerve terminals. Proc Natl Acad Sci USA 92:3161–3165[Abstract/Free Full Text]
  4. Rogers KV, Dunn CK, Hebert SC, Brown EM 1997 Localization of calcium receptor mRNA in the adult rat central nervous system by in situ hybridization. Brain Res 744:47–56[CrossRef][Medline]
  5. Mitsuma T, Rhue N, Kayama M, Mori Y, Adachi K, Yokoi Y, Ping J, Nogimori T, Hirooka Y 1999 Distribution of calcium sensing receptor in rats: an immunohistochemical study. Endocr Regul 33:55–59[Medline]
  6. Chattopadhyay N, Ye CP, Yamaguchi T, Kifor O, Vassilev PM, Nishimura RN, Brown EM 1998 Extracellular calcium-sensing receptor in rat oligodendrocytes: expression and potential role in regulation of cellular proliferation and an outward K+ channel. Glia 24:449–458[CrossRef][Medline]
  7. Chattopadhyay N, Ye CP, Yamaguchi T, Nakai M, Kifor O, Vassilev PM, Nishimura RN, Brown EM 1999 The extracellular calcium-sensing receptor is expressed in rat microglia and modulates an outward K+ channel. J Neurochem 72:1915–1922[CrossRef][Medline]
  8. Chattopadhyay N, Evliyaoglu C, Heese O, Carroll R, Sanders J, Black P, Brown EM 2000 Regulation of secretion of PTHrP by Ca2+-sensing receptor in human astrocytes, astrocytomas, and meningiomas. Am J Physiol Cell Physiol 279:C691–C699
  9. Shorte SL, Schofield JG 1996 The effect of extracellular polyvalent cations on bovine anterior pituitary cells. Evidence for a Ca2+-sensing receptor coupled to release of intracellular calcium stores. Cell Calcium 19:43–57[CrossRef][Medline]
  10. Emanuel RL, Adler GK, Kifor O, Quinn SJ, Fuller F, Krapcho K, Brown EM 1996 Calcium-sensing receptor expression and regulation by extracellular calcium in the AtT-20 pituitary cell line. Mol Endocrinol 10:555–565[Abstract]
  11. Romoli R, Lania A, Mantovani G, Corbetta S, Persani L, Spada A 1999 Expression of calcium-sensing receptor and characterization of intracellular signaling in human pituitary adenomas. J Clin Endocrinol Metab 84:2848–2853[Abstract/Free Full Text]
  12. Ferry S, Chatel B, Dodd RH, Lair C, Gully D, Maffr JP, Ruat M 1997 Effects of divalent cations and of a calcimimetic on adrenocorticotropic hormone release in pituitary tumor cells. Biochem Biophys Res Commun 238:866–873[CrossRef][Medline]
  13. Zivadinovic D, Tomic M, Yuan D, Stojilkovic SS 2002 Cell-type specific messenger functions of extracellular calcium in the anterior pituitary. Endocrinology 143:445–455[Abstract/Free Full Text]
  14. Kolk SM, Kramer BRM, Cornelisse LN, Scheenen WJJM, Jenks BG, Roubos EW 2002 Multiple control and dynamic response of the Xenopus melanotrope cell. Comp Biochem Physiol B Biochem Mol Biol 132:257–268[CrossRef][Medline]
  15. Douglas WW, Shibuya I 1993 Calcium signals in melanotrophs and their relation to autonomous secretion and its modification by inhibitory and stimulatory ligands. Ann N Y Acad Sci 680:229–245[CrossRef][Medline]
  16. Scheenen WJJM, de-Koning HP, Jenks BG, Vaudry H, Roubos EW 1994 The secretion of {alpha}-MSH from Xenopus melanotropes involves calcium influx through omega-conotoxin-sensitive voltage-operated calcium channels. J Neuroendocrinol 6:457–464[CrossRef][Medline]
  17. Martens GJM, Jenks BG, van-Overbeeke AP 1981 Microsuperfusion of neurointermediate lobes of Xenopus laevis: concomitant and coordinately controlled release of newly synthesized peptides. Comp Biochem Physiol C 69:75–81[CrossRef]
  18. Stiffler DF 1993 Amphibian calcium metabolism. J Exp Biol 184:47–61[Abstract]
  19. Conigrave AD, Quinn SJ, Brown EM 2000 L-amino acid sensing by the extracellular Ca2+-sensing receptor. Proc Natl Acad Sci USA 97:4814–4819[Abstract/Free Full Text]
  20. Zhang Z, Jiang Y, Quinn SJ, Krapcho K, Nemeth EF, Bai M 2002 L-phenylalanine and NPS R-467 synergistically potentiate the function of the extracellular calcium-sensing receptor through distinct sites. J Biol Chem 277:33736–33741[Abstract/Free Full Text]
  21. Quinn SJ, Ye CP, Diaz R, Kifor O, Bai M, Vassilev PM, Brown EM 1997 The Ca2+-sensing receptor: a target for polyamines. Am J Physiol 273:C1315–C1323
  22. Scheenen WJJM, Dernison MM, Lieste JR, Jenks BG, Roubos EW 2003 Electrical membrane activity and regulators of intracellular calcium control exocytosis efficiency of the Xenopus melanotrope cells. Neuroendocrinol 77:153–161[CrossRef][Medline]
  23. Kramer BMR, Cruijsen PJMJ, Ouwens DTWM, Coolen MW, Martens GJM, Roubos EW, Jenks BG 2002 Evidence that brain-derived neurotrophic factor acts as an autocrine factor on pituitary melanotrope cells of Xenopus laevis. Endocrinology 143:1337–1345[Abstract/Free Full Text]
  24. Martens GJM 1986 Expression of two proopiomelanocortin genes in the pituitary gland of Xenopus laevis: complete structures of the two preprohormones. Nucleic Acids Res 14:3791–3798[Abstract/Free Full Text]
  25. Martens GJM, Weterings KA, van-Zoest ID, Jenks BG 1987 Physiologically induced changes in proopiomelanocortin mRNA levels in the pituitary gland of the amphibian Xenopus laevis. Biochem Biophys Res Commun 143:678–684[CrossRef][Medline]
  26. Holthuis JC, Jansen EJ, van-Riel MC, Martens GJM 1995 Molecular probing of the secretory pathway in peptide hormone-producing cells. J Cell Sci 108:3295–3305[Abstract]
  27. Kolk SM, Nordquist R, Tuinhof R, Gagliardini L, Thompson B, Cools AR, Roubos EW 2000 Localization and physiological regulation of the exocytosis protein SNAP-25 in the brain and pituitary gland of Xenopus laevis. J Neuroendocrinol 12:694–706[CrossRef][Medline]
  28. Jenks BG, Ouwens DTWM, Coolen MW, Roubos EW, Martens GJM 2002 Demonstration of postsynaptic receptor plasticity in an amphibian neuroendocrine interface. J Neuroendocrinol 14:843–845[CrossRef][Medline]
  29. McGehee DS, Aldersberg M, Liu KP, Hsuing S, Heath MJ, Tamir H 1997 Mechanism of extracellular Ca2+ receptor-stimulated hormone release from sheep thyroid parafollicular cells. J Physiol 502:31–44[CrossRef]
  30. Ray JM, Squires PE, Curtis SB, Meloche MR, Buchan AMJ 1997 Expression of the calcium-sensing receptor on human antral gastrin cells in culture. J Clin Invest 99:2328–2333[Medline]
  31. Kato M, Doi R, Imamura M, Furutani M, Hosotani R, Shimada Y 1997 Calcium-evoked insulin release from insulinoma cells is mediated via calcium-sensing receptor. Surgery 122:1203–1211[CrossRef][Medline]
  32. Shibuya I, Douglas WW 1993 Spontaneous cytosolic calcium pulses in Xenopus melanotrophs are due to calcium influx during phasic increases in the calcium permeability of the cell membrane. Endocrinology 132:2176–2183[Abstract]
  33. Scheenen WJJM, Jenks BG, Roubos EW, Willems PH 1994 Spontaneous calcium oscillations in Xenopus laevis melanotrope cells are mediated by omega-conotoxin sensitive calcium channels. Cell Calcium 15:36–44[CrossRef][Medline]
  34. Breitwieser GE, Gama L 2001 Calcium-sensing receptor activation induces intracellular calcium oscillations. Am J Physiol Cell Physiol 280:C1412–C1421
  35. Young SH, Rozengurt E 2002 Amino acids and Ca2+ stimulate different patterns of Ca2+ oscillations through the Ca2+-sensing receptor. Am J Physiol Cell Physiol 282:C1414–C1422
  36. Soderling TR, Chang B, Brickey D 2001 Cellular signaling through multifunctional Ca2+/calmodulin-dependent protein kinase II. J Biol Chem 276:3719–3722[Free Full Text]
  37. Mons N, Decorte L, Jaffard R, Cooper DMF 1998 Ca2+-sensitive adenylyl cyclases, key integrators of cellular signalling. Life Sci 62:1647–1652[CrossRef][Medline]
  38. Andric SA, Kostic TS, Tomic M, Koshimizu T, Stojilkovic SS 2001 Dependence of soluble guanylyl cyclase activity on calcium signaling in pituitary cells. J Biol Chem 276:844–849[Abstract/Free Full Text]
  39. Zagotta WN, Siegelbaum SA 1996 Structure and function of cyclic nucleotide-gated channels. Annu Rev Neurosci 19:235–263[CrossRef][Medline]
  40. Su H, Alroy G, Kirson ED, Yaari Y 2001 Extracellular calcium modulates persistent sodium current-dependent burst-firing in hippocampal pyramidal neurons. J Neurosci 21:4173–4182[Abstract/Free Full Text]
  41. Johnson J-PJ, Balser JR, Bennett PB 2001 A novel extracellular calcium sensing mechanism in voltage-gated potassium ion channels. J Neurosci 21:4143–4153[Abstract/Free Full Text]
  42. Clapham DE 1995 Calcium signaling. Cell 80:259–268[CrossRef][Medline]
  43. Yamamori E, Iwasaki Y, Aoki Y, Nomura A, Tachikawa K, Ariyoshi Y, Mutsuga N, Morishita M, Yoshida M, Asai M, Oiso Y, Saito H 2001 Polyamine regulation of the rat pro-opiomelanocortin gene expression in AtT-20 cells. J Neuroendocrinol 13:774–778[CrossRef][Medline]
  44. Oda Y, Tu CL, Pillai S, Bikle DD 1998 The calcium sensing receptor and its alternatively spliced form in keratinocyte differentiation. J Biol Chem 273:23344–23352[Abstract/Free Full Text]
  45. Chattopadhyay N, Ye C, Singh DP, Kifor O, Vassilev PM, Shinohara T, Chylack Jr L-T, Brown EM 1997 Expression of extracellular calcium-sensing receptor by human lens epithelial cells. Biochem Biophys Res Commun 233:801–805[CrossRef][Medline]
  46. De-Bold AJ, de-Bold ML, Kraicer J 1980 Structural relationships between parenchymal and stromal elements in the pars intermedia of the rat adenohypophysis as demonstrated by extracellular space markers. Cell Tissue Res 207:347–359[Medline]
  47. Belan P, Gardner J, Gerasimenko O, Gerasimenko J, Mills CL, Petersen OH, Tepikin AV 1998 Isoproterenol evokes extracellular Ca2+ spikes due to secretory events in salivary gland cells. J Biol Chem 273:4106–4111[Abstract/Free Full Text]
  48. Hutton JC, Penn EJ, Peshavaria M 1983 Low-molecular-weight constituents of isolated insulin-secretory granules. Bivalent cations, adenine nucleotides and inorganic phosphate. Biochem J 210:297–305[Medline]
  49. Hofer AM, Curci S, Doble MA, Brown EM, Soybel DI 2000 Intercellular communication mediated by the extracellular calcium-sensing receptor. Nat Cell Biol 2:392–398[CrossRef][Medline]



This article has been cited by other articles:


Home page
Ann. N. Y. Acad. Sci.Home page
E. W. ROUBOS, W. J. J. M. SCHEENEN, and B. G. JENKS
Neuronal, Neurohormonal, and Autocrine Control of Xenopus Melanotrope Cell Activity
Ann. N.Y. Acad. Sci., April 1, 2005; 1040(1): 172 - 183.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar