help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lin, R.-Y.
Right arrow Articles by Davies, T. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lin, R.-Y.
Right arrow Articles by Davies, T. F.
Endocrinology Vol. 144, No. 6 2644-2649
Copyright © 2003 by The Endocrine Society

Committing Embryonic Stem Cells to Differentiate into Thyrocyte-Like Cells in Vitro

Reigh-Yi Lin, Atsushi Kubo, Gordon M. Keller and Terry F. Davies

Division of Endocrinology, Diabetes, and Bone Diseases, Department of Medicine (R.-Y.L., T.F.D.) and Carl C. Icahn Institute for Gene Therapy and Molecular Medicine (A.K., G.M.K.), Mount Sinai School of Medicine, New York, New York 10029

Address all correspondence and requests for reprints to: Reigh-Yi Lin, Ph.D., Department of Medicine, Mount Sinai School of Medicine, Box 1055, One Gustave L. Levy Place, New York, New York 10029-6574. E-mail: reigh-yi.lin{at}mssm.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The derivation of thyrocyte-like cells in culture is of importance in the basic study of early thyroid embryogenesis and the generation of an unlimited clinical source of thyrocytes for genetic manipulation and cell transplantation. We have established an experimental system, which shows that 6-d-old embryoid bodies (EBs) differentiated from mouse embryonic stem (ES) cells expressed a set of genes traditionally associated with thyroid cells. The genes analyzed included the thyroid transcription factor PAX8, the Na+/I- symporter, thyroperoxidase, thyroglobulin, and the TSH receptor (TSHR). Immunofluorescent analysis demonstrated the presence of TSHR-positive cells as outgrowths from 8-d-old EBs cultured on chamber slides. Accordingly, this area of cells also expressed PAX8 and another thyroid transcription factor TTF2. Of importance, TSH, the main regulator of the thyroid gland, was necessary to maintain the expression of PAX8 and TSHR genes during EB differentiation. Furthermore, thyroid-specific function, such as cAMP generation by TSH, was maintained in this model. Together, these results suggested that the developmental program associated with thyrocyte development is recapitulated in the ES/EB model system. The differentiation of mouse ES cells into thyrocyte-like cells provides a powerful model for the study of thyrocyte developmental diseases associated with this lineage and contributes to the development of thyroid hormone-secreting cell lines.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
THE CELLULAR AND molecular mechanisms leading to thyrocyte developmental abnormalities are presently unknown. This lack of understanding stems from the lack of good model system to study thyrocyte development and differentiation. Current approaches to investigate thyrocyte differentiation rely on the in vitro culture of mouse or human thyroid cells (1, 2, 3, 4) or established cell lines of rat (FRTL-5 and PC C1–3; Refs. 5, 6, 7) or more recently human thyroid (8). Although these approaches have provided information, each has its limitations. Primary cultures are often contaminated with other cell types and are difficult to maintain. The well-characterized FRTL-5 cells, which originated from adult rat thyroid glands, can be propagated indefinitely and retain most of the features of differentiated thyrocytes, such as the ability to respond to TSH by cAMP production, iodide trapping, and thyroglobulin secretion (4, 9). However, FRTL-5 cells have been shown to be tetraploid (10), and with age, the characteristics of FRTL-5 cells in culture can change, leading to poor differentiation (11). Furthermore, they are incapable of forming follicles in culture, and, when injected into nude mice, some FRTL-5 cell clones develop TSH-dependent tumors.

In an attempt to establish a better model to study early thyroid cell differentiation, we developed a novel embryonic stem (ES) cell-based approach. ES cells are continuously growing cell lines isolated from the inner cell mass of the blastocyst that can be propagated indefinitely in an undifferentiated state (12, 13). When ES cells are induced to differentiate in vitro, they form three-dimensional structures called embryoid bodies (EBs) that are composed of derivatives of the three embryonic germ layers (13) and have the potential to differentiate into cells of all lineages. Using the ES/EB differentiation model, cells with hemangioblast potential have been identified (14). Murine ES cell-derived hematopoietic precursors (13, 15), neural precursors (16, 17), insulin-producing ß-cells, and cardiomyocytes (18) have been successfully characterized and transplanted into recipient animals.

The thyroid gland consists of several cell types that are derived from all three embryonic germ layers. Thyroid follicular cells, which represent the most abundant cellular population, are of endodermal origin. The thyroid gland is the only tissue in the body that can absorb iodine and convert it into thyroid hormones T3 and T4 (19). This gland is centrally important in metabolic homeostasis, growth, and development. Thyroid hormones derive from the degradation of a large precursor, thyroglobulin (Tg), which is iodinated in tyrosine residues by a thyroid-specific enzyme, thyroperoxidase (TPO; Ref. 20). Three transcription factors, TTF1, TTF2, and PAX8, have been implicated in the control of transcription of Tg and TPO genes (21, 22, 23, 24). And four markers of thyroid differentiation, including Na+/I- symporter (NIS), TPO, Tg, and TSH receptor (TSHR), dictate the complex machinery of thyroid hormone synthesis (9, 25, 26, 27) and can be considered the differentiation markers of thyroid follicular cells. In this study, we have demonstrated that mouse ES cells can give rise to thyrocyte-like cells in vitro. These observations provide an important step in exploring the potential of thyroid stem cells to use them as a model system to study the differentiation mechanisms underlying thyrocyte lineage.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Growth and differentiation of ES cells
The CCE ES cells (Ref. 28 ; passages 5–10) were maintained as previously described (15). In brief, 1 x 106 ES cells were cultured on irradiated feeder cells in DMEM (Life Technologies, Inc., Grand Island, NY) supplemented with 15% fetal calf serum (FCS), penicillin-streptomycin (100 U/ml, Life Technologies, Inc.), 1% supernatant leukemia inhibitory factor (13), and 1.5 x 10-4 M monothioglycerol (Sigma, St. Louis, MO). ES cells divided rapidly; therefore, cultures were monitored daily and the cells passaged at 1:3 ratio every 2 d. To induce formation of EBs, cells were trypsinized and seeded in suspension in a 60-mm Petri dish at the concentration of 5000 cells/ml. The EB differentiation media contained Iscove’s modified Dulbecco’s medium (Life Technologies, Inc.) supplemented with 15% FCS, 0.5 mg/ml ascorbic acid (Sigma), and 1.5 x 10-4 M monothioglycerol. Cultures were maintained in a humidified chamber in a 5% CO2/air mixture at 37 C. The EBs were cultured for 6 d and then replated on tissue culture plates coated with 0.1% gelatin. The cells were grown in the presence of 15% FCS or 15% knockout serum replacement medium (Life Technologies, Inc.). In some experiments, cells were grown in the presence of knockout serum replacement supplemented with human recombinant TSH (hTSH, 0.1–10 mU/ml, Sigma). Under these conditions, the differentiated embryonic cells were grown for another 5–10 d.

RNA isolation and gene expression analysis
Total RNA was collected from mouse ES colonies, free-floating EB spheres, and differentiated cells growing from spheres that were induced to differentiate to the thyrocyte lineages as described above. Total RNA was isolated using RNeasy kit (QIAGEN, Valencia, CA) and was reverse transcribed into cDNA using Thermoscript first-strand synthesis system (Invitrogen, Carlsbad, CA). PCR was performed using standard protocols with platinum Taq polymerase (Invitrogen). Amplification conditions were as follows: initial denaturation at 94 C for 2 min followed by 30–35 cycles of denaturation at 94 C for 30 sec, annealing at 50–61 C for 45 sec, extension at 72 C for 45 sec, and final extension at 72 C for 7 min. Annealing temperature in all cases were set at 2 C below the calculated denaturation temperature. The amount of cDNA into each sample was normalized using ß-actin as a control. RNA controls were included to monitor genomic contamination. The amplified PCR products were separated on 2% agarose gels and visualized by ethidium bromide staining. The identity of related PCR products was confirmed by direct sequencing. Each PCR product was sequenced with each sequence matching that published for each gene. Forward and reverse primer sequences, from the 5' to 3' direction, the length of the amplified products and corresponding amino acid residues of the respective protein were as follows: PAX8, tgcctttccccatgctgcctccgtgta and ggtgggtggtgcgcttggccttgatgtag (298 bp; corresponding to amino acid residues 351–426); TPO, tgccaacagaagcatgggcaac and gcacaaagttcccattgtccac (424 bp; corresponding to amino acid residues 602–742); Tg, tgggacgtgaaaggggaatggtgc and gtgagcttttggaatggcaggcga (394 bp; corresponding to amino acid residues 1833–1970); TSHR, gagtgtgcgtctccaccatg and ttgcagccgctgcagagttgc (209 bp; corresponding to amino acid residues 23–93); NIS, gctctcatcagctacctaactg and ctcagaggttggtctcaacatc (243 bp; corresponding to amino acid residues 539–618); and Oct4, ggcgttctctttggaaaggtgttc and ctcgaaccacatccttctct (293 bp; corresponding to amino acid residues 137–240).

Immunofluorescent microscopy
Cells were fixed in 4% paraformaldehyde in PBS (10 mM phosphate and 150 mM NaCl, pH 7.4). Immunocytochemistry was carried out using standard protocols. In brief, cells were permeabilized with 0.1% Triton X-100 in PBS for 10 min at room temperature. The fixed cells were preblocked with 3% BSA in PBS or 2–5% serum of the same species in PBS as the secondary antibody. The following primary antibodies were used: hamster TSHR antiserum (1:500; Ref. 29); TTF2 rabbit polyclonal (1:100; Ref. 26); and PAX8 rabbit polyclonal (1:500; Ref. 26) antibodies. The hamster antiserum containing TSHR antibodies were generated in our laboratory. In brief, the TSHR antiserum was generated by immunizing female Armenian hamster with adenovirus (5 x 1011 particles per animal) incorporating full-length hTSHR (provided by Dr. Y. Nagayama, Nagasaki University School of Medicine, Nagasaki, Japan). Sera were harvested after 18 wk of immunization (29). TTF2 and PAX8 antibodies were gifts of Dr. R. Di Lauro (Stazione Zoologica ‘A. Dohrn’ Villa Communale, Italy). For detection of primary antibodies, fluorescent-labeled secondary antibodies (Vector Laboratories, Burlingame, CA) were used according to methods described by the manufacturer. The stained cells were mounted using Vectashield with 4',6-diamidino-2-phenylindole (DAPI; Vector Laboratories). Images were captured using an Axioskop fluorescent microscope (Zeiss, Thornwood, NJ).

Intracellular cAMP measurement
The d 6 EBs were gently trypsinized and seeded in 24-well microtiter plates coated with 0.1% gelatin (50,000 cells/well) to form monolayers. The cells were grown in EB differentiation medium in the presence of 15% knockout serum replacement medium as mentioned before. Four hours after the culture, the medium was changed to that supplemented with 0, 1, or 10 mU/ml hTSH for 11 d. The medium with the indicated concentrations of hTSH was changed every 3 d. To determine TSHR functionality, 24 h before the cAMP assay, the cells were removed from the culturing medium. The cAMP responses of cells were measured after incubating the cells for 1 h in the absence or presence at 100 mU/ml bovine TSH using the Biotrak cAMP enzyme immunoassay system (Amersham Pharmacia Biotech, Piscataway, NJ) according to the manufacturers’ protocol. Data represent the mean of two independent experiments, each performed in duplicate.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Expression of thyrocyte-specific markers
To derive thyrocyte-like cells, differentiation of mouse ES cells was induced in liquid cultures by depletion of the feeder cell layer as described previously (13). To assess the differentiation of ES cells into thyrocyte lineages, the expression pattern of genes associated with this lineage was examined by RT-PCR. In the undifferentiated state, ES cells expressed the undifferentiated stem cell marker Oct4, but none of the thyroid cell markers (Fig. 1Go). Following 6 d of differentiation in the presence of serum, EBs expressed NIS, PAX8, Tg, TPO, and TSHR genes (Fig. 1Go). EB differentiation in the absence of serum displayed a similar profile with the exception of the reduced Tg expression. This difference suggests that additional molecules in serum were required for Tg expression (Fig. 1Go). This pattern of thyroid-related gene expression was maintained throughout the 10-d culture period. The findings from these expression studies suggest that ES cells have the potential to differentiate into the thyrocyte lineage in vitro.



View larger version (84K):
[in this window]
[in a new window]
 
Figure 1. Kinetics of thyrocyte gene expression patterns during EB development. Total RNA was isolated from undifferentiated ES cells or differentiated EBs cultured in the presence or absence of serum as described in Materials and Methods. The cDNA was synthesized from the total RNA by using oligo-dT primers. RT-PCR was performed to detect the expression of NIS, PAX8, Tg, TPO, TSHR, Oct4, and ß-actin. Numbers on top of the figure indicate days of EB differentiation.

 
Indirect immunofluorescent analysis
Further characterization of thyrocyte development within the EBs was performed by indirect immunofluorescent analysis. The d 8 EBs were immunostained with hamster anti-TSHR antibody/fluorescein isothiocyanate-labeled secondary antibody and then observed using fluorescent micro-scopy (Fig. 2Go). TSHR-positive cells were seen as outgrowths from EBs (Fig. 2Go, upper panel), rather than the central layer cells (Fig. 2Go, lower panel). The same field was counterstained with DAPI, showing that the TSHR-positive area was the cytoplasm of fixed cells in clusters in the discrete areas within the EB outgrowths. These results showed that TSHR-positive cells appeared when EBs derived from ES cells were adherently cultured for differentiation. During the next 2 d of culture, differentiation continued within the outer layer of cells surrounding the EBs, as demonstrated by the presence of PAX8 and TTF2 (Fig. 3AGo). It appeared that the PAX8-positive cells were growing out from the spheres to form a monolayer of differentiated cells (Fig. 3AGo, upper panel). The cell clusters near the edges of EBs also expressed TTF2 in the cell nuclei (Fig. 3AGo, lower panel). Further analysis of cells from later stage (d 12) EBs revealed that PAX8 appeared to be localized in bipolar mitotic spindles in cells undergoing division (Fig. 3BGo). Small punctate TTF2-positive signals were also observed between spindle poles in these populations (Fig. 3BGo). The findings from our immunohistochemical study further suggest the interpretation that thyrocyte-like cells were present within the EB-derived adherent cell population.



View larger version (63K):
[in this window]
[in a new window]
 
Figure 2. Expression of TSHR in differentiated EBs. The presence of the TSHR was detected by immunohistocytochemical staining. TSHRs were present in cells surrounding the 8-d-old EB (upper panel, left) but not in cells within the EB (lower panel, left). Middle panels indicate number and location of cells by nuclear DAPI staining. Right panels represent overlaid images. Magnification, x200.

 


View larger version (58K):
[in this window]
[in a new window]
 
Figure 3. Expression of PAX8 and TTF2 in differentiated EB cells. A, Immunofluorescent images of d 10 EBs (magnification, x200). Expression of PAX8 (upper left panel) and TTF2 (lower left panel) were seen as green signals in the nuclei of EB-derived cells. Middle panels indicate number and location of cells by nuclear DAPI staining. Right panels are overlaid images. B, Immunofluorescent images of d 12 EB-derived differentiated monolayer cells. PAX8 appeared to be localized in bipolar mitotic spindles (upper left panel); right, the same field of cells shown DAPI staining. TTF2 showed small punctate staining in dividing cells (lower left panel); right, the same field of cells shown DAPI staining. Magnification, x400.

 
Differentiation of EBs by TSH
Given that the TSHR was expressed in d 6 EBs, we next examined the influence of TSH on the differentiation of EB-derived cells. The d 6 EBs were replated to form monolayers on gelatin-coated dishes in serum-free conditions, supplemented with 1–10 mU/ml recombinant hTSH (30). Control cultures were maintained without TSH. To determine whether the TSHRs expressed in EBs were functional, the production of cAMP in response to TSH was evaluated. After 17 d of differentiation (11 d of exposure to TSH), the cells treated with 1 and 10 mU/ml TSH showed a higher intracellular cAMP content (346 ± 36 vs. 598 ± 56 fmol/well, respectively) than cells maintained in the absence of TSH (105 ± 50 fmol/well; Fig. 4AGo), indicating TSHRs present in these cells can mediate a signal. However, the difference between treatment groups was not statistically significant (P = 0.13). Although the cells that received no TSH treatment showed the lowest cAMP response (Fig. 4AGo), the level of TSHR gene expression in these populations was undetectable (Fig. 4BGo). Although Tg mRNA transcripts were undetectable in cultured cells at this stage, PAX8 and TSHR mRNA transcripts were robustly expressed in cells grown in the presence of TSH (Fig. 4BGo). Together, these data suggested that TSH was necessary to maintain the expression level of PAX8 and the TSHR genes during EB differentiation.



View larger version (25K):
[in this window]
[in a new window]
 
Figure 4. Effects of TSH on thyroid marker expression in differentiated EBs. The d 6 EB cells were replated to form monolayers on 0.1% gelatin-coated dishes in serum-free conditions, supplemented with 1–10 mU/ml hTSH for 11 d before functional cAMP assay and RT-PCR analysis for thyroid-specific mRNA transcripts. Control cultures were maintained without TSH. A, Intracellular cAMP was measured in the lysate using the Biotrak cAMP immunoassay (enzyme immunoassay) system as described in Materials and Methods. B, Thyrocyte-related gene expression patterns by RT-PCR.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
ES cells have extraordinary self-renewal and differentiation capacity and thus offer several advantages over other current models to study thyroid-cell differentiation. First, ES cell self-renewal can be perpetuated over many generations, resulting in considerable amplification of cell numbers, thereby providing an unlimited source of thyrocytes for genetic manipulation and analysis. Second, access to thyroid stem/progenitor cell populations in EBs will enable a detailed molecular analysis of the development of this lineage. These studies will ultimately lead to a better understanding of the causes of thyroid birth defects that result in congenital hypothyroidism. Finally, the potential use of human ES cells as a renewable source of thyroid follicular cells for replacement therapy holds attractive therapeutic potential.

The present study demonstrated that cultures of EB-derived adherent cell populations contained thyrocyte-like cells. RT-PCR analysis of the differentiating EB cells revealed the temporal appearance of mRNA transcripts for a number of thyroid differentiation genes including PAX8, NIS, TPO, TSHR, and Tg. It is known that during mouse embryogenesis, TTF1 and PAX8 are expressed at the onset of thyroid gland formation at E8–9.5, and Tg, TPO, TSHR, and NIS are expressed at E14 during gland migration. However, this temporal pattern of gene expression was not seen when using EB-derived differentiated cells as a source. It is postulated that these genes may be expressed in nonthyroid cells as well because the current culture conditions did not exclusively direct differentiation to only one cell type. Of importance, the present study showed that the process of EB development resulted in the appearance of PAX8 and TSHR, which were under the influence of the main trophic regulator of the thyroid gland, TSH. Furthermore, thyroid-specific function, such as cAMP generation by TSH, was maintained in this model. Together, these results suggest that the developmental program associated with thyrocyte development is recapitulated in the ES/EB model system.

Our immunofluorescent findings showed that TSHR-positive cells were expressed as outgrowths from EBs. The hamster serum containing TSHR antibodies used in this study was generated by immunizing female Armenian hamster with adenovirus incorporating full-length hTSHR (29). The TSHR antibodies are polyclonal and react well with the membrane form of the TSHR. Our fluorescence-activated cell sorter analysis showed that it recognized both fixed and nonfixed Chinese hamster ovary/TSHR cells (data not shown). In the present study, the TSHR-positive cells appeared as clusters when EBs were attached to form monolayers. Apparently the similar clusters of cells also expressed PAX8 and TTF2. Our data thus far were based on single labeling; it is therefore difficult to confirm whether TSHRs were present in the same cells that expressed PAX8 and TTF2. To answer this question more precisely, it will be necessary to demonstrate the coexistence of TSHR and PAX8 or TTF2 in the same cells by double-immunofluorescent labeling.

We found that thyroid transcription factors PAX8 and TTF2 were expressed in the nuclei of outer layer of cells surrounding 10-d-old EBs. PAX8 belongs to the mammalian PAX protein family (31) and has been implicated in the control of transcription of Tg, TPO, and NIS genes (19, 23, 32, 33). In mice lacking the PAX8 locus, the thyroid is small, with no follicular cells (23, 34, 35). TTF2 is a member of a large family of proteins that bind DNA through a sequence called the forkhead domain. Mice lacking the TTF2 locus showed either a sublingual or the complete absence of a thyroid gland, indicating the necessity of TTF2 during thyroid development (36). PAX8 and TTF2 are expressed also in cell types different from the thyroid follicular cells. However, the combination of these factors is specific to the thyroid hormone-producing cells. Our immunohistochemical findings of PAX8 and TTF2 expression suggest a fundamental role of these two transcription factors in the differentiation of EB-derived thyrocyte-like cells. Furthermore, a unique staining pattern of mitotic spindles in cells undergoing division was observed in later stages EBs. The findings raise the interesting possibility that PAX8 and TTF2 play some role in cell division with this lineage.

Lineage-specific differentiation initiated by growth factors has been reported. Several soluble factors have been shown to direct differentiation of mouse ES cells, e.g. IL-3, IL-6, retinoic acid, TGF-ß1, bovine fibroblast growth factor, and IGF-1 (37). In the present study, we observed that TSH was necessary to maintain the expression of the PAX8 and TSHR genes during EB differentiation. Previous data from cultured human adult thyroid cells (both normal and pathological) have indicated limited or no TSH-induced thyroid cell growth in vitro (1, 2, 38). TSH is necessary to maintain the thyrocyte architecture in FRTL-5 cells. However, this has not been observed with normal cells because TSHR knockout mice continued to form thyroid follicles (39, 40). The mechanism by which TSH achieves thyroid-specific gene expression is unclear but appears to be intimately associated with its influence on a variety of mitogenic control. Identification of additional growth-related factors remains to be performed. Such factors may reflect physiologically important mechanisms to facilitate thyrocyte differentiation in vitro. The production of cAMP in response to TSH was maintained in the ES/EB differentiation model system. However, the level of cAMP generated was low (Fig. 4AGo), compared with other systems such as JPO9 cells (Chinese hamster ovarian cells stably expressing human TSHR). It is conceivable that the lower cAMP levels generated in these EB-derived cells were due to the heterogeneity of these populations.

We have previously examined the in vitro Tg secretion characteristics of human thyroid monolayer cells and observed that although human Tg secretion was under TSH control, thyroid follicle formation and Tg expression could proceed in the absence of TSH (1, 3, 38, 41, 42, 43). In the present series of experiments, basal Tg expression in the absence of serum was minimal, indicating that the presence of a variety of trophic factors, in addition to TSH, may be required for full Tg expression and thyroid hormone synthesis. It is interesting to note the lack of TSH responsiveness demonstrated by EB-derived monolayer cultures grown in TSH-free conditions, suggesting the dependence of the TSH receptor on TSH itself. We and others have previously observed that the TSHR was positively regulated by TSH (1), and this may be a related phenomenon.

To better understand the mechanisms that control thyrocyte differentiation, it is essential to generate an enriched population of proliferating thyrocyte progenitors and identify genes that are involved specifically in regulating thyrocyte activity. The expression of the TSH receptor during early EB development could provide an ideal marker for their isolation by cell sorting. The identification of the thyrocytes in conjunction with the availability of many different knockout ES cell lines also provides a unique opportunity to delineate the role of specific genes in thyroid cell development. In summary, we identified a novel ES cell-derived thyrocyte-like population. These cells developed early during EB development and persisted for a short period of time. Embryonic stem cells appear, therefore, to be a useful and highly appropriate in vitro model for future studies on thyroid cell differentiation. This work will promote research in thyroid stem cells, enabling large-scale analysis of mRNA and protein expression, and will expedite manipulations with growth and differentiation factors that may enable the identification of the earliest events involved in the commitment toward the thyrocyte lineage during embryonic development.


    Acknowledgments
 
We thank Drs. Takao Ando, Russell Marians, and Rauf Latif for their helpful advice and Dr. Scott Henderson of the shared facility at Mount Sinai School of Medicine (supported with funding from NIH 1S10RR9145-01 and NSF DBI-9724504) for all the immunofluorescent microscopy work. We also thank Dr. R. Di Lauro (Stazione Zoologica ‘A. Dohrn’ Villa Communale, Italy) for the PAX8 and TTF2 antibodies.


    Footnotes
 
This work was supported in part by NIH Grants DK-52464, DK-45011, and AI-24671 (to T.F.D.) and HL-48834, HL-65169, and DK/HL-60627 (to G.M.K.).

Abbreviations: DAPI, 4',6-Diamidino-2-phenylindole; EB, embryoid body; ES, embryonic stem cells; FCS, fetal calf serum; hTSH, human recombinant TSH; NIS, sodium-iodide symporter; Tg, thyroglobulin; TPO, thyroperoxidase; TSHR, TSH receptor; TTF, thyroid transcription factor.

Received December 10, 2002.

Accepted for publication February 20, 2003.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Huber GK, Davies TF 1990 Human fetal thyroid cell growth in vitro: system characterization and cytokine inhibition. Endocrinology 126:869–875[Abstract/Free Full Text]
  2. Davies TF, Platzer M, Schwartz AE, Friedman EW 1985 Short- and long-term evaluation of normal and abnormal human thyroid cells in monolayer culture. Clin Endocrinol (Oxf) 23:469–479[Medline]
  3. Feldman A, Singh A, Diamond EJ, Schwartz AE, Friedman EW, Davies TF 1987 Variability in production and immunoreactivity of in vitro secreted human thyroglobulin. Clin Endocrinol (Oxf) 27:691–701[Medline]
  4. Ambesi-Impiombato FS, Coon HG 1979 Thyroid cells in culture. Int Rev Cytol Suppl 10:163–172
  5. Davies TF, Yang C, Platzer M 1987 Cloning of the Fisher rat thyroid cell line (FRTL-5): variability in clonal growth and cyclic AMP response to thyrotropin. Endocrinology 121:78–83[Abstract/Free Full Text]
  6. Weiss SJ, Philp NJ, Grollman EF 1984 Effect of thyrotropin on iodide efflux in FRTL-5 cells mediated by Ca2+. Endocrinology 114:1108–1113[Abstract/Free Full Text]
  7. Fusco A, Berlingieri MT, Fiore PP, Portella G, Grieco M, Vecchio G1987 One- and two-step transformations of rat thyroid epithelial cells by retroviral oncogenes. Mol Cell Biol 7:3365–3370
  8. Fayet G, Hovsepian S 2002 Isolation of a normal human thyroid cell line: hormonal requirement for thyroglobulin regulation. Thyroid 12:539–546[CrossRef][Medline]
  9. Ambesi-Impiombato FS, Parks LAM, Coon HG 1980 Culture of hormone-dependent functional epithelial cells from rat thyroids. Proc Natl Acad Sci USA 77:3455–3459[Abstract/Free Full Text]
  10. Tasevski V, Benn D, Peters G, Luttrell B, Simpson A 1998 The Fischer rat thyroid cell line FRTL-5 exhibits a nondiploid karyotype. Thyroid 8:623–626[Medline]
  11. Zimmermann-Belsing T, Rasmussen AK, Feldt-Rasmussen U 1998 Lack of thyroglobulin synthesis as an indicator of early random dedifferentiation of the Fischer rat thyroid cell line FRTL-5. Scand J Clin Lab Invest 58:529–535[CrossRef][Medline]
  12. Evans MJ, Kaufman MH 1981 Establishment in culture of pluripotential cells from mouse embryos. Nature 292:154–156[CrossRef][Medline]
  13. Keller GM 1995 In vitro differentiation of embryonic stem cells. Curr Opin Cell Biol 7:862–869[CrossRef][Medline]
  14. Choi K, Kennedy M, Kazarov A, Papadimitriou JC, Keller G 1998 A common precursor for hematopoietic and endothelial cells. Development 125:725–732[Abstract]
  15. Keller G, Kennedy M, Papayannopoulou T, Wiles MV 1993 Hematopoietic commitment during embryonic stem cell differentiation in culture. Mol Cell Biol 13:473–486[Abstract/Free Full Text]
  16. Bain G, Kitchens D, Yao M, Huettner JE, Gottlieb DI 1995 Embryonic stem cells express neuronal properties in vitro. Dev Biol 168:342–357[CrossRef][Medline]
  17. Kawasaki H, Mizuseki K, Nishikawa S, Kaneko S, Kuwana Y, Nakanishi S, Nishikawa SI, Sasai Y 2000 Induction of midbrain dopaminergic neurons from ES cells by stromal cell-derived inducing activity. Neuron 28:31–40[CrossRef][Medline]
  18. Lumelsky N, Blondel O, Laeng P, Velasco I, Ravin R, McKay R 2001 Differentiation of embryonic stem cells to insulin-secreting structures similar to pancreatic islets. Science 292:1389–1394[Abstract/Free Full Text]
  19. Suzuki K, Lavaroni S, Mori A, Ohta M, Saito J, Pietrarelli M, Singer DS, Kimura S, Katoh R, Kawaoi A, Kohn LD 1998 Autoregulation of thyroid-specific gene transcription by thyroglobulin. Proc Natl Acad Sci USA 95:8251–8256[Abstract/Free Full Text]
  20. Seto P, Hirayu H, Magnusson RP, Gestautas J, Portmann L, DeGroot LJ, Rapoport B 1987 Isolation of a complementary DNA clone for thyroid microsomal antigen. Homology with the gene for thyroid peroxidase. J Clin Invest 80:1205–1208
  21. Civitareale D, Castelli MP, Falasca P, Saiardi A 1993 Thyroid transcription factor 1 activates the promoter of the thyrotropin receptor gene. Mol Endocrinol 7:1589–1595[Abstract/Free Full Text]
  22. Miccadei S, De Leo R, Zammarchi E, Natali PG, Civitareale D 2002 The synergistic activity of thyroid transcription factor 1 and pax 8 relies on the promoter/enhancer interplay. Mol Endocrinol 16:837–846[Abstract/Free Full Text]
  23. Mansouri A, Chowdhury K, Gruss P 1998 Follicular cells of the thyroid gland require Pax8 gene function. Nat Genet 19:87–90[CrossRef][Medline]
  24. Damante G, Tell G, Di Lauro R 2001 A unique combination of transcription factors controls differentiation of thyroid cells. Prog Nucleic Acids Res Mol Biol 66:307–356[Medline]
  25. Dai G, Levy O, Carrasco N 1996 Cloning and characterization of the thyroid iodide transporter. Nature 379:458–460[CrossRef][Medline]
  26. Weiss SJ, Philp NJ, Ambesi-Impiombato FS, Grollman EF 1984 Thyrotropin-stimulated iodide transport mediated by adenosine 3', 5'-monophosphate and dependent on protein synthesis. Endocrinology 114:1099–1107[Abstract/Free Full Text]
  27. Davies T, Marians R, Latif R 2002 The TSH receptor reveals itself. J Clin Invest 110:161–164[CrossRef][Medline]
  28. Robertson E, Bradley A, Kuehn M, Evans M 1986 Germ-line transmission of genes introduced into cultured pluripotential cells by retroviral vector. Nature 323:445–448[CrossRef][Medline]
  29. Ando T, Imaizumi M, Graves P, Unger P, Davies TF 2003 Induction of TSH receptor autoimmunity in hamsters. Endocrinology 144:671–680[Abstract/Free Full Text]
  30. Huber GK, Fong P, Concepcion ES, Davies TF 1991 Recombinant human thyroid-stimulating hormone: initial bioactivity assessment using human fetal thyroid cells. J Clin Endocrinol Metab 72:1328–1331[Abstract/Free Full Text]
  31. Plachov D, Chowdhury K, Walther C, Simon D, Guenet JL, Gruss P 1990 Pax8, a murine paired box gene expressed in the developing excretory system and thyroid gland. Development 110:643–651[Abstract/Free Full Text]
  32. Espinoza CR, Schmitt TL, Loos U 2001 Thyroid transcription factor 1 and Pax8 synergistically activate the promoter of the human thyroglobulin gene. J Mol Endocrinol 27:59–67[Abstract]
  33. Schmitt TL, Espinoza CR, Loos U 2001 Transcriptional regulation of the human sodium/iodide symporter gene by Pax8 and TTF-1. Exp Clin Endocrinol Diabetes 109:27–31[CrossRef][Medline]
  34. Komatsu M, Takahashi T, Takahashi I, Nakamura M, Takada G 2001 Thyroid dysgenesis caused by PAX8 mutation: the hypermutability with CpG dinucleotides at codon 31. J Pediatr 139:597–599[CrossRef][Medline]
  35. Flamant F, Poguet AL, Plateroti M, Chassande O, Gauthier K, Streichenberger N, Mansouri A, Samarut J 2002 Congenital hypothyroid Pax8(-/-) mutant mice can be rescued by inactivating the TR{alpha} gene. Mol Endocrinol 16:24–32[Abstract/Free Full Text]
  36. Zannini M, Avantaggiato V, Biffali E, Arnone MI, Sato K, Pischetola M, Taylor BA, Phillips SJ, Simeone A, Di Lauro R 1997 TTF-2, a new forkhead protein, shows a temporal expression in the developing thyroid which is consistent with a role in controlling the onset of differentiation. EMBO J 16:3185–197[CrossRef][Medline]
  37. Schuldiner M, Yanuka O, Itskovitz-Eldor J, Melton DA, Benvenisty N 2000 From the cover: effects of eight growth factors on the differentiation of cells derived from human embryonic stem cells. Proc Natl Acad Sci USA 97:11307–11312[Abstract/Free Full Text]
  38. Davies TF, Platzer M, Schwartz AE, Friedman E 1984 Thyroglobulin secretion by human thyroid cells after monolayer culture—comparison of normal and adenomatous cells. Clin Endocrinol (Oxf) 21:239–246[Medline]
  39. Marians RC, Ng L, Blair HC, Unger P, Graves PN, Davies TF 2002 Defining TSH-dependent and TSH-independent steps of thyroid hormone synthesis using thyrotropin receptor-null mice. Proc Natl Acad Sci USA 99:15776–15781[Abstract/Free Full Text]
  40. Postiglione MP, Parlato R, Rodriguez-Mallon A, Rosica A, Mithbaokar P, Maresca M, Marians RC, Davies TF, Zannini MS, De Felice M, Di Lauro R 2002 Role of the thyroid-stimulating hormone receptor signaling in development and differentiation of the thyroid gland. Proc Natl Acad Sci USA 99:15462–15467[Abstract/Free Full Text]
  41. Graves PN, Davies TF 1993 Thyrotropin regulates thyroglobulin mRNA splicing and differential processing. Mol Cell Endocrinol 93:213–218[CrossRef][Medline]
  42. Martin A, Valentine M, Unger P, Lichtenstein C, Schwartz AE, Friedman EW, Shultz LD, Davies TF 1993 Preservation of functioning human thyroid organoids in the scid mouse: 1. System characterization. J Clin Endocrinol Metab 77:305–310[Abstract]
  43. Valentine M, Martin A, Unger P, Katz N, Shultz LD, Davies TF 1994 Preservation of functioning human thyroid "organoids" in the severe combined immunodeficient mouse. III. Thyrotropin independence of thyroid follicle formation. Endocrinology 134:1225–1230[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
EndocrinologyHome page
R. Ma, R. Latif, and T. F. Davies
Thyrotropin-Independent Induction of Thyroid Endoderm from Embryonic Stem Cells by Activin A
Endocrinology, April 1, 2009; 150(4): 1970 - 1975.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
A. Fierabracci, M. A. Puglisi, L. Giuliani, S. Mattarocci, and M. Gallinella-Muzi
Identification of an adult stem/progenitor cell-like population in the human thyroid
J. Endocrinol., September 1, 2008; 198(3): 471 - 487.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
D. Thomas, S. Friedman, and R.-Y. Lin
Thyroid stem cells: lessons from normal development and thyroid cancer
Endocr. Relat. Cancer, March 1, 2008; 15(1): 51 - 58.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
M. Lu and R.-Y. Lin
TSH stimulates adipogenesis in mouse embryonic stem cells
J. Endocrinol., January 1, 2008; 196(1): 159 - 169.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
N. Hoshi, T. Kusakabe, B. J. Taylor, and S. Kimura
Side Population Cells in the Mouse Thyroid Exhibit Stem/Progenitor Cell-Like Characteristics
Endocrinology, September 1, 2007; 148(9): 4251 - 4258.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
M. C. Arufe, M. Lu, A. Kubo, G. Keller, T. F. Davies, and R.-Y. Lin
Directed Differentiation of Mouse Embryonic Stem Cells into Thyroid Follicular Cells
Endocrinology, June 1, 2006; 147(6): 3007 - 3015.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
G. Keller
Embryonic stem cell differentiation: emergence of a new era in biology and medicine
Genes & Dev., May 15, 2005; 19(10): 1129 - 1155.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lin, R.-Y.
Right arrow Articles by Davies, T. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lin, R.-Y.
Right arrow Articles by Davies, T. F.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals