help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Whitfield, G. K.
Right arrow Articles by Marchalonis, J. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Whitfield, G. K.
Right arrow Articles by Marchalonis, J. J.
Endocrinology Vol. 144, No. 6 2704-2716
Copyright © 2003 by The Endocrine Society

Cloning of a Functional Vitamin D Receptor from the Lamprey (Petromyzon marinus), an Ancient Vertebrate Lacking a Calcified Skeleton and Teeth

G. Kerr Whitfield, Hope T. L. Dang, Samuel F. Schluter, Ralph M. Bernstein, Tara Bunag, Lori A. Manzon, Grace Hsieh, Carlos Encinas Dominguez, John H. Youson, Mark R. Haussler and John J. Marchalonis

Departments of Biochemistry and Molecular Biophysics (G.K.W., H.T.L.D., T.B., G.H., C.E.D., M.R.H.) and Microbiology and Immunology (S.F.S., R.M.B., J.J.M.), College of Medicine, University of Arizona, Tucson, Arizona 85724; Department of Zoology and the Division of Life Sciences (L.A.M., J.H.Y.), University of Toronto at Scarborough, Ontario, Canada M1C 1A4

Address all correspondence and requests for reprints to: G. Kerr Whitfield, Department of Biochemistry & Molecular Biophysics, University of Arizona College of Medicine, 1501 North Campbell Avenue, P.O. Box 245042, Tucson, Arizona 85724. E-mail: kerr{at}medbioc.arizona.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The nuclear vitamin D receptor (VDR) mediates the actions of its 1,25-dihydroxyvitamin D3 ligand to control gene expression in terrestrial vertebrates. Prominent functions of VDR-regulated genes are to promote intestinal absorption of calcium and phosphate for bone mineralization and to potentiate the hair cycle in mammals. We report the cloning of VDR from Petromyzon marinus, an unexpected finding because lampreys lack mineralized tissues and hair. Lamprey VDR (lampVDR) clones were obtained via RT-PCR from larval protospleen tissue and skin and mouth of juveniles. LampVDR expressed in transfected mammalian COS-7 cells bound 1,25-dihydroxyvitamin D3 with high affinity, and transactivated a reporter gene linked to a vitamin D-responsive element from the human CYP3A4 gene, which encodes a P450 enzyme involved in xenobiotic detoxification. In tests with other vitamin D responsive elements, such as that from the rat osteocalcin gene, lampVDR showed little or no activity. Phylogenetic comparisons with nuclear receptors from other vertebrates revealed that lampVDR is a basal member of the VDR grouping, also closely related to the pregnane X receptors and constitutive androstane receptors. We propose that, in this evolutionarily ancient vertebrate, VDR may function in part, like pregnane X receptors and constitutive androstane receptors, to induce P450 enzymes for xenobiotic detoxification.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
THE ACTIONS OF 1,25-dihydroxyvitamin D3 [1,25(OH)2D3] are mediated by the vitamin D receptor (VDR) in concert with an obligate heterodimeric partner, the retinoid X receptor (RXR; Ref. 1). Analogous to other members of the nuclear receptor superfamily (2), liganded VDR, together with its RXR dimer partner, binds to specific vitamin D responsive elements (VDREs) adjacent to target genes and activates or represses these genes to mediate the biological effects of the hormonal ligand (1). VDR null mice have provided strong support for a role of liganded VDR in maintaining blood calcium levels by promoting intestinal calcium absorption and permitting the formation of calcified structures, especially after weaning when the animals are deprived of a steady, abundant source of calcium (3, 4). VDR is also crucial for the maintenance of hair in mice, apparently by playing a role in the hair cycle (5).

VDRs have been characterized from mammals (6, 7, 8), birds (9), Xenopus laevis (10), zebrafish (GenBank accession no. AAF21427), and two VDRs from Japanese flounder, Paralichthys olivaceus (11). All of these species represent vertebrates with calcified endoskeletons. True VDRs are unknown in nonchordate species; the currently known nonchordate protein with the highest similarity to VDR is the ecdysone receptor (12), found in insects and crustaceans, with 27–30% amino acid sequence identity to human VDR (hVDR). Before the recent cloning of zebrafish VDR and flounder VDRa and VDRb, it was speculated that the 1,25(OH)2D3-VDR system originated with terrestrial tetrapods (10). Such an origin of VDR, per se, has become untenable with the cloning of fish VDRs; also, it is known that a variety of fish species, including a shark (Prionace glauca) and lamprey (Entosphenus japonicus) (13), contain appreciable levels of plasma 1,25(OH)2D3, ranging from 28–274 pg/ml (0.07–0.66 nM; Refs. 13, 14, 15, 16, 17). Nevertheless, in the absence of studies to determine the exact physiologic role of 1,25(OH)2D3 in fish, it is still possible that participation of VDR and 1,25(OH)2D3 in calcium homeostasis may indeed date from a time when animals could no longer access an unlimited supply of calcium from their aquatic environment (10).

Lampreys represent, with hagfishes, jawless (agnathan) fishes with the most ancient lineage among extant vertebrates (18, 19, 20). The placement of lampreys in the evolution of vertebrates is not completely clarified, but recent phylogenies, based on new finds of primitive lower Cambrian vertebrates (e.g. Ref. 20), suggest that lampreys belong to a group of soft-bodied vertebrates that diverged before the development of calcified structures (19, 20). Given this tentative phylogenetic position, plus the above-cited evidence that lampreys contain significant circulating levels of 1,25(OH)2D3, the active hormonal form of vitamin D, the present study was undertaken to determine whether lampreys contain a functional VDR. In this report, we describe three distinct VDR cDNA clones obtained from both larval and juvenile specimens of sea lamprey, Petromyzon marinus, that appear to reflect differences in mRNA splicing. In a limited survey of tissues, skin and mouth represent major sites of VDR mRNA expression in juvenile lamprey. Relatively little VDR mRNA was found in juvenile intestine, unlike the situation in mammals and birds. Lamprey VDR (lampVDR) is functional in that it binds 1,25(OH)2D3 with high affinity and transactivates a transfected reporter construct containing a VDRE derived from the human CYP3A4 gene (21), which encodes a cytochrome P450-containing enzyme (CYP) implicated in detoxification of xenobiotics (22). Therefore, we present the first evidence that the appearance of VDR in the vertebrate lineage may actually predate calcified tissues, and we postulate that its original, noncalcemic role might have been, at least in part, the induction of P450 detoxification enzymes.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
RNA samples and cDNA libraries
Tissues were dissected from a single P. marinus larva and four juveniles. The larva was supplied by the Hammond Bay Biological Station of the U.S. Geological Survey (Millersburg, MI) and was killed after anesthesia in 0.05% tricaine methanesulfonate in accordance with a protocol approved by the University of Arizona Institutional Animal Care and Use Committee. Protospleen tissue was collected by scraping the outside of the larval intestine. The four juvenile animals were captured as larvae in spring 2000 and maintained at the University of Toronto at Scarborough (Toronto, Ontario, Canada) under approved conditions. They underwent metamorphosis in the laboratory during the summer and were killed under 0.05% tricaine methanesulfonate in January 2001. Tissues were dissected, stored at -80 C, and used to prepare poly(A)+ RNA using a FastTrack mRNA isolation system (Invitrogen Corp., Carlsbad, CA) according to the manufacturer’s instructions. Total RNA preparations from toad (Bufo marinus) and gecko (Gekko gecko) kidney tissues were a kind gift from Dr. R. H. Wasserman, Cornell University (Ithaca, NY).

PCR using degenerate primers
First-strand cDNA was made from protospleen poly(A)+ RNA (1 µg) using an RT-PCR kit with supplied oligo(deoxythymidine) primers (Stratagene Corp., La Jolla, CA). For the design of degenerate VDR primers for PCR, two areas of amino acid identity among human, mouse, rat, and chicken VDRs were found near the N and C termini. A sense primer encoding part of the open reading frame near the N terminus, corresponding to codons 33–40 of hVDR (-GFHFNAMT-), was 5'-GGNTTYCAYTTYAAYGCNATGAC-3' (where N is a mixture of all four bases and Y is a mixture of both pyrimidines). An antisense primer, corresponding to codons 394–401 near the C terminus of hVDR (-NEEHSKQY-), was 5'-TAYTGYTTNGARTGYTCYTCRTT-3' (abbreviations as above, with R being a mixture of both purines). The PCR contained 2 µl of the first-strand cDNA reaction (described above) along with 500 ng of each degenerate primer and 2.5 U Taq polymerase (Life Technologies, Inc., Rockville, MD) in a 50-µl reaction volume. PCR conditions were as follows: presteps, 94 C for 1 min and 78 C for 3 min, during which the Taq polymerase was added; 40 cycles of 94 C for 30 sec, 55* C for 30 sec, and 72 C for 1 min 20 sec; and a final incubation at 72 C for 10 min, followed by storage at 4 C. The annealing temperature (indicated by an asterisk) was decreased from 55 C to 43 C in 0.3 C increments over 40 cycles.

Cloning and sequencing
PCR products were subjected to agarose gel electrophoresis, excised from the gel, and purified using a Qiaex II agarose gel extraction kit (QIAGEN, Inc., Valencia, CA). Purified PCR products (7.5 µl) were cloned into T-vector (Promega Corp., Madison, WI) and sequenced using a T7 Sequenase 2.0 kit (Amersham Pharmacia Biotech Inc., Piscataway, NJ). Alternatively, preparations of T-vector harboring PCR products were sent to an in-house core facility for automated sequencing.

5'- and 3'-rapid amplification of cDNA ends (RACE)
A cDNA library was constructed from larval protospleen poly(A)+ RNA (1 µg) using a Marathon cDNA amplification kit (CLONTECH Laboratories, Inc., Palo Alto, CA). 5' and 3' RACE reactions were then performed using the AP1 primer from the kit in combination with VDR-specific primers designed from partial lampVDR sequence data. The successful 5' and 3' primers are underlined in Fig. 1AGo (the 5' primer was the antisense complement of the underlined sequence). To identify the lamprey-specific product, 5'-RACE reactions were subjected to agarose gel electrophoresis and then blotted onto an Immobilon Ny+ membrane (Millipore Corp., Bedford, MA) by capillary action. As the hybridization probe, a 210-bp NcoI-AflIII fragment including 149 bp from the 5'-end of the original lamprey clone was biotinylated using a biotin high prime kit (Roche Molecular Biochemicals, Indianapolis, IN), and then 4 µl of this probe was incubated with the Immobilon blot at 42 C overnight in 10 ml of a solution containing 5x SSPE (1x SSPE = 0.18 M NaCl; 10 mM NaxPO4, pH 7.4; 1 mM EDTA), 5x Denhardt’s solution, and 50% formamide. Washes were 2 x 5 min at room temperature in 2x SSPE/0.1% sodium dodecyl sulfate and then 2 x 15 min at 65 C in 0.1x SSPE, 0.1% sodium dodecyl sulfate. Detection of hybridizing bands was carried out using 5-bromo-4-chloro-3-indolylphosphate and 4-nitro blue tetrazolium (both reagents from Roche Molecular Biochemicals) as previously published (23).



View larger version (72K):
[in this window]
[in a new window]
 
Figure 1. Deduced amino acid sequence of lampVDR. A, The sequence of VDR cDNA from P. marinus, excluding two insertions at intron-exon boundaries. The open reading frame (preceded by two in-frame stop codons, which are boxed) predicts a 406 amino acid protein. Regions corresponding to three functional domains in hVDR are hatched (the N-terminal DBD), gray [for the conserved E1 region implicated in heterodimerization with RXR (77 )], or hatched [the C-terminal activation function-2, or AF2, domain (78 )]. Residues that are identical with ligand contacts in a crystal of the hVDR ligand-binding domain (39 ) are circled; the dotted circle around leu-397 indicates that this residue is not identical with the corresponding hVDR amino acid (val). Positions of two out-of-frame insertions are indicated by solid arrowheads. Sequences used to design primers for 5'- and 3'-RACE are underlined. B, Two insertions (bold type) in lamprey cDNA clones relative to known intron-exon boundaries (indicated by solid arrowheads) in the human (36 ) and rat (37 ) VDR genes. The original lampVDR cDNA clone obtained from larval protospleen contained both insertions; the four other clones obtained to date from this tissue contain only insert B. Clones from juveniles contain neither insert (see Fig. 2Go). Boxed sequences indicate donor or acceptor splicing signals in the mammalian genes.

 
Cloning of full-length lampVDR
After the 5' and 3' ends of the lampVDR cDNA had been obtained by RACE, primers were designed from the 5'- and 3'-untranslated regions (UTRs) for amplification of the entire coding region. The 5' primer, corresponding to bases -31 to -7, was 5'-gaattCCGGGCAGGTCTTTAGGCTGCTTAG (a restriction site for EcoRI was added at the 5' end and is shown in lower case). The 3' primer corresponded to bases +1252–1276, with the (antisense) sequence 5'-ggatccGGAGGGCAGCAATCTCTCCACTCG and a site for BamHI (lowercase) at the 5' end. An aliquot of the Marathon cDNA library was diluted 1:150, and 5.5 µl was taken for a PCR using 100 ng each of the above primers in a 50-µl reaction using reagents from an Advantage high-fidelity PCR kit (CLONTECH Laboratories, Inc.). The temperature profile was: prestep at 94 C for 45 sec; 20 cycles of 94 C for 10 sec and 78* C for 3 min 30 sec; 20 cycles at 94 C for 10 sec and 68 C for 3 min 30 sec; and a final incubation at 72 C for 10 min, followed by storage at 4 C. The annealing temperature (*) was decreased from the initial 78 C to 68 C in 0.5 C increments over the first 20 cycles.

PCR products were resolved on agarose gels, excised, purified, and cloned into T-vector as described above. After confirmatory sequencing, the T-vector clone was digested with EcoRI and BamHI, and the lamprey insert of 1347 bp, which lacked insert A (see Fig. 1BGo, top), was purified on an agarose gel and cloned into predigested pSG5 vector (24). Site-directed mutagenesis of the pSG5-lampVDR to remove insert B was performed using the oligonucleotide primer 5'-GGCTATCTGCCTCTTCTCTCCCG ACCGGCCTGGCGTACAAGACCG, and its complement, corresponding to 22–23 bases on either side of the insert (see Fig. 1BGo, bottom), in a PCR-based protocol using a QuikChange kit (Stratagene Corp.). The resulting clone is referred to as lampVDR.

Cloning of lampVDR from juvenile tissues
First-strand cDNA was prepared from juvenile intestine, skin, and mouth poly(A)+ RNA as described above for larval protospleen and then subjected to PCR amplification using primers flanking insert B in the larval VDR clones: forward primer 5'-CATTGAAATCATCATCCTCCGC-3', corresponding to bp 738–759 of the lampVDR cDNA (Fig. 1Go), and reverse primer 5'-ATCTCTCCACTTCGTCCATCCC-3', corresponding to the antisense of bp 1244–1264. Likewise, primers flanking insert A were designed, consisting of forward primer 5'-GCAACATCACCAAGGACAACCG-3', corresponding to bp 237–258, and reverse primer 5'-GCATTTCTACATTCAGGACTGCCATC-3', corresponding to the antisense of bp 518–543. The absence of inserts A and B was confirmed by sequencing of independent clones from mouth and skin using each primer pair.

Sequence alignments and phylogenetic comparisons
Sequences for VDRs and other related receptors were obtained from GenBank, often by using BLAST searches (http://www.ncbi.nlm.nih.gov/BLAST/). Sequences were aligned using Clustal W, version 1.8 (25). Aligned sequences were then used to construct cladograms in Clustal W but also in Puzzle (version 4.0.2; Ref. 26) and in the Protpars routine from Phylip (version 3.573c; Ref. 27). The insect ultraspiracle protein from Locusta migratoria (accession no. AAF00981.1) and the nhr-8 protein from Caenorhabditis elegans (accession no. AAB88373.1) were used as outgroups.

Transfection and transactivation assays
The pSG5 plasmids (25–50 ng/well) harboring cDNAs for lampVDR, hVDR, or pSG5 vector without cDNA insert were transfected into COS-7 monkey kidney cells (60,000/1.88 cm2 well in a 24-well plate), using a calcium phosphate coprecipitation procedure as previously described (28). All transfections included a human GH reporter plasmid (1.0 µg/well) linked to two or more copies of VDREs from vitamin D-regulated genes. VDREs used for this analysis included the rat osteocalcin VDRE (29) as well as two distinct VDREs from the human CYP3A4 gene, namely a distal VDRE (21) of the DR3 type, with the sequence 5'-GGGTCAgcaAGTTCA-3' (two hexanucleotide half-sites in uppercase), and a proximal VDRE of the ER6 type (21, 30), with the sequence 5'-TGAACTcaaaggAGGTCA-3' (upstream half-site is everted). Some transfections also contained 50 ng/well of a TIF plasmid expressing Danio rerio (zebrafish) RXR{alpha} (31). Cells were incubated for 24 h with 1,25(OH)2D3 or ethanol vehicle, and then culture media were assayed for secreted GH using a kit from Nichols Institute (San Juan Capistrano, CA).

Hormone-binding assay
The pSG5 plasmids (10 µg) harboring cDNAs for lampVDR, hVDR, or pSG5 without cDNA insert were transfected into COS-7 cells (3 x 106 cells/150-mm plate) as described above but without the VDRE reporter construct. After a 48-h incubation without hormone, cells were washed twice with PBS, and then cell lysates were prepared as described in Nakajima et al. (32). The ability of expressed lampVDR to bind [3H]-1,25(OH)2D3 was assessed as described in Whitfield et al. (28), with the following modifications: 10–30 µl of lysate were combined with 30 µl rat liver nuclear lysate, prepared according to Nakajima et al. (33), in 200 µl total volume. [Rat liver contains both RXR{alpha} and RXRß (34) to serve as potential heterodimeric partners for VDR.] The 1,25(OH)2-26,27-[3H]dimethyl-vitamin D3 (Amersham Pharmacia Biotech, original specific activity 163 Ci/mmol) was diluted to 18 Ci/mmol with unlabeled 1,25(OH)2D3 and then further diluted with 90% ethanol/5% isopropanol. After a 15-min incubation on ice, 10 µl of the appropriate dilutions were added to achieve the following approximate final concentrations in nM: 0.1, 0.2, 0.4, 0.8, and 1.6. Binding reactions were incubated overnight on ice. Unbound hormone was removed by incubation for 15 min at 4 C with 80 µl of a 3% suspension of dextran-coated charcoal (Sigma-Aldrich Corp., St. Louis, MO) prepared in 0.15 M NaCl, 0.015 M NaN3, sodium phosphate buffer, pH 7 (0.085 M Na2HPO4 and 0.055 M NaH2PO4), and 0.1% gelatin. Samples were centrifuged at 10,000 x g for 2 min, and supernatants (200 µl) were taken for scintillation counting. Data were transformed for Scatchard analysis using LIGAND (35), a program originally written in BASIC and adapted for the Macintosh by Robert E. Williams (Xoma Corp., Santa Monica, CA).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cloning of lampVDR
PCR using degenerate primers VDR1 and VDR2B yielded an initial 997-bp product from lamprey larval protospleen poly(A)+ RNA. Sequencing revealed an open reading frame whose conceptual translation yielded an amino acid sequence with more than 59% identity to human VDR. However, this reading frame also contained two out-of-frame insertions. Products were also obtained from kidney total RNA samples from cane toad (B. marinus) and lizard (G. gecko). The toad and gecko sequences were used for phylogenetic comparisons (see below).

A 3' RACE reaction yielded a 488-bp product containing the 3' end of the lampVDR coding region, an in-frame stop codon, and 353 bases of 3'-UTR. Numerous 5' RACE reactions using a variety of primers finally produced a 260-bp product that hybridized to a lampVDR probe (see Materials and Methods). This 5'-RACE product contained the 5' end of the lampVDR coding region and 31 bases of 5'-UTR. In addition, two in-frame stop codons (Fig. 1AGo, enclosed in boxes at top) were found within the 5'-UTR, making it highly likely that the complete coding region of the lamprey cDNA clone had been obtained. High-fidelity PCR was then performed using primers in the 5'- and 3'-UTRs (primer sequences given in Materials and Methods). Two independent PCRs each produced a 1349-bp product, which was cloned into T-vector for confirmatory sequencing.

The sequence presented in Fig. 1AGo represents a composite of nine independent, overlapping PCR products, seven partial sequences, and two high-fidelity cDNAs containing the entire coding region. The open reading frame, discounting the two out-of-frame insertions, predicts a protein of 406 amino acids, compared with a range of 420–453 residues for other known VDRs (6, 7, 8, 9, 10, 11). Figure 1BGo displays the two insertions found in larval clones. Insert A (31 bp), found only in the original clone produced by PCR with degenerate primers, occurred precisely at the junction between exons 3 and 4 in the human VDR gene (36). Insert B (41 bp) occurs at a location exactly matching the junction between exons 8 and 9 in the rat (37) and human (36) VDR genes and was found in all five clones obtained from the original larval protospleen. A minor fraction of rat VDR cDNA has been reported (37) to contain a much larger insertion (retained intron) in exactly the same position as insert B, resulting in expression of a truncated VDR with dominant negative activity.

Expression of lampVDR mRNA in juvenile lamprey tissues
To show that lampVDR transcripts exist in which both insertions are lacking, we prepared poly(A)+ RNA from three tissues dissected from juvenile lampreys. Skin, mouth, and intestinal RNAs were subjected to RT-PCR using two sets of primers (Fig. 2Go). One primer set matched sequences in lampVDR-flanking insert A (Fig. 2AGo), and the second primer set flanked insert B (Fig. 2BGo). PCR products from both reactions were cloned and sequenced. As can be seen in Fig. 2AGo, the sequences of PCR products from both mouth and skin were nearly identical with the original larval clone except that insert A was missing from both clones; one clone, that from skin, contained a Thr codon in place of a Met codon at position 98 (three codons past where insert A would have occurred). Likewise, the PCR products seen in Fig. 2BGo also matched the original lamprey clone except that insert B was missing from both clones, and one clone, this time from mouth, contained a different codon at position 371, encoding Gly instead of Ser. Also, both clones differed with the original larval clone at codon 360, which was ACC (Thr) in the larval form but GCC (Ala) in both juvenile clones.



View larger version (65K):
[in this window]
[in a new window]
 
Figure 2. Juvenile lamprey tissues express VDR mRNAs lacking both inserts. A, Poly(A)+ RNAs from three juvenile tissues were subjected to RT-PCR with primers flanking insert A. Skin and mouth samples yielded a PCR product of approximately 310 bp (see gel photograph at top right), but the product from intestine was weak or absent. Products from mouth and skin were subcloned into vector pCR 2.1 (Invitrogen) and sequenced from the M13R and T7 primer sites present in the vector. The cDNA sequence was then conceptually translated to the amino acid sequences shown at the bottom of the panel. Amino acids different from the original larval clone are shown with white text inside a black box. B, RT-PCR, similar to that in A, was performed with primers flanking insert B. The gel shown at top right also contains a 550-bp PCR product, derived from lamprey lactate dehydrogenase, which served to demonstrate that all three samples, including intestine (not shown), contained intact mRNAs. The lack of insert B in mouth and skin was confirmed by sequencing subcloned PCR products. Deduced codons that differ from the original larval sequence are highlighted as in A.

 
Because the differences at positions 98 and 371 occurred only in single reactions, these were judged to be likely PCR artifacts. However, the discrepancy at position 360 occurred in juvenile clones from both skin and mouth and thus may represent a polymorphic variation among the five different animals used in this study (one larval and four juveniles). It should be noted that both a Thr and Ala are found at this position in VDRs from other species (see Fig. 7Go, lower right panel).



View larger version (44K):
[in this window]
[in a new window]
 
Figure 7. Sequence comparisons in selected functional domains between lampVDR, other VDRs, PXRs, and related receptors. Accession numbers for most amino acid sequences are given in legend to Figs. 3Go and 6Go. VDR sequences from G. gecko and the cane toad, B. marinus, are designated as geVDR and tdVDR, respectively, and were obtained as part of this study. Top panel shows a schematic representation of functional domains in hVDR, with lines indicating those regions that were chosen for analysis. The left lower panel contains a comparison of the extreme N terminus of hVDR, compared with selected group 1I receptors, along with the cTR{alpha} (accession no. P04625). Residues of particular interest in this region are a pair of basic residues (shown in red and indicated with plus symbols) that mediate interaction of hVDR with TFIIB (42 ) and a cluster of basic residues that subserve the same function in cTR{alpha} (43 ). Acidic residues are shown in blue type. Those residues in lampVDR that differ significantly from corresponding residues in other VDRs are highlighted in yellow. Panel at bottom center compares sequences just C-terminal to the zinc finger DBD, with emphasis on conserved groups of basic (red) and acidic (blue) amino acids. This region has been shown to contain DNA contacts in a cocrystal of the human thyroid receptor-ß (hTRß) DBD complexed with the same domain of RXR{alpha} on a thyroid hormone response element (62 ). Those known or suspected DNA contacts that are basic charged residues (see text) are indicated by a circled plus symbol; other DNA contacts are shown with solid circles. Residues shown to be important in dimer formation with RXR on a DR3 (hVDR) or DR4 (hTRß) are indicated by a capital D inside a hexagon. The right lower panel illustrates a region near the C terminus that is also involved in dimerization with the RXR coreceptor. The bottom sequence is that of hRAR{alpha} (accession no. A29491), whose ligand-binding domain has been crystallized as a dimer with the ligand-binding domain of mouse RXR{alpha} (46 ). Residues in hRAR{alpha} that form part of the dimer interface are indicated by solid circles or, if the contact is a basic residue, a circled plus symbol. Selected residues in lampVDR, zfVDR, tdVDR, xVDR, or geVDR that differ from other VDRs are shown with yellow highlighting.

 
Curiously, poly(A)+ RNA from intestine, a tissue that contains a relatively high level of VDR in higher vertebrates (e.g. Ref. 38), did not yield PCR products for lampVDR in a reproducible fashion. This observation does not reflect poor condition of intestinal RNA because a 550-bp PCR product for lamprey lactate dehydrogenase was readily obtained from this RNA (Fig. 2BGo and data not shown).

General comparison of lampVDR with related nuclear receptors
The deduced amino acid sequence of lampVDR showed an overall amino acid identity of 59–62% with other vertebrate VDRs (Fig. 3Go). The highest overall identity to lampVDR among other vertebrate VDRs is seen with flounder VDRa (62.2%), and the lowest identity is with X. laevis VDR (58.4%). By comparison, human VDR exhibits 67% or greater identity with other vertebrate VDRs (excluding lampVDR). Thus, lampVDR represents the most divergent member of the known VDRs. The amino acids that show identity to other VDRs tend to occur in regions of known functional significance. Accordingly, the zinc finger DNA-binding domain (DBD, black shading) in lampVDR contains 58 of 66 residues (87.9%) that are identical with those in human VDR. Also, of 14 residues known to contact the 1,25(OH)2D3 ligand in the hVDR ligand-binding domain crystal (39) (these residues are localized in the gray shaded areas in Fig. 3Go and are circled in Fig. 1AGo), 13 residues (92.9%) are identical in lampVDR. The heterodimerization interface with RXR (hatched in Fig. 3Go) is less well defined in VDRs, with the only relevant crystal data being from a heterodimer of mouse RXR{alpha} with the all-trans-retinoic acid receptor, hRAR{alpha}. By analogy to this crystal, the general regions involved in heterodimerization (hatched in Fig. 3Go) display from 57–63% identity when lampVDR is compared with known VDRs from other vertebrate species (see also Fig. 7Go, below).



View larger version (39K):
[in this window]
[in a new window]
 
Figure 3. Amino acid sequence identities between the lampVDR clone (without insertions) and related nuclear receptors. VDRs are from the following species, with GenBank accession numbers in parentheses: flVDRa, Japanese flounder (P. olivaceus) VDRa (BAA95016); zfVDR, zebrafish D. rerio (AAF21427); xVDR, African clawed frog X. laevis (U91846); cVDR, chicken Gallus gallus (AAB62579.1); hVDR, human (NP_000367). The human PXR (hPXR) sequence was accessed at AF061056, the xONR sequence at CAA53006.1, and the hCAR sequence was taken from NM_005122. The ecdysone receptor from the insect L. migratoria (LmEcR), accession no. AAD19828, represents a group 1H receptor used as an outgroup for the cladogram in Fig. 6AGo. DBD is shown as black shading; other functional domains are identified in the key at the top. Numbers given above the schematic sequences represent additional (+) or missing (-) amino acid positions relative to the lamprey sequence.

 
Although lampVDR is the most divergent VDR, compared with other VDRs, it tends to show a higher sequence similarity to the NR1I2 and NR1I3 receptors than do other VDRs. For example, lampVDR has 43.6% identity with the Xenopus orphan nuclear receptor (ONR), 43.0% identity to human pregnane X receptor (PXR), and 39.2% to human constitutive androstane receptor (CAR), whereas hVDR possesses amino acid identities of only 42.0%, 39.1%, and 36.2% to human PXR, Xenopus ONR (xONR), and human CAR, respectively. NR1I2 and NR1I3 receptors like PXR and CAR are currently thought to function primarily as mediators of xenobiotic ligand detoxification via induction of CYPs and ATP-binding cassette transporters (40).

Assessment of 1,25(OH)2D3 hormone binding by lampVDR
Larval lampVDR cDNAs in a pSG5 expression construct, both containing and lacking insert B, were transfected into VDR-deficient COS-7 cells to test the ability of expressed lampVDR to bind radiolabeled 1,25(OH)2D3, using pSG5-hVDR as a positive control. LampVDR expressed from a cDNA that retained insert B was unable to bind hormone at the tested concentrations of 1,25(OH)2D3 (0.1–1.6 nM), showing only background levels of [3H]1,25(OH)2D3 in the protein-bound fraction, which, in COS-7 cells, typically constitute less than 500 receptors/cell (data not shown). When COS-7 cultures were transfected with either insertless lampVDR or an hVDR positive control; however, the number of high-affinity, saturable receptors was much higher, averaging 5.4 ± 2.7 x 105 receptors/cell for lampVDR and 3.0 ± 0.4 x 105 receptors/cell for hVDR SD, n = 3). Moreover, as illustrated in Fig. 4BGo, the insertless lampVDR cDNA expressed a protein that bound 1,25(OH)2D3 with high affinity. In three independent experiments, dissociation constants for 1,25(OH)2D3 of lampVDR ranged from 0.1 to 1.4 nM and were typically three times greater than the dissociation constants determined for matched hVDR controls (Fig. 4AGo). Thus, lampVDR can be considered a bona fide VDR based on its high affinity for the 1,25(OH)2D3 hormonal ligand.



View larger version (19K):
[in this window]
[in a new window]
 
Figure 4. LampVDR binds 1,25(OH)2D3 with high affinity. Insert B was removed by site-directed mutagenesis (see Materials and Methods) to produce lampVDR in the expression plasmid pSG5, which was introduced into COS-7 cells by transfection. Lysates were prepared from these cultures as well as control cultures receiving pSG5-hVDR, pSG5 vector lacking a receptor cDNA, or pSG5 harboring a lampVDR cDNA-containing insert B, and used in saturation binding assays with [3H]-1,25(OH)2D3 (see Materials and Methods). Data are shown as Scatchard transformations for hVDR (A) and lampVDR (B). Nonspecific binding was assessed in lysates from cultures containing the pSG5 vector alone (not shown). The results are representative of three independent experiments.

 
Evaluation of functional transcriptional activation by lampVDR
The ability of lampVDR to activate transcription was examined in transfected mammalian cell lines in a series of experiments using reporter genes linked to three different hormone-responsive elements from two different genes, namely rat osteocalcin and human CYP3A4 (41). Two of these VDREs were imperfect direct AGGTCA repeats separated by a spacer of three nucleotides (DR3), exemplified by the human CYP3A4 VDRE with the sequence GGGTCAgcaAGTTCA (hexanucleotide repeats are in upper case). When cultures of COS-7 cells were transfected with insertless lampVDR and a reporter construct containing four copies of the well-characterized rat osteocalcin VDRE, the level of reporter gene expression was only slightly elevated (1.93x) and not significantly higher than that seen in control cells transfected with a pSG5 expression plasmid containing no VDR cDNA insert (1.09x) (Fig. 5AGo, compare right two bars with left two bars). In contrast, hVDR mediated a robust (40.8x) transcriptional response from the osteocalcin VDRE (Fig. 5AGo), as shown in many previous studies (reviewed in Ref. 1). When tested on an everted repeat (ER6) element from the human CYP3A4 gene (Fig. 5BGo), lampVDR appeared to mediate a small, but not significant, transcriptional response to 10-8 M 1,25(OH)2D3, again in contrast to hVDR, which showed a nearly 18-fold induction by 1,25(OH)2D3. However, lampVDR was able to mediate a significant functional response (3.91x) from the CYP3A4 distal VDRE of the DR3 type (Fig. 5CGo). This response was enhanced to 4.5x (Fig. 5DGo) by the cotransfection of zebrafish RXR{alpha}. In three independent experiments using zebrafish RXR{alpha}, the reporter gene up-regulation mediated by lampVDR in the presence of 10-8 M 1,25(OH)2D3 was 4.54-, 5.21-, and 4.50-fold, compared with values with the insertless pSG5 expression vector of 1.17-, 1.34-, and 1.44-fold, respectively. LampVDR also appeared to be capable of inhibiting reporter gene transcription in the absence of hormone (e.g. Fig. 5DGo, white bar marked with ***).



View larger version (32K):
[in this window]
[in a new window]
 
Figure 5. LampVDR shows a selective ability to mediate 1,25(OH)2D3-dependent transactivation from mammalian VDREs. COS-7 cells were transfected with an empty pSG5 expression plasmid (control), pSG5 plasmid expressing hVDR, or pSG5 vector expressing a lampVDR lacking both inserts. All transfections received a reporter plasmid with a thymidine kinase promoter-driving expression of human GH under the control of various VDREs. A, Four copies of the rat osteocalcin VDRE (29 ). B, Two copies of the proximal ER6-type element from the human CYP3A4 gene (21 30 ). C and D, Two copies of the distal DR3-type element from the human CYP3A4 gene (Ref. 21 ; see Materials and Methods for sequences of these elements). The experiment illustrated in D also included a TIF expression plasmid for zebrafish RXR{alpha} (31 ) to serve as the heterodimeric partner for lampVDR in addition to the monkey RXR{alpha} contained in the recipient COS-7 cells. Results are expressed as the amount of human GH secreted in a 24- to 48-h period after transfection. *, Differs from corresponding control value, P < 0.05. **, Differs from control, P < 0.01. ***, Differs from control, P < 0.005. Bars (D) represent the average of quadruplicate values ± SD and are typical of three independent experiments.

 
Phylogenetic comparison of lampVDR with other nuclear receptors
Given the sequence and functional similarity between lampVDR and other VDRs, a phylogenetic analysis was performed to place lampVDR into the context of the complete human group 1 nuclear receptor complement, using an insect group 2 receptor as an outgroup (Fig. 6AGo). The resulting cladogram confirms that lampVDR is in subgroup NR1I containing known VDRs (1I1) as well as PXRs (1I2) and CARs (1I3). An expanded analysis of lampVDR with a more extensive sampling of group 1I nuclear receptors is shown in Fig. 6BGo. This analysis includes receptors from mammals, one avian species, one reptile, two amphibians, and three bony fishes. Two VDR sequences, from G. gecko (reptile) and B. marinus (amphibian), were obtained in our laboratory and are here reported for the first time. In addition, the analysis includes the closest BLAST hits to human and lampVDRs from the genomes of tunicate (Ciona intestinalis), fruitfly (Drosophila melanogaster), and nematode (C. elegans). Among the subgroup 1I receptors, lampVDR unambiguously groups with other VDRs. Numerous other phylogenetic analyses have been performed using different selections of receptors and different regions of the amino acid alignment, but, as shown here, lampVDR always forms the basal member of the VDR grouping and does not group with either the PXRs or CARs (data not shown).



View larger version (41K):
[in this window]
[in a new window]
 
Figure 6. Phylogenetic relationships between lampVDR and other group 1 nuclear receptors. A, LampVDR groups with hVDR, hPXR, and the human xenobiotic-binding receptor CAR in subgroup 1I, compared with the entire complement of human group 1 receptors. Amino acid sequences of human receptors were obtained from the GenBank database. Sources for hVDR, hPXR, and hCAR are given in the legend to Fig. 3Go. Other human receptors have the following GenBank accession numbers: liver X receptor-{alpha} (LXR{alpha}), AAA85856; LXRß, P55055; farnesoid X receptor (FXR), NP_005114; thyroid hormone receptor-{alpha} (TR{alpha}), CAA38749; TRß, TVHUAR; RAR{alpha}, A29491; RARß, NP_000956; RAR{gamma}, AAA52692; peroxisome proliferator activated receptor-{alpha} (PPAR{alpha}), NP_005027; PPARß, CAB38629; PPAR{gamma}, BAA23354; reverb{alpha}, XP_113329; reverbß, Q14995; RAR-related orphan receptor-{alpha} (ROR{alpha}), U04897; RORß, Y08639; ROR{gamma}, U16997. The ultraspiracle protein from the insect L. migratoria (accession no. AAF00981.1) was used as an outgroup for this analysis. A conserved region of 105 amino acids representing the zinc finger DBD and its CTE (see C below) were used to construct this cladogram in Clustal W (25 ). B, LampVDR is the basal member of known VDRs in subgroup 1I. The phylogenetic position of lampVDR relative to known subgroup 1I receptors from other species was analyzed as in A, except that a 331 amino acid alignment was used, which encompassed approximately two thirds of the DBD (seven of the nine conserved cysteines) and most of the hormone binding domain of VDRs (see C, below). The definitions and accession numbers for hVDR, hPXR, and hCAR are given in the legend to Fig. 3Go, and the sources of cVDR, xVDR, zfVDR, flVDRa, xONR, and hCAR can be found in the description of Fig. 3Go (above). Additional receptors included are: mouse VDR (mVDR), AAH06716; G. gecko VDR (geVDR), this study; cane toad (B. marinus) VDR (tVDR), this study; pufferfish (Takifugu rubrides) VDRa-like protein (fuVDRa), SINFRUP00000073157; Japanese flounder (Paralichyths olivaceus) VDRb (flVDRb), BAA95015; mouse PXR (mPXR), AAC39964; X. laevis benzoate receptor-ß (xBXRß), AAG24910.1; pufferfish PXR-like protein (fuPXR), SINFRUP00000078207; zebrafish PXR (zfPXR), AAM10635.1; pufferfish VDRb-like protein (fuVDRb), SINFRUP00000064850; mouse CAR (mCAR), AAC53349.1; and chicken xenobiotic receptor (cPXR), AAG18374. Pufferfish sequences were taken from http://scrappy. fugu-sg.org/Fugu_rubripes/blastview. The complete genomes of the tunicate C. intestinalis, the fruitfly D. melanogaster, and the nematode C. elegans were searched using BLAST at the following web addresses: http://genome.jgi-psf.org/ciona4/ciona4.home.html, http://www.ncbi.nlm. nih.gov/blast/, and http://www.wormbase.org/db/searches/blast. Those proteins showing the best matches to the hVDR and lampVDR amino acid sequences were included in the analysis, namely tunicate proteins ci0100135732 (35732) and ci0100152224 (52224), the fruitfly ecdysone receptor (EcR; P34021), and the nematode proteins daf12 (CAC42284) and nhr8 (NP_741445). The cladogram, with bootstrapping, was created in Clustal W (25 ). C, Schematic diagram of an idealized nuclear receptor showing the segments of amino acid sequence used for the comparisons shown in A and B. E1 and AF2 regions are defined in the legend to Fig. 1AGo. MTCEGCK and DLRSL refer to conserved sequences in VDRs that define the N- and C-terminal ends, respectively, of the amino acid regions used for the analysis shown in B.

 
Detailed comparison of functional domains in lampVDR with other VDRs and closely related nuclear receptors
Selected regions of the amino acid sequence from subgroup 1I receptors are shown in Fig. 7Go. The first of these regions (left side of figure) is the N-terminal region that contains a docking site for general transcription factor IIB (TFIIB) in hVDR (42) and the chicken thyroid receptor-{alpha} (cTR{alpha}; Ref. 43). In both cases, the interacting region contains two or more basic residues (indicated by circled plus symbols and enclosed by brackets for hVDR and cTR{alpha}), flanked on the N-terminal side by a single acidic residue (indicated by a boxed minus symbol). The sequence of lampVDR in this region contains only one of the two basic amino acids that are otherwise conserved in all vertebrate VDRs (missing basic residue and other selected sequence divergences highlighted in yellow). Also, lampVDR is similar to the PXRs in that the putative TFIIB docking site is flanked on the N-terminal side by an extensive stretch of acidic residues. These differences between lampVDR and other vertebrate VDRs could conceivably impact the transactivation potential of lampVDR when tested in a mammalian system. Indeed, a common polymorphic variant of hVDR has been reported in which the removal of a negatively charged residue from the N terminus enhances transcriptional activity (42, 44).

The second region analyzed is a C-terminal extension (CTE) of the DNA-binding region (Fig. 7Go, center). This region contains clusters of basic amino acids (shown in red) that are conserved between lampVDR and hVDR in a pattern that is distinctive for each subgroup of group 1 receptors (45).

The third region examined in Fig. 7Go is a portion of the C-terminal ligand-binding domain that has been shown to form part of the dimerization interface in a cocrystal of hRAR{alpha} with mouse RXR{alpha} (46). Unlike the previously discussed two regions, the sequence of lampVDR in this putative dimer interface is quite divergent from that of other VDRs (differing residues shown in yellow) and also related receptors, PXRs and CARs (Fig. 7Go and data not shown).


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The identification of the cDNA cloned in these experiments as encoding a lamprey ortholog to VDR is based on the following: 1) BLAST searches with the lampVDR amino acid sequence return the top 12 matches as vertebrate VDRs with 58–62% identity to lampVDR (most of these are included in the Fig. 6BGo cladogram); 2) the next closest receptor by BLAST analysis, PXR, shows less than 44% identity to lampVDR; 3) lampVDR binds 1,25(OH)2D3 with high affinity; and 4) lampVDR is capable of mediating 1,25(OH)2D3-dependent transactivation from a VDRE-containing reporter gene. However, our data cannot exclude the possibility that the lamprey genome may harbor a second VDR gene, such as is found in pufferfish and flounder.

The present report of a bona fide VDR from an agnathan reveals that this nuclear receptor has a more ancient origin than previously suspected. Complete cDNAs have been reported of apparent VDR homologs from teleost fishes, and, taken together with previous reports of high-affinity 1,25(OH)2D3 binding in species such as trout (47), eel (16), and cod (17), provide evidence that teleost fishes possess functional VDRs. However, lampreys represent a far more ancient group of fishes than teleosts, having diverged from other vertebrates over 450 million years ago (18, 19, 20).

The affinity of lampVDR for 1,25(OH)2D3 is slightly lower than that of human VDR. This could be due to variation in a residue known to be a ligand contact in the human receptor (39), namely Val-418, which is a leucine in lampVDR. It is perhaps worth noting that the levels of circulating 1,25(OH)2D3 reported for a Japanese lamprey species, E. japonicus (13), are, at 274 pg/ml, approximately 7- to 8-fold higher than the average 1,25(OH)2D3 levels of 33 pg/ml (48) and 36 pg/ml (49) reported for normal human subjects. Thus, the lower ligand-binding affinity of lampVDR determined in the present study would seem to be compatible with the higher circulating levels of 1,25(OH)2D3, at least in one lamprey species.

Additional functional testing revealed that lampVDR is capable of modest but reproducible and significant 1,25(OH)2D3-dependent transactivation from a DR3-type responsive element found in the human CYP3A4 gene (Fig. 5Go, C and D). LampVDR did not show measurable activity from either the rat osteocalcin VDRE, also of the DR3 type, or ER6-type element in the human CYP3A4 gene. The fact that lampVDR transcriptional activity is of a lower magnitude (5x), compared with hVDR (20x) when tested in a mammalian cell transfection system, could be due to several potential factors. One possibility is that lampVDR may not interact well with mammalian proteins required for transactivation, such as with TFIIB or the endogenous (monkey) RXR isoforms in the host cells used for transfection. As noted above, the amino acid sequence of lampVDR is quite divergent from that of other VDRs in a region corresponding to a dimerization domain in hRAR{alpha} (Fig. 7Go, bottom right). This possibility is further supported by gel mobility shift analyses, which demonstrated that lampVDR was incapable of forming a detectable complex with human RXR{alpha} on either the rat osteocalcin VDRE or mouse osteopontin VDRE (with the sequence GGTTCAcgaGGTTCA) (50), under conditions that allowed for strong complex formation by hVDR (data not shown). That mammalian RXRß or RXR{gamma} isoforms are also not ideal partners for lampVDR is strongly suggested by transactivation experiments performed in HeLa cells (containing mainly human RXRß) (51) or HT-29 cells (containing mainly human RXR{gamma}) (52), which also showed no activity with the rat osteocalcin VDRE reporter construct (data not shown). The additional observation that zebrafish RXR{alpha} was able to boost transactivation by lampVDR (Fig. 5DGo) is consistent with the fact that three recently isolated lamprey RXR isoforms show slightly higher amino acid sequence identities to zebrafish RXR{alpha} (72%, 73%, and 72%), compared with identities to human RXR{alpha} of 70%, 70%, and 69%, respectively (Manzon, L. A., and J. H. Youson, unpublished data).

The evident difficulty in heterodimerization between lampVDR and mammalian RXRs may help explain the selectivity of lampVDR with respect to transactivation. The CYP3A4 DR3 (GGGTCAgcaAGTTCA) (taken from Ref. 21), which supported measurable transcriptional activation by lampVDR (Fig. 5Go, C and D), represents a nearly perfect high-affinity site for VDR-RXR binding, as determined by binding of hVDR-RXR heterodimers to random oligonucleotides (reported as PuGGTCAxxgPuGTTCA, where Pu is either A or G) (53, 54). Thus, a perfect VDRE may be able to compensate in some way for an imperfect heterodimeric partner, perhaps because of the very high affinity of VDR and RXR for their respective DR3 half-elements.

Another, more speculative explanation relates to the type of gene from which the VDRE was taken. Rat osteocalcin is a Gla-containing, calcium-binding protein expressed in bone that likely has no counterpart in the boneless lamprey. On the other hand, CYP3A4 is an enzyme whose function is believed to be detoxification of xenobiotics. Recent studies have shown that VDR can not only regulate human CYP3A4 in intestine (21, 41) but can also bind to certain toxic ligands such as the secondary bile acid, lithocholic acid, presumably serving as a sensor to activate detoxification of these compounds in mammals (55). This novel activity of VDR is similar to reported actions of PXR and CAR (56), perhaps reflecting the close evolutionary relationship of these receptors (Fig. 6Go). It has been reported further that a protein in C. elegans, nhr-8, whose amino acid sequence shows a similarity to the VDR/PXR/CAR grouping (57), plays a role in detoxification of colchicine and chloroquine in the nematode gut (58). This observation suggests that activation of detoxification pathways may be a very ancient function of group 1I receptors (58).

The present phylogenetic analyses confirm that PXRs and CARs are the closest relatives of VDR. Indeed, a standardized nuclear receptor nomenclature system places VDRs and PXRs/xONRs as the sister groups NR1I1 and NR1I2 (2, 59). Another striking similarity between VDRs and the PXR/ONR grouping exists as well because these receptors are the only known members of the superfamily to heterodimerize with RXR on a DR3-type responsive element (60, 61). The ability of VDRs and PXRs to preferentially bind DR3-type elements is perhaps reflected in the conservation of the amino acid residues in the DBD. A cocrystal of the human thyroid hormone receptor-ß and human RXR-{alpha} DBDs on a thyroid hormone DNA response element (62) has revealed that residues just C-terminal to the zinc finger DNA-binding motifs in the thyroid hormone receptor make very significant DNA contacts. Further, of 10 such contacts, six involve positively charged residues. When the corresponding regions of VDRs and PXRs are examined (Fig. 7Go, center panel; see also Ref. 45), it can be seen that clusters of positively charged residues occur in the CTE of the DBD. The conservation of these positively charged clusters between VDRs (including lampVDR) and PXRs is striking and entirely consistent with the above-cited observation that these receptors, alone among known nuclear receptors, bind to DR3-type DNA elements (45, 60, 61, 62).

This high degree of relatedness suggests that VDRs (NR1I1) and the PXR/xONR group (NR1I2) diverged relatively recently in evolutionary history, presumably by means of gene duplication (reviewed in Ref. 63). The analysis in Fig. 6BGo suggests that such a duplication may have taken place before the divergence of vertebrates from nonvertebrate chordates, perhaps during one of two genome-wide duplications proposed to have transpired in early vertebrate evolution (63). This conclusion is based on the presence of separate VDR-like and PXR-like sequences in the pufferfish genome and also on the observation that related sequences from tunicate, fruitfly, and nematode seem to predate the divergence of VDR from PXRs. However, this conclusion must remain tentative because of the uncertainty of whether lampreys or other groups, such as cephalochordates, contain PXR-like sequences. Regarding CARs (NR1I3), the absence of any CAR-like sequences in fish suggests that CAR may be a tetrapod innovation. The exact timing of these divergences must await the analysis of sequences from other taxa. Nevertheless, the present analysis points to an origin of VDR at the dawn of vertebrates. What, then, might have been its ancestral function?

Studies of mice in which the VDR has been ablated support the traditional view that VDR, with its 1,25(OH)2D3 ligand, plays a crucial role in the formation of calcified structures (bones and teeth) by acting as a hypercalcemic hormone to promote both calcium and phosphate absorption from the intestine as well as calcium and phosphate retention at the kidney (4, 64). Other studies of VDR null mice have also revealed a role for VDR in skin, mainly in the mammalian hair cycle (5). Translation of these observations in mice to the physiology of lampreys is made difficult by the absence in the latter species of a calcified skeleton and teeth, as well as hair. Nevertheless, related functions may exist in lampreys, or in their ancestors, that may be regulated by VDR.

There are fossil groups of jawless fishes that possessed extensive dermal plates, thought to have contained a calcium phosphate derivative (18, 19). One interpretation (reviewed in Ref. 18) holds that lampreys are descendants of these armored agnathans and that extant lampreys have secondarily lost the ability to form these calcified structures. Two published observations would tend to support this view: an extant lamprey species, Ichthyomyzon unicuspis, has been reported to possess calcified cartilage in the head region (65), and living (but not dead) tissues from P. marinus adult specimens (head region) have been shown to be capable of calcifying the extracellular matrix when supplied with sufficient calcium and phosphate in organ culture (66).

If it is true that modern lampreys are descended from organisms that had calcified head plates, then the ability to form calcified structures (including, presumably, VDR action to mediate calcium homeostasis) may still be latent in lampreys but not actually expressed. This lack of VDR activity could be due to a lower level of lampVDR expression in key tissues such as intestine and kidney or an inactivation of lampVDR at key times in development. It is conceivable that both of these mechanisms might be at work in P. marinus because we have observed both a low level of intestinal expression of lampVDR in the juvenile as well as inactivating insertions in the larval protospleen. A more complete examination of larval juvenile and adult tissues will be required to fully examine this hypothesis.

An alternative interpretation of vertebrate evolution (reviewed in Ref. 19) is that lampreys diverged from other vertebrates before the advent of calcified tissues. If this view is correct, then the occurrence of VDR in a lamprey is evidence that VDR phylogenetically predates calcified structures. This does not totally preclude a role for lampVDR in calcium homeostasis because calcium levels might require regulation for other physiologic reasons. However, a role for VDR in skin differentiation is well established (5), and lampreys, although lacking hair, do have specialized skin structures such as keratinized teeth and mucous glands (67). Whether VDR regulates the development or maintenance of either teeth or mucous glands in lampreys is unknown, although the (qualitatively) high expression of normally spliced lampVDR mRNA in juvenile skin and mouth tissue is consistent with such a possibility.

As introduced above, another candidate function for lampVDR is as a sensor for endogenous or exogenous toxins and an inducer of CYP enzymes to detoxify them. An implication of this idea for VDR is that the toxins themselves, rather than (or in addition to) 1,25(OH)2D3, are ligands for VDR. Indeed, human and rodent VDRs have recently been shown to bind to and be activated by toxic bile salt derivatives, including lithocholic acid and 3-keto lithocholic acid (55). Whether lampVDR binds to the lamprey versions of bile acids or their derivatives has not yet been tested.

Yet a third possibility for a VDR function in lampreys is suggested by many studies documenting a role of the 1,25(OH)2D3-VDR system in the regulation of immune function. In mammals, VDR is involved in differentiation and regulation of certain immune cell types, including T-cells (see reviews in Refs. 68, 69). Although lampreys appear to lack the defining characteristics of the adaptive or combinatorial immune system in higher vertebrates, namely immunoglobulins, T cell receptors, or recombination activator genes (70), larval lampreys do possess cells in either protospleen (71) or gut epithelium (72, 73) that not only morphogenetically resemble lymphocytes but, in the case of the gut-associated cells, also express genes that are known to be crucial for lymphocyte differentiation in higher vertebrates (73, 74, 75). Our attempts to isolate lampVDR from juvenile intestine and larval peripheral blood lymphocytes have been either equivocal (intestine) or consistently negative (peripheral blood lymphocytes, data not shown). Also, as noted above, larval intestine yielded lampVDR transcripts that appear to contain inactivating insertions. Nevertheless, it might be worthwhile to examine more thoroughly the possibility of lampVDR expression in larval and/or juvenile lymphocyte-related cells, or in the adult fat column, in which lymphoid-like cells have been shown to reside (76).

In summary, the modern actions of VDR in terrestrial animals relating to a mineralized skeleton for locomotion and hair growth for protection from the sun are clearly not relevant in the sea lamprey. Instead, it must be hypothesized that VDR plays a different and, perhaps, more fundamental role in this ancient vertebrate. A full appreciation of the evolution of the VDR/PXR/CAR nuclear receptor grouping will require further studies in a variety of vertebrates with an ancient lineage as well as in key organisms such as protochordates and echinoderms. The presence of the related nhr-8 receptor in C. elegans, as noted above (57, 58), indicates that the evolutionary history of the VDR/PXR/CAR grouping could be very ancient indeed.


    Acknowledgments
 
The authors are grateful to S. M. Myskowski for patient proofing of sequence data, B. Beckett and M. Petrovich for the zebrafish RXR{alpha} expression plasmid, and J. B. Whitfield for helpful discussions regarding the phylogenetic analysis. The novel nucleotide sequences presented in this manuscript have been submitted to GenBank under the following accession numbers: lampVDR, AY249863; geVDR, AY254096; tdVDR, AY268062.


    Footnotes
 
This work was supported by a seed grant from the University of Arizona Office of Vice President for Research (to G.K.W.), National Science Foundation Grants MCB-9906439 and MCB-0221487 (to J.J.M.), NIH grants (to M.R.H.), and research support from the Natural Sciences and Engineering Council of Canada (to J.H.Y.). T.B. was a participant in the Undergraduate Biology Research Program at the University of Arizona, funded in part by the Howard Hughes Medical Institute. L.A.M. was supported by an Ontario Graduate Scholarship in Science and Technology.

Abbreviations: CAR, Constitutive androstane receptor; CTE, C-terminal extension; cTR{alpha}, chicken thyroid receptor-{alpha}; CYP, cytochrome P450-containing enzyme; DBD, DNA-binding domain; 1,25(OH)2D3, 1,25-dihydroxyvitamin D3; hRAR, human retinoic acid receptor; hVDR, human vitamin D receptor; lampVDR, lamprey vitamin D receptor; ONR, orphan nuclear receptor; PXR, pregnane X receptor; RACE, rapid amplification of cDNA ends; RXR, retinoid X receptor; SSPE, sodium chloride/sodium phosphate/EDTA; TFIIB, transcription factor IIB; UTR, untranslated region; VDR, vitamin D receptor; VDRE, vitamin D responsive element; xONR, Xenopus ONR.

Received October 23, 2002.

Accepted for publication February 3, 2003.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Haussler MR, Whitfield GK, Haussler CA, Hsieh J-C, Thompson PD, Selznick SH, Encinas Dominguez C, Jurutka PW 1998 The nuclear vitamin D receptor: biological and molecular regulatory properties revealed. J Bone Miner Res 13:325–349[CrossRef][Medline]
  2. Whitfield GK, Jurutka PW, Haussler CA, Haussler MR 1999 Steroid hormone receptors: evolution, ligands and molecular basis of biologic function. J Cell Biochem Suppl 32/33:110–122
  3. Li YC, Pirro AE, Amling M, Delling G, Baron R, Bronson R, Demay MB 1997 Targeted ablation of the vitamin D receptor: an animal model of vitamin D-dependent rickets type II with alopecia. Proc Natl Acad Sci USA 94:9831–9835[Abstract/Free Full Text]
  4. Yoshizawa T, Handa Y, Uematsu Y, Takeda S, Sekine K, Yoshihara Y, Kawakami T, Arioka K, Sato H, Uchiyama Y, Masushige S, Fukamizu A, Matsumoto T, Kato S 1997 Mice lacking the vitamin D receptor exhibit impaired bone formation, uterine hypoplasia and growth retardation after weaning. Nat Genet 16:391–396[CrossRef][Medline]
  5. Sakai Y, Kishimoto J, Demay MB 2001 Metabolic and cellular analysis of alopecia in vitamin D receptor knockout mice. J Clin Invest 107:961–966[Medline]
  6. Baker AR, McDonnell DP, Hughes MR, Crisp TM, Mangelsdorf DJ, Haussler MR, Pike JW, Shine J, O’Malley BW 1988 Cloning and expression of full-length cDNA encoding human vitamin D receptor. Proc Natl Acad Sci USA 85:3294–3298[Abstract/Free Full Text]
  7. Burmester JK, Wiese RJ, Maeda N, DeLuca HF 1988 Structure and regulation of the rat 1,25-dihydroxyvitamin D3 receptor. Proc Natl Acad Sci USA 85:9499–9502[Abstract/Free Full Text]
  8. Kamei Y, Kawada T, Fukuwatari T, Ono T, Kato S, Sugimoto E 1995 Cloning and sequencing of the gene encoding the mouse vitamin D receptor. Gene 152:281–282[CrossRef][Medline]
  9. Lu Z, Hanson K, DeLuca HF 1997 Cloning and origin of the two forms of chicken vitamin D receptor. Arch Biochem Biophys 339:99–106[CrossRef][Medline]
  10. Li YC, Bergwitz C, Jüppner H, Demay MB 1997 Cloning and characterization of the vitamin D receptor from Xenopus laevis. Endocrinology 138:2347–2353[Abstract/Free Full Text]
  11. Suzuki T, Suzuki N, Srivastava AS, Kurokawa T 2000 Identification of cDNAs encoding two subtypes of vitamin D receptor in flounder, Paralichthys olivaceus. Biochem Biophys Res Commun 270:40–45[CrossRef][Medline]
  12. Koelle MR, Talbot WS, Segraves WA, Bender MT, Cherbas P, Hogness DS 1991 The Drosophila EcR gene encodes an ecdysone receptor, a new member of the steroid receptor family. Cell 67:59–77[CrossRef][Medline]
  13. Kobayashi T, Takeuchi A, Okano T 1991 An evolutionary aspect in vertebrates from the viewpoint of vitamin D3 metabolism. In: Norman AW, Bouillon R, Thomasset M, eds. Vitamin D: gene regulation, structure-function analysis and clinical application. New York: Walter de Gruyter; 679–680
  14. Avila EM, Basantes SP, Ferraris RP 1999 Cholecalciferol modulates plasma phosphate but not plasma vitamin D levels and intestinal phosphate absorption in rainbow trout (Oncorhynchus mykiss). Gen Comp Endocrinol 114:460–469[CrossRef][Medline]
  15. Chandler JS, Pike JW, Hagan LA, Haussler MR 1980 A sensitive radioreceptor assay for 1{alpha}, 25-dihydroxyvitamin D in biological fluids. Methods Enzymol 67:522–528[Medline]
  16. Marcocci C, Freake HC, Iwasaki J, Lopez E, MacIntyre I 1982 Demonstration and organ distribution of the 1, 25-dihydroxyvitamin D3-binding protein in fish (A. anguilla). Endocrinology 110:1347–1354[Abstract/Free Full Text]
  17. Sundell K, Bishop JE, Bjornsson BT, Norman AW 1992 1, 25-Dihydroxyvitamin D3 in the Atlantic cod: plasma levels, a plasma binding component, and organ distribution of a high affinity receptor. Endocrinology 131:2279–2286[Abstract/Free Full Text]
  18. Forey P, Janvier P 1993 Agnathans and the origin of jawed vertebrates. Nature 361:129–134[CrossRef]
  19. Donoghue PCJ, Forey PL, Aldridge RJ 2000 Conodont affinity and chordate phylogeny. Biol Rev Camb Philos Soc 75:191–251[Medline]
  20. Shu D-G, Luo H-L, Conway Morris S, Zhang X-L, Hu S-X, Chen L, Han J, Zhu M, Li Y, Chen L-Z 1999 Lower Cambrian vertebrates from south China. Nature 402:42–46
  21. Thompson PD, Jurutka PW, Whitfield GK, Myskowski SM, Eichhorst KR, Encinas Dominguez C, Haussler CA, Haussler MR2002 Liganded VDR induces CYP3A4 in small intestinal and colon cancer cells via DR3 and ER6 vitamin D responsive elements. Biochem Biophys Res Commun 299:730–738
  22. Li AP, Kaminski DL, Rasmussen A 1995 Substrates of human hepatic cytochrome P450 3A4. Toxicology 104:1–8[CrossRef][Medline]
  23. Hsieh J-C, Jurutka PW, Nakajima S, Galligan MA, Haussler CA, Shimizu Y, Shimizu N, Whitfield GK, Haussler MR 1993 Phosphorylation of the human vitamin D receptor by protein kinase C: biochemical and functional evaluation of the serine 51 recognition site. J Biol Chem 268:15118–15126[Abstract/Free Full Text]
  24. Green S, Isseman I, Sheer E 1988 A versatile in vivo and in vitro eukaryotic expression vector for protein engineering. Nucleic Acids Res 16:369[Free Full Text]
  25. Thompson JD, Higgins DG, Gibson TJ 1994 CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22:4673–4680[Abstract/Free Full Text]
  26. Strimmer K, von Haeseler A 1996 Quartet puzzling: a quartet maximum likelihood method for reconstructing tree topologies. Mol Biol Evol 13:964–969
  27. Felsenstein J 1988 Phylogenies from molecular sequences: inference and reliability. Ann Rev Genet 22:521–565[CrossRef][Medline]
  28. Whitfield GK, Selznick SH, Haussler CA, Hsieh J-C, Galligan MA, Jurutka PW, Thompson PD, Lee SM, Zerwekh JE, Haussler MR 1996 Vitamin D receptors from patients with resistance to 1, 25-dihydroxyvitamin D3: point mutations confer reduced transactivation in response to ligand and impaired interaction with the retinoid X receptor heterodimeric partner. Mol Endocrinol 10:1617–1631[Abstract/Free Full Text]
  29. Terpening CM, Haussler CA, Jurutka PW, Galligan MA, Komm BS, Haussler MR 1991 The vitamin D-responsive element in the rat bone gla protein is an imperfect direct repeat that cooperates with other cis-elements in 1, 25-dihydroxyvitamin D3-mediated transcriptional activation. Mol Endocrinol 5:373–385[Abstract/Free Full Text]
  30. Lehmann JM, McKee DD, Watson MA, Willson TM, Moore JT, Kliewer SA 1998 The human orphan nuclear receptor PXR is activated by compounds that regulate CYP3A4 gene expression and cause drug interactions. J Clin Invest 102:1016–1023[Medline]
  31. Jones BB, Ohno CK, Allenby G, Boffa MB, Levin AA, Grippo JF, Petkovich M 1995 New retinoid X receptor subtypes in zebra fish (Danio rerio) differentially modulate transcription and do not bind 9-cis retinoic acid. Mol Cell Biol 15:5226–5234[Abstract/Free Full Text]
  32. Nakajima S, Hsieh J-C, MacDonald PN, Galligan MA, Haussler CA, Whitfield GK, Haussler MR 1994 The C-terminal region of the vitamin D receptor is essential to form a complex with a receptor auxiliary factor required for high affinity binding to the vitamin D responsive element. Mol Endocrinol 8:159–172[Abstract/Free Full Text]
  33. Nakajima S, Hsieh J-C, MacDonald PN, Haussler CA, Galligan MA, Jurutka PW, Haussler MR 1993 Purified human vitamin D receptor overexpressed in E. coli and baculovirus systems does not bind 1, 25-dihydroxyvitamin D3 hormone efficiently unless supplemented with a rat liver nuclear extract. Biochem Biophys Res Commun 197:478–485[CrossRef][Medline]
  34. Mangelsdorf DJ, Borgmeyer U, Heyman RA, Zhou JY, Ong ES, Oro AE, Kakizuka A, Evans RM 1992 Characterization of three RXR genes that mediate the action of 9-cis retinoic acid. Genes Dev 6:329–344[Abstract/Free Full Text]
  35. Munson PJ, Rodbard D 1980 LIGAND: a versatile computerized approach for characterization of ligand-binding systems. Anal Biochem 107:220–239[CrossRef][Medline]
  36. Miyamoto K-I, Kesterson RA, Yamamoto H, Taketani Y, Nishiwaki E, Tatsumi S, Inoue Y, Morita K, Takeda E, Pike JW 1997 Structural organization of the human vitamin D receptor chromosomal gene and its promoter. Mol Endocrinol 11:1165–1179[Abstract/Free Full Text]
  37. Ebihara K, Masuhiro Y, Kitamoto T, Suzawa M, Uematsu Y, Yoshizawa T, Ono T, Harada H, Matsuda K, Hasegawa T, Masushige S, Kato S 1996 Intron retention generates a novel isoform of the murine vitamin D receptor that acts in a dominant negative way on the vitamin D signaling pathway. Mol Cell Biol 16:3393–3400[Abstract/Free Full Text]
  38. Clemens TL, Garrett KP, Zhou X-Y, Pike JW, Haussler MR, Dempster DW 1988 Immunocytochemical localization of the 1, 25-dihydroxyvitamin D3 receptor in target cells. Endocrinology 122:1224–1230[Abstract/Free Full Text]
  39. Rochel N, Wurtz JM, Mitschler A, Klaholz B, Moras D 2000 The crystal structure of the nuclear receptor for vitamin D bound to its natural ligand. Mol Cell 5:173–179[CrossRef][Medline]
  40. Chawla A, Repa JJ, Evans RM, Mangelsdorf DJ 2001 Nuclear receptors and lipid physiology: opening the X-files. Science 294:1866–1870[Abstract/Free Full Text]
  41. Thummel KE, Brimer C, Yasuda K, Thottassery J, Senn T, Lin Y, Ishizuka H, Kharasch E, Schuetz J, Schuetz E 2001 Transcriptional control of intestinal cytochrome P-4503A by 1{alpha}, 25-dihydroxy vitamin D3. Mol Pharmacol 60:1399–1406[Abstract/Free Full Text]
  42. Jurutka PW, Remus LS, Whitfield GK, Thompson PD, Hsieh J-C, Zitzer H, Tavakkoli P, Galligan MA, Dang HT, Haussler CA, Haussler MR 2000 The polymorphic N terminus in human vitamin D receptor isoforms influences transcriptional activity by modulating interaction with transcription factor IIB. Mol Endocrinol 14:401–420[Abstract/Free Full Text]
  43. Hadzic E, Desai-Yajnik V, Helmer E, Guo S, Wu S, Koudinova N, Casanova J, Raaka BM, Samuels HH 1995 A 10-amino-acid sequence in the N-terminal A/B domain of thyroid hormone receptor alpha is essential for transcriptional activation and interaction with the general transcription factor TFIIB. Mol Cell Biol 15:4507–4517[Abstract/Free Full Text]
  44. Arai H, Miyamoto K-I, Taketani Y, Yamamoto H, Iemori Y, Morita K, Tonai T, Nishisho T, Mori S, Takeda E 1997 A vitamin D receptor gene polymorphism in the translation initiation codon: effect on protein activity and relation to bone mineral density in Japanese women. J Bone Miner Res 12:915–921[CrossRef][Medline]
  45. Hsieh J-C, Whitfield GK, Oza AK, Dang HTL, Price JN, Galligan MA, Jurutka PW, Thompson PD, Haussler CA, Haussler MR 1999 Characterization of unique DNA binding and transcriptional activation functions in the carboxyl-terminal extension of the zinc finger region in the human vitamin D receptor. Biochemistry 38:16347–16358[CrossRef][Medline]
  46. Bourguet W, Vivat V, Wurtz JM, Chambon P, Gronemeyer H, Moras D 2000 Crystal structure of a heterodimeric complex of RAR and RXR ligand-binding domains. Mol Cell 5:289–298[CrossRef][Medline]
  47. Dokoh S, Llach F, Haussler MR 1982 25-Hydroxyvitamin D and 1, 25-dihydroxyvitamin D: new ultrasensitive and accurate assays. In: Norman AW, Schaefer K, von Herrath D, Grigoleit H-G, eds. Vitamin D, chemical, biochemical and clinical endocrinology of calcium metabolism. Berlin: Walter de Gruyter; 743–749
  48. Haussler MR, Baylink DJ, Hughes MR, Brumbaugh PF, Wergedal JE, Shen FH, Nielsen RL, Counts SJ, Bursac KM, McCain TA 1976 The assay of 1{alpha}, 25-dihydroxyvitamin D3: physiologic and pathologic modulation of circulating hormone levels. Clin Endocrinol (Oxf) 5 Suppl:151S–165S
  49. Kobayashi N, Imazu T, Kitahori J, Mano H, Shimada K 1997 A selective immunoaffinity chromatography for determination of plasma 1{alpha}, 25-dihydroxyvitamin D3: application of specific antibodies raised against a 1{alpha}, 25-dihydroxyvitamin D3-bovine serum albumin conjugate linked through the 11{alpha}-position. Anal Biochem 244:374–383[CrossRef][Medline]
  50. Noda M, Vogel RL, Craig AM, Prahl J, DeLuca HF, Denhardt DT 1990 Identification of a DNA sequence responsible for binding of the 1, 25-dihydroxyvitamin D3 receptor and 1, 25-dihydroxyvitamin D3 enhancement of mouse secreted phosphoprotein 1 (Spp-1 or osteopontin) gene expression. Proc Natl Acad Sci USA 87:9995–9999[Abstract/Free Full Text]
  51. MacDonald PN, Dowd DR, Nakajima S, Galligan MA, Reeder MC, Haussler CA, Ozato K, Haussler MR 1993 Retinoid X receptors stimulate and 9-cis retinoic acid inhibits 1, 25-dihydroxyvitamin D3-activated expression of the rat osteocalcin gene. Mol Cell Biol 13:5907–5917[Abstract/Free Full Text]
  52. Kane KF, Langman MJS, Williams GR 1996 Antiproliferative responses of two human colon cancer cell lines to vitamin D3 are differentially modified by 9-cis-retinoic acid. Cancer Res 56:623–632[Abstract/Free Full Text]
  53. Colnot S, Lambert M, Blin C, Thomasset M, Perret C 1995 Identification of DNA sequences that bind retinoid X receptor-1, 25(OH)2D3-receptor heterodimers with high affinity. Mol Cell Endocrinol 113:89–98[CrossRef][Medline]
  54. Nishikawa J, Kitaura M, Matsumoto M, Imagawa M, Nishihara T 1994 Difference and similarity of DNA sequence recognized by VDR homodimer and VDR/RXR heterodimer. Nucleic Acids Res 22:2902–2907[Abstract/Free Full Text]
  55. Makishima M, Lu TT, Xie W, Whitfield GK, Domoto H, Evans RM, Haussler MR, Mangelsdorf DJ 2002 Vitamin D receptor as an intestinal bile acid sensor. Science 296:1313–1316[Abstract/Free Full Text]
  56. Moore LB, Parks DJ, Jones SA, Bledsoe RK, Consler TG, Stimmel JB, Goodwin B, Liddle C, Blanchard SG, Willson TM, Collins JL, Kliewer SA 2000 Orphan nuclear receptors constitutive androstane receptor and pregnane X receptor share xenobiotic and steroid ligands. J Biol Chem 275:15122–15127[Abstract/Free Full Text]
  57. Sluder AE, Maina CV 2001 Nuclear receptors in nematodes: themes and variations. Trends Genet 17:206–213[CrossRef][Medline]
  58. Lindblom TH, Pierce GJ, Sluder AE 2001 A C. elegans orphan nuclear receptor contributes to xenobiotic resistance. Curr Biol 11:864–868[CrossRef][Medline]
  59. Laudet V, Auwerx J, Gustafsson J-A, Wahli W 1999 A unified nomenclature system for the nuclear receptor superfamily. Cell 97:161–163[CrossRef][Medline]
  60. Smith DP, Mason CS, Jones EA, Old RW 1994 A novel nuclear receptor superfamily member in Xenopus that associates with RXR, and shares extensive sequence similarity to the mammalian vitamin D3 receptor. Nucleic Acids Res 22:66–71[Abstract/Free Full Text]
  61. Jones SA, Moore LB, Shenk JL, Wisely GB, Hamilton GA, McKee DD, Tomkinson NC, LeCluyse EL, Lambert MH, Willson TM, Kliewer SA, Moore JT 2000 The pregnane X receptor: a promiscuous xenobiotic receptor that has diverged during evolution. Mol Endocrinol 14:27–39[Abstract/Free Full Text]
  62. Rastinejad F, Perlmann T, Evans RM, Sigler PB 1995 Structural determinants of nuclear receptor assembly on DNA direct repeats. Nature 375:203–211[CrossRef][Medline]
  63. Escriva H, Manzon L, Youson J, Laudet V 2002 Analysis of lamprey and hagfish genes reveals a complex history of gene duplications during early vertebrate evolution. Mol Biol Evol 19:1440–1450[Abstract/Free Full Text]
  64. Kato S, Takeyama K, Kitanaka S, Murayama A, Sekine K, Yoshizawa T1999 In vivo function of VDR in gene expression-VDR knock-out mice. J Steroid Biochem Mol Biol 69:247–251
  65. Bardack D, Zangerl R 1971 Lampreys in the fossil record. In: Hardisty MW, Potter IC, eds. The biology of lampreys. London: Academic Press; vol 1:67–84
  66. Langille RM, Hall BK 1993 Calcification of cartilage from the lamprey Petromyzon marinus. Acta Zool 74:31–41
  67. Zaccone G, Howie AJ, Mauceri A, Fasulo S, Lo Cascio P, Youson JH 1995 Distribution patterns of cytokeratins in epidermis and horny teeth of the adult sea lamprey, Petromyzon marinus. Folia Histochem Cytobiol 33:69–75[Medline]
  68. Manolagas SC, Yu X-P, Girasole G, Bellido T 1994 Vitamin D and the hematolymphopoietic tissue: a 1994 update. Sem Nephrol 14:129–143[Medline]
  69. Lemire J 2000 1, 25-Dihydroxyvitamin D3—a hormone with immunomodulatory properties. Z Rheumatol 59(Suppl):24–27
  70. Marchalonis JJ, Schluter SF, Bernstein RM, Shen S, Edmundson AB 1998 Phylogenetic emergence and molecular evolution of the immunoglobulin family. Adv Immunol 70:417–506[Medline]
  71. Zapata A, Ardavin CF, Gomariz RP, Leceta J 1981 Plasma cells in the ammocoete of Petromyzon marinus. Cell Tissue Res 221:203–208[CrossRef][Medline]
  72. Good RA, Finstad J, Litman GW 1972 Immunology. In: Hardisty MW, Potter IC, eds. The biology of lampreys. London: Academic Press; vol 2:405–432
  73. Shintani S, Terzic J, Sato A, Saraga-Babic M, O’hUigin C, Tichy H, Klein J 2000 Do lampreys have lymphocytes? The Spi evidence. Proc Natl Acad Sci USA 97:7417–7122[Abstract/Free Full Text]
  74. Anderson MK, Sun X, Miracle AL, Litman GW, Rothenberg EV 2001 Evolution of hematopoiesis: three members of the PU.1 transcription factor family in a cartilaginous fish, Raja eglanteria. Proc Natl Acad Sci USA 98:553–558[Abstract/Free Full Text]
  75. Haire RN, Miracle AL, Rast JP, Litman GW 2000 Members of the Ikaros gene family are present in early representative vertebrates. J Immunol 165:306–312[Abstract/Free Full Text]
  76. Hagen M, Filosa MF, Youson JH 1983 Immunocytochemical localization of antibody-producing cells in adult lamprey. Immunol Lett 6:87–92[CrossRef][Medline]
  77. Lee JW, Gulick T, Moore DD 1992 Thyroid hormone receptor dimerization function maps to a conserved subregion of the ligand binding domain. Mol Endocrinol 6:1867–1873[Abstract/Free Full Text]
  78. Webster NJG, Green S, Jin JR, Chambon P 1988 The hormone binding domains of the estrogen and glucocorticoid receptors contain an inducible transcription activation function. Cell 54:199–207[CrossRef][Medline]



This article has been cited by other articles:


Home page
Endocr. Rev.Home page
R. Bouillon, G. Carmeliet, L. Verlinden, E. van Etten, A. Verstuyf, H. F. Luderer, L. Lieben, C. Mathieu, and M. Demay
Vitamin D and Human Health: Lessons from Vitamin D Receptor Null Mice
Endocr. Rev., October 1, 2008; 29(6): 726 - 776.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
R. F Chun, J. S Adams, and M. Hewison
Back to the future: a new look at 'old' vitamin D
J. Endocrinol., August 1, 2008; 198(2): 261 - 269.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
D. L. Howarth, S. H. W. Law, B. Barnes, J. M. Hall, D. E. Hinton, L. Moore, J. M. Maglich, J. T. Moore, and S. W. Kullman
Paralogous Vitamin D Receptors in Teleosts: Transition of Nuclear Receptor Function
Endocrinology, May 1, 2008; 149(5): 2411 - 2422.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
C. Zierold, J. A. Mings, and H. F. Deluca
19nor-1,25-Dihydroxyvitamin D2 Specifically Induces CYP3A9 in Rat Intestine More Strongly than 1,25-Dihydroxyvitamin D3 in Vivo and in Vitro
Mol. Pharmacol., May 1, 2006; 69(5): 1740 - 1747.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
M. D. Krasowski, K. Yasuda, L. R. Hagey, and E. G. Schuetz
Evolution of the Pregnane X Receptor: Adaptation to Cross-Species Differences in Biliary Bile Salts
Mol. Endocrinol., July 1, 2005; 19(7): 1720 - 1739.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Whitfield, G. K.
Right arrow Articles by Marchalonis, J. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Whitfield, G. K.
Right arrow Articles by Marchalonis, J. J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals