| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Division of Molecular Neuroendocrinology (N.B., C.B.M., K.E.M., A.M., I.C.A.F.R.), National Institute for Medical Research, Mill Hill, London NW7 1AA, United Kingdom; and Institut National de la Santé et de la Recherche Medicale Unité-469 (P.-F.M., P.M.), 34094 Montpellier Cedex 5, France
Address all correspondence and requests for reprints to: Professor Iain C. A. F. Robinson, Division of Molecular Neuroendocrinology, National Institute for Medical Research, The Ridgeway, Mill Hill, London NW7 1AA, United Kingdom. E-mail: irobins{at}nimr.mrc.ac.uk.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The regularity of spontaneous GH pulses implies an underlying pulse generator, either intrinsic to GHRH or somatostatin cells or extrinsic to them but driving their episodic activity in a coordinated fashion (14). Electrophysiological recordings have been made from unidentified ARC neurons (15), but it has not been possible to characterize the electrophysiological properties of identified GHRH neurons to know whether they show periodic increases in firing rates or bursting patterns of activity, as has been described for other hypothalamic neuroendocrine cells (16). To generate a GHRH pulse, there is likely to be some temporal synchronization of episodic firing in a network of GHRH cells connected directly or indirectly via interneurons (14, 17). To investigate this, it is necessary to study structural and functional properties of populations of identified GHRH cells and monitor their connectivity and activity. Because peptide release from terminals can be regulated independently of firing activity in neuroendocrine cell bodies (18), an approach that could give some insight into the transport and release of GHRH from secretory vesicles (SVs) in the GHRH neuron terminals would also be useful.
Recently, enhanced green fluorescent protein (eGFP) expressed from transgenes has been shown to be a useful way to first identify and then record from specific hypothalamic neurons (19, 20, 21, 22). We have now generated transgenic mice with eGFP targeted to GHRH cells, using a genomic GHRH promoter construct (23). By using an eGFP variant that is packaged in SVs (24), the transport of eGFP-tagged vesicles to terminals and exocytotic release events may also be visualized (22, 24, 25). In this study we present the first electrophysiological recordings of bursting activity from preidentified GHRH-eGFP neurons and use multiple approaches to image a network of GHRH cells and their terminals at the subcellular, single cell, and multicellular levels at the intact ventral surface of the brain.
| Materials and Methods |
|---|
|
|
|---|
|
32P]dCTP and [
32P]dATP] by random-prime labeling (Prime-a-gene kit, Promega Corp., Southampton, UK) and hybridized to 4.9-kb and 1.4-kb fragments in transgenic and wild-type DNA, respectively. Progeny were subsequently genotyped using a PCR assay (24) that amplifies across the first intron of hGH present in the transgene. All lines were maintained as hemizygous, with nontransgenic (NT) littermates serving as controls for the transgenic (T) animals. All T mice were generated and maintained at the National Institute for Medical Research, London; breeding pairs were then sent to establish a parallel colony of line 39 at Institut National de la Santé et de la Recherche Medicale Unité-469, Montpellier, for other experiments. All animal experiments were carried out strictly in accordance with the relevant institutional and national guidelines at both centers.
RT-PCR
RNA was extracted using Trizol reagent (Life Technologies, Inc., Paisley, United Kingdom) and 500 ng transcribed with 200 U Moloney murine leukemia virus reverse transcriptase (Roche Diagnostics, Lewes, UK) in 1x Moloney murine leukemia virus reverse transcriptase buffer (Roche Diagnostics) supplemented with 1 µg random primers (Invitrogen, Paisley, UK), deoxynucleotide triphosphates (0.3 mM, Amersham Pharmacia Biotech, Little Chalfont, UK), 40 U ribonuclease (RNase) inhibitor (Promega Corp.), and 5 mM dithiothreitol. The mixture was incubated at 37 C for 2 h and cDNAs amplified by PCR. For the transgene product, the primers spanned from hGH to eGFP sequences and were AACCACTCAGGGTCCTGTGGACAG (forward) and GAGGACGGCAACATCCTGGGGCA (reverse) to amplify a predicted fragment size of 950 bp. Mouse ß-actin control transcripts were amplified using the primers TTGTAACCAACTGGGACGATATGG (forward) and GATCTTGATCTTCATGGTGCTAGG (reverse) to amplify a predicted fragment size of 764 bp.
RNase protection assay
RNase protection assays were performed using the RNase protection assay III kit (Ambion, Inc., Huntingdon, UK). [
32P]-uridine 5-triphosphate-labeled RNA probes were generated by in vitro transcription (see below) and purified by 5% acrylamide gel electrophoresis. For mGHRH, a PvuII digest of an mGHRH clone (I.M.A.G.E., 1496474, HGMP Resource Centre, Cambridge, UK) was transcribed to generate a 330-bp probe that protects a 300-bp 3' fragment of mGHRH. For ß-actin a 334-bp probe was generated to protect a 246-bp fragment of RNA. Labeled probes (1 x 105 cpm) were incubated with 10 µg hypothalamic RNA samples at 42 C overnight. For quantification, RNA samples from two hypothalami were pooled and four extracts each of T or NT mice were processed separately. After hybridization, samples were treated with RNase and protected fragments separated on 5% acrylamide gels. Gels were analyzed using ImageQuant (Molecular Dynamics, Inc., Sunnyvale, CA), and the amounts of protected sample RNA were normalized to ß-actin RNA measured in the same samples.
In situ hybridization
Antisense and sense riboprobes corresponding to full-length cDNAs for eGFP or mouse GHRH were labeled with either [
35S]-uridine 5-triphosphate or digoxigenin (DIG) using SP6/T7 transcription kits (Roche Diagnostics), treated with Dnase I for 15 min at 37 C, and purified by gel filtration or phenol/chloroform extraction and ethanol precipitation. For radiolabeled probes, in situ hybridizations were performed as previously described (26). Slides were exposed to autoradiographic films that were scanned and analyzed using NIH Image. Slides were then dipped in photographic emulsion (G5, Ilford Imaging, Knutsford, UK) for several days, developed, and counterstained in cresyl-fast violet. For DIG-labeled probes, paraffin-embedded slides were rehydrated, permeabilized (10 µg/ml proteinase K, Sigma, Poole, UK), fixed in 4% paraformaldehyde, acetylated, and incubated in prehybridization buffer (4x saline sodium citrate, 50% formamide). Sections were then hybridized overnight, washed, and incubated with RNase (40 mg/ml) at 37 C for 30 min. DIG labeling was visualized (27) using sheep anti-DIG-alkaline phosphatase and Nitro-blue tetrazolium/Bromo-chloro-indolyl-phosphate as substrate.
RIAs
Tissues were homogenized and assayed for eGFP protein or GH using RIAs as previously described (24).
Confocal microscopy
Coronal vibratome sections (150 µm) were cut from GHRH-eGFP mouse brains and placed in a recording chamber on a microscope stage, perfused with artificial cerebrospinal fluid (mM: 120 NaCl, 3 KCL, 1.2 NaH2PO4, 2 CaCl2, 1 MgSO4, 23 NaHCO3, 10 glucose; gassed with 95% O2 and 5% CO2 at 32 C). These were imaged using a Axioskop upright microscope (Carl Zeiss, Le Pecq, France), a x60, 0.9 NA, long-working distance water immersion objective (Olympus Corp.), and an MRC 1000 scanning confocal microscope (Bio-Rad Laboratories, Inc., Hemel Hempstead, UK). For excitation, the 488-nm line of an argon ion laser was used, and emission filters were optimized for eGFP. Digital images were collected in COMOS (Bio-Rad Laboratories, Inc.) and analyzed offline in NIH Image.
Culture of hypothalamic neurons
Brains from a litter of 1- to 2-d old pups were placed in ice-cold HDMEM (25 mM HEPES-buffered Dulbeccos medium, pH 7.3, Life Technologies, Inc.) and the hypothalamus dissected into an ice-cold solution of 25 mM HEPES-buffered Ca2+ and Mg2+-free Earles BSS, pH 7.3 (Life Technologies, Inc.). Tissues were transferred into a solution containing 6 mg/ml papain, 1 mg/ml DL-cysteine, 250 µM EDTA, 50 µM ß-mercaptoethanol in 25 mM HEPES-buffered Ca2+ and Mg2+-free Earles BSS, pH 7.3 (Life Technologies, Inc.), and incubated at 37 C in a shaking water bath for 2025 min. Tissue was washed and then incubated with 1 mg/ml chick egg white trypsin inhibitor, 0.1 mg/ml Dnase in HDMEM (Life Technologies, Inc.). After dilution with 5 ml culture medium (1% N2 medium supplement, 10% horse serum, 1% antibiotics, 1 mM sodium pyruvate, 20 mM glucose in glutamine-free basal medium Eagle, Life Technologies, Inc.), tissue was dissociated by trituration, centrifuged (200 x g for 2 min), and the cell pellet resuspended and layered on 13-mm coverslips coated with poly-D-lysine- and laminin. Coverslips were removed from culture every 24 h, fixed in 4% paraformaldehyde, mounted in Mowiol (Harco, Essex, UK), and examined by bright-field and fluorescence microscopy.
Slice preparation for electrophysiological recording
The procedure was essentially as described in (28) but adapted for adult mice. The GHRH-eGFP mice (612 wk old, line 39) were anesthetized by isoflurane inhalation, killed by decapitation, and brains quickly removed into cold (04 C) solution-1 (in mM; 92 NMDG-Cl, 2.3 KCl, 1 CaCl2, 6 MgCl2, 26 NaHCO3, 1.2 KH2PO4, 25 glucose, 0.2 ascorbic acid, 0.2 thiourea (pH 7.4), gassed with 95% CO2, 5% O2). Meninges and blood vessels were carefully dissected from the ventral hypothalamus, sagittal sections (300 µm) cut with a vibrating blade microtome (DSK, Kyoto, Japan) and stored at 34 C in solution-2 (mM; 115 NaCl, 2.5 KCl, 1 CaCl2, 4 MgCl2, 26 NaHCO3, 1.25 NaH2PO4, 25 glucose, 0.2 ascorbic acid, 0.2 thiourea, pH 7.4, gassed with 95% CO2, 5% O2) for at least 30 min.
Patch-clamp recordings
Slices were immobilized with a nylon grid in a submersion chamber on the stage of an upright microscope (Axioskop FS, Carl Zeiss) and superfused continuously with solution-3 (mM; 125 NaCl, 2.5 KCl, 2 CaCl2, 1 MgCl2, 26 NaHCO3, 1.25 NaH2PO4, 5 glucose, pH 7.4, gassed with 95% CO2, 5% O2) at a rate of approximately 4 ml/min for at least 30 min at 2527 C. They were viewed with a x63 immersion objective (Achroplan, Carl Zeiss) and Nomarski differential interference contrast optics. Infrared differential interference contrast illumination was used to visualize neurons deeper in the slices and the images captured with an infrared camera (Hamamatsu Photonics, Massy, France), displayed, and stored on a computer controlled by Scion 1.62c (NIH Image). Bosilicate glass pipettes (58 M
) filled with a standard intracellular solution (in mM; 100 K-gluconate, 40 KCl, 2 MgATP, 3 EGTA, 10 HEPES, pH 7.3 with KOH) were used for whole-cell patch clamp experiments in voltage- or current-clamp modes. Alexa 350 (0.1 mM, Molecular Probes, Inc., Eugene, OR) was added to the pipette solution as an intracellular marker dye (29). Pipettes were connected to the head stage of an EPC-9 amplifier (HEKA, Lambrecht, Germany) to acquire and store patch-clamp data using Pulse 8.09 software (HEKA). Pipette and cell capacitances were fully compensated, and recorded voltages were corrected for a junction potential of -10 mV (30). Spontaneous activity was recorded in current-clamp mode or at a fixed membrane potential (typically -70 mV) in voltage-clamp mode. Passive and active membrane properties were examined in current-clamp mode by injecting triggered current pulses (50 msec or 200 msec duration) through the pipette. Recordings were analyzed with IgoPro version 3.0 (Wavemetrics, Lake Oswego, OR) and Axograph 4.0 (Axon Instruments Inc., Foster City, CA).
Intact brain imaging by epifluorescence stereomicroscopy
Brains were removed as described above and kept in cold solution-2. Care was taken when cutting the pituitary stalk to avoid damaging the median eminence. Whole brains were transferred, ventral surface uppermost, to the stage of a modified stereomicroscope equipped with epifluorescence and x1.6, x2.5, or x20 objectives (Carl Zeiss; Kramer, Valley Cottage, NY). The intensity of the fluorescent lamp (HBO 100 W; Osram, Munsen, Germany) was reduced to less than 50% by an AttoArc power supply (Carl Zeiss). Fluorescence images (16 bit) were acquired with a cooled CCD (Roper Scientific, Evry, France) controlled using Metamorph 4.0 (Universal Imaging, West Chester, PA). Image stacks were collected with a motorized Z-controller (LEP, Hawthorne, NY) at fixed step amplitudes (typically 200 nm) and deconvoluted with Huygens2 as previously described (31).
Data analysis
Unless otherwise stated, data are shown as mean ± SEM. Differences between groups were analyzed by t test, with P less than 0.05 taken as significant (n.s. = nonsignificant).
| Results |
|---|
|
|
|---|
|
RIA of hypothalamic extracts showed eGFP-immunoreactive protein in T but not NT mice from each line (Fig. 3
), with line 151 showing a 6- to 10-fold higher hypothalamic eGFP protein content than the other two lines. Extracts from groups of males and females from line 39 showed similar eGFP contents (9.7 ± 2.2 vs. 8.1 ± 1.5 ng eGFP/hypothalamic extract, n = 7). RNase protection assays, performed on hypothalamic extracts from adult NT and T mice from line 39 showed that expression of eGFP protein in GHRH neurons did not affect endogenous mouse GHRH mRNA abundance (2.61 ± 0.4 vs. 2.45 ± 0.5 arbitrary densitometer units, n = 4 pairs per group, n.s.).
|
|
Similar results were obtained for transgenic mice from line 342. However, animals from line 151 showed much more widespread and intense eGFP expression with many more eGFP-labeled cells in many other hypothalamic areas in addition to the ventral ARC, consistent with the higher amounts of eGFP protein detected in this line (Fig. 3
). In the ARC of this line, colocalization of eGFP and GHRH was observed in only 81% of the cells. Because eGFP was clearly not a specific reporter for GHRH cells in line 151, these animals were not studied further.
Fluorescence microscopy
Fluorescence microscopy on vibratome slices (150 µm) of hypothalamus from transgenic mice from lines 39 and 342 showed fluorescent neurons in ARC and a stronger fluorescent signal in the ME. No other regions of the hypothalamus showed eGFP fluorescence in these lines. Using confocal microscopy, individual GHRH cell bodies and their primary axons were resolved, which showed a punctate pattern of eGFP fluorescence (Fig. 4
, Ba and Bb). In the ME, the terminal fields of these neurons were brightly fluorescent (Fig. 4Bc
), and fluorescent beaded varicosities were evident along the entire length of these projections (Fig. 4
, Bd and Be) coursing throughout both internal and external zones of the ME. These images were consistent with the packaging of the eGFP product into SVs, and their transport along the axons, to be stored in the ME terminals of GHRH neurons.
We tested whether GHRH-eGFP neurons could be identified after in vitro culture of dissociated hypothalamic cells from newborn mice from line 39. Because the hemizygous mice could not be genotyped before pooling for cell culture, the cells originated from both T and NT pups. Very few eGFP-fluorescent rounded cells were visible after 4 h of culturing (Fig. 4C
, upper panels). After 72 h, only one to two eGFP fluorescing neurons per coverslip could be detected, but these were bright and had clearly discernible projections containing fluorescent material at their tips (Fig. 4C
, lower panels).
Electrophysiological recordings from GHRH-eGFP neurons
Patch-clamp experiments were performed on eGFP-positive GHRH neurons visualized in acutely prepared parasagittal brain slices from adult GHRH-eGFP mice (Fig. 5
). Two eGFP-positive neurons were seen in the field shown in Fig. 5Ab
and the left one brought into focus. Infrared illumination was used to monitor the shape of this neuron before (Fig. 5Aa
) and during (Fig. 5Ac
) patch-clamp recording. The patch pipette was loaded with a blue fluorescent dye (Alexa 350, Molecular Probes, Inc.), which labeled the cytoplasm of the eGFP-positive neuron being recorded (Fig. 5Ad
).
|
Triggered current injection was performed to resolve passive membrane properties and action potential kinetics of GHRH-eGFP neurons. Constant negative current injection was often required to minimize spontaneous activity under steady-state conditions, upon which 50-msec-duration pulses of varying amplitude were delivered. In Fig. 5C
, the membrane potential was driven in a linear manner by subthreshold current injections (-15 to 40 pA). Current injections above 40 pA elicited action potential firing as membrane potential exceeded threshold. Note again the large afterhyperpolarization phase following repolarization. The responses of GHRH-eGFP neurons to longer (200 msec) current pulses were also examined (Fig. 5D
). Moderate current injections elicited action potentials that shared almost identical threshold, peak, and afterhyperpolarization characteristics. However, increasing current amplitude from 40 (top panel) to 55 pA (bottom panel) increased both the depolarization rate near threshold and action potential firing. On average, the action potential threshold was -47.7 ± 1.6 mV (n = 8), and the action potential peaked at 10.1 ± 3.8 mV (n = 8), followed by an afterhyperpolarization (-62.8 ± 2.2 mV, n = 8), well below the resting potential (-54.1 ± 1.89 mV, n = 10).
Spontaneous ionic currents were always observed in the voltage-clamp mode (15 experiments). In the recording shown in Fig. 5E
, inward synaptic currents are shown in an eGFP-positive neuron held at -70 mV. These inward currents were often clustered or even superimposed, and their fast kinetics are shown in Fig. 5F
. The maximal amplitude of the inward currents increased as the holding potential was lowered to -90 mV and decreased when the potential was held at -50 mV (data not shown). No outward currents were observed under these experimental conditions.
Imaging the GHRH ventral neuronal population in intact brains from GHRH-eGFP mice
Because many of the GHRH cells are very close to the ventral hypothalamic surface, we examined the ventral surface of the intact brain of a GHRH-eGFP mouse with an epifluorescence binocular stereomicroscope. Figure 6
shows that a large population of eGFP-positive cells, their fibers, and terminals is readily visible with this technique. At low magnifications (Fig. 6
, A and B), an intense eGFP signal was evident in the ME. As magnification was progressively increased (Fig. 6
, CE), numerous eGFP-positive neuronal cell bodies became evident in the vicinity of the ME, with more scattered eGFP-positive neurons in lateral areas of the hypothalamus. At the highest magnifications (Fig. 6
, E and F), individual rGHRH-eGFP neurons could be distinguished and the punctate subcellular distribution of eGFP fluorescence could be resolved in discrete areas of the cells and their processes (Fig. 6
, E and F). Intriguingly, many bright eGFP-containing beaded processes were seen apparently coursing between nearby rGHRH-eGFP neurons (Fig. 6F
).
|
|
|
| Discussion |
|---|
|
|
|---|
Although neuroendocrine promoter transgenes driving GFP have proved successful in targeting other hypothalamic neuronal systems (19, 20, 21, 22), short GHRH promoter sequences have not succeeded (35) (Robinson, I. C. A. F., unpublished observations), probably because of the presence of several upstream promoters in this locus (36, 37) whose enhancer and regulatory elements are poorly defined. However, we have engineered a GHRH cosmid that does drive transgene expression specifically in hypothalamic GHRH neurons in most lines (23, 38, 39), although low-level transgene expression can be detected in other tissues, reflecting low-level production of endogenous GHRH (40), other products from the GHRH precursor (41), or ectopic expression.
We generated three GHRH-eGFP transgenic lines, none of which showed any overt phenotypic differences from their NT littermates. Hypothalamic GHRH mRNA, pituitary GH contents, and growth rates were all normal, suggesting that the rGHRH-eGFP transgene had no deleterious effect on the GHRH/GH axis. All three lines expressed a fluorescent eGFP product in ARC, but the specificity and intensity of expression differed between the lines. Two lines showed transgene expression highly restricted to the hypothalamic GHRH cells, mainly in ARC (42, 43) but with few scattered eGFP- and GHRH-positive neurons in more dorsal hypothalamic regions (4). Colocalization studies showed that GHRH and eGFP mRNAs were coexpressed in at least 90% of the labeled ARC neurons in these two lines. This is probably an underestimate because GHRH signal intensity varies markedly from cell to cell, and the sensitivities of the probes are lower when used in double-label studies. Because only 6% of the ARC eGFP cells did not show detectable GHRH expression in line 39, eGFP identifies the vast majority of ARC GHRH-expressing neurons in this line. Although 4% of the GHRH cells that did not show eGFP expression probably reflect differences in RNA abundance and detection, it is possible that they activate their GHRH expression from a promoter element other than that into which the eGFP reporter was cloned.
Other tissues showed no eGFP expression, with the exception of a few eGFP-positive cells in the kidney in some T individuals. The cosmid might contain cryptic kidney-specific sequences but why these would be active in some animals but not others is unclear, and no GHRH transcripts were detected in these cells. However, because transgenic line 151 showed more widespread eGFP expression in other parts of the central nervous system, it is clear that even our 38-kb rGHRH cosmid does not contain all the locus control sequences (44) necessary for position-independent, tissue-specific GHRH expression in every line, and it was necessary to assess several lines of mice to identify one (line 39) in which eGFP was a reliable reporter for GHRH neurons.
Because we wished to visualize GHRH terminals as well as cell bodies, we used an eGFP variant targeted to the secretory pathway (24) and obtained a distribution of eGFP fluorescence very similar to that of GHRH in mice (42, 43). Fluorescence and confocal microscopy showed ARC neurons with bright perinuclear fluorescence in the soma, from which axons could be traced to the ME, filled with intensely fluorescent varicose terminals. That the eGFP accumulates in the ME is expected because the vast majority of GHRH neurons project to this site, storing their peptide in terminal varicosities for release into hypophysial portal blood (43). In the outer zone of the ME, eGFP was clearly contained in vesicular varicosities, typical of those identified in beaded strands in GHRH neurons and their terminal arborizations by immunostaining and EM (45). Whether this eGFP variant is costored with GHRH in the same SVs will require a double-immunogold EM study, but in other studies in GH cells (24), we showed that this eGFP variant was copackaged with GH in SVs and coreleased on stimulation.
It was possible to culture hypothalamic neurons from neonatal GHRH-eGFP mice. Only few eGFP-positive cells were detected, but these formed projections and maintained eGFP expression for up to 3 d. The use of homozygous litters or fluorescence-activated cell sorting of cells before culture may improve the efficiency, but yields are likely to remain low because only a small proportion of neonatal hypothalamic neurons express GHRH and at levels much lower than in adults (46). It may be more useful to combine this eGFP approach with suspension or explant culture techniques (47, 48).
We present here the first electrophysiological recordings from preidentified GHRH cells in hypothalamic slices. All GHRH neurons showed spontaneous action potential firing, similar to what was reported from other GFP-tagged neuroendocrine neurons (20), although GHRH neurons might be distinguished from proopiomelanocortin neurons (20) and cholecystokinin-sensitive neurons (49) by their lower resting membrane potential. GHRH neurons also showed clusters of spike activity in bursts. We believe the bursting behavior is physiologically relevant because GH release induced by electrical stimulation of the ARC is markedly potentiated with increases in the duration of bursts of firing (50). The GHRH neurons exhibited high input resistance, and internal dialysis with Alexa 350 always stained the single neuron under study, so the soma of GHRH neurons are unlikely to be tightly coupled via gap junctions. In these isolated slices, the clustering of bursts was apparently randomly distributed within and between recordings in individual neurons. However, when held at hyperpolarized potentials, GHRH neurons exhibited frequent and robust inward currents, reflecting intense synaptic activity, and spontaneous depolarizations were routinely observed, triggering action potentials. Further experiments are in progress to elucidate the ionic nature and pharmacological properties of these synaptic events.
Although this provided new information about the electrophysiological properties of individual GHRH neurons, relating this to global GHRH episodic secretion requires monitoring of populations of GHRH cells. Because so many of the GHRH cells lie close to the ventral surface of the hypothalamus and send their projections superficially to the outer zone of the ME, we attempted to image a large ventral population of GHRH-eGFP cells in situ simply by external observation of the exposed hypothalamic surface of an intact brain, using an epifluorescence stereomicroscope. A population of individually identifiable eGFP-tagged GHRH cell bodies could readily be imaged in this way, and their fluorescent fibers followed as they coursed to their terminal projection fields in the ME. This should make it possible to perform optically guided recordings of multiunit activity and seek direct evidence for functional connections between identified GHRH neurons in known positions in this network.
This imaging approach showed the existence of clusters of GHRH cells with closely apposed cell bodies and that many other more separated GHRH cells seemed to be locally interconnected with visible projections containing GHRH-eGFP coursing between them. This suggests that this ventral population of GHRH neurons may form a directly connected homotypic network. Axosomatic contacts between GHRH cells have been described previously (45), and there is ultrastructural evidence for direct connections between GHRH cells (51), suggesting that network activity could be regulated by GHRH itself (52) or a related product of these cells (53). Other morphological, stimulation, and receptor colocalization studies suggest other candidate neurotransmitters and neuropeptides that could directly affect GHRH cell activity (15, 48, 54, 55, 56, 57, 58). Because it is possible to expose and record from the ventral ARC surface in anesthetized animals, we can now realistically contemplate measuring functional activity in networks of identified GHRH cells in vivo for the first time in the intact brain to gain an understanding of the mechanisms generating episodic GH secretion.
| Acknowledgments |
|---|
| Footnotes |
|---|
Current address for N.B.: Beth Israel Deaconess Medical Center, Harvard Medical School Division of Endocrinology, Boston, Massachusetts.
This work was supported by the United Kingdom MRC (to N.B., C.B.M., K.E.M., I.C.A.F.R.), Institut National de la Santé et de la Recherche Medicale, and Fondation pour la Recherche Médicale (to P.F.M., A.M., P.M.).
Abbreviations: ARC, Arcuate; DIG, digoxigenin; eGFP, enhanced green fluorescent protein; hGH, human GH; ME, median eminence; NT, nontransgenic; rGHRH, rat GHRH; RNase, ribonuclease; SV, secretory vesicle; T, transgenic.
Received January 3, 2003.
Accepted for publication February 21, 2003.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
K. J. Suter and L. O'Farrell Impaired episodic LH secretion in female mice with GFP in GnRH neurons Am J Physiol Endocrinol Metab, July 1, 2008; 295(1): E130 - E136. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Lin, E.-J. D. Lin, D. Boey, N. J. Lee, K. Slack, M. J. During, A. Sainsbury, and H. Herzog Fasting Inhibits the Growth and Reproductive Axes via Distinct Y2 and Y4 Receptor-Mediated Pathways Endocrinology, May 1, 2007; 148(5): 2056 - 2065. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Baccam, G. Alonso, T. Costecalde, P. Fontanaud, F. Molino, I. C. A. F. Robinson, P. Mollard, and P.-F. Mery Dual-Level Afferent Control of Growth Hormone-Releasing Hormone (GHRH) Neurons in GHRH-Green Fluorescent Protein Transgenic Mice J. Neurosci., February 14, 2007; 27(7): 1631 - 1641. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Bouyer, C. Loudes, I. C. A. F. Robinson, J. Epelbaum, and A. Faivre-Bauman Sexually Dimorphic Distribution of sst2A Somatostatin Receptors on Growth Hormone-Releasing Hormone Neurons in Mice Endocrinology, June 1, 2006; 147(6): 2670 - 2674. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D. Veldhuis, J. N. Roemmich, E. J. Richmond, and C. Y. Bowers Somatotropic and Gonadotropic Axes Linkages in Infancy, Childhood, and the Puberty-Adult Transition Endocr. Rev., April 1, 2006; 27(2): 101 - 140. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. R. Le Tissier, D. F. Carmignac, S. Lilley, A. K. Sesay, C. J. Phelps, P. Houston, K. Mathers, C. Magoulas, D. Ogden, and I. C. A. F. Robinson Hypothalamic Growth Hormone-Releasing Hormone (GHRH) Deficiency: Targeted Ablation of GHRH Neurons in Mice Using a Viral Ion Channel Transgene Mol. Endocrinol., May 1, 2005; 19(5): 1251 - 1262. [Abstract] [Full Text] [PDF] |
||||
![]() |
J S Davies, J L Holter, D Knight, S M Beaucourt, D Murphy, D A Carter, and T Wells Manipulating sorting signals to generate co-expression of somatostatin and eGFP in the regulated secretory pathway from a monocistronic construct J. Mol. Endocrinol., October 1, 2004; 33(2): 523 - 532. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. J. Suter The Ontogeny of Pulsatile Growth Hormone Secretion and Its Temporal Relationship to the Onset of Puberty in the Agonadal Male Rhesus Monkey (Macaca mulatta) J. Clin. Endocrinol. Metab., May 1, 2004; 89(5): 2275 - 2280. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Lall, N. Balthasar, D. Carmignac, C. Magoulas, A. Sesay, P. Houston, K. Mathers, and I. Robinson Physiological Studies of Transgenic Mice Overexpressing Growth Hormone (GH) Secretagogue Receptor 1A in GH-Releasing Hormone Neurons Endocrinology, April 1, 2004; 145(4): 1602 - 1611. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |