help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2003-0102
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
144/7/2797    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Payet, L. D.
Right arrow Articles by Firth, S. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Payet, L. D.
Right arrow Articles by Firth, S. M.
Endocrinology Vol. 144, No. 7 2797-2806
Copyright © 2003 by The Endocrine Society

Amino- and Carboxyl-Terminal Fragments of Insulin-Like Growth Factor (IGF) Binding Protein-3 Cooperate to Bind IGFs with High Affinity and Inhibit IGF Receptor Interactions

Louis D. Payet, Xiu-Hong Wang, Robert C. Baxter and Sue M. Firth

Kolling Institute of Medical Research, University of Sydney, Royal North Shore Hospital, St. Leonards, New South Wales 2065, Australia

Address all correspondence and requests for reprints to: Sue M. Firth, Ph.D., Kolling Institute of Medical Research, Royal North Shore Hospital, St. Leonards, New South Wales 2065, Australia. E-mail: sfirth{at}med.usyd.edu.au


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Both the amino-terminal and carboxyl-terminal domains of IGF binding protein (IGFBP)-3 are believed to contribute to high-affinity IGF binding. To investigate cooperativity in IGF binding by these domains, we expressed IGFBP-3 fragments 1–88 (NBP-3) and 185–264 (CBP-3) as FLAG and hexahistidine-tagged fusion proteins, respectively. IGF-I and IGF-II bound to NBP-3 poorly and to CBP-3 with moderate affinities, approximately 1 liter/nmol. Coincubating the fragments in equimolar concentrations caused a significant cooperative increase in IGF binding, demonstrated by immunoprecipitation with IGFBP-3, FLAG, or hexahistidine antibodies. Equimolar NBP-3 + CBP-3 bound IGF-II with an affinity (12.2 liter/nmol) only 4-fold lower than that of the IGFBP-3-IGF-II complex and IGF-I with an affinity (3.2 liter/nmol) 13-fold lower than IGFBP-3-IGF-I. Heterotrimeric complexes of NBP-3, CBP-3, and IGF, also demonstrated by affinity labeling, bound acid-labile subunit poorly. Coprecipitation assays with iodinated NBP-3 or CBP-3 indicated that the fragments cannot interact unless IGF is also present. Complexing with NBP-3 + CBP-3 inhibited IGF stimulation of type 1 IGF receptor activity and IGF-II binding to the type II receptor. This study demonstrates that isolated amino-terminal and carboxyl-terminal domains of IGFBP-3 cooperate in the presence of IGFs to form high-affinity complexes that retain the ability to block IGF activity.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
THE BIOAVAILABILITY AND actions of IGF-I and IGF-II are regulated by six high-affinity IGF binding proteins (IGFBPs) with strong sequence homology, IGFBP-1 to -6. Both the amino- and carboxyl-terminal regions of the IGFBPs are cysteine rich, and the disulfide bond pattern is essentially conserved across all of the IGFBPs. In contrast, the central domain of the IGFBPs has no conserved cysteine residues, and this region has little sequence homology among any of the IGFBPs (1, 2). IGFBP-3 is abundant in the adult circulation, in which the majority of circulating IGFs are found in ternary complexes with IGFBP-3 and a third protein, the acid-labile subunit (ALS) (3). Apart from binding IGFs and ALS, IGFBP-3 interacts with a variety of other extracellular and intracellular proteins including plasminogen, transferrin, and retinoid-X receptor as well as heparin and heparan sulfate proteoglycans (4, 5, 6, 7, 8). Although IGFBP-3 can influence cell growth by modulating IGF access to the IGF receptor type 1 (IGFRI), it is also reported to have IGFRI-independent effects, possibly mediated by a putative IGFBP-3 receptor (9, 10).

Despite the importance of understanding how IGFBP-3 binds IGF-I and IGF-II, the tertiary structure of IGFBP-3 has not been determined, and the majority of studies investigating the IGF-binding domain have used either mutated or truncated forms of the protein. Valuable information has come from nuclear magnetic resonance structural determination of a fragment of IGFBP-5 (11), which indicated that a hydrophobic patch in the amino-terminal domain is critical to IGF binding. Mutations of the corresponding hydrophobic residues of IGFBP-3 have been found to significantly decrease IGF binding (12, 13, 14). In contrast, other evidence points to the involvement of carboxyl-terminal residues in IGF binding (15).

In attempting to elucidate the main IGF-binding determinants of IGFBP-3, several groups have evaluated natural or synthetic amino- and carboxyl-terminal IGFBP-3 fragments. These fragments invariably show greatly decreased IGF-binding affinity, compared with the intact protein (15, 16, 17, 18). Indeed, the proteolysis of IGFBP-3 and other IGFBPs is widely regarded as a potent physiological mechanism by which IGFBPs release their ligands, thus allowing IGFs to activate IGFRI (8, 19, 20, 21).

To determine whether IGFBP-3 fragments, representing the amino- and carboxyl-terminal domains, cooperate in IGF binding, we synthesized amino-terminal (residues 1–88) and carboxyl-terminal (residues 185–264) fragments in Escherichia coli. We now report that, although each fragment individually binds IGFs, together they show strong cooperativity in the presence of IGFs to form high-affinity binding complexes. Further, in contrast to the individual, low-affinity fragments, the high-affinity complex containing equimolar concentrations of the amino- and carboxyl-terminal fragments can block activation of the IGFRI and inhibit IGF-II binding to the IGF receptor type II (IGFRII).


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Materials
All radiolabeled proteins used were prepared as described previously (22, 23). IGF-I was a generous gift from Genentech, Inc. (South San Francisco, CA) and IGF-II, des (1–3) IGF-I and des (1–6) IGF-II were purchased from GroPep Pty. Ltd. (Adelaide, Australia). Natural human full-length IGFBP-3 was purified from Cohn fraction IV of plasma (23). ALS was purified from human serum (24). The rabbit polyclonal antiserum (R-30) was raised in-house against natural human IGFBP-3, and the goat polyclonal IgG (C-19), raised against a synthetic carboxyl-terminal peptide of human IGFBP-3, was purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). The mouse anti-FLAG M2 and mouse antipolyhistidine H1 monoclonal antibodies were from Sigma-Aldrich Corp. (St. Louis, MO), the goat antirabbit antiserum from Bioclone (Sydney, Australia), the sheep antimouse antiserum from Silenus (Hawthorn, Australia), and the sheep antimouse IgG-horseradish peroxidase conjugate from Amersham Biosciences (Piscataway, NJ). Restriction and modifying enzymes were obtained from Promega Corp. (Madison, WI). The HiTrap Ni-chelating column and the Superose-12 HR 10/30 column were purchased from Amersham Biosciences, and AffiGel-10 was purchased from Bio-Rad Laboratories, Inc. (Hercules, CA). Biochemicals were purchased from Sigma-Aldrich Corp. [3H]Thymidine was obtained from Amersham Biosciences.

N-terminal fragment of IGFBP-3 (NBP3)
Recombinant NBP3 fragment (amino acids 1–88), FLAG-tagged at the carboxylterminus, was expressed in bacterial strain TOP10F’ as previously described (15). The soluble bacterial extract (50 ml) was loaded onto an IGF-I-agarose affinity column (1 x 1.5 cm, containing 1.5 mg IGF-I) at a flow rate of 0.3 ml/min. The column was washed with 20 ml of 50 mM NaH2PO4 buffer (pH 6.5) at 0.5 ml/min and bound proteins were eluted with 1 M acetic acid at 1 ml/min. Fractions containing IGFBP-3 (detected by SDS-PAGE and Coomassie stain) were further purified on a 300 Å, 5 µ C18 HPLC column (Phenomenex, Torrance, CA) using a linear 15–60% acetonitrile gradient in 0.1% trifluoroacetic acid over 30 min at 1.5 ml/min. NBP3 eluted at 18 min from this column. The identity and integrity of the NBP3 were confirmed by electrospray mass spectrometry, ligand blot using 125I-IGF-I, and immunoblot using an IGFBP-3 antiserum, as previously described (25).

Construction of IGFBP-3 C-terminal fragment expression plasmid
A DNA fragment encoding the carboxyl-terminal domain (CBP3, residues 185–264) of human IGFBP-3 was generated by PCR using 5' primer GCGGATCCCCCTGCCGTAGAGAAATGG, 3' primer ATGAATTCTTACTATCACTTGCTCTGCATGCTGTAGC, and human fibroblast IGFBP-3 cDNA as template. BamHI and EcoRI sites were incorporated into the 5' and 3' ends of the coding sequence to permit insertion of the fragment into the mini-pRSET expression vector (a generous gift from Dr. Joel Mackay, School of Molecular and Microbial Biosciences, University of Sydney, Sydney, Australia). The construct encodes a hexahistidine tag linked to the fragment’s amino terminus by seven amino acids (MRGSHHHHHHGLVPRGS). The cloned vector was transformed into competent E. coli DH5{alpha} cells after which positive clones were identified by double-restriction enzyme digestion screening. The presence of the cloned IGFBP-3 fragment was confirmed by automated DNA sequencing of both strands.

Expression and purification of CBP3
E. coli BL21({lambda}DE3) transformed with the CBP3 expression vector was grown in 1 liter Luria-Bertani broth containing 100 µg/ml ampicillin at 37 C with shaking. After reaching an OD600 of 0.4, the cells were induced by the addition of 1 mM isopropyl-ß-D-thiogalactopyranoside. Cells were harvested 4 h post induction, and the cell pellet was resuspended in 40 ml buffer (0.02 M Na phosphate; 0.5 M NaCl; 0.1% Triton X-100; and 1 mg/ml lysozyme, pH 7.4) and incubated on ice for 1 h with gentle shaking. The cell debris was removed by centrifugation and the supernatant loaded on a precharged HiTrap Ni-chelating column. The column was washed and eluted with buffer containing 0.5 M imidazole, 0.5 M NaCl, and 0.02 M sodium phosphate (pH 7.4). The eluate was dialyzed against 0.5 M acetic acid overnight at 4 C, and the precipitate was removed by centrifugation. CBP3 was further purified from the aqueous phase by reverse-phase HPLC as described for NBP3 purification above. The identity and integrity of the CBP3 were confirmed by electrospray mass spectrometry, N-terminal amino acid sequencing, ligand blotting using 125I-IGF-II, and immunoblotting using an anticarboxyl-terminal IGFBP-3 antibody. NBP3 and CBP3 were quantified spectrophotometrically, based on calculated extinction coefficients at 280 nm of 4,560 M-1 cm-1 and 11,170 M-1 cm-1, respectively.

SDS-PAGE, silver staining, and immunoblotting
Proteins were reconstituted in Laemmli sample buffer, heated at 95 C for 5 min, and electrophoresed under nonreducing conditions on a 14% SDS-polyacrylamide gel. The gel was stained using a silver staining kit (Bio-Rad Laboratories, Inc.) according to the manufacturer’s specifications. Alternatively, the proteins on the gel were transferred to nitrocellulose and blotted with specific antibodies using standard techniques.

Binding assays
Complex formation between IGF-I or IGF-II and various combinations of NBP3 and CBP3 was measured essentially as described previously (22). Briefly, 125I-IGF-I or 125I-IGF-II (10,000 cpm, 150–200 µCi/µg) was incubated with varying concentrations of NBP3, CBP3, equimolar NBP3 + CBP3, or IGFBP-3 in 100 mM Na phosphate, 0.25% BSA, and 0.1% Nonidet P-40, pH 6.5 (binding buffer) in a final volume of 300 µl. After 16 h at 22 C, 5 µl IGFBP-3 antiserum R-30 were added, and samples were then further incubated at 22 C for 2 h. IGF-binding complexes were then precipitated by the addition of 25 µl goat antirabbit serum (1 h at 22 C) and 1 ml cold polyethylene glycol, 60 g/liter in 0.15 M NaCl (15 min, 22 C). The samples were then centrifuged (4200 rpm, 20 min), the supernatants decanted, and the pellets counted in a {gamma} counter.

Similar binding assays were set up as described above except that the complexes were incubated with either FLAG antibody at final dilution 1:500 or polyhistidine antibody at final dilution 1:250. After incubating at 22 C for 2 h, 5 µl sheep antimouse antiserum were added, and the IGF bound complexes were then precipitated as described above.

Alternatively, binding assays were set up using 125I-labeled NBP3 and unlabeled CBP3 in the absence or presence of either IGF-I or IGF-II. Reactions were incubated at 22 C for 2 h before the addition of polyhistidine antibody (final dilution 1:250). Complexes were then precipitated as described above. Reciprocal assays were performed with 125I-labeled CBP3 and unlabeled NBP3 in the presence or absence of IGF-I or IGF-II with complexes being precipitated using anti-FLAG antibody (final dilution 1:500).

ALS binding was measured by incubating 125I-labeled ALS (10,000 cpm, ~12 µCi/µg) with varying concentrations of NBP3, CBP3, equimolar NBP3 and CBP3, or IGFBP-3 in the absence or presence of IGF-I or IGF-II. Samples were incubated overnight at 22 C, and then ALS binding complexes were precipitated with 5 µl IGFBP-3 antiserum R-30 and 25 µl goat antirabbit serum as described above.

Competitive binding assays
Competitive binding assays were performed by incubating either 125I-IGF-I or 125I-IGF-II (10,000 cpm) and constant amounts of NBP3, CBP3, equimolar NBP3 and CBP3, or IGFBP-3 with increasing amounts of IGF-I, IGF-II, des (1–3) IGF-I, or des (1–6) IGF-II. All samples were made up to a final volume of 400 µl in binding buffer and were incubated overnight at 22 C. IGF-binding complexes were then precipitated as described above except 1 µl IGFBP-3 antiserum R-30 and 5 µl goat antirabbit serum were used. Scatchard plots were constructed from the IGF-I and IGF-II displacement assay data. Data were fitted to a single binding site model after correction for nonspecific binding, and the association constant (Ka) of the IGFs for CBP3, NBP3 and CBP3 together, or IGFBP-3 was derived. Because of the low binding of NBP3 to IGF-I and IGF-II, affinities could not be obtained for these complexes by this method.

Affinity labeling
125I-IGF-I or 125I-IGF-II (10,000 cpm) was incubated with NBP3, CBP3, NBP3 and CBP3, or IGFBP-3 (all at 50 ng). All samples were made up to 25 µl using PBS (pH 7.4) containing 0.1% BSA and incubated at 22 C for 2 h. Samples were then treated with either disuccinimidyl suberate (DSS) (Pierce Chemical Co., Rockford, IL), 0.25 mM in 2 µl dimethyl sulfoxide, or 2 µl dimethyl sulfoxide alone as a control and incubated on ice for 45 min. The reactions were stopped by the addition of 1 µl of 1 M Tris-HCl, pH 6.5. Samples were then resolved by SDS-PAGE on 14% gels. The gels were stained with amido black, destained, dried, and then exposed to Hyperfilm MP (Amersham Biosciences) for 2 d. Similar experiments were carried out using 125I-NBP3 (10,000 cpm) coincubated with 50 ng unlabeled CBP3 in the presence or absence of either IGF-I or IGF-II (100 ng). Samples were then cross-linked and resolved on SDS-PAGE as described above.

Gel permeation chromatography
IGFBP-3 (30 ng) or equimolar NBP3 + CBP3 (10 ng) were incubated 2 h at 22 C with 125I-IGF-II and then injected onto a Superose-12 column and eluted at 1 ml/min. Fractions of 0.5 ml were collected and counted in a {gamma} counter.

[3H]Thymidine incorporation
Analysis of IGF-I-stimulated DNA synthesis in MCF-10A cells (Drs. Robert Pauley and Herbert Soule, Karmanos Cancer Institute, Detroit, MI) was carried out essentially as previously described (26). Briefly, cells were plated into 96-well plates at a density of 5 x 104 cells/well and were grown for 24 h. The cells were then maintained in serum-free DMEM(F12) medium containing 1% BSA for 48 h before addition of test reagents in fresh serum-free medium for a further 20 h. [3H]Thymidine (0.5 µCi/well) was then added in 50 µl serum-free medium for a further 4-h incubation. Monolayers were washed with ice-cold 0.9% NaCl and then fixed with 0.2 ml/well ice-cold methanol:acetic acid (3:1) at 4 C for 2 h. Cells were then solubilized in 0.5 ml/well 0.5 M NaOH, and lysates were mixed with scintillant (UltimaGold, Packard Biosciences, Groningen, Netherlands) before counting for 2 min in a ß-counter (Hewlett-Packard Co., Downers Grove, IL).

IGFRII binding assay
Rat liver microsomal membranes (RLMs), as a source of IGFRII, were prepared as previously described (27). The protein concentration of the RLM preparations was determined by Bradford assay (Bio-Rad Laboratories, Inc.). For binding assays, 25 µg RLM protein were incubated with 125I-IGF-II (6000 cpm) and an increasing amount of NBP3, CBP3, NBP3 + CBP3, or IGFBP-3. All reactions were made up to 300 µl in binding buffer and incubated at 22 C for 3 h. The samples were then precipitated (13,000 rpm for 5 min) and washed twice with ice-cold binding buffer. Membrane pellets were counted for 2 min in a {gamma} counter. To determine that 125I-IGF-II bound specifically to IGFRII in RLM preparations, similar binding assays were performed in the presence of increasing doses of unlabeled IGF-I or IGF-II.

Statistical analysis
Statistical analysis was carried out using Statview 5.0 PPC (Abacus Concepts Inc., Berkeley, CA). Differences between groups were evaluated by Fisher’s protected least significant difference test after ANOVA, and a significant difference was defined as P < 0.05.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Characterization of NBP3 and CBP3
The IGFBP-3 part sequences, NBP3 and CBP3, were expressed in E. coli and purified by affinity chromatography and reverse-phase HPLC. Figure 1AGo shows the detection of NBP3 (seen as approximately 14 kDa) and CBP3 (approximately 15 kDa) after SDS-PAGE by silver staining. Mass spectrometric analysis of NBP3 and CBP3 indicated that the proteins have comparable molecular masses of 11.2 kDa and 11.3 kDa, respectively, in agreement with the expected mass of 11,223 Da for NBP3 and 11,265 Da for CBP3. Antibodies against specific epitope tags were used to confirm the presence of NBP3’s FLAG tag and CBP3’s hexahistidine tag by immunoblotting (Fig. 1Go, B and C). NBP3 was detected only by the FLAG antibody and CBP3 was detected only by polyhistidine antibody.



View larger version (56K):
[in this window]
[in a new window]
 
Figure 1. Characterization of IGFBP-3 fragments NBP3 and CBP3. NBP3 and CBP3 were separated by SDS-PAGE. Samples were silver stained (A) or immunoblotted with either FLAG (B) or polyhistidine (C) monoclonal antibodies. Relative migration distances of molecular mass standards are indicated in kilodaltons on the right of each panel.

 
Precipitation of IGF-binding complexes
The solution-binding activity of NBP3 and CBP3 was evaluated using 125I-labeled IGF-I and IGF-II (Fig. 2Go). NBP3 bound IGF-I poorly, binding only 5% of total radioactivity when 10 ng NBP3 were used. 125I-IGF-I binding to CBP3 appeared parallel to its binding to IGFBP-3 but with approximately 100-fold lower potency. Interestingly, when equimolar NBP3 and CBP3 were coincubated with 125I-IGF-I, there was a cooperative increase in the ability of the fragments to bind IGF-I so that the potency of NBP3 + CBP3 combined was only 10-fold lower than that of intact IGFBP-3 (Fig. 2AGo). A similar synergistic effect, but with higher binding activity, was seen in the presence of 125I-IGF-II (Fig. 2BGo). NBP3 again showed poor binding, whereas CBP3 achieved high 125I-IGF-II binding, although with 100-fold lower potency than IGFBP-3. Equimolar NBP3 + CBP3 bound 125I-IGF-II efficiently, with only about 6-fold reduction in activity, compared with intact IGFBP-3. Overall, it appears that the fragments preferentially bind 125I-IGF-II compared with 125I-IGF-I, although a similar effect was not seen for IGFBP-3, which binds the two peptides similarly.



View larger version (30K):
[in this window]
[in a new window]
 
Figure 2. IGF binding to amino- and carboxyl-terminal fragments of IGFBP-3. 125I-IGF-I (A) or 125I-IGF-II (B) was incubated with increasing amounts of NBP3 ({blacksquare}), CBP3 ({bullet}), equimolar NBP3 + CBP3 ({square}), or IGFBP-3 ({circ}). IGF-binding complexes were immunoprecipitated using polyclonal IGFBP-3 antiserum ({alpha}-IGFBP-3). Values are corrected for nonspecific binding (2.3% of total radioactivity), determined in the absence of binding protein. The binding curves shown are representatives of at least two independent measurements for each peptide.

 
To ensure that the synergistic binding effect seen in the previous experiments was not an artifact caused by the use of polyclonal IGFBP-3 antiserum to immunoprecipitate the complexes, the epitope tags on NBP3 (FLAG-labeled) and CBP3 (hexahistidine-labeled) were used for immunoprecipitation, using either anti-FLAG or antipolyhistidine antibody as the precipitating reagent (Fig. 3Go). As seen when precipitated with the IGFBP-3 antiserum, the coincubation of 125I-labeled IGF-I or -II with NBP3 plus CBP3 led to a marked increase in IGF binding relative to either NBP3 or CBP3 alone. No binding of the tracer was seen to CBP3 in the FLAG antibody precipitation experiments (Fig. 3Go, A and B) or to NBP3 when the hexahistidine antibody was used (Fig. 3Go, C and D) because these fragment lack the epitopes recognized by these antibodies. However, both antibodies could precipitate ternary complexes containing NBP3, CBP3, and IGF. The apparent decrease in binding at higher concentrations of NBP3 plus CBP3 (Fig. 3Go, B and C) is due to a limitation of precipitating reagents.



View larger version (25K):
[in this window]
[in a new window]
 
Figure 3. IGF binding to amino- and carboxyl-terminal fragments of IGFBP-3. 125I-IGF-I (A and C) or 125I-IGF-II (B and D) was incubated with increasing amounts of NBP3 ({blacksquare}), CBP3 ({bullet}), or equimolar NBP3 + CBP3 ({square}). IGF-binding complexes were immunoprecipitated using polyclonal anti-FLAG antiserum ({alpha}-FLAG) (A and B) or antipolyhistidine antiserum ({alpha}-His) (C and D). Values are corrected for nonspecific binding (2.3% for FLAG antibody, 1.8% for polyhistidine antibody), determined in the absence of binding protein. The binding curves shown are representatives of at least two independent measurements for each peptide.

 
Affinity for IGF binding to IGFBP-3 fragments
IGF competitive binding experiments were performed to compare IGF-I and IGF-II affinities for CBP3 and CBP3 plus NBP3 (Fig. 4Go, open symbols). For comparison, displacement curves were also carried out with full-length IGFBP-3, but a similar analysis was not performed on NBP3 alone because of its low binding of IGF-I and IGF-II. Scatchard plots were generated from the displacement curves and Kas for the binding of IGF-I and IGF-II to CBP3, NBP3 + CBP3, and IGFBP-3 were calculated (Table 1Go). Intact IGFBP-3 bound IGF-I and -II with affinities comparable to those previously reported from this laboratory (28, 29). CBP3 bound weakly to both IGF-I and IGF-II, compared with IGFBP-3, with Ka value 100-fold lower and 50-fold lower for IGF-I and IGF-II, respectively (both P < 0.0001). However, compared with IGFBP-3, the affinity of NBP3 + CBP3 together was only 13.5-fold and 4.5-fold lower for IGF-I and IGF-II, respectively (both P < 0.0001). Thus, coincubating the two fragments together with IGFs had a strong cooperative effect on their IGF-binding affinity, the addition of NBP3 enhancing the affinity of CBP3 alone by an order of magnitude for both ligands. Notably, CBP3 had a 2-fold greater affinity for IGF-II than IGF-I (P = 0.0009), and NBP3 + CBP3 had a 4-fold higher affinity for IGF-II (P < 0.0001). These data confirm the marked cooperativity between the fragments in IGF binding.



View larger version (35K):
[in this window]
[in a new window]
 
Figure 4. Competitive binding curves for IGF binding to IGFBP-3 fragments. 125I-IGF-I (A, D, and G) or 125I-IGF-II (B, E, and H) was incubated for 2 h with IGFBP-3 0.25 ng (A and B), CBP3 50 ng (D and E), or NBP3 + CBP3, 4 ng each for IGF-I, 2 ng each for IGF-II (G and H) and increasing amounts of unlabeled IGFs. A, D, and G, Unlabeled IGF-I ({circ}) or des(1–3)IGF-I ({bullet}). B, E, and H, Unlabeled IGF-II ({square}) or des(1–6)IGF-II ({blacksquare}). IGF-binding complexes were immunoprecipitated using IGFBP-3 antiserum. The binding curves shown are representatives of at least three independent measurements for each peptide. C, F, and I, Representative Scatchard plots of either IGF-I ({circ}) or IGF-II ({square}) binding to IGFBP-3 (C), CBP3 (F), or equimolar NBP3 + CBP3 (I).

 

View this table:
[in this window]
[in a new window]
 
Table 1. Association constants for IGF-I and IGF-II binding to IGFBP-3 fragments

 
Interaction of truncated IGFs with IGFBP-3 fragments
Des(1–3)IGF-I and des(1–6)IGF-II are amino-terminally truncated IGFs with moderately reduced affinity for IGFBP-3 and greatly reduced affinity for other IGFBPs (30, 31). To determine the role of the IGF aminoterminus in the formation of complexes with NBP3 and CBP3, intact IGF-I and IGF-II (open symbols), and their truncated counterparts (closed symbols), were compared for their ability to displace iodinated IGFs from IGFBP-3, CBP3, and NBP3 + CBP3 (Fig. 4Go). Des(1–3)IGF-I competed for 125I-IGF-I binding to IGFBP-3 with 5- to 10-fold less potency than IGF-I (Fig. 4AGo); similarly, des(1–6)IGF-II was 5- to 10-fold less potent than IGF-II in competing for 125I-IGF-II binding (Fig. 4BGo). In contrast, the amino-terminally truncated IGF peptides were at least 50- to 100-fold less potent than their intact counterparts in displacing IGF tracers from CBP3 (Fig. 4Go, D and E) and were completely ineffective when tested for competitive binding to equimolar NBP3 + CBP3 (Fig. 4Go, G and H). However, des(1–3)IGF-I was equipotent as IGF-I in displacing 125I-IGF-I from NBP3 (even though the binding of 125I-IGF-I to NBP3 was very poor, as shown in Fig. 2AGo), and approximately 1000-fold more IGF analogs were required to displace binding half-maximally from NBP3 than IGFBP-3 (data not shown). These results indicate that the IGF-I and -II amino-terminal residues, which make only a moderate contribution to the IGF affinity for intact IGFBP-3, are essential for IGF binding to NBP3 + CBP3. Because the truncated peptides bind extremely poorly to CBP3, the data suggest that an important interaction exists between the IGF amino terminus and IGFBP-3 carboxyl terminus.

Affinity labeling of IGF and IGFBP-3 fragments
The ability of NBP3 and CBP3 to coassociate with IGFs was further demonstrated by cross-linking 125I-labeled IGF-I (Fig. 5AGo) and IGF-II (Fig. 5BGo) to the IGFBP-3 fragments and then visualizing the complexes formed by autoradiography after SDS-PAGE. For each set of treatments, samples were loaded uncross-linked followed by the cross-linked treatments. The cross-linking procedure had no effect on the mobility of the IGF tracers alone (lanes 1 and 2). In the presence of NBP3, 125I-IGF-I and 125I-IGF-II formed complexes of approximately 20 kDa (lanes 3 and 4). Similarly the cross-linking of CBP3 to 125I-IGF-I or -II also shifted the tracers to approximately 20 kDa (lanes 7 and 8) and, in the case of IGF-II, also formed a minor 30-kDa band, possibly containing some dimerized CBP3. Cross-linking of the two fragments together with either tracer (lanes 5 and 6) showed the formation of a strong 30-kDa band, corresponding to the expected size of the ternary NBP3-IGF-CBP3 complex as well as a 20-kDa band, assumed to contain some binary complexes between IGF and NBP3 or CBP3. IGFBP-3 gave the expected cross-linked complexes of approximately 50 kDa (lanes 9 and 10).



View larger version (64K):
[in this window]
[in a new window]
 
Figure 5. Affinity labeling of NBP3 and CBP3 with 125I-IGF-I and 125I-IGF-II. NBP3 and CBP3 were incubated with radiolabeled IGF-I (A) or IGF-II (B) for 3 h and then cross-linked with DSS, or not cross-linked, as indicated. Samples were separated by SDS-PAGE and autoradiographed. Lanes 1 and 2, Buffer alone; lanes 3 and 4, NBP3; lanes 5 and 6, NBP3 + CBP3; lanes 7 and 8, CBP3; lanes 9 and 10, IGFBP-3. Relative migration distances of molecular mass standards are indicated in kilodaltons on the left of each panel.

 
To determine whether the N- and C-fragments could interact in the absence of IGFs, 125I-labeled NBP3 was cross-linked to each unlabeled fragment in the presence or absence of IGFs (Fig. 6Go). The iodinated NBP3 appeared as an approximately 15-kDa band (Fig. 6AGo, lane 1) unaffected by the cross-linking procedure (lane 2). When 125I-NBP3 and CBP3 were coincubated together in the absence of IGFs and then cross-linked, there was no shift in the 125I-NBP3 band (Fig. 6AGo, lane 4), indicating that no interaction between the two fragments occurs in the absence of IGFs. When either IGF-I (lane 8) or IGF-II (lane 10) was cross-linked to 125I-NBP3, a new 20-kDa band appeared, consistent with IGF-NBP3 binary complexes. The addition of unlabeled NBP3 in the presence of IGF-I (Fig 6AGo, lane 12) or IGF-II (Fig. 6BGo, lane 4) did not result in any additional bands, suggesting that NBP3 does not dimerize in the presence of IGFs.



View larger version (36K):
[in this window]
[in a new window]
 
Figure 6. IGF is required to form NBP3 + CBP3 complex. A and B, Affinity labeling. 125I-NBP3 was coincubated with either NBP3 or CBP3 (100 ng) in the presence or absence of IGF-I or -II (250 ng) and then cross-linked with DSS (+) or not cross-linked (-). Samples were separated on SDS-PAGE and autoradiographed. A, Lanes 1 and 2, buffer alone; lanes 3 and 4, NBP3; lanes 5 and 6, CBP3; lanes 7 and 8, IGF-I; lanes 9 and 10, IGF-II; lanes 11 and 12. IGF-I + NBP3. B, Lanes 1 and 2, IGF-I +CBP3; lanes 3 and 4, IGF-II + NBP3; lanes 5 and 6, IGF-II + CBP3. Relative migration distances of molecular mass standards are indicated (in kilodaltons) on the left of each panel. C and D, Solution binding. 125I-CBP3 and 125I-NBP3 interaction with IGFs, NBP3, and CBP3. C, 125I-CBP3 was incubated with increasing amounts of unlabeled NBP3 or CBP3 in the presence or absence of either IGF-I or IGF-II (100 ng). Samples were then precipitated with anti-FLAG antibody. D, Similar protocol except 125I-NBP3 was used as a tracer, and samples were precipitated with anti-polyHis antibody. Symbols represent NBP3 (), CBP3 ({boxtimes}), NBP3 + IGF-I ({square}), CBP3 + IGF-I ({circ}), NBP3 + IGF-II (), CBP3 + IGF-II ({bullet}), NBP3 + CBP3 ({blacksquare}). The binding curves shown are representatives of two independent measurements for each peptide.

 
Cross-linking 125I-NBP3 to the C-terminal fragment in the presence of either IGF-I or IGF-II led to the formation of 20-, 25-, and 30-kDa bands (Fig. 6BGo, lanes 2 and 6). The 30-kDa band is assumed to represent the ternary complex composed of the two fragments cross-linked to an IGF molecule, consistent with the size of the ternary complex detected previously when 125I-IGF-I or -II was coincubated with NBP3 and CBP3 and then cross-linked (Fig. 5Go). The 20- and 25-kDa bands are assumed to represent 125I-NBP3 cross-linked to IGF or CBP3, respectively. Although no band of 25 kDa was evident when 125I-NBP3 and CBP3 were incubated with each other in the absence of IGFs (Fig. 6AGo, lane 6), we speculate that when NBP3-IGF-CBP3 complexes were incubated with DSS, some cross-linking may have occurred between NBP3 and CBP3 if they were in close proximity (~10 Å) in the ternary complex. Any noncross-linked IGF within the complex would dissociate during SDS-PAGE, leaving some approximately 25-kDa-labeled NBP3-CBP3 complexes.

To confirm the requirement for IGF-I or -II for the IGFBP-3 fragments to interact, 125I-labeled NBP3 or CBP3 was incubated with increasing amounts of unlabeled NBP3 and CBP3 in the presence and absence of IGFs. The complexes formed were then precipitated using either polyhistidine antibody (for 125I-NBP3) or FLAG antibody (for 125I-CBP3), thus ensuring that neither tracer could be precipitated unless it interacted with the opposite fragment (Fig. 6Go, C and D). Using FLAG antibody (Fig. 6CGo), no precipitation of 125I-CBP3 occurred when increasing amounts of unlabeled NBP3 were coincubated in the absence of IGFs. However, when either IGF-I or IGF-II was incubated with NBP3 and 125I-CBP3, coprecipitation of the tracer by the FLAG antibody was seen, indicating that IGFs mediate the interaction of the fragments. IGF-II resulted in the formation of a stronger 125I-CBP3-binding complex than IGF-I. Similarly, using the polyhistidine antiserum (Fig. 6DGo), CBP3 did not interact with 125I-NBP3 unless IGFs were present. Again, the complex containing IGF-II formed preferentially to that containing IGF-I.

ALS binding to IGFBP-3 fragments
ALS plays a crucial role in regulating IGF bioavailability by forming ternary complexes of 130–140 kDa with IGFBP-3 or IGFBP-5 and the IGFs (3, 32). Although the precise residues involved in the binding of IGFBP-3 to ALS have not been elucidated, regions in both the carboxyl-terminal domain and central domain of IGFBP-3 and IGFBP-5 are thought to be important (25, 32, 33, 34). Previous studies have shown that a carboxyl-terminal fragment of IGFBP-3 (residues 165–264) binds weakly to ALS in the presence of IGF-II (15). The binding of 125I-ALS to NBP3, CBP3, equimolar NBP3 + CBP3, and IGFBP-3 was therefore examined in the presence of IGF-I and IGF-II (Fig. 7Go, A and B). Neither NBP3 nor CBP3 alone displayed any binding to ALS. However, equimolar NBP3 + CBP3, in the presence of either IGF-I or IGF-II, bound ALS weakly, although this was very poor, compared with the binding of ALS to IGFBP-3. Complex formation with ALS was also examined chromatographically. Figure 7CGo shows the ternary complex formed among IGFBP-3, IGF-II, and ALS, peaking in fractions 21–23. Uncomplexed IGF-II peaked in fractions 32–34. Equimolar NBP3 + CBP3 was clearly able to complex with ALS in the presence of IGF-II, though weakly relative to intact IGFBP-3.



View larger version (28K):
[in this window]
[in a new window]
 
Figure 7. ALS binding to complexes containing NBP3, CBP3, and IGF. A, B, 125I-ALS was incubated with increasing amounts of NBP3 ({blacksquare}), CBP3 ({bullet}), NBP3 + CBP3 ({square}), or IGFBP-3 ({circ}) in the presence of 200 ng/tube of IGF-I (A) or IGF-II (B). ALS binding complexes were immunoprecipitated using IGFBP-3 antiserum. C, IGFBP-3 (30 ng) or equimolar NBP3 + CBP3 (10 ng) was incubated 2 h at 22 C with 125I-IGF-II and 1 µg ALS and then injected onto a Superose-12 column and eluted at 1 ml/min. Fractions of 0.5 ml were collected and counted in a {gamma} counter. The gray arrow indicates the peak elution position of IGFBP-3 ternary complexes (fractions 21–23), and the black arrow indicates free IGF-I.

 
IGFBP-3 fragments inhibit IGF receptor binding and action
The biological activity of the complexes between IGFs and IGFBP-3 fragments was assessed by their ability to compete with IGF receptors for IGF binding. Most of the effects of IGF-I and IGF-II are mediated by binding to IGFRI (35). Stimulation of thymidine incorporation in the IGF-sensitive MCF-10A human breast epithelial cell line (26) was assessed as a marker of IGFRI activation. Basal levels of DNA synthesis in MCF-10A cells were not affected by treatment with NBP3, CBP3, NBP3 + CBP3, or IGFBP-3 (Fig. 8AGo). DNA synthesis was stimulated approximately 8-fold in the presence of 2 ng/well (1.3 nM) of either IGF-I or IGF-II. IGFBP-3 inhibited the IGF stimulatory effect in a dose-dependent manner, with DNA synthesis strongly inhibited by 60 ng/well IGFBP-3 (6.6 nM) and similar to unstimulated levels in the presence of 300 ng/well (33 nM) IGFBP-3 (P < 0.0001 for both concentrations of IGFBP-3, compared with IGF-I or IGF-II alone).



View larger version (37K):
[in this window]
[in a new window]
 
Figure 8. Modulation of IGF receptor binding and activity by IGFBP-3 fragments. A, MCF-10A cells growing in 200 µl culture medium were treated with IGF-I or IGF-II (2 ng/well, 10 ng/ml) in the absence or presence of NBP3, CBP3, NBP3 + CBP3, or IGFBP-3 at the concentrations indicated (in nanograms per well). DNA synthesis was determined by [3H]thymidine incorporation as described in Materials and Methods. The data are mean values ± SEM, expressed as fold stimulation of thymidine incorporation measured in the absence of IGFs or IGFBPs. B and C, IGFRII binding. RLM (25 µg protein) was incubated in 300 µl with 125I-IGF-II and increasing concentrations of IGF-I ({bullet}) or IGF-II ({circ}), as shown (B). To determine the inhibition of receptor binding by IGFBP-3 fragments, 25 µg of membrane was incubated with 125I-IGF-II in the presence of increasing concentrations of NBP-3 ({blacksquare}), CBP3 ({square}), NBP3 + CBP3 ({bullet}), or IGFBP-3 ({circ}) as indicated (C). Membranes were precipitated and counted as described in Materials and Methods.

 
Neither NBP3 nor CBP3 alone had any effect on the DNA synthesis induced by IGF-I when tested at 15 ng/well or 6.6 nM, a 5-fold molar excess over IGF-I (Fig. 8AGo). When either peptide was tested at 25-fold molar excess (33 nM, 75 ng/well), IGF-I-stimulated DNA synthesis was inhibited by only about 10% (P = 0.0035 for NBP3, P = 0.0282 for CBP3). However, the combination of NBP3 + CBP3 showed marked, dose-dependent inhibition of IGF-I-stimulated DNA synthesis, with a 5-fold molar excess of fragments resulting in 37% decrease (P < 0.0001) and a 25-molar excess resulting in 70% decrease (P < 0.0001) in 3H-thymidine incorporation. The level of inhibition by 33 nM NBP3 + CBP3 was not significantly different from that of 6.6 nM IGFBP-3, suggesting that the combined fragments have only 5-fold lower IGF affinity than intact IGFBP-3. The fragments appeared even more potent in blocking IGF-II stimulation than IGF-I, with DNA synthesis strongly inhibited (79% decrease; P < 0.0001, compared with IGF-II-stimulated cells) and levels returning to basal levels (P = 0.164, compared with unstimulated cells) by 33 nM of the fragments in combination.

We have previously reported that RLMs are a rich source of IGFRII (36). Confirming the expected specificity of this receptor, IGF-II was 100-fold more potent than IGF-I in displacing 125I-IGF-II from membrane receptors (Fig. 8BGo). IGFBP-3 inhibited 125I-IGF-II binding with half-maximal inhibition at 0.25 nmol IGFBP-3 per tube (Fig. 8CGo). Increasing concentrations of NBP3 or CBP3 alone had no effect on 125I-IGF-II binding to RLMs. However, increasing concentrations of the two fragments in equimolar amounts inhibited 125I-IGF-II binding to RLMs, although the fragments were approximately 200-fold less potent than intact IGFBP-3. This demonstrates that, like IGFRI activation, IGFRII binding is blocked by the interaction of amino- and carboxyl-terminal IGFBP-3 fragments with IGF-II.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
This study presents novel evidence that 11-kDa protein fragments representing the amino- and carboxyl-terminal domains of IGFBP-3, which individually have greatly reduced IGF binding, compared with the intact protein, together form complexes with IGF-I and IGF-II with binding affinities within an order of magnitude of those of IGFBP-3. Although lacking the entire IGFBP-3 central domain, the complexes bind ALS weakly, block IGF-I and IGF-II activation of the IGFRI, and block IGF-II binding to IGFRII. These observations suggest that the limited proteolysis of IGFBP-3, assumed to inactivate the protein and allow IGFs access to their receptors (8), may in fact yield fragments that, cooperatively, retain the ability to sequester IGFs and limit receptor binding. Further experiments using naturally derived proteolyzed fragments will be required to test this hypothesis.

The IGFBPs share highly conserved amino- and carboxyl-terminal domains, and there is evidence that both of these regions are important in IGF binding (1, 2). For example, the deletion or mutagenesis of either amino- or carboxyl-terminal residues of IGFBP-1 (37, 38) or IGFBP-4 (39) greatly reduces or eliminates IGF binding. Structural studies of an IGFBP-5 fragment consisting of residues 40–92 showed that IGF-II interacted with an exposed hydrophobic pocket on the surface of the IGFBP-5 fragment (11, 40). The importance of this hydrophobic pocket in IGF binding has been supported by mutation studies in which the alteration of key IGFBP-5 residues resulted in a 1000-fold reduction in IGF-binding affinity, compared with wild-type IGFBP-5 (14). The homologous residues in IGFBP-3 have also been shown by mutational studies to be involved in IGF binding (12, 13, 14). However, the amino-terminal domain in isolation binds IGFs with an affinity at least 100-fold lower than intact IGFBP-3, as shown by this and other studies (25, 41, 42). This suggests that residues additional to those in the amino-terminal hydrophobic patch contribute to the IGF-binding site.

The existence of IGF-binding determinants in the carboxyl-terminal domain of the IGFBPs is now well established. Recombinant IGFBP-2 mutants truncated at their carboxyl domains indicate that residues 222–236 are important for IGF binding, and residues past 236 are nonessential for binding (43). Similarly, natural carboxyl-terminal fragments of IGFBP-2 isolated from human milk (residues 169–289 and 181–289) were also able to bind to both IGFs (44). Using biosensor analysis, Galanis et al. (15) demonstrated that residues 165–264 of IGFBP-3 could bind both IGF-I and -II. Although Kas were not obtained in that study, a recent biosensor study with a larger fragment, IGFBP-3 (98–264), ascertained that the immobilized fragment had at least three orders of magnitude lower affinity for IGFs than full-length IGFBP-3 (42). Surprisingly, in this study we have shown by equilibrium-binding studies in solution that a smaller fragment of IGFBP-3 (CBP3), comprising carboxyl-terminal residues 185–264, bound IGF-I and IGF-II with only 100-fold and 50-fold reduction in affinity, respectively, compared with the intact protein.

Given that both the amino- and carboxyl-terminal domains of the IGFBPs have binding activity, these domains might together interact with the IGFs to form a single high-affinity binding pocket (39, 42). It has been suggested that initial IGF binding occurs within the amino-terminal domain, and the carboxyl-terminal domain contributes to the stability of the complex leading to high-affinity binding, although this was not explicitly demonstrated in previous studies. Some evidence for this hypothesis is provided by a biosensor analysis of IGFBP-2 fragments (45) in which IGF-II and IGFBP-2 (1–132) sequentially interacted with immobilized IGFBP-2 (136–279), although affinities were not determined. However, in the reverse experiment, when IGFBP-2 (136–279) was injected across the preformed IGF-II and immobilized IGFBP-2 (1–132) complexes, no further binding was evident.

The present study shows for the first time that two separate fragments of IGFBP-3, representing the amino- and carboxyl-terminal domains, cooperate to form a high-affinity IGF-binding site. The slightly lower affinities of the complexes containing these fragments, compared with intact IGFBP-3, suggest that the central domain of IGFBP-3 may play a role in mediating or stabilizing the interaction of the amino- and carboxyl-terminal domains with the IGFs or that the conformation of the isolated fragments is slightly different from that in the intact protein. NBP3 and CBP3, each approximately 11.2 kDa, together form a 30-kDa ternary complex with IGF-I or IGF-II, with the presence of all three proteins shown by independent solution binding and cross-linking studies. However, it is not clear whether, within these complexes, the fragments interact directly with each other or if the IGF simply acts as a bridge between them. The amino-terminally truncated IGF-I and IGF-II analogs, des(1–3)IGF-I and des(1–6)IGF-II, did not complex with NBP3 and CBP3, although they bind to intact IGFBP-3 with only about 10-fold less potency than the native IGFs. Previous studies with a carboxyl-terminal IGFBP-2 fragment showed that the IGF aminoterminus was necessary for binding to the IGFBP carboxylterminus (44, 45), a finding supported by our observation that neither of the truncated IGFs was effective in competing for intact IGF binding to CBP3. Comparable binding studies using des(1–3)IGF-I and NBP3 indicated that the analog was as effective as native IGF-I, suggesting that the IGF aminoterminus is not involved in NBP3 binding. This is in agreement with our previous study that reported that the IGF-I A-domain residues 49–51 (Phe-Arg-Ser) are involved in IGFBP-3 binding (22), and these correspond to the IGF-II residues 48–50 that are predicted by nuclear magnetic resonance to interact with amino-terminal IGFBP hydrophobic patch (11).

Affinity-labeling experiments performed with iodinated NBP3 and CBP3 indicate that the fragments do not interact with each other in the absence of IGFs. However, in cross-linking experiments involving IGFs, CBP3, and 125I-labeled NBP3, 25-kDa complexes were evident in addition to the expected 20-kDa NBP3-IGF binary complexes and 30-kDa ternary complexes. These 25-kDa complexes are interpreted to represent NBP3 and CBP3, located within approximately 10 Å in the ternary complex, cross-linked by disuccinimidyl suberate (46). However, this interpretation remains speculative until the structure of the complex is fully resolved

Equimolar NBP3 + CBP3 displayed a 4-fold preferential affinity for IGF-II over IGF-I, whereas IGFBP-3 shows little binding preference for IGF-II over IGF-I. Preferential binding for IGF-II has been reported previously for fragments of IGFBP-2 (residues 169–289 and 181–289) isolated from human milk (44) and for other recombinant carboxyl-terminal fragments (15). In this case IGF-II bound to the carboxyl-terminal fragments with 2.5-fold higher affinity than IGF-I. It is possible that this difference in specificity for IGF-II over IGF-I may be negated by the presence of the central domain of IGFBP-3 because both CBP3 and the NBP3 + CBP3 preferentially bind IGF-II. Similarly, comparative studies of the binding of IGF-I and IGF-II to both full-length and carboxyl-terminal domain fragments of IGFBP-2 indicate that although IGF-II binds to the carboxyl-terminal domain fragment with a 1.7-fold higher affinity than IGF-I, no such difference is seen in the binding of the IGFs to the full-length IGFBP-2 (45). Studies of IGFBP-3 fragments encompassing either the amino-terminal domain (residues 1–97) or the central and carboxyl-terminal domains (98–264) showed equal binding to IGF-I and IGF-II (42). If carboxyl domain fragments of IGFBP-3 do preferentially bind to IGF-II, it may be of biological significance in relation to the role of proteolyzed IGFBP fragments. It has been reported that although both amino- and carboxyl-terminal fragments of IGFBP-3 were able to bind IGFs, only the carboxyl-terminal fragment interacted with cell surfaces (47). The cell binding and preferential IGF-II binding properties of the carboxyl-terminal fragments raise the possibility that proteolyzed IGFBP-3 fragments may play a role in modulating the delivery of specific IGFs to the cell surface and hence IGF receptor interactions.

This direct modulation of IGF receptor interactions by the combined IGFBP-3 fragments is shown for the first time in this study. Although even a 25-fold excess of either NBP3 or CBP3 alone had minimal effects on DNA synthesis induced by IGF-I or IGF-II, equimolar NBP3 + CBP3 significantly inhibited IGF-stimulated DNA synthesis in MCF10A cells. Similarly, equimolar NBP3 + CBP3 inhibited IGF-II binding to rat liver IGFRII in a dose-dependent manner. These observations suggest that the fragments acting in concert are biologically active in sequestering IGFs and preventing receptor interactions. In light of this, the current paradigm that proteolysis of IGFBP-3 results in low-affinity fragments that release IGFs will have to be reexamined. Together with recent reports of IGFBP-3 fragments that have intrinsic IGF-independent bioactivities (48, 49, 50), it is clear that the relationship between proteolysis and the modulation of IGFBP activity is complex. ALS binds to IGFBP-3 near the carboxyl-terminal heparin-binding site. ALS binding to NBP3 + CBP3 in the presence of the IGFs was very weak, compared with full-length IGFBP-3, but clearly formed a high-molecular-weight complex visualized by gel permeation chromatography. Our previous studies have shown that mutation of residues 228–232 in the carboxyl domain of IGFBP-3 decreased ALS affinity 10-fold without affecting IGF binding (25). Carboxyl domain residues of IGFBP-5 are also important for ALS binding (32, 33). However, we were unable to demonstrate any binding of CBP3 alone to ALS, although we previously showed low-affinity binding of a larger carboxyl domain fragment of IGFBP-3 (residues 165–264) to ALS in the presence of IGF-I and IGF-II (15). It is possible that the additional 20 central domain residues may have contributed to the ALS binding because central domain residues in IGFBP-5 have been reported to be important in ALS binding (33, 34).

In conclusion, we have shown that although there are independent low-affinity IGF binding sites within the amino- and carboxyl-terminal IGFBP-3 domains, NBP3 and CBP3 can together form a high-affinity-binding site. Like the individual fragments, the combined fragments bind IGF-II preferentially. The binary complexes between either NBP3 or CBP3 and IGF were unable to bind ALS, whereas the trimeric complexes containing NBP3, CBP3, and IGF showed some binding to ALS. It has been postulated that the limited proteolysis of IGFBP-3 to low-affinity fragments may release bound IGFs, leading to increased IGF bioavailability. However, we have shown that low-affinity fragments can cooperate to bind IGFs with sufficiently high affinity to prevent IGF-IGFR interactions. On the basis of the present study, it is clear that in the presence of both amino- and carboxyl-domain fragments, the molecular dynamics of the low-affinity binary fragment-IGF complexes may change to high-affinity trimeric complexes that can modulate IGF bioactivity. It will be interesting to investigate the generation of similar inhibitory complexes from naturally formed proteolysis fragments of IGFBP-3.


    Footnotes
 
This work was supported by the National Health and Medical Research Council, Australia (Grant 990005 to R.C.B. and S.M.F.) and a University of Sydney U2000 Postdoctoral Fellowship (to X.-H.W.).

Abbreviations: ALS, Acid-labile subunit; DSS, disuccinimidyl suberate; IGFBP, IGF binding protein; IGFRI, IGF receptor type 1; IGFRII, IGF receptor type II; Ka, association constant; RLM, rat liver microsomal membrane.

Received January 21, 2003.

Accepted for publication March 27, 2003.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Baxter RC 2000 Insulin-like growth factor (IGF)-binding proteins: interactions with IGFs and intrinsic bioactivities. Am J Physiol 278:E967–E976
  2. Clemmons DR 2001 Use of mutagenesis to probe IGF-binding protein structure/function relationships. Endocr Rev 22:800–817[Abstract/Free Full Text]
  3. Baxter RC, Martin JL 1989 Structure of the Mr 140,000 growth hormone-dependent insulin-like growth factor binding protein complex: Determination by reconstitution and affinity labeling. Proc Natl Acad Sci USA 86:6898–6902[Abstract/Free Full Text]
  4. Fowlkes JL, Thrailkill KM, George-Nascimento C, Rosenberg CK, Serra DM 1997 Heparin-binding, highly basic regions within the thyroglobulin type-1 repeat of insulin-like growth factor (IGF)-binding proteins (IGFBPs)-3, -5, and -6 inhibit IGFBP-4 degradation. Endocrinology 138:2280–2285[Abstract/Free Full Text]
  5. Campbell PG, Durham SK, Suwanichkul A, Hayes JD, Powell DR 1998 Plasminogen binds the heparin-binding domain of insulin-like growth factor-binding protein-3. Am J Physiol 275:E321–E331
  6. Liu B, Lee HY, Weinzimer SA, Powell DR, Clifford JL, Kurie JM, Cohen P 2000 Direct functional interactions between insulin-like growth factor-binding protein-3 and retinoid X receptor-{alpha} regulate transcriptional signaling and apoptosis. J Biol Chem 275:33607–33613[Abstract/Free Full Text]
  7. Weinzimer SA, Gibson TB, Collett-Solberg PF, Khare A, Liu B, Cohen P 2001 Transferrin is an insulin-like growth factor-binding protein-3 binding protein. J Clin Endocrinol Metab 86:1806–1813[Abstract/Free Full Text]
  8. Firth SM, Baxter RC 2002 Cellular actions of the insulin-like growth factor binding proteins. Endocr Rev 23:824–854[Abstract/Free Full Text]
  9. Oh Y, Muller HL, Pham H, Rosenfeld RG 1993 Demonstration of receptors for insulin-like growth factor binding protein-3 on HS578T human breast cancer cells. J Biol Chem 268:26045–26048[Abstract/Free Full Text]
  10. Fanayan S, Firth SM, Baxter RC 2002 Signaling through the Smad pathway by insulin-like growth factor binding protein-3 in breast cancer cells: relationship to transforming growth factor-ß1 signaling. J Biol Chem 277:7255–7261[Abstract/Free Full Text]
  11. Kalus W, Zweckstetter M, Renner C, Sanchez Y, Georgescu J, Grol M, Demuth D, Schumacher R, Dony C, Lang K, Holak TA 1998 Structure of the IGF-binding domain of the insulin-like growth factor-binding protein-5 (IGFBP-5): implications for IGF and IGF-I receptor interactions. EMBO J 17:6558–6572[CrossRef][Medline]
  12. Buckway CK, Wilson EM, Ahlsen M, Bang P, Oh Y, Rosenfeld RG 2001 Mutation of three critical amino acids of the N-terminal domain of IGF-binding protein-3 essential for high affinity IGF binding. J Clin Endocrinol Metab 86:4943–4950[Abstract/Free Full Text]
  13. Hong J, Zhang G, Dong F, Rechler MM 2002 Insulin-like growth factor (IGF)-binding protein-3 mutants that do not bind IGF-I or IGF-II stimulate apoptosis in human prostate cancer cells. J Biol Chem 277:10489–10497[Abstract/Free Full Text]
  14. Imai Y, Moralez A, Andag U, Clarke JB, Busby WH, Clemmons DR 2000 Substitutions for hydrophobic amino acids in the N-terminal domains of IGFBP-3 and-5 markedly reduce IGF-I binding and alter their biologic actions. J Biol Chem 275:18188–18194[Abstract/Free Full Text]
  15. Galanis M, Firth SM, Bond J, Nathanielsz A, Kortt AA, Hudson PJ, Baxter RC 2001 Ligand-binding characteristics of recombinant amino- and carboxyl-terminal fragments of human insulin-like growth factor-binding protein-3. J Endocrinol 169:123–133[Abstract]
  16. Booth BA, Boes M, Dake BL, Bar RS 1999 Isolation and characterization of plasmin-generated bioactive fragments of IGFBP-3. Am J Physiol 276:E450–E454
  17. Lalou C, Lassarre C, Binoux M 1996 A proteolytic fragment of insulin-like growth factor (IGF) binding protein-3 that fails to bind IGFs inhibits the mitogenic effects of IGF-I and insulin. Endocrinology 137:3206–3212[Abstract]
  18. Vorwerk P, Yamanaka Y, Spagnoli A, Oh YM, Rosenfeld RG 1998 Insulin and IGF binding by IGFBP-3 fragments derived from proteolysis, baculovirus expression and normal human urine. J Clin Endocrinol Metab 83:1392–1395[Abstract/Free Full Text]
  19. Conover CA 1995 Insulin-like growth factor binding protein proteolysis in bone cell models. Prog Growth Factor Res 6:301–309[CrossRef][Medline]
  20. Clemmons DR 1998 Role of insulin-like growth factor binding proteins in controlling IGF actions. Mol Cell Endocrinol 140:19–24[CrossRef][Medline]
  21. Lassarre C, Duron F, Binoux M 2001 Use of the ligand immunofunctional assay for human insulin-like growth factor ((IGF) binding protein-3 (IGFBP-3) to analyze IGFBP-3 proteolysis and IGF-I bioavailability in healthy adults, GH-deficient and acromegalic patients, and diabetics. J Clin Endocrinol Metab 86:1942–1952[Abstract/Free Full Text]
  22. Baxter RC, Bayne ML, Cascieri MA 1992 Structural determinants for binary and ternary complex formation between insulin-like growth factor-I (IGF-I) and IGF binding protein-3. J Biol Chem 267:60–65[Abstract/Free Full Text]
  23. Baxter RC, Martin JL 1986 Radioimmunoassay of growth hormone-dependent insulin-like growth factor binding protein in human plasma. J Clin Invest 78:1504–1512
  24. Baxter RC, Martin JL, Beniac VA 1989 High molecular weight insulin-like growth factor binding protein complex. Purification and properties of the acid-labile subunit from human serum. J Biol Chem 264:11843–11848[Abstract/Free Full Text]
  25. Firth SM, Ganeshprasad U, Baxter RC 1998 Structural determinants of ligand and cell surface binding of insulin-like growth factor-binding protein-3. J Biol Chem 273:2631–2638[Abstract/Free Full Text]
  26. Martin JL, Baxter RC 1999 Oncogenic ras causes resistance to the growth inhibitor insulin-like growth factor binding protein-3 (IGFBP-3) in breast cancer cells. J Biol Chem 274:16407–16411[Abstract/Free Full Text]
  27. Bryson JM, Baxter RC 1987 High-affinity receptor for insulin-like growth factor II in rat liver: properties and regulation in vivo. J Endocrinol 113:27–35[Abstract]
  28. Holman SR, Baxter RC 1996 Insulin-like growth factor binding protein-3: factors affecting binary and ternary complex formation. Growth Regul 6:42–47[Medline]
  29. Martin JL, Baxter RC 1986 Insulin-like growth factor binding protein from human plasma. Purification and characterization. J Biol Chem 261:8754–8760[Abstract/Free Full Text]
  30. Francis GL, Aplin SE, McNeil KA, Milner SJ, Forbes BE, Ross M, Ballard FJ, Wallace JC 1994 Molecular interactions of IGF-I and IGF-II with their binding proteins and receptors. In: Rosenfeld RG, ed. The insulin-like growth factors and their regulatory proteins. Amsterdam: Elsevier; 57–66
  31. Heding A, Gill R, Ogawa Y, De Meyts P, Shymko RM 1996 Biosensor measurement of the binding of insulin-like growth factors I and II and their analogues to the insulin-like growth factor-binding protein-3. J Biol Chem 271:13948–13952[Abstract/Free Full Text]
  32. Twigg SM, Kiefer MC, Zapf J, Baxter RC 1998 Insulin-like growth factor-binding protein 5 complexes with the acid-labile subunit. Role of the carboxyl-terminal domain. J Biol Chem 273:28791–28798[Abstract/Free Full Text]
  33. Firth SM, Clemmons DR, Baxter RC 2001 Mutagenesis of basic amino acids in the carboxyl-terminal region of insulin-like growth factor binding protein-5 affects acid-labile subunit binding. Endocrinology 142:2147–2150[Abstract/Free Full Text]
  34. Twigg SM, Kiefer MC, Zapf J, Baxter RC 2000 A central domain binding site in insulin-like growth factor binding protein-5 for the acid-labile subunit. Endocrinology 141:454–457[Abstract/Free Full Text]
  35. Nakae J, Kido Y, Accili D 2001 Distinct and overlapping functions of insulin and IGF-I receptors. Endocr Rev 22:818–835[Abstract/Free Full Text]
  36. Scott CD, Baxter RC 1987 Purification and immunological characterization of the rat liver insulin-like growth factor-II receptor. Endocrinology 120:1–9[Abstract]
  37. Brinkman A, Kortleve DJ, Schuller AG, Zwarthoff EC, Drop SLS 1991 Site-directed mutagenesis of the N-terminal region of IGF binding protein 1: analysis of IGF binding capability. FEBS Lett 291:264–268[CrossRef][Medline]
  38. Brinkman A, Kortleve DJ, Zwarthoff EC, Drop SLS 1991 Mutations in the C-terminal part of insulin-like growth factor (IGF)-binding protein-1 result in dimer formation and loss of IGF binding capacity. Mol Endocrinol 5:987–994[Abstract]
  39. Qin XZ, Strong DD, Baylink DJ, Mohan S 1998 Structure-function analysis of the human insulin-like growth factor binding protein-4. J Biol Chem 273:23509–23516[Abstract/Free Full Text]
  40. Zeslawski W, Beisel HG, Kamionka M, Kalus W, Engh RA, Huber R, Lang K, Holak TA 2001 The interaction of insulin-like growth factor-I with the N-terminal domain of IGFBP-5. EMBO J 20:3638–3644[CrossRef][Medline]
  41. Hashimoto R, Ono M, Fujiwara H, Higashihashi N, Yoshida M, Enjoh-Kimura T, Sakano K 1997 Binding sites and binding properties of binary and ternary complexes of insulin-like growth factor-II (IGF-II), IGF-binding protein-3, and acid-labile subunit. J Biol Chem 272:27936–27942[Abstract/Free Full Text]
  42. Vorwerk P, Hohmann B, Oh Y, Rosenfeld RG, Shymko RM 2002 Binding properties of insulin-like growth factor binding protein-3 (IGFBP-3), IGFBP-3 N- and C-terminal fragments, and structurally related proteins mac25 and connective tissue growth factor measured using a biosensor. Endocrinology 143:1677–1685[Abstract/Free Full Text]
  43. Forbes BE, Turner D, Hodge SJ, McNeil KA, Forsberg G, Wallace JC 1998 Localization of an insulin-like growth factor (IGF) binding site of bovine IGF binding protein-2 using disulfide mapping and deletion mutation analysis of the C-terminal domain. J Biol Chem 273:4647–4652[Abstract/Free Full Text]
  44. Ho PJ, Baxter RC 1997 Characterization of truncated insulin-like growth factor-binding protein-2 in human milk. Endocrinology 138:3811–3818[Abstract/Free Full Text]
  45. Carrick FE, Forbes BE, Wallace JC 2001 BIAcore analysis of bovine insulin-like growth factor (IGF)-binding protein-2 identifies major IGF binding site determinants in both the amino- and carboxyl-terminal domains. J Biol Chem 276:27120–27128[Abstract/Free Full Text]
  46. Goren HJ, Kahn CR 1982 Effect of cross-linking agents on insulin associated responses in adipocytes. Can J Biochem 60:987–1000[Medline]
  47. Devi GR, Yang DH, Rosenfeld RG, Oh Y 2000 Differential effects of insulin-like growth factor (IGF)-binding protein-3 and its proteolytic fragments on ligand binding, cell surface association, and IGF-I receptor signaling. Endocrinology 141:4171–4179[Abstract/Free Full Text]
  48. Bernard L, Babajko S, Binoux M, Ricort JM 2002 The amino-terminal region of insulin-like growth factor binding protein-3, (1–95)IGFBP-3, induces apoptosis of MCF-7 breast carcinoma cells. Biochem Biophys Res Commun 293:55–60[CrossRef][Medline]
  49. Salahifar H, Firth SM, Baxter RC, Martin JL 2000 Characterization of an amino-terminal fragment of insulin-like growth factor binding protein-3 and its effects in MCF-7 breast cancer cells. Growth Hormone IGF Res 10:367–377[CrossRef][Medline]
  50. Zadeh SM, Binoux M 1997 The 16-kDa proteolytic fragment of insulin-like growth factor (IGF) binding protein-3 inhibits the mitogenic action of fibroblast growth factor on mouse fibroblasts with a targeted disruption of the type 1 IGF receptor gene. Endocrinology 138:3069–3072[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Mol. Endocrinol.Home page
L. S. Laursen, K. Kjaer-Sorensen, M. H. Andersen, and C. Oxvig
Regulation of Insulin-Like Growth Factor (IGF) Bioactivity by Sequential Proteolytic Cleavage of IGF Binding Protein-4 and -5
Mol. Endocrinol., May 1, 2007; 21(5): 1246 - 1257.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
X. Yan, R. C. Baxter, B. Perbal, and S. M. Firth
The Aminoterminal Insulin-Like Growth Factor (IGF) Binding Domain of IGF Binding Protein-3 Cannot Be Functionally Substituted by the Structurally Homologous Domain of CCN3
Endocrinology, November 1, 2006; 147(11): 5268 - 5274.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
T. Sitar, G. M. Popowicz, I. Siwanowicz, R. Huber, and T. A. Holak
Structural basis for the inhibition of insulin-like growth factors by insulin-like growth factor-binding proteins
PNAS, August 29, 2006; 103(35): 13028 - 13033.
[Abstract] [Full Text] [PDF]