| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Kolling Institute of Medical Research, University of Sydney, Royal North Shore Hospital, St. Leonards, New South Wales 2065, Australia
Address all correspondence and requests for reprints to: Sue M. Firth, Ph.D., Kolling Institute of Medical Research, Royal North Shore Hospital, St. Leonards, New South Wales 2065, Australia. E-mail: sfirth{at}med.usyd.edu.au
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Despite the importance of understanding how IGFBP-3 binds IGF-I and IGF-II, the tertiary structure of IGFBP-3 has not been determined, and the majority of studies investigating the IGF-binding domain have used either mutated or truncated forms of the protein. Valuable information has come from nuclear magnetic resonance structural determination of a fragment of IGFBP-5 (11), which indicated that a hydrophobic patch in the amino-terminal domain is critical to IGF binding. Mutations of the corresponding hydrophobic residues of IGFBP-3 have been found to significantly decrease IGF binding (12, 13, 14). In contrast, other evidence points to the involvement of carboxyl-terminal residues in IGF binding (15).
In attempting to elucidate the main IGF-binding determinants of IGFBP-3, several groups have evaluated natural or synthetic amino- and carboxyl-terminal IGFBP-3 fragments. These fragments invariably show greatly decreased IGF-binding affinity, compared with the intact protein (15, 16, 17, 18). Indeed, the proteolysis of IGFBP-3 and other IGFBPs is widely regarded as a potent physiological mechanism by which IGFBPs release their ligands, thus allowing IGFs to activate IGFRI (8, 19, 20, 21).
To determine whether IGFBP-3 fragments, representing the amino- and carboxyl-terminal domains, cooperate in IGF binding, we synthesized amino-terminal (residues 188) and carboxyl-terminal (residues 185264) fragments in Escherichia coli. We now report that, although each fragment individually binds IGFs, together they show strong cooperativity in the presence of IGFs to form high-affinity binding complexes. Further, in contrast to the individual, low-affinity fragments, the high-affinity complex containing equimolar concentrations of the amino- and carboxyl-terminal fragments can block activation of the IGFRI and inhibit IGF-II binding to the IGF receptor type II (IGFRII).
| Materials and Methods |
|---|
|
|
|---|
N-terminal fragment of IGFBP-3 (NBP3)
Recombinant NBP3 fragment (amino acids 188), FLAG-tagged at the carboxylterminus, was expressed in bacterial strain TOP10F as previously described (15). The soluble bacterial extract (50 ml) was loaded onto an IGF-I-agarose affinity column (1 x 1.5 cm, containing 1.5 mg IGF-I) at a flow rate of 0.3 ml/min. The column was washed with 20 ml of 50 mM NaH2PO4 buffer (pH 6.5) at 0.5 ml/min and bound proteins were eluted with 1 M acetic acid at 1 ml/min. Fractions containing IGFBP-3 (detected by SDS-PAGE and Coomassie stain) were further purified on a 300 Å, 5 µ C18 HPLC column (Phenomenex, Torrance, CA) using a linear 1560% acetonitrile gradient in 0.1% trifluoroacetic acid over 30 min at 1.5 ml/min. NBP3 eluted at 18 min from this column. The identity and integrity of the NBP3 were confirmed by electrospray mass spectrometry, ligand blot using 125I-IGF-I, and immunoblot using an IGFBP-3 antiserum, as previously described (25).
Construction of IGFBP-3 C-terminal fragment expression plasmid
A DNA fragment encoding the carboxyl-terminal domain (CBP3, residues 185264) of human IGFBP-3 was generated by PCR using 5' primer GCGGATCCCCCTGCCGTAGAGAAATGG, 3' primer ATGAATTCTTACTATCACTTGCTCTGCATGCTGTAGC, and human fibroblast IGFBP-3 cDNA as template. BamHI and EcoRI sites were incorporated into the 5' and 3' ends of the coding sequence to permit insertion of the fragment into the mini-pRSET expression vector (a generous gift from Dr. Joel Mackay, School of Molecular and Microbial Biosciences, University of Sydney, Sydney, Australia). The construct encodes a hexahistidine tag linked to the fragments amino terminus by seven amino acids (MRGSHHHHHHGLVPRGS). The cloned vector was transformed into competent E. coli DH5
cells after which positive clones were identified by double-restriction enzyme digestion screening. The presence of the cloned IGFBP-3 fragment was confirmed by automated DNA sequencing of both strands.
Expression and purification of CBP3
E. coli BL21(
DE3) transformed with the CBP3 expression vector was grown in 1 liter Luria-Bertani broth containing 100 µg/ml ampicillin at 37 C with shaking. After reaching an OD600 of 0.4, the cells were induced by the addition of 1 mM isopropyl-ß-D-thiogalactopyranoside. Cells were harvested 4 h post induction, and the cell pellet was resuspended in 40 ml buffer (0.02 M Na phosphate; 0.5 M NaCl; 0.1% Triton X-100; and 1 mg/ml lysozyme, pH 7.4) and incubated on ice for 1 h with gentle shaking. The cell debris was removed by centrifugation and the supernatant loaded on a precharged HiTrap Ni-chelating column. The column was washed and eluted with buffer containing 0.5 M imidazole, 0.5 M NaCl, and 0.02 M sodium phosphate (pH 7.4). The eluate was dialyzed against 0.5 M acetic acid overnight at 4 C, and the precipitate was removed by centrifugation. CBP3 was further purified from the aqueous phase by reverse-phase HPLC as described for NBP3 purification above. The identity and integrity of the CBP3 were confirmed by electrospray mass spectrometry, N-terminal amino acid sequencing, ligand blotting using 125I-IGF-II, and immunoblotting using an anticarboxyl-terminal IGFBP-3 antibody. NBP3 and CBP3 were quantified spectrophotometrically, based on calculated extinction coefficients at 280 nm of 4,560 M-1 cm-1 and 11,170 M-1 cm-1, respectively.
SDS-PAGE, silver staining, and immunoblotting
Proteins were reconstituted in Laemmli sample buffer, heated at 95 C for 5 min, and electrophoresed under nonreducing conditions on a 14% SDS-polyacrylamide gel. The gel was stained using a silver staining kit (Bio-Rad Laboratories, Inc.) according to the manufacturers specifications. Alternatively, the proteins on the gel were transferred to nitrocellulose and blotted with specific antibodies using standard techniques.
Binding assays
Complex formation between IGF-I or IGF-II and various combinations of NBP3 and CBP3 was measured essentially as described previously (22). Briefly, 125I-IGF-I or 125I-IGF-II (10,000 cpm, 150200 µCi/µg) was incubated with varying concentrations of NBP3, CBP3, equimolar NBP3 + CBP3, or IGFBP-3 in 100 mM Na phosphate, 0.25% BSA, and 0.1% Nonidet P-40, pH 6.5 (binding buffer) in a final volume of 300 µl. After 16 h at 22 C, 5 µl IGFBP-3 antiserum R-30 were added, and samples were then further incubated at 22 C for 2 h. IGF-binding complexes were then precipitated by the addition of 25 µl goat antirabbit serum (1 h at 22 C) and 1 ml cold polyethylene glycol, 60 g/liter in 0.15 M NaCl (15 min, 22 C). The samples were then centrifuged (4200 rpm, 20 min), the supernatants decanted, and the pellets counted in a
counter.
Similar binding assays were set up as described above except that the complexes were incubated with either FLAG antibody at final dilution 1:500 or polyhistidine antibody at final dilution 1:250. After incubating at 22 C for 2 h, 5 µl sheep antimouse antiserum were added, and the IGF bound complexes were then precipitated as described above.
Alternatively, binding assays were set up using 125I-labeled NBP3 and unlabeled CBP3 in the absence or presence of either IGF-I or IGF-II. Reactions were incubated at 22 C for 2 h before the addition of polyhistidine antibody (final dilution 1:250). Complexes were then precipitated as described above. Reciprocal assays were performed with 125I-labeled CBP3 and unlabeled NBP3 in the presence or absence of IGF-I or IGF-II with complexes being precipitated using anti-FLAG antibody (final dilution 1:500).
ALS binding was measured by incubating 125I-labeled ALS (10,000 cpm,
12 µCi/µg) with varying concentrations of NBP3, CBP3, equimolar NBP3 and CBP3, or IGFBP-3 in the absence or presence of IGF-I or IGF-II. Samples were incubated overnight at 22 C, and then ALS binding complexes were precipitated with 5 µl IGFBP-3 antiserum R-30 and 25 µl goat antirabbit serum as described above.
Competitive binding assays
Competitive binding assays were performed by incubating either 125I-IGF-I or 125I-IGF-II (10,000 cpm) and constant amounts of NBP3, CBP3, equimolar NBP3 and CBP3, or IGFBP-3 with increasing amounts of IGF-I, IGF-II, des (13) IGF-I, or des (16) IGF-II. All samples were made up to a final volume of 400 µl in binding buffer and were incubated overnight at 22 C. IGF-binding complexes were then precipitated as described above except 1 µl IGFBP-3 antiserum R-30 and 5 µl goat antirabbit serum were used. Scatchard plots were constructed from the IGF-I and IGF-II displacement assay data. Data were fitted to a single binding site model after correction for nonspecific binding, and the association constant (Ka) of the IGFs for CBP3, NBP3 and CBP3 together, or IGFBP-3 was derived. Because of the low binding of NBP3 to IGF-I and IGF-II, affinities could not be obtained for these complexes by this method.
Affinity labeling
125I-IGF-I or 125I-IGF-II (10,000 cpm) was incubated with NBP3, CBP3, NBP3 and CBP3, or IGFBP-3 (all at 50 ng). All samples were made up to 25 µl using PBS (pH 7.4) containing 0.1% BSA and incubated at 22 C for 2 h. Samples were then treated with either disuccinimidyl suberate (DSS) (Pierce Chemical Co., Rockford, IL), 0.25 mM in 2 µl dimethyl sulfoxide, or 2 µl dimethyl sulfoxide alone as a control and incubated on ice for 45 min. The reactions were stopped by the addition of 1 µl of 1 M Tris-HCl, pH 6.5. Samples were then resolved by SDS-PAGE on 14% gels. The gels were stained with amido black, destained, dried, and then exposed to Hyperfilm MP (Amersham Biosciences) for 2 d. Similar experiments were carried out using 125I-NBP3 (10,000 cpm) coincubated with 50 ng unlabeled CBP3 in the presence or absence of either IGF-I or IGF-II (100 ng). Samples were then cross-linked and resolved on SDS-PAGE as described above.
Gel permeation chromatography
IGFBP-3 (30 ng) or equimolar NBP3 + CBP3 (10 ng) were incubated 2 h at 22 C with 125I-IGF-II and then injected onto a Superose-12 column and eluted at 1 ml/min. Fractions of 0.5 ml were collected and counted in a
counter.
[3H]Thymidine incorporation
Analysis of IGF-I-stimulated DNA synthesis in MCF-10A cells (Drs. Robert Pauley and Herbert Soule, Karmanos Cancer Institute, Detroit, MI) was carried out essentially as previously described (26). Briefly, cells were plated into 96-well plates at a density of 5 x 104 cells/well and were grown for 24 h. The cells were then maintained in serum-free DMEM(F12) medium containing 1% BSA for 48 h before addition of test reagents in fresh serum-free medium for a further 20 h. [3H]Thymidine (0.5 µCi/well) was then added in 50 µl serum-free medium for a further 4-h incubation. Monolayers were washed with ice-cold 0.9% NaCl and then fixed with 0.2 ml/well ice-cold methanol:acetic acid (3:1) at 4 C for 2 h. Cells were then solubilized in 0.5 ml/well 0.5 M NaOH, and lysates were mixed with scintillant (UltimaGold, Packard Biosciences, Groningen, Netherlands) before counting for 2 min in a ß-counter (Hewlett-Packard Co., Downers Grove, IL).
IGFRII binding assay
Rat liver microsomal membranes (RLMs), as a source of IGFRII, were prepared as previously described (27). The protein concentration of the RLM preparations was determined by Bradford assay (Bio-Rad Laboratories, Inc.). For binding assays, 25 µg RLM protein were incubated with 125I-IGF-II (6000 cpm) and an increasing amount of NBP3, CBP3, NBP3 + CBP3, or IGFBP-3. All reactions were made up to 300 µl in binding buffer and incubated at 22 C for 3 h. The samples were then precipitated (13,000 rpm for 5 min) and washed twice with ice-cold binding buffer. Membrane pellets were counted for 2 min in a
counter. To determine that 125I-IGF-II bound specifically to IGFRII in RLM preparations, similar binding assays were performed in the presence of increasing doses of unlabeled IGF-I or IGF-II.
Statistical analysis
Statistical analysis was carried out using Statview 5.0 PPC (Abacus Concepts Inc., Berkeley, CA). Differences between groups were evaluated by Fishers protected least significant difference test after ANOVA, and a significant difference was defined as P < 0.05.
| Results |
|---|
|
|
|---|
|
|
|
|
|
Affinity labeling of IGF and IGFBP-3 fragments
The ability of NBP3 and CBP3 to coassociate with IGFs was further demonstrated by cross-linking 125I-labeled IGF-I (Fig. 5A
) and IGF-II (Fig. 5B
) to the IGFBP-3 fragments and then visualizing the complexes formed by autoradiography after SDS-PAGE. For each set of treatments, samples were loaded uncross-linked followed by the cross-linked treatments. The cross-linking procedure had no effect on the mobility of the IGF tracers alone (lanes 1 and 2). In the presence of NBP3, 125I-IGF-I and 125I-IGF-II formed complexes of approximately 20 kDa (lanes 3 and 4). Similarly the cross-linking of CBP3 to 125I-IGF-I or -II also shifted the tracers to approximately 20 kDa (lanes 7 and 8) and, in the case of IGF-II, also formed a minor 30-kDa band, possibly containing some dimerized CBP3. Cross-linking of the two fragments together with either tracer (lanes 5 and 6) showed the formation of a strong 30-kDa band, corresponding to the expected size of the ternary NBP3-IGF-CBP3 complex as well as a 20-kDa band, assumed to contain some binary complexes between IGF and NBP3 or CBP3. IGFBP-3 gave the expected cross-linked complexes of approximately 50 kDa (lanes 9 and 10).
|
|
10 Å) in the ternary complex. Any noncross-linked IGF within the complex would dissociate during SDS-PAGE, leaving some approximately 25-kDa-labeled NBP3-CBP3 complexes.
To confirm the requirement for IGF-I or -II for the IGFBP-3 fragments to interact, 125I-labeled NBP3 or CBP3 was incubated with increasing amounts of unlabeled NBP3 and CBP3 in the presence and absence of IGFs. The complexes formed were then precipitated using either polyhistidine antibody (for 125I-NBP3) or FLAG antibody (for 125I-CBP3), thus ensuring that neither tracer could be precipitated unless it interacted with the opposite fragment (Fig. 6
, C and D). Using FLAG antibody (Fig. 6C
), no precipitation of 125I-CBP3 occurred when increasing amounts of unlabeled NBP3 were coincubated in the absence of IGFs. However, when either IGF-I or IGF-II was incubated with NBP3 and 125I-CBP3, coprecipitation of the tracer by the FLAG antibody was seen, indicating that IGFs mediate the interaction of the fragments. IGF-II resulted in the formation of a stronger 125I-CBP3-binding complex than IGF-I. Similarly, using the polyhistidine antiserum (Fig. 6D
), CBP3 did not interact with 125I-NBP3 unless IGFs were present. Again, the complex containing IGF-II formed preferentially to that containing IGF-I.
ALS binding to IGFBP-3 fragments
ALS plays a crucial role in regulating IGF bioavailability by forming ternary complexes of 130140 kDa with IGFBP-3 or IGFBP-5 and the IGFs (3, 32). Although the precise residues involved in the binding of IGFBP-3 to ALS have not been elucidated, regions in both the carboxyl-terminal domain and central domain of IGFBP-3 and IGFBP-5 are thought to be important (25, 32, 33, 34). Previous studies have shown that a carboxyl-terminal fragment of IGFBP-3 (residues 165264) binds weakly to ALS in the presence of IGF-II (15). The binding of 125I-ALS to NBP3, CBP3, equimolar NBP3 + CBP3, and IGFBP-3 was therefore examined in the presence of IGF-I and IGF-II (Fig. 7
, A and B). Neither NBP3 nor CBP3 alone displayed any binding to ALS. However, equimolar NBP3 + CBP3, in the presence of either IGF-I or IGF-II, bound ALS weakly, although this was very poor, compared with the binding of ALS to IGFBP-3. Complex formation with ALS was also examined chromatographically. Figure 7C
shows the ternary complex formed among IGFBP-3, IGF-II, and ALS, peaking in fractions 2123. Uncomplexed IGF-II peaked in fractions 3234. Equimolar NBP3 + CBP3 was clearly able to complex with ALS in the presence of IGF-II, though weakly relative to intact IGFBP-3.
|
|
We have previously reported that RLMs are a rich source of IGFRII (36). Confirming the expected specificity of this receptor, IGF-II was 100-fold more potent than IGF-I in displacing 125I-IGF-II from membrane receptors (Fig. 8B
). IGFBP-3 inhibited 125I-IGF-II binding with half-maximal inhibition at 0.25 nmol IGFBP-3 per tube (Fig. 8C
). Increasing concentrations of NBP3 or CBP3 alone had no effect on 125I-IGF-II binding to RLMs. However, increasing concentrations of the two fragments in equimolar amounts inhibited 125I-IGF-II binding to RLMs, although the fragments were approximately 200-fold less potent than intact IGFBP-3. This demonstrates that, like IGFRI activation, IGFRII binding is blocked by the interaction of amino- and carboxyl-terminal IGFBP-3 fragments with IGF-II.
| Discussion |
|---|
|
|
|---|
The IGFBPs share highly conserved amino- and carboxyl-terminal domains, and there is evidence that both of these regions are important in IGF binding (1, 2). For example, the deletion or mutagenesis of either amino- or carboxyl-terminal residues of IGFBP-1 (37, 38) or IGFBP-4 (39) greatly reduces or eliminates IGF binding. Structural studies of an IGFBP-5 fragment consisting of residues 4092 showed that IGF-II interacted with an exposed hydrophobic pocket on the surface of the IGFBP-5 fragment (11, 40). The importance of this hydrophobic pocket in IGF binding has been supported by mutation studies in which the alteration of key IGFBP-5 residues resulted in a 1000-fold reduction in IGF-binding affinity, compared with wild-type IGFBP-5 (14). The homologous residues in IGFBP-3 have also been shown by mutational studies to be involved in IGF binding (12, 13, 14). However, the amino-terminal domain in isolation binds IGFs with an affinity at least 100-fold lower than intact IGFBP-3, as shown by this and other studies (25, 41, 42). This suggests that residues additional to those in the amino-terminal hydrophobic patch contribute to the IGF-binding site.
The existence of IGF-binding determinants in the carboxyl-terminal domain of the IGFBPs is now well established. Recombinant IGFBP-2 mutants truncated at their carboxyl domains indicate that residues 222236 are important for IGF binding, and residues past 236 are nonessential for binding (43). Similarly, natural carboxyl-terminal fragments of IGFBP-2 isolated from human milk (residues 169289 and 181289) were also able to bind to both IGFs (44). Using biosensor analysis, Galanis et al. (15) demonstrated that residues 165264 of IGFBP-3 could bind both IGF-I and -II. Although Kas were not obtained in that study, a recent biosensor study with a larger fragment, IGFBP-3 (98264), ascertained that the immobilized fragment had at least three orders of magnitude lower affinity for IGFs than full-length IGFBP-3 (42). Surprisingly, in this study we have shown by equilibrium-binding studies in solution that a smaller fragment of IGFBP-3 (CBP3), comprising carboxyl-terminal residues 185264, bound IGF-I and IGF-II with only 100-fold and 50-fold reduction in affinity, respectively, compared with the intact protein.
Given that both the amino- and carboxyl-terminal domains of the IGFBPs have binding activity, these domains might together interact with the IGFs to form a single high-affinity binding pocket (39, 42). It has been suggested that initial IGF binding occurs within the amino-terminal domain, and the carboxyl-terminal domain contributes to the stability of the complex leading to high-affinity binding, although this was not explicitly demonstrated in previous studies. Some evidence for this hypothesis is provided by a biosensor analysis of IGFBP-2 fragments (45) in which IGF-II and IGFBP-2 (1132) sequentially interacted with immobilized IGFBP-2 (136279), although affinities were not determined. However, in the reverse experiment, when IGFBP-2 (136279) was injected across the preformed IGF-II and immobilized IGFBP-2 (1132) complexes, no further binding was evident.
The present study shows for the first time that two separate fragments of IGFBP-3, representing the amino- and carboxyl-terminal domains, cooperate to form a high-affinity IGF-binding site. The slightly lower affinities of the complexes containing these fragments, compared with intact IGFBP-3, suggest that the central domain of IGFBP-3 may play a role in mediating or stabilizing the interaction of the amino- and carboxyl-terminal domains with the IGFs or that the conformation of the isolated fragments is slightly different from that in the intact protein. NBP3 and CBP3, each approximately 11.2 kDa, together form a 30-kDa ternary complex with IGF-I or IGF-II, with the presence of all three proteins shown by independent solution binding and cross-linking studies. However, it is not clear whether, within these complexes, the fragments interact directly with each other or if the IGF simply acts as a bridge between them. The amino-terminally truncated IGF-I and IGF-II analogs, des(13)IGF-I and des(16)IGF-II, did not complex with NBP3 and CBP3, although they bind to intact IGFBP-3 with only about 10-fold less potency than the native IGFs. Previous studies with a carboxyl-terminal IGFBP-2 fragment showed that the IGF aminoterminus was necessary for binding to the IGFBP carboxylterminus (44, 45), a finding supported by our observation that neither of the truncated IGFs was effective in competing for intact IGF binding to CBP3. Comparable binding studies using des(13)IGF-I and NBP3 indicated that the analog was as effective as native IGF-I, suggesting that the IGF aminoterminus is not involved in NBP3 binding. This is in agreement with our previous study that reported that the IGF-I A-domain residues 4951 (Phe-Arg-Ser) are involved in IGFBP-3 binding (22), and these correspond to the IGF-II residues 4850 that are predicted by nuclear magnetic resonance to interact with amino-terminal IGFBP hydrophobic patch (11).
Affinity-labeling experiments performed with iodinated NBP3 and CBP3 indicate that the fragments do not interact with each other in the absence of IGFs. However, in cross-linking experiments involving IGFs, CBP3, and 125I-labeled NBP3, 25-kDa complexes were evident in addition to the expected 20-kDa NBP3-IGF binary complexes and 30-kDa ternary complexes. These 25-kDa complexes are interpreted to represent NBP3 and CBP3, located within approximately 10 Å in the ternary complex, cross-linked by disuccinimidyl suberate (46). However, this interpretation remains speculative until the structure of the complex is fully resolved
Equimolar NBP3 + CBP3 displayed a 4-fold preferential affinity for IGF-II over IGF-I, whereas IGFBP-3 shows little binding preference for IGF-II over IGF-I. Preferential binding for IGF-II has been reported previously for fragments of IGFBP-2 (residues 169289 and 181289) isolated from human milk (44) and for other recombinant carboxyl-terminal fragments (15). In this case IGF-II bound to the carboxyl-terminal fragments with 2.5-fold higher affinity than IGF-I. It is possible that this difference in specificity for IGF-II over IGF-I may be negated by the presence of the central domain of IGFBP-3 because both CBP3 and the NBP3 + CBP3 preferentially bind IGF-II. Similarly, comparative studies of the binding of IGF-I and IGF-II to both full-length and carboxyl-terminal domain fragments of IGFBP-2 indicate that although IGF-II binds to the carboxyl-terminal domain fragment with a 1.7-fold higher affinity than IGF-I, no such difference is seen in the binding of the IGFs to the full-length IGFBP-2 (45). Studies of IGFBP-3 fragments encompassing either the amino-terminal domain (residues 197) or the central and carboxyl-terminal domains (98264) showed equal binding to IGF-I and IGF-II (42). If carboxyl domain fragments of IGFBP-3 do preferentially bind to IGF-II, it may be of biological significance in relation to the role of proteolyzed IGFBP fragments. It has been reported that although both amino- and carboxyl-terminal fragments of IGFBP-3 were able to bind IGFs, only the carboxyl-terminal fragment interacted with cell surfaces (47). The cell binding and preferential IGF-II binding properties of the carboxyl-terminal fragments raise the possibility that proteolyzed IGFBP-3 fragments may play a role in modulating the delivery of specific IGFs to the cell surface and hence IGF receptor interactions.
This direct modulation of IGF receptor interactions by the combined IGFBP-3 fragments is shown for the first time in this study. Although even a 25-fold excess of either NBP3 or CBP3 alone had minimal effects on DNA synthesis induced by IGF-I or IGF-II, equimolar NBP3 + CBP3 significantly inhibited IGF-stimulated DNA synthesis in MCF10A cells. Similarly, equimolar NBP3 + CBP3 inhibited IGF-II binding to rat liver IGFRII in a dose-dependent manner. These observations suggest that the fragments acting in concert are biologically active in sequestering IGFs and preventing receptor interactions. In light of this, the current paradigm that proteolysis of IGFBP-3 results in low-affinity fragments that release IGFs will have to be reexamined. Together with recent reports of IGFBP-3 fragments that have intrinsic IGF-independent bioactivities (48, 49, 50), it is clear that the relationship between proteolysis and the modulation of IGFBP activity is complex. ALS binds to IGFBP-3 near the carboxyl-terminal heparin-binding site. ALS binding to NBP3 + CBP3 in the presence of the IGFs was very weak, compared with full-length IGFBP-3, but clearly formed a high-molecular-weight complex visualized by gel permeation chromatography. Our previous studies have shown that mutation of residues 228232 in the carboxyl domain of IGFBP-3 decreased ALS affinity 10-fold without affecting IGF binding (25). Carboxyl domain residues of IGFBP-5 are also important for ALS binding (32, 33). However, we were unable to demonstrate any binding of CBP3 alone to ALS, although we previously showed low-affinity binding of a larger carboxyl domain fragment of IGFBP-3 (residues 165264) to ALS in the presence of IGF-I and IGF-II (15). It is possible that the additional 20 central domain residues may have contributed to the ALS binding because central domain residues in IGFBP-5 have been reported to be important in ALS binding (33, 34).
In conclusion, we have shown that although there are independent low-affinity IGF binding sites within the amino- and carboxyl-terminal IGFBP-3 domains, NBP3 and CBP3 can together form a high-affinity-binding site. Like the individual fragments, the combined fragments bind IGF-II preferentially. The binary complexes between either NBP3 or CBP3 and IGF were unable to bind ALS, whereas the trimeric complexes containing NBP3, CBP3, and IGF showed some binding to ALS. It has been postulated that the limited proteolysis of IGFBP-3 to low-affinity fragments may release bound IGFs, leading to increased IGF bioavailability. However, we have shown that low-affinity fragments can cooperate to bind IGFs with sufficiently high affinity to prevent IGF-IGFR interactions. On the basis of the present study, it is clear that in the presence of both amino- and carboxyl-domain fragments, the molecular dynamics of the low-affinity binary fragment-IGF complexes may change to high-affinity trimeric complexes that can modulate IGF bioactivity. It will be interesting to investigate the generation of similar inhibitory complexes from naturally formed proteolysis fragments of IGFBP-3.
| Footnotes |
|---|
Abbreviations: ALS, Acid-labile subunit; DSS, disuccinimidyl suberate; IGFBP, IGF binding protein; IGFRI, IGF receptor type 1; IGFRII, IGF receptor type II; Ka, association constant; RLM, rat liver microsomal membrane.
Received January 21, 2003.
Accepted for publication March 27, 2003.
| References |
|---|
|
|
|---|
regulate transcriptional signaling and apoptosis. J Biol Chem 275:3360733613This article has been cited by other articles:
![]() |
X. Yan, L. D. Payet, R. C. Baxter, and S. M. Firth Activity of Human Pregnancy Insulin-Like Growth Factor Binding Protein-3: Determination by Reconstituting Recombinant Complexes Endocrinology, November 1, 2009; 150(11): 4968 - 4976. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. S. Laursen, K. Kjaer-Sorensen, M. H. Andersen, and C. Oxvig Regulation of Insulin-Like Growth Factor (IGF) Bioactivity by Sequential Proteolytic Cleavage of IGF Binding Protein-4 and -5 Mol. Endocrinol., May 1, 2007; 21(5): 1246 - 1257. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Yan, R. C. Baxter, B. Perbal, and S. M. Firth The Aminoterminal Insulin-Like Growth Factor (IGF) Binding Domain of IGF Binding Protein-3 Cannot Be Functionally Substituted by the Structurally Homologous Domain of CCN3 Endocrinology, November 1, 2006; 147(11): 5268 - 5274. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Sitar, G. M. Popowicz, I. Siwanowicz, R. Huber, and T. A. Holak Structural basis for the inhibition of insulin-like growth factors by insulin-like growth factor-binding proteins PNAS, August 29, 2006; 103(35): 13028 - 13033. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. M. Kibbey, M. J. Jameson, E. M. Eaton, and S. A. Rosenzweig Insulin-Like Growth Factor Binding Protein-2: Contributions of the C-Terminal Domain to Insulin-Like Growth Factor-1 Binding Mol. Pharmacol., March 1, 2006; 69(3): 833 - 845. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. J. Allan, E. Tonner, M. Szymanowska, J. H. Shand, S. M. Kelly, K. Phillips, R. A. Clegg, I. F. Gow, J. Beattie, and D. J. Flint Cumulative Mutagenesis of the Basic Residues in the 201-218 Region of Insulin-Like Growth Factor (IGF)-Binding Protein-5 Results in Progressive Loss of Both IGF-I Binding and Inhibition of IGF-I Biological Action Endocrinology, January 1, 2006; 147(1): 338 - 349. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. S. Y. Chan, S. M. Twigg, S. M. Firth, and R. C. Baxter Insulin-Like Growth Factor Binding Protein-3 Leads to Insulin Resistance in Adipocytes J. Clin. Endocrinol. Metab., December 1, 2005; 90(12): 6588 - 6595. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Yan, B. E. Forbes, K. A. McNeil, R. C. Baxter, and S. M. Firth Role of N- and C-terminal Residues of Insulin-like Growth Factor (IGF)-binding Protein-3 in Regulating IGF Complex Formation and Receptor Activation J. Biol. Chem., December 17, 2004; 279(51): 53232 - 53240. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. J Headey, K. S Leeding, R. S Norton, and L. A Bach Contributions of the N- and C-terminal domains of IGF binding protein-6 to IGF binding J. Mol. Endocrinol., October 1, 2004; 33(2): 377 - 386. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |