| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Institute of Comparative Medicine (P.J.OS., L.M.F., G.J., P.J.B.), University of Glasgow Veterinary School, Glasgow, Scotland G61 1QH, United Kingdom; and Developmental Biology Program (U.H., P.R.), Oklahoma Medical Research Foundation, Oklahoma City, Oklahoma 73104
Address all correspondence and requests for reprints to: P. J. OShaughnessy, Institute of Comparative Medicine, University of Glasgow Veterinary School, Bearsden Road, Glasgow, Scotland G61 1QH, United Kingdom. E-mail: p.j.o'shaughnessy{at}vet.gla.ac.uk.
| Abstract |
|---|
|
|
|---|
-MSH nor
-MSH had any effect on androgen production in vitro at any age. Fetal testosterone levels were normal in mice that lack circulating ACTH (proopiomelanocortin-null) indicating that ACTH is not essential for fetal Leydig cell function. Results show that both LH and ACTH can regulate testicular steroidogenesis during fetal development in the mouse and suggest that fetal Leydig cells, but not adult Leydig cells, are sensitive to ACTH stimulation. | Introduction |
|---|
|
|
|---|
| Materials and Methods |
|---|
|
|
|---|
Steriods were extracted from the testes as previously described (6). Blood, for measurement of ACTH levels, was collected from fetuses or neonates following decapitation and serum was stored frozen at -70 C.
Identification of fetal-specific testis transcripts
To identify mRNA species differentially expressed in the fetal testis, the NCBI UniGene Lib.324 (testes from embryos at E15) was compared with combined libraries 41, 273 293, 463, 464, and 476 (all from adult testicular tissue) and to a SAGE library from mouse 3T3 cells. Library 324 contains 8553 ESTs in 4156 UniGene clusters, and the combined adult libraries contain 87439 ESTs in 16522 unique UniGene clusters. To identify genes that are differentially expressed, the EST libraries were downloaded from NCBI (http://www.ncbi.nlm.nih.gov/UniGene/lbrowse.cgi?ORG=Mm) and converted to Microsoft Access files for comparison using the UniGene number as the related record.
Tissue and cell incubations
To measure testicular androgen production in response to ACTH, testes from postnatal animals were decapsulated and incubated in culture medium (DMEM/F12, Invitrogen, Paisley, UK) under 5% CO2 in air. Testes from fetal animals were incubated in a similar manner with the exception that the tunica was torn with fine forceps and partially removed before incubation. Testes were incubated for 5 h, and one testis from each animal was incubated under basal conditions, whereas the contralateral testis was incubated with 10-6 M ACTH (fragment 124) (Sigma-Aldrich Co. Ltd., Poole, UK). Testes from animals aged up to 25 d were incubated at 37 C, whereas testes from animals aged 30 d and over were incubated at 32 C. At the end of the incubation period, the medium was heated to 95 C, centrifuged at 4000 x g for 10 min, and the supernatant stored frozen until assayed for androgen or corticosteroid content by RIA. To compare the trophic effect of ACTH with that of human chorionic gonadotropin (hCG), one testis from a fetal or neonatal animal was incubated with ACTH (10-6 M), whereas the contralateral testes was incubated with recombinant hCG (Serono Pharmaceuticals Ltd., Feltham, UK) (10-7 M) and testosterone measured as above.
Dispersed testicular cells were prepared by collagenase treatment of whole testes as previously described (12). The number of testes used to prepare isolated cells depended on the age of the animals: 4 testes were used from adult mice, 68 testes from neonatal (5 d old) mice, and 812 testes from fetal (E17.5) mice. Testes were dispersed at 37 C in DMEM/F12 containing 1 mg/ml collagenase (Worthington CLS type 4, purchased from Lorne Laboratories Ltd., Twyford, UK) (12) and isolated cells were filtered through a nylon sieve with a pore size of 50 µm. Cell number was counted using a hemocytometer, and the percentage of Leydig cells present was determined by histochemical staining for 3ß-hydroxysteroid dehydrogenase (13). Aliquots of isolated cells (1 ml total) were incubated for 3 h at 37 C (fetal and neonatal cells) or 32 C (adult cells) in DMEM/F12 in an atmosphere of 5% CO2 and in the presence of varying concentrations of hCG, ACTH (fragment 124),
-MSH (Sigma-Aldrich Co. Ltd., Poole, UK) or
-MSH (Sigma-Aldrich Co. Ltd.). At the end of the incubation period, cells and medium were placed in a heating block at 100 C for 5 min and then centrifuged at 4000 x g for 10 min. The supernatant was stored frozen at -20 C until assayed for testosterone by RIA. Each dose-response curve was generated twice in separate experiments.
RT-PCR
Total RNA was extracted from whole testes using Trizol (Life Technologies, Paisley, UK), and residual genomic DNA was removed by deoxyribonuclease treatment (DNA-free, Ambion Inc., supplied by AMS Biotechnology, Abington, UK). Treatment of the RNA to remove contaminating genomic DNA was necessary because the melanocortin receptor (Mcr) genes are largely devoid of introns, and it was not possible to design primers for PCR that crossed intron sequence. Removal of contaminating DNA was tested by PCR amplification of RNA without the reverse transcription step. RNA was reverse transcribed using random hexamers and Moloney murine leukemia virus reverse transcriptase (Superscript II, Invitrogen) as described previously (14, 15). PCRs were carried out in Tris/HCl buffer (75 mM, pH 9.0, at 25 C) containing (NH4)2SO4 (20 mM), Tween 20 (0.01%), MgCl2 (2 mM), deoxynucleotide triphosphates (0.2 mM each), Taq polymerase (2 U/100 µl), primers (200 nM each), and template (0.5 µl) in a total reaction volume of 50 µl.
The primers used to amplify the five different Mcr isoforms were based on GenBank sequences NM008559 (Mc1r), NM008560 (Mc2r), NM008561 (Mc3r), AF201662 (Mc4r), and NM013596 (Mc5r).
Primers used were: Mc1r forward-GGGCAGAGGGTGACAGTGAT, reverse-CCATCCCTGTCTCCT CCACTT, expected product size 200 bp; Mc2r forward-TGTCCTCCTGGCTGTGATCA, reverse-CTCCCTGTGCAGAACATCCA, expected size 351 bp; Mc3r forward-CGATGCTGCCTAACCTCTCTG, reverse-AACTGGTCCTCCAAGGTCAGG, expected size 300 bp, Mc4r forward-ATGTTCCTGATGGCGAGGC, reverse-CATGAAGCACACGCAGTATGG, expected size 200 bp; Mc5r forward-CGGACGAGAGCAGAATGGTAA, reverse-CGATGTGTCGCACAAAGGTG, expected size 400 bp. Products were separated on 2% NuSieve/agarose (3/1) gels (BioWhittaker UK Ltd., Wokingham, UK).
Real-time PCR
To quantify the content of Mc2r mRNA in the testis during development, a real-time PCR approach was used that utilized the TaqMan PCR method following RT of the isolated RNA (16). Levels of Mc2r mRNA were measured relative to expression of the ubiquitous gene Wbscr1 (17). Primers and probes used to amplify Wbscr1 cDNA were as previously described (17), while the primers used to amplify Mc2r had sequences CACAGGGAGCGGCATCA and GGGAACAGCGATGTGAAGGT and the probe had sequence TCTCCCACCACATCCCCACAGTGC. The real-time PCR amplifications were carried out as previously described (17, 18).
RIA
Levels of testosterone in incubation medium and in testicular extracts were measured by RIA as previously described (19). Corticosteroid levels in incubation medium were measured using a commercial RIA (Immunodiagnostic Systems Ltd., Boldon, UK). Serum levels of ACTH were also measured using a commercial RIA (ICN Pharmaceuticals Ltd., Basingstoke, UK). Serum from three or four animals was pooled to generate each sample for ACTH RIA.
Statistics
Results were analyzed using paired t tests or by single factor ANOVA with differences between individual means assessed by the Neuman-Keuls test.
| Results |
|---|
|
|
|---|
|
|
Dose-response relationship to hCG, ACTH,
-MSH, and
-MSH
The steroidogenic response of testicular cells, isolated from fetal, neonatal or adult animals, to increasing doses of hCG, ACTH,
-MSH, and
-MSH is shown in Fig. 3
. Testosterone production by cells from all three age groups was stimulated by hCG with an effect first seen at 3 x 10-13 M hCG in fetal and neonatal animals and 10-12 M in adult animals. The ED50 for hCG was between 3 and 6 x 10-12 M at all three ages. Testiscular cells from fetal and neonatal animals also responded to ACTH with the maximum response similar to that seen with hCG. The minimum dose of ACTH which stimulated a steroidogenic response was 2 x 10-11 M, and the ED50 for ACTH was 7 x 10-10 M for fetal testes and 2 x 10-10 M for neonatal testes. ACTH had no effect on androgen production by adult testes. Neither
-MSH or
-MSH (up to 10-8 M) had any effect on androgen production at any age.
|
|
|
| Discussion |
|---|
|
|
|---|
In animals lacking circulating LH fetal androgen levels are normal, but there is a rapid decline in testosterone after birth with testicular levels barely detectable by d 5 (6). There is no chorionic gonadotropin in rodents, and these data suggest that whatever maintains androgen production during fetal development in LH-deficient mice must show a significant decline after birth. Results from this study and others have shown that there is a marked drop in circulating ACTH levels after birth in mice and rats (22, 23, 24), such that by d 5 ACTH levels are below the minimum level that would stimulate Leydig cell function. This would be consistent with the hypothesis that both hormones act to maintain Leydig cell function during fetal development.
POMC gives rise to five peptides (ACTH,
-MSH, ß-MSH,
-MSH, and ß-endorphin) with a wide range of biological activities. The melanocortins (ACTH and MSHs) act through the melanocortin receptors, which make up a distinct family of G protein-coupled receptors with seven transmembrane domains (25). There are five known members of the Mcr family, each with characteristic affinity for the different melanocortins derived from POMC (25). Both expression of Mc2r in the testis and trophic effects of ACTH on fetal testicular steroidogenesis were a surprise initially because the distribution of Mc2r is, otherwise, restricted to the adrenal gland with low expression in skin and adipose tissue (26, 27, 28). In addition, an early study reported that testosterone production by late fetal mouse testes in vitro was not affected by ACTH (20). It is clear, however, from the current studies that androgen production by the fetal testis can be regulated by ACTH with a sensitivity similar to that seen previously with isolated adrenocortical cells in vitro (29, 30). Although three different forms of the Mcr are expressed in the fetal testis, it is highly likely that the effects of ACTH are mediated through Mc2r because this is the only receptor that responds to ACTH but not
-MSH (25, 31, 32). The presence of Mc3r and Mc4r in the fetal testis also suggests, however, that the melanocortins may have other activities in the fetal testis that are unrelated to steroidogenesis.
During development, the gonad and adrenal gland arise in close proximity, and it has been proposed that Leydig cells and steroidogenic cells of the adrenal share a common origin (33). Functionally, the cells are very similar with differences in steroid output due to specific expression of 21-hydroxylase (Cyp21) and 11ß-hydroxylase (Cyp11b) in the adrenal. Even these differences are limited, however, because it has been shown that rat Leydig cells express Cyp11b (34) and that Cyp21 can be induced in mouse Leydig cells under chronic trophic stimulation (35). In addition, previous studies have shown that LH receptor expression can be induced in the mouse adrenal gland (36). The current data showing expression of functional Mc2r in the fetal testis fits, therefore, with previous studies and provides further evidence that fetal Leydig and adrenal cells arise from a common origin.
The data presented here also serve to illustrate a further possible difference in gene expression and function between adult and fetal Leydig cell populations (17). The progressive decline in testicular sensitivity to ACTH after d 10 coincides with the development of the adult population of Leydig cells (1, 2, 3). This indicates that the developing adult cells lack Mc2r receptors with residual Mc2r expression in the adult likely to be due to the presence of surviving fetal cells (37, 38). There is some evidence from differences between fetal and adult Leydig cell populations that the adult population may have evolved later than the fetal population to regulate adult fertility and behavior (39). Absence of ACTH sensitivity in these cells may be important to ensure that adult Leydig cells function independently of the hypothalamic-pituitary-adrenal axis and thus allow greater control of Leydig cell activity during events such as puberty.
It is clear that there are fundamental differences between regulation of sexual development in humans and mice. In humans, functional LH receptors are crucial for at least the onset of Leydig cell function during fetal development, whereas LH is not required for this process in mice (6, 40). In addition, high levels of hCG in the first trimester of pregnancy ensures that stimulation through the LH receptor will be high during this period. It is uncertain, however, whether other hormones may also have an effect on fetal human Leydig cells, especially during the last trimester when hCG levels are lower, and during early postnatal development. There is evidence that chronic excessive ACTH levels in young boys can stimulate Leydig cell function leading to precocious puberty (41, 42), which suggests that Leydig cell sensitivity to ACTH may be a widespread phenomenon during mammalian development.
Interestingly, classic congenital adrenal hyperplasia in humans, which leads to chronic excessive ACTH levels, is commonly associated with formation of testicular masses (43). These are known as adrenal rest tissues and are thought to arise from ectopic adrenal tissue that has failed to separate from the gonad during fetal differentiation (43). Results from this study suggest, however, that it is also possible these masses could arise in some cases from ACTH-sensitive fetal Leydig cells, which probably remain in the testis past puberty (38). It is unlikely that the reverse argument could be applied (ACTH-stimulated testosterone production in the fetal mouse testis is due to ectopic adrenal cells) because corticosterone production was very low in these tissues.
This study demonstrates that fetal testicular steroidogenesis is highly sensitive to both ACTH and LH. Fetal androgen production can occur in the absence of either hormone, however, suggesting a possible dual role in regulation of fetal Leydig cell function. Although this remains to be shown, such a mechanism may have evolved to ensure adequate androgen levels are produced during late fetal development. Similar dual regulation may occur in other species with, for example, both hCG and fetal LH able to regulate testicular androgen levels during development in the human.
| Footnotes |
|---|
Abbreviations: E, Embryonic day; EST, expressed sequence tag; hCG, human chorionic gonadotropin; Mcr or MCR, melanocortin receptor; Mc2r, melanocortin type 2 receptor; POMC, proopiomelanocortin.
Received March 3, 2003.
Accepted for publication May 1, 2003.
| References |
|---|
|
|
|---|
-subunit produces hypogonadal and hypothyroid mice. Genes Dev 9:20072019
-hydroxylase protein and mRNA in the testis of the testicular feminized (Tfm) mouse. J Mol Endocrinol 11:7782
melanotropin and other proopiomelanocortin peptides in the hypothalamus and limbic system. Proc Natl Acad Sci USA 90:88568860This article has been cited by other articles:
![]() |
N. Aluru and M. M. Vijayan Molecular Characterization, Tissue-Specific Expression, and Regulation of Melanocortin 2 Receptor in Rainbow Trout Endocrinology, September 1, 2008; 149(9): 4577 - 4588. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Yazawa, M. Uesaka, Y. Inaoka, T. Mizutani, T. Sekiguchi, T. Kajitani, T. Kitano, A. Umezawa, and K. Miyamoto Cyp11b1 Is Induced in the Murine Gonad by Luteinizing Hormone/Human Chorionic Gonadotropin and Involved in the Production of 11-Ketotestosterone, a Major Fish Androgen: Conservation and Evolution of the Androgen Metabolic Pathway Endocrinology, April 1, 2008; 149(4): 1786 - 1792. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Martinez-Aguayo, A. Rocha, N. Rojas, C. Garcia, R. Parra, M. Lagos, L. Valdivia, H. Poggi, A. Cattani, and the Chilean Collaborative Testicular Adrenal Rest Testicular Adrenal Rest Tumors and Leydig and Sertoli Cell Function in Boys with Classical Congenital Adrenal Hyperplasia J. Clin. Endocrinol. Metab., December 1, 2007; 92(12): 4583 - 4589. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Hu, A. Monteiro, H. Johnston, P. King, and P. J O'Shaughnessy Expression of Cyp21a1 and Cyp11b1 in the fetal mouse testis Reproduction, October 1, 2007; 134(4): 585 - 591. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Johnston, P. J King, and P. J O'Shaughnessy Effects of ACTH and expression of the melanocortin-2 receptor in the neonatal mouse testis Reproduction, June 1, 2007; 133(6): 1181 - 1187. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. A Noon, A. Bakmanidis, A. J L Clark, P. J O'Shaughnessy, and P. J King Identification of a novel melanocortin 2 receptor splice variant in murine adipocytes: implications for post-transcriptional control of expression during adipogenesis J. Mol. Endocrinol., December 1, 2006; 37(3): 415 - 420. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. A. Noon, A. J. L. Clark, P. J. O'Shaughnessy, and P. J. King A CCAAT/Enhancer-Binding Protein Site at -87 Is Required for the Activation of a Novel Murine Melanocortin 2-Receptor Promoter at Late Stages during Adipogenesis Endocrinology, December 1, 2006; 147(12): 6019 - 6026. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Alevizaki, K. Saltiki, E. Mantzou, E. Anastasiou, and I. Huhtaniemi The adrenal gland may be a target of LH action in postmenopausal women. Eur. J. Endocrinol., June 1, 2006; 154(6): 875 - 881. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. J. Thompson, S. M. Ross, J. Hensley, K. Liu, S. C. Heinze, S. S. Young, and K. W. Gaido Differential Steroidogenic Gene Expression in the Fetal Adrenal Gland Versus the Testis and Rapid and Dynamic Response of the Fetal Testis to Di(n-butyl) Phthalate Biol Reprod, November 1, 2005; 73(5): 908 - 917. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Gondo, T. Yanase, T. Okabe, T. Tanaka, H. Morinaga, M. Nomura, K. Goto, and H. Nawata SF-1/Ad4BP transforms primary long-term cultured bone marrow cells into ACTH-responsive steroidogenic cells Genes Cells, December 1, 2004; 9(12): 1239 - 1247. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Samson, F. V. Peale Jr., G. Frantz, N. Rioux-Leclercq, E. Rajpert-De Meyts, and N. Ferrara Human Endocrine Gland-Derived Vascular Endothelial Growth Factor: Expression Early in Development and in Leydig Cell Tumors Suggests Roles in Normal and Pathological Testis Angiogenesis J. Clin. Endocrinol. Metab., August 1, 2004; 89(8): 4078 - 4088. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. A. Noon, A. J. L. Clark, and P. J. King A Peroxisome Proliferator-response Element in the Murine mc2-r Promoter Regulates Its Transcriptional Activation during Differentiation of 3T3-L1 Adipocytes J. Biol. Chem., May 28, 2004; 279(22): 22803 - 22808. [Abstract] [Full Text] [PDF] |
||||
![]() |
F.-p. Zhang, T. Pakarainen, F. Zhu, M. Poutanen, and I. Huhtaniemi Molecular Characterization of Postnatal Development of Testicular Steroidogenesis in Luteinizing Hormone Receptor Knockout Mice Endocrinology, March 1, 2004; 145(3): 1453 - 1463. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. S. Calikoglu Adrenocorticotropic Hormone, a New Player in the Control of Testicular Steroidogenesis Endocrinology, August 1, 2003; 144(8): 3277 - 3278. [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |