help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology, doi:10.1210/en.2003-0277
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by O’Shaughnessy, P. J.
Right arrow Articles by Baker, P. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by O’Shaughnessy, P. J.
Right arrow Articles by Baker, P. J.
Endocrinology Vol. 144, No. 8 3279-3284
Copyright © 2003 by The Endocrine Society

Adrenocorticotropic Hormone Directly Stimulates Testosterone Production by the Fetal and Neonatal Mouse Testis

P. J. O’Shaughnessy, L. M. Fleming, G. Jackson, U. Hochgeschwender, P. Reed and P. J. Baker

Institute of Comparative Medicine (P.J.O’S., L.M.F., G.J., P.J.B.), University of Glasgow Veterinary School, Glasgow, Scotland G61 1QH, United Kingdom; and Developmental Biology Program (U.H., P.R.), Oklahoma Medical Research Foundation, Oklahoma City, Oklahoma 73104

Address all correspondence and requests for reprints to: P. J. O’Shaughnessy, Institute of Comparative Medicine, University of Glasgow Veterinary School, Bearsden Road, Glasgow, Scotland G61 1QH, United Kingdom. E-mail: p.j.o'shaughnessy{at}vet.gla.ac.uk.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Adult Leydig cell steroidogenesis is dependent on LH but fetal Leydig cells can function independently of gonadotropin stimulation. To identify factors that may be involved in regulation of fetal Leydig cells expressed sequence tag libraries from fetal and adult testes were compared, and fetal-specific genes identified. The ACTH receptor [melanocortin type 2 receptor (Mc2r)] was identified within this fetal-specific group. Subsequent real-time PCR studies confirmed that Mc2r was expressed in the fetal testis at 100-fold higher levels than in the adult testis. Incubation of fetal or neonatal testes with ACTH in vitro stimulated testosterone production more than 10-fold, although ACTH had no effect on testes from animals aged 20 d or older. The steroidogenic response of fetal and neonatal testes to a maximally stimulating dose of human chorionic gonadotropin was similar to the response shown to ACTH. The ED50 for ACTH, measured in isolated fetal and neonatal testicular cells, was 5 x 10-10 M and the lowest dose of ACTH eliciting a response was 2 x 10-11 M. Circulating ACTH levels in fetal mice were around 8 x 10-11 M. Neither {alpha}-MSH nor {gamma}-MSH had any effect on androgen production in vitro at any age. Fetal testosterone levels were normal in mice that lack circulating ACTH (proopiomelanocortin-null) indicating that ACTH is not essential for fetal Leydig cell function. Results show that both LH and ACTH can regulate testicular steroidogenesis during fetal development in the mouse and suggest that fetal Leydig cells, but not adult Leydig cells, are sensitive to ACTH stimulation.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
DURING DEVELOPMENT in the mouse, two populations of Leydig cells arise sequentially. A fetal population appears shortly after testis differentiation in utero and is followed by an adult population that arises after birth, at around d 7 in the mouse (1, 2, 3). It is well established that the adult population of cells is critically dependent on LH for development and activity and in mice lacking LH or the LH receptor adult Leydig cell number fails to develop normally after birth and circulating androgen levels are very low (4, 5, 6, 7). In contrast, however, it is less clear how Leydig cell function is regulated during fetal development. Masculinization of the fetus occurs normally in mice that lack gonadotropins or the LH receptor (4, 5, 8, 9), and androgen levels have been shown to be normal during fetal development in mice that lack circulating gonadotropins (6). Thus, LH appears not to be essential for fetal Leydig cell function. Interestingly, in mice lacking a pituitary gland through a null-mutation in the T/ebp gene masculinization is normal, but testicular androgen levels are markedly reduced in late gestation (10). This suggests that a pituitary hormone other than LH may regulate Leydig cell function during fetal development. As a step toward identification of receptors or growth factors that may mediate stimulation of fetal Leydig cell function a virtual subtraction was carried out using fetal and adult testis expressed sequence tag (EST) libraries. The fetal-specific mRNA species identified from this subtraction included the melanocortin type 2 receptor (Mc2r). In this study, we show that the Mc2r ligand, ACTH, is a potent stimulator of fetal mouse testicular steroidogenesis. Proopiomelanocortin (POMC)-deficient mice had normal levels of testosterone in late fetal gestation, however, which indicates that ACTH does not act alone to regulate fetal testicular steroid production.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Animals and tissues
Normal mice were bred at the University of Glasgow Veterinary School and maintained as required under United Kingdom Home Office regulations. The mice used were derived from F1 hybrids of C3H/HeH and 101/H strains. To time fetal development, males were caged with females overnight and the morning was designated as embryonic day (E) 0.5. For studies on postnatal animals, the day of birth was designated as d 1 and animals were killed on d 1, 5, 10, 15, 20, 25, and 30. Adult animals were 90–180 d old. Fetal mice lacking POMC-derived peptides (POMC-null) were bred on a 129/SvEv background as described previously (11) and were killed on E18. Genotypes were determined by PCR from tail tissue.

Steriods were extracted from the testes as previously described (6). Blood, for measurement of ACTH levels, was collected from fetuses or neonates following decapitation and serum was stored frozen at -70 C.

Identification of fetal-specific testis transcripts
To identify mRNA species differentially expressed in the fetal testis, the NCBI UniGene Lib.324 (testes from embryos at E15) was compared with combined libraries 41, 273 293, 463, 464, and 476 (all from adult testicular tissue) and to a SAGE library from mouse 3T3 cells. Library 324 contains 8553 ESTs in 4156 UniGene clusters, and the combined adult libraries contain 87439 ESTs in 16522 unique UniGene clusters. To identify genes that are differentially expressed, the EST libraries were downloaded from NCBI (http://www.ncbi.nlm.nih.gov/UniGene/lbrowse.cgi?ORG=Mm) and converted to Microsoft Access files for comparison using the UniGene number as the related record.

Tissue and cell incubations
To measure testicular androgen production in response to ACTH, testes from postnatal animals were decapsulated and incubated in culture medium (DMEM/F12, Invitrogen, Paisley, UK) under 5% CO2 in air. Testes from fetal animals were incubated in a similar manner with the exception that the tunica was torn with fine forceps and partially removed before incubation. Testes were incubated for 5 h, and one testis from each animal was incubated under basal conditions, whereas the contralateral testis was incubated with 10-6 M ACTH (fragment 1–24) (Sigma-Aldrich Co. Ltd., Poole, UK). Testes from animals aged up to 25 d were incubated at 37 C, whereas testes from animals aged 30 d and over were incubated at 32 C. At the end of the incubation period, the medium was heated to 95 C, centrifuged at 4000 x g for 10 min, and the supernatant stored frozen until assayed for androgen or corticosteroid content by RIA. To compare the trophic effect of ACTH with that of human chorionic gonadotropin (hCG), one testis from a fetal or neonatal animal was incubated with ACTH (10-6 M), whereas the contralateral testes was incubated with recombinant hCG (Serono Pharmaceuticals Ltd., Feltham, UK) (10-7 M) and testosterone measured as above.

Dispersed testicular cells were prepared by collagenase treatment of whole testes as previously described (12). The number of testes used to prepare isolated cells depended on the age of the animals: 4 testes were used from adult mice, 6–8 testes from neonatal (5 d old) mice, and 8–12 testes from fetal (E17.5) mice. Testes were dispersed at 37 C in DMEM/F12 containing 1 mg/ml collagenase (Worthington CLS type 4, purchased from Lorne Laboratories Ltd., Twyford, UK) (12) and isolated cells were filtered through a nylon sieve with a pore size of 50 µm. Cell number was counted using a hemocytometer, and the percentage of Leydig cells present was determined by histochemical staining for 3ß-hydroxysteroid dehydrogenase (13). Aliquots of isolated cells (1 ml total) were incubated for 3 h at 37 C (fetal and neonatal cells) or 32 C (adult cells) in DMEM/F12 in an atmosphere of 5% CO2 and in the presence of varying concentrations of hCG, ACTH (fragment 1–24), {alpha}-MSH (Sigma-Aldrich Co. Ltd., Poole, UK) or {gamma}-MSH (Sigma-Aldrich Co. Ltd.). At the end of the incubation period, cells and medium were placed in a heating block at 100 C for 5 min and then centrifuged at 4000 x g for 10 min. The supernatant was stored frozen at -20 C until assayed for testosterone by RIA. Each dose-response curve was generated twice in separate experiments.

RT-PCR
Total RNA was extracted from whole testes using Trizol (Life Technologies, Paisley, UK), and residual genomic DNA was removed by deoxyribonuclease treatment (DNA-free, Ambion Inc., supplied by AMS Biotechnology, Abington, UK). Treatment of the RNA to remove contaminating genomic DNA was necessary because the melanocortin receptor (Mcr) genes are largely devoid of introns, and it was not possible to design primers for PCR that crossed intron sequence. Removal of contaminating DNA was tested by PCR amplification of RNA without the reverse transcription step. RNA was reverse transcribed using random hexamers and Moloney murine leukemia virus reverse transcriptase (Superscript II, Invitrogen) as described previously (14, 15). PCRs were carried out in Tris/HCl buffer (75 mM, pH 9.0, at 25 C) containing (NH4)2SO4 (20 mM), Tween 20 (0.01%), MgCl2 (2 mM), deoxynucleotide triphosphates (0.2 mM each), Taq polymerase (2 U/100 µl), primers (200 nM each), and template (0.5 µl) in a total reaction volume of 50 µl.

The primers used to amplify the five different Mcr isoforms were based on GenBank sequences NM008559 (Mc1r), NM008560 (Mc2r), NM008561 (Mc3r), AF201662 (Mc4r), and NM013596 (Mc5r).

Primers used were: Mc1r forward-GGGCAGAGGGTGACAGTGAT, reverse-CCATCCCTGTCTCCT CCACTT, expected product size 200 bp; Mc2r forward-TGTCCTCCTGGCTGTGATCA, reverse-CTCCCTGTGCAGAACATCCA, expected size 351 bp; Mc3r forward-CGATGCTGCCTAACCTCTCTG, reverse-AACTGGTCCTCCAAGGTCAGG, expected size 300 bp, Mc4r forward-ATGTTCCTGATGGCGAGGC, reverse-CATGAAGCACACGCAGTATGG, expected size 200 bp; Mc5r forward-CGGACGAGAGCAGAATGGTAA, reverse-CGATGTGTCGCACAAAGGTG, expected size 400 bp. Products were separated on 2% NuSieve/agarose (3/1) gels (BioWhittaker UK Ltd., Wokingham, UK).

Real-time PCR
To quantify the content of Mc2r mRNA in the testis during development, a real-time PCR approach was used that utilized the TaqMan PCR method following RT of the isolated RNA (16). Levels of Mc2r mRNA were measured relative to expression of the ubiquitous gene Wbscr1 (17). Primers and probes used to amplify Wbscr1 cDNA were as previously described (17), while the primers used to amplify Mc2r had sequences CACAGGGAGCGGCATCA and GGGAACAGCGATGTGAAGGT and the probe had sequence TCTCCCACCACATCCCCACAGTGC. The real-time PCR amplifications were carried out as previously described (17, 18).

RIA
Levels of testosterone in incubation medium and in testicular extracts were measured by RIA as previously described (19). Corticosteroid levels in incubation medium were measured using a commercial RIA (Immunodiagnostic Systems Ltd., Boldon, UK). Serum levels of ACTH were also measured using a commercial RIA (ICN Pharmaceuticals Ltd., Basingstoke, UK). Serum from three or four animals was pooled to generate each sample for ACTH RIA.

Statistics
Results were analyzed using paired t tests or by single factor ANOVA with differences between individual means assessed by the Neuman-Keuls test.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Identification of Mc2r expression in the fetal testis
Comparison of fetal testis EST library 324 with adult testis EST libraries and a 3T3 SAGE library showed that the fetal testis library contained 1302 unique UniGene clusters. The cluster Mm.41498 representing Mc2r was among those found only in the fetal testis library. To confirm that Mc2r was expressed differentially in the fetal testis and to determine whether other melanocortin receptors are expressed in the testis PCR was used to amplify all five forms of the melanocortin receptor (Fig. 1AGo). Results showed that Mc2r, Mc3r, and Mc4r were present in the fetal testis but were not detectable in the adult testis under the PCR conditions used. Changes in testicular Mc2r mRNA expression during development were measured by real-time PCR (Fig. 1BGo). Expressed relative to the ubiquitous gene Wbscr1 (17) Mc2r mRNA levels were relatively high in the fetal testis declining rapidly after birth and remaining low up to adulthood.



View larger version (45K):
[in this window]
[in a new window]
  		FIG. 1. Expression of melanocortin receptor mRNA in the developing mouse testis. A, cDNA was prepared from fetal and adult testes and amplified by PCR using primers specific to MCR 1, 2, 3, 4, and 5 as shown. Products were separated on a 2% NuSieve/agarose (3/1) gel and the expected product sizes were 200, 351, 300, 200, and 400 bp, respectively. The first lane contained a 100-bp ladder. B, Expression of Mc2r mRNA measured by real-time PCR and expressed relative to the ubiquitous gene wbscr1. Results show the mean ± SEM of between three and seven animals per group. Ad, Adult. Groups with different superscript letters are significantly different.

 
Effect of ACTH and hCG on steroid production by whole testes in vitro
To determine whether ACTH affects testicular steroidogenesis directly, whole testes from animals of different ages were incubated in vitro in the presence or absence of ACTH (10-6 M), and testosterone production was measured by RIA. At all fetal ages tested, ACTH caused a marked stimulation of testosterone production in vitro (Fig. 2AGo). This effect was also seen in neonatal animals up to 10 d. After 10 d, the effect of ACTH was less marked and from 20 d to adulthood ACTH had no significant effect on testosterone production. The steroidogenic response of fetal and neonatal testes to a maximally stimulating dose of hCG was similar to the response shown to ACTH (Fig. 2BGo).



View larger version (26K):
[in this window]
[in a new window]
  		FIG. 2. Androgen production by whole testes in vitro. A, Effect of ACTH on whole testes isolated from mice of different ages. Whole testes were incubated in the presence or absence of ACTH (10-6 M) and testosterone production measured by RIA. Results show the mean ± SEM of between three and six animals per group. *, Significant (P < 0.05) effect of ACTH compared with the age-matched basal control. B, Comparison of the effects of ACTH (10-6 M) and hCG (10-7 M) on whole testes from mice of different ages. The mean ± SEM of three or four animals per group is shown. There was no significant difference between the effects of ACTH and hCG.

 
Medium from the incubation of fetal (E18) testes was also assayed for the presence of corticosterone. Apparent corticosterone levels were very low in all samples although there was a slight increase in the presence of ACTH (basal 0.1 ± 0.04 pmol/testis; ACTH 0.41 ± 0.08 pmol/testis, P < 0.01).

Dose-response relationship to hCG, ACTH, {alpha}-MSH, and {gamma}-MSH
The steroidogenic response of testicular cells, isolated from fetal, neonatal or adult animals, to increasing doses of hCG, ACTH, {alpha}-MSH, and {gamma}-MSH is shown in Fig. 3Go. Testosterone production by cells from all three age groups was stimulated by hCG with an effect first seen at 3 x 10-13 M hCG in fetal and neonatal animals and 10-12 M in adult animals. The ED50 for hCG was between 3 and 6 x 10-12 M at all three ages. Testiscular cells from fetal and neonatal animals also responded to ACTH with the maximum response similar to that seen with hCG. The minimum dose of ACTH which stimulated a steroidogenic response was 2 x 10-11 M, and the ED50 for ACTH was 7 x 10-10 M for fetal testes and 2 x 10-10 M for neonatal testes. ACTH had no effect on androgen production by adult testes. Neither {alpha}-MSH or {gamma}-MSH (up to 10-8 M) had any effect on androgen production at any age.



View larger version (17K):
[in this window]
[in a new window]
  		FIG. 3. Log dose-response relationship between increasing concentrations of hCG and ACTH and the steroidogenic response of isolated testicular cells from A, fetal (E17); B, neonatal (5 d); and C, adult mice. Results show data from a single representative experiment at each age. Cells were isolated from whole testes as described in Materials and Methods and incubated with increasing concentrations of hormone. The testosterone content of cells and medium was measured by RIA. Cells were also incubated with increasing concentrations of {alpha}-MSH and {gamma}-MSH, but testosterone levels did not increase above basal and, for clarity, only the response of the cells to 10-8 M hormone is shown. Results show the mean ± SEM of duplicate independent incubations.

 
Cirulating ACTH levels
Levels of circulating ACTH were relatively high in fetal mice but declined significantly after birth and were about 15% of fetal levels in 5-d-old neonatal mice (Fig. 4Go).



View larger version (11K):
[in this window]
[in a new window]
  		FIG. 4. Circulating ACTH levels in fetal and neonatal mice. To generate sufficient serum for RIA samples from three or four animals were pooled. Results show the mean ± SEM of three pooled samples at each age.

 
Testicular testosterone levels in fetal POMC-null mice
To determine whether ACTH alone regulates fetal Leydig cell activity intratesticular testosterone levels were measured in normal fetal mice and in POMC-null mice. Results in Table 1Go show that at E18 there was no difference in testicular testosterone levels between POMC-null mice and heterozygous or wild-type siblings.


View this table:
[in this window]
[in a new window]
  		TABLE 1. Testosterone levels in testes of fetal (E18) POMC-null mice (mean ± SEM)

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
During development in utero, the male fetus depends on testicular androgen production to maintain the Wolffian duct and to masculinize the external genitalia. The Leydig cells of the developing testis are the source of fetal androgens, but we currently do not know how these cells are regulated during this crucial phase of sexual development. In T/ebp-null mice, which lack both pituitary and thyroid glands, androgen levels are significantly reduced in late fetal life (10), suggesting that one or more pituitary hormones are required for Leydig cell function. Previous studies have shown that LH can regulate fetal Leydig cell activity (20, 21) but lack of LH or the LH receptor does not affect fetal androgen production (6, 8, 21). In this study, we now show that the fetal testes are also highly responsive to ACTH although fetal androgen levels are normal in POMC-null mice. This raises the possibility that regulation of fetal Leydig cell function may show redundancy with both LH and ACTH able to maintain cell activity.

In animals lacking circulating LH fetal androgen levels are normal, but there is a rapid decline in testosterone after birth with testicular levels barely detectable by d 5 (6). There is no chorionic gonadotropin in rodents, and these data suggest that whatever maintains androgen production during fetal development in LH-deficient mice must show a significant decline after birth. Results from this study and others have shown that there is a marked drop in circulating ACTH levels after birth in mice and rats (22, 23, 24), such that by d 5 ACTH levels are below the minimum level that would stimulate Leydig cell function. This would be consistent with the hypothesis that both hormones act to maintain Leydig cell function during fetal development.

POMC gives rise to five peptides (ACTH, {alpha}-MSH, ß-MSH, {gamma}-MSH, and ß-endorphin) with a wide range of biological activities. The melanocortins (ACTH and MSHs) act through the melanocortin receptors, which make up a distinct family of G protein-coupled receptors with seven transmembrane domains (25). There are five known members of the Mcr family, each with characteristic affinity for the different melanocortins derived from POMC (25). Both expression of Mc2r in the testis and trophic effects of ACTH on fetal testicular steroidogenesis were a surprise initially because the distribution of Mc2r is, otherwise, restricted to the adrenal gland with low expression in skin and adipose tissue (26, 27, 28). In addition, an early study reported that testosterone production by late fetal mouse testes in vitro was not affected by ACTH (20). It is clear, however, from the current studies that androgen production by the fetal testis can be regulated by ACTH with a sensitivity similar to that seen previously with isolated adrenocortical cells in vitro (29, 30). Although three different forms of the Mcr are expressed in the fetal testis, it is highly likely that the effects of ACTH are mediated through Mc2r because this is the only receptor that responds to ACTH but not {alpha}-MSH (25, 31, 32). The presence of Mc3r and Mc4r in the fetal testis also suggests, however, that the melanocortins may have other activities in the fetal testis that are unrelated to steroidogenesis.

During development, the gonad and adrenal gland arise in close proximity, and it has been proposed that Leydig cells and steroidogenic cells of the adrenal share a common origin (33). Functionally, the cells are very similar with differences in steroid output due to specific expression of 21-hydroxylase (Cyp21) and 11ß-hydroxylase (Cyp11b) in the adrenal. Even these differences are limited, however, because it has been shown that rat Leydig cells express Cyp11b (34) and that Cyp21 can be induced in mouse Leydig cells under chronic trophic stimulation (35). In addition, previous studies have shown that LH receptor expression can be induced in the mouse adrenal gland (36). The current data showing expression of functional Mc2r in the fetal testis fits, therefore, with previous studies and provides further evidence that fetal Leydig and adrenal cells arise from a common origin.

The data presented here also serve to illustrate a further possible difference in gene expression and function between adult and fetal Leydig cell populations (17). The progressive decline in testicular sensitivity to ACTH after d 10 coincides with the development of the adult population of Leydig cells (1, 2, 3). This indicates that the developing adult cells lack Mc2r receptors with residual Mc2r expression in the adult likely to be due to the presence of surviving fetal cells (37, 38). There is some evidence from differences between fetal and adult Leydig cell populations that the adult population may have evolved later than the fetal population to regulate adult fertility and behavior (39). Absence of ACTH sensitivity in these cells may be important to ensure that adult Leydig cells function independently of the hypothalamic-pituitary-adrenal axis and thus allow greater control of Leydig cell activity during events such as puberty.

It is clear that there are fundamental differences between regulation of sexual development in humans and mice. In humans, functional LH receptors are crucial for at least the onset of Leydig cell function during fetal development, whereas LH is not required for this process in mice (6, 40). In addition, high levels of hCG in the first trimester of pregnancy ensures that stimulation through the LH receptor will be high during this period. It is uncertain, however, whether other hormones may also have an effect on fetal human Leydig cells, especially during the last trimester when hCG levels are lower, and during early postnatal development. There is evidence that chronic excessive ACTH levels in young boys can stimulate Leydig cell function leading to precocious puberty (41, 42), which suggests that Leydig cell sensitivity to ACTH may be a widespread phenomenon during mammalian development.

Interestingly, classic congenital adrenal hyperplasia in humans, which leads to chronic excessive ACTH levels, is commonly associated with formation of testicular masses (43). These are known as adrenal rest tissues and are thought to arise from ectopic adrenal tissue that has failed to separate from the gonad during fetal differentiation (43). Results from this study suggest, however, that it is also possible these masses could arise in some cases from ACTH-sensitive fetal Leydig cells, which probably remain in the testis past puberty (38). It is unlikely that the reverse argument could be applied (ACTH-stimulated testosterone production in the fetal mouse testis is due to ectopic adrenal cells) because corticosterone production was very low in these tissues.

This study demonstrates that fetal testicular steroidogenesis is highly sensitive to both ACTH and LH. Fetal androgen production can occur in the absence of either hormone, however, suggesting a possible dual role in regulation of fetal Leydig cell function. Although this remains to be shown, such a mechanism may have evolved to ensure adequate androgen levels are produced during late fetal development. Similar dual regulation may occur in other species with, for example, both hCG and fetal LH able to regulate testicular androgen levels during development in the human.


   Footnotes
 
This study was supported by awards from the Biotechnology and Biological Sciences Research Council and the Wellcome Trust.

Abbreviations: E, Embryonic day; EST, expressed sequence tag; hCG, human chorionic gonadotropin; Mcr or MCR, melanocortin receptor; Mc2r, melanocortin type 2 receptor; POMC, proopiomelanocortin.

Received March 3, 2003.

Accepted for publication May 1, 2003.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Baker PJ, Sha JA, McBride MW, Peng L, Payne AH, O’Shaughnessy PJ 1999 Expression of 3ß-hydroxysteriod dehydrogenase type I and VI isoforms in the mouse testis during development. Eur J Biochem 260:911–916[Medline]
  2. Nef S, Shipman T, Parada LF 2000 A molecular basis for estrogen-induced cryptorchidism. Dev Biol 224:354–361[CrossRef][Medline]
  3. Vergouwen RPFA, Jacobs SGPM, Huiskamp R, Davids JAG, Derooij 1991 Proliferative activity of gonocytes, sertoli cells and interstitial cells during testicular development in mice. J Reprod Fertil 93:233–243[Abstract/Free Full Text]
  4. Zhang F-P, Poutanen M, Wilbertz J, Huhtaniemi I 2001 Normal prenatal but arrested postnatal sexual development of luteinizing hormone receptor knockout (LuRKO) mice. Mol Endocrinol 15:172–183[Abstract/Free Full Text]
  5. Lei ZM, Mishra S, Zou W, Xu B, Foltz M, Li X, Rao CV 2001 Targeted disruption of luteinizing hormone/human chorionic gonadotrophin receptor gene. Mol Endocrinol 15:184–200[Abstract/Free Full Text]
  6. O’Shaughnessy PJ, Baker P, Sohnius U, Haavisto A-M, Charlton HM, Huhtaniemi I 1998 Fetal development of Leydig cell activity in the mouse is independent of pituitary gonadotroph function. Endocrinology 139:1141–1146[Abstract/Free Full Text]
  7. Baker PJ, O’Shaughnessy PJ 2001 Role of gonadotrophins in regulating numbers of Leydig and Sertoli cells during fetal and postnatal development in mice. Reproduction 122:227–234[Abstract]
  8. Kendall SK, Samuelson LC, Saunders TL, Wood RI, Camper SA 1995 Targeted disruption of the pituitary glycoprotein hormone {alpha}-subunit produces hypogonadal and hypothyroid mice. Genes Dev 9:2007–2019[Abstract/Free Full Text]
  9. Cattanach BM, Iddon CA, Charlton HM, Chiappa SA, Fink G 1977 Gonadtrophin releasing hormone deficiency in a mutant mouse with hypogonadism. Nature 269:338–340[CrossRef][Medline]
  10. Pakarinen P, Kimura S, El Gehani F, Pelliniemi LJ, Huhtaniemi I 2002 Pituitary hormones are not required for sexual differentiation of male mice: phenotype of the T/ebp/Nkx2.1 null mutant mice. Endocrinology 143:4477–4482[Abstract/Free Full Text]
  11. Yaswen L, Diehl N, Brennan MB, Hochgeschwender U 1999 Obesity in the mouse model of pro-opiomelanocortin deficiency responds to peripheral melanocortin. Nat Med 5:1066–1070[CrossRef][Medline]
  12. Stalvey JR, Payne AH 1983 Luteinizing hormone receptors and testosterone production in whole testes and purified Leydig cells from the mouse: differences among inbred strains. Endocrinology 112:1696–1701[Abstract/Free Full Text]
  13. O’Shaughnessy PJ, Wong KL, Payne AH 1981 Differential steroidogenic enzyme-activities in different populations of rat leydig-cells. Endocrinology 109:1061–1066[Abstract/Free Full Text]
  14. O’Shaughnessy PJ, Murphy L 1993 Cytochrome P-450 17{alpha}-hydroxylase protein and mRNA in the testis of the testicular feminized (Tfm) mouse. J Mol Endocrinol 11:77–82[Abstract/Free Full Text]
  15. O’Shaughnessy PJ, Marsh P, Dudley K 1994 Follicle-stimulating hormone receptor mRNA in the mouse ovary during post-natal development in the normal mouse and in the adult hypogonadal (hpg) mouse: structure of alternate transcripts. Mol Cell Endocrinol 101:197–201[CrossRef][Medline]
  16. Bustin SA 2000 Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays. J Mol Endocrinol 25:169–193[Abstract]
  17. O’Shaughnessy PJ, Willerton L, Baker PJ 2002 Changes in Leydig cell gene expression during development in the mouse. Biol Reprod 66:966–975[Abstract/Free Full Text]
  18. Baker PJ, O’Shaughnessy PJ 2001 Expression of prostaglandin D synthetase during development in the mouse testis. Reproduction 122:553–559[Abstract]
  19. O’Shaughnessy PJ, Sheffield JW 1990 Effect of testosterone on testicular steroidogenesis in the hypogonadal (hpg) mouse. J Steroid Biochem 35:729–734[CrossRef][Medline]
  20. Pointis G, Mahoudeau JA, Courrier R 1975 The effect of gonadotropic hormones and the fetal hypophysis on testosterone production by the testis of 18 day mouse fetuses in organ culture. C R Acad Sci Hebd Seances Acad Sci Ser D 280:2361–2364
  21. Pointis G, Mahoudeau JA 1977 Responsiveness of foetal mouse testis to gonadotrophins at various times during sexual differentiation. J Endocrinol 74:149–150[Abstract/Free Full Text]
  22. Chatelain A, Dupouy JP, Allaume P 1980 Fetal-maternal adrenocorticotropin and corticosterone relationships in the rat: effects of maternal adrenalectomy. Endocrinology 106:1297–1303[Medline]
  23. Boudouresque F, Guillaume V, Grino M, Strbak V, Chautard T, Conte-Devolx B, Oliver C 1988 Maturation of the pituitary-adrenal function in rat fetuses. Neuroendocrinology 48:417–422[Medline]
  24. Erisman S, Carnes M, Takahashi LK, Lent SJ 1990 The effects of stress on plasma ACTH and corticosterone in young and aging pregnant rats and their fetuses. Life Sci 47:1527–1533[CrossRef][Medline]
  25. Abdel-Malek ZA 2001 Melanocortin receptors: their functions and regulation by physiological agonists and antagonists. Cell Mol Life Sci 58:434–441[CrossRef][Medline]
  26. Mountjoy KG, Robbins LS, Mortrud MT, Cone RD 1992 The cloning of a family of genes that encode the melanocortin receptors. Science 257:1248–1251[Abstract/Free Full Text]
  27. Boston BA, Cone RD 1996 Characterization of melanocortin receptor subtype expression in murine adipose tissues and in the 3T3-L1 cell line. Endocrinology 137:2043–2050[Abstract]
  28. Slominski A, Ermak G, Mihm M 1996 ACTH receptor, CYP11A1, CYP17 and CYP21A2 genes are expressed in skin. J Clin Endocrinol Metab 81:2746–2749[Abstract]
  29. Kojima I, Kojima K, Rasmussen H 1985 Role of calcium and cAMP in the action of adrenocorticotropin on aldosterone secretion. J Biol Chem 260:4248–4256[Abstract/Free Full Text]
  30. Tait JF, Tait SA, Gould RP, Mee MS 1974 The properties of adrenal zona glomerulosa cells after purification by gravitational sedimentation. Proc R Soc Lond B Biol Sci 185:375–407[Medline]
  31. Roselli-Rehfuss L, Mountjoy KG, Robbins LS, Mortrud MT, Low MJ, Tatro JB, Entwistle ML, Simerly RB, Cone RD 1993 Identification of a receptor for {gamma} melanotropin and other proopiomelanocortin peptides in the hypothalamus and limbic system. Proc Natl Acad Sci USA 90:8856–8860[Abstract/Free Full Text]
  32. Gantz I, Miwa H, Konda Y, Shimoto Y, Tashiro T, Watson SJ, DelValle J, Yamada T 1993 Molecular cloning, expression, and gene localization of a fourth melanocortin receptor. J Biol Chem 268:15174–15179[Abstract/Free Full Text]
  33. Hatano O, Takakusu A, Nomura M, Morohashi K 1996 Identical origin of adrenal cortex and gonad revealed by expression profiles of Ad4BP/SF-1. Genes Cells 1:663–671[Abstract]
  34. Wang GM, Ge RS, Latif SA, Morris DJ, Hardy MP 2002 Expression of 11beta-hydroxylase in rat Leydig cells. Endocrinology 143:621–626[Abstract/Free Full Text]
  35. Hu MC, Hsu NC, El Hadj NB, Pai CI, Chu HP, Wang CK, Chung BC 2002 Steroid deficiency syndromes in mice with targeted disruption of CYP11A1. Mol Endocrinol 16:1943–1950[Abstract/Free Full Text]
  36. Kero J, Poutanen M, Zhang FP, Rahman N, McNicol AM, Nilson JH, Keri RA, Huhtaniemi IT 2000 Elevated luteinizing hormone induces expression of its receptor and promotes steroidogenesis in the adrenal cortex. J Clin Invest 105:633–641[Medline]
  37. Clark AM, Garland KK, Russell LD 2000 Desert hedgehog (Dhh) gene is required in the mouse testis for formation of adult-type Leydig cells and normal development of peritubular cells and seminiferous tubules. Biol Reprod 63:1825–1838[Abstract/Free Full Text]
  38. Kerr JB, Knell CM 1988 The fate of fetal leydig-cells during the development of the fetal and postnatal rat testis. Development 103:535–544[Abstract]
  39. O’Shaughnessy PJ, Baker PJ, Heikkila M, Vainio S, McMahon AP 2000 Localization of 17ß-hydroxysteroid dehydrogenase/17-ketosteroid reductase isoform expression in the developing mouse testis—androstenedione is the major androgen secreted by fetal/neonatal Leydig cells. Endocrinology 141:2631–2637[Abstract/Free Full Text]
  40. Kremer H, Kraaij R, Toledo SPA, Pos M, Fridman JB, Hayashida CY, van Reen M, Milgrom E, Ropers HH, Mariman E, Themmen APN, Brunner HG 1995 Male pseudohermaphroditism due to a homozygous missense mutation of the luteinizing hormone receptor gene. Nat Genet 9:160–164[CrossRef][Medline]
  41. Srikanth MS, West BR, Ishitani M, Isaacs Jr H, Applebaum H, Costin G 1992 Benign testicular tumors in children with congenital adrenal hyperplasia. J Pediatr Surg 27:639–641[CrossRef][Medline]
  42. Domenice S, Latronico AC, Brito VN, Arnhold IJ, Kok F, Mendonca BB 2001 Adrenocorticotropin-dependent precocious puberty of testicular origin in a boy with X-linked adrenal hypoplasia congenita due to a novel mutation in the DAX1 gene. J Clin Endocrinol Metab 86:4068–4071[Abstract/Free Full Text]
  43. Merke DP, Bornstein SR, Avila NA, Chrousos GP 2002 NIH Conference: future directions in the study and management of congenital adrenal hyperplasia due to 21-hydroxylase deficiency. Ann Intern Med 136:320–334[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 EndocrinologyHome page
N. Aluru and M. M. Vijayan
Molecular Characterization, Tissue-Specific Expression, and Regulation of Melanocortin 2 Receptor in Rainbow Trout
Endocrinology, September 1, 2008; 149(9): 4577 - 4588.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
T. Yazawa, M. Uesaka, Y. Inaoka, T. Mizutani, T. Sekiguchi, T. Kajitani, T. Kitano, A. Umezawa, and K. Miyamoto
Cyp11b1 Is Induced in the Murine Gonad by Luteinizing Hormone/Human Chorionic Gonadotropin and Involved in the Production of 11-Ketotestosterone, a Major Fish Androgen: Conservation and Evolution of the Androgen Metabolic Pathway
Endocrinology, April 1, 2008; 149(4): 1786 - 1792.
[Abstract] [Full Text] [PDF]

Home page
 J. Clin. Endocrinol. Metab.Home page
A. Martinez-Aguayo, A. Rocha, N. Rojas, C. Garcia, R. Parra, M. Lagos, L. Valdivia, H. Poggi, A. Cattani, and the Chilean Collaborative Testicular Adrenal Rest
Testicular Adrenal Rest Tumors and Leydig and Sertoli Cell Function in Boys with Classical Congenital Adrenal Hyperplasia
J. Clin. Endocrinol. Metab., December 1, 2007; 92(12): 4583 - 4589.
[Abstract] [Full Text] [PDF]

Home page
 ReproductionHome page
L. Hu, A. Monteiro, H. Johnston, P. King, and P. J O'Shaughnessy
Expression of Cyp21a1 and Cyp11b1 in the fetal mouse testis
Reproduction, October 1, 2007; 134(4): 585 - 591.
[Abstract] [Full Text] [PDF]

Home page
 ReproductionHome page
H. Johnston, P. J King, and P. J O'Shaughnessy
Effects of ACTH and expression of the melanocortin-2 receptor in the neonatal mouse testis
Reproduction, June 1, 2007; 133(6): 1181 - 1187.
[Abstract] [Full Text] [PDF]

Home page
 J Mol EndocrinolHome page
L. A Noon, A. Bakmanidis, A. J L Clark, P. J O'Shaughnessy, and P. J King
Identification of a novel melanocortin 2 receptor splice variant in murine adipocytes: implications for post-transcriptional control of expression during adipogenesis
J. Mol. Endocrinol., December 1, 2006; 37(3): 415 - 420.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
L. A. Noon, A. J. L. Clark, P. J. O'Shaughnessy, and P. J. King
A CCAAT/Enhancer-Binding Protein Site at -87 Is Required for the Activation of a Novel Murine Melanocortin 2-Receptor Promoter at Late Stages during Adipogenesis
Endocrinology, December 1, 2006; 147(12): 6019 - 6026.
[Abstract] [Full Text] [PDF]

Home page
 Eur J EndocrinolHome page
M. Alevizaki, K. Saltiki, E. Mantzou, E. Anastasiou, and I. Huhtaniemi
The adrenal gland may be a target of LH action in postmenopausal women.
Eur. J. Endocrinol., June 1, 2006; 154(6): 875 - 881.
[Abstract] [Full Text] [PDF]

Home page
 Biol. Reprod.Home page
C. J. Thompson, S. M. Ross, J. Hensley, K. Liu, S. C. Heinze, S. S. Young, and K. W. Gaido
Differential Steroidogenic Gene Expression in the Fetal Adrenal Gland Versus the Testis and Rapid and Dynamic Response of the Fetal Testis to Di(n-butyl) Phthalate
Biol Reprod, November 1, 2005; 73(5): 908 - 917.
[Abstract] [Full Text] [PDF]

Home page
 GENES CELLSHome page
S. Gondo, T. Yanase, T. Okabe, T. Tanaka, H. Morinaga, M. Nomura, K. Goto, and H. Nawata
SF-1/Ad4BP transforms primary long-term cultured bone marrow cells into ACTH-responsive steroidogenic cells
Genes Cells, December 1, 2004; 9(12): 1239 - 1247.
[Abstract] [Full Text] [PDF]

Home page
 J. Clin. Endocrinol. Metab.Home page
M. Samson, F. V. Peale Jr., G. Frantz, N. Rioux-Leclercq, E. Rajpert-De Meyts, and N. Ferrara
Human Endocrine Gland-Derived Vascular Endothelial Growth Factor: Expression Early in Development and in Leydig Cell Tumors Suggests Roles in Normal and Pathological Testis Angiogenesis
J. Clin. Endocrinol. Metab., August 1, 2004; 89(8): 4078 - 4088.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
L. A. Noon, A. J. L. Clark, and P. J. King
A Peroxisome Proliferator-response Element in the Murine mc2-r Promoter Regulates Its Transcriptional Activation during Differentiation of 3T3-L1 Adipocytes
J. Biol. Chem., May 28, 2004; 279(22): 22803 - 22808.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
F.-p. Zhang, T. Pakarainen, F. Zhu, M. Poutanen, and I. Huhtaniemi
Molecular Characterization of Postnatal Development of Testicular Steroidogenesis in Luteinizing Hormone Receptor Knockout Mice
Endocrinology, March 1, 2004; 145(3): 1453 - 1463.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
A. S. Calikoglu
Adrenocorticotropic Hormone, a New Player in the Control of Testicular Steroidogenesis
Endocrinology, August 1, 2003; 144(8): 3277 - 3278.
[Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by O’Shaughnessy, P. J.
Right arrow Articles by Baker, P. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by O’Shaughnessy, P. J.
Right arrow Articles by Baker, P. J.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals