help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2002-0181
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
144/8/3287    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yaoi, Y.
Right arrow Articles by Tanaka, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yaoi, Y.
Right arrow Articles by Tanaka, S.
Endocrinology Vol. 144, No. 8 3287-3296
Copyright © 2003 by The Endocrine Society

Molecular Cloning of Otoconin-22 Complementary Deoxyribonucleic Acid in the Bullfrog Endolymphatic Sac: Effect of Calcitonin on Otoconin-22 Messenger Ribonucleic Acid Levels

Yuichi Yaoi, Masakazu Suzuki, Hideaki Tomura, Yuichi Sasayama, Sakae Kikuyama and Shigeyasu Tanaka

Department of Biology (Y.Y., M.S., S.T.), Faculty of Science, Shizuoka University, Shizuoka 422-8529, Japan; Institute for Molecular and Cellular Regulation (H.T.), Gunma University, Maebashi 371-8512, Japan; Division of Biodiversity (Y.S.), Noto Marine Laboratory, Institute of Nature and Environmental Technology, Kanazawa University, Kanazawa 927-0553, Japan; and Department of Biology (S.K.), School of Education, Waseda University, Tokyo 169-8050, Japan

Address all correspondence and requests for reprints to: Dr. Shigeyasu Tanaka, Department of Biology, Faculty of Science, Shizuoka University, Ohya 836, Shizuoka 422-8529, Japan. E-mail: sbstana{at}ipc shizuoka.ac.jp.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Anuran amphibians have a special organ called the endolymphatic sac (ELS), containing many calcium carbonate crystals, which is believed to have a calcium storage function. The major protein of aragonitic otoconia, otoconin-22, which is considered to be involved in the formation of calcium carbonate crystals, has been purified from the saccule of the Xenopus inner ear. In this study, we cloned a cDNA encoding otoconin-22 from the cDNA library constructed for the paravertebral lime sac (PVLS) of the bullfrog, Rana catesbeiana, and sequenced it. The bullfrog otoconin-22 encoded a protein consisting of 147 amino acids, including a signal peptide of 20 amino acids. The protein had cysteine residues identical in a number and position to those conserved among the secretory phospholipase A2 family. The mRNA of bullfrog otoconin-22 was expressed in the ELS, including the PVLS and inner ear. This study also revealed the presence of calcitonin receptor-like protein in the ELS, with the putative seven-transmembrane domains of the G protein-coupled receptors. The ultimobranchialectomy induced a prominent decrease in the otoconin-22 mRNA levels of the bullfrog PVLS. Supplementation of the ultimobranchialectomized bullfrogs with synthetic salmon calcitonin elicited a significant increase in the mRNA levels of the sac. These findings suggest that calcitonin secreted from the ultimobranchial gland, regulates expression of bullfrog otoconin-22 mRNA via calcitonin receptor-like protein on the ELS, thereby stimulating the formation of calcium carbonate crystals in the lumen of the ELS.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
IN GENERAL, IT is well known that the membranous labyrinth of the inner ear consists of two main parts, i.e. the utriculus and sacculus, which make stones from calcium carbonate and are involved in the sense of balance. In most vertebrates the endolymphatic sac (ELS), which arises as the endolymphatic duct from the junction of the utriculus and the sacculus, terminates in a small blind-ending vesicle within the braincase, whereas the amphibian endolymphatic sac not only enlarges to form processes around the brain but also extends caudally along the vertebral canal and protrudes between the vertebrae, in which it is referred to as the paravertebral lime sac (PVLS). Notably, the amphibian brain and pituitary gland are surrounded by an ELS (1). This endolymphatic system contains tiny crystals of calcium carbonate in the form of aragonite (2, 3, 4). Very recently we demonstrated in an immunocytochemical study (5) that the secretory phospholipase A2 (PLA2)-like protein obtained during purification of the bullfrog thyroid-stimulating hormone is derived from the ELS adhering to the pituitary, and we suggested that this protein is homologous to Xenopus otoconin-22, the major protein of aragonitic otoconia in the saccule of the Xenopus inner ear (6). Several lines of evidence suggest that otoconin-22 is involved in formation and growth of calcium carbonate crystals (6, 7, 8). In the tree frogs (Hyla japonica), Kawamata (9) showed that the growth of calcium carbonate crystals in the ELS is accelerated when they are maintained in the water containing a high concentration of calcium chloride. Ultimobrantialectomy in the frogs, Rana pipens and R. nigromaculata, induced a decrease in the calcium content in the PVLS (10, 11), whereas administration of calcitonin stimulated incorporation of serum calcium into the PVLS in R. nigromaculata and R. tigrina (11, 12). These results imply that the ultimobrantial gland is involved in the formation of calcium carbonate crystals, presumably through the otoconin-22 protein, in the ELS of the frogs.

In this study, we cloned a cDNA encoding the bullfrog otoconin-22 from the PVLS. Furthermore, we demonstrated the calcitonin receptor mRNA expression in the PVLS. Using the otoconin-22 cDNA as a probe, we also showed that the otoconin-22 mRNA levels in the PVLS is regulated by calcitonin.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animals
Adult male bullfrogs (R. catesbeiana) were purchased from Ouchi (Misato, Japan). They were acclimated under normal laboratory conditions for at least 1 wk. They were fed pieces of porcine liver twice a week. The PVLS except the inner ear dissected under anesthesia with MS-222 (Nacalai tesque, Kyoto, Japan) was used for cDNA cloning and Northern blot analysis. All animal experiments were in compliance with the Guide for Care and Use of Laboratory Animals at Shizuoka University.

Construction of the PVLS cDNA library
Total RNA was extracted from 2.6 g of the PVLSs of bullfrogs using TRIZOL RNA extraction reagent (Life Technologies, Inc., Rockville, MD), and then 5.0 µg polyadenylated RNA was separated from about 230 µg of the total RNA using Oligotex-dT30 super (Takara, Kyoto, Japan). We constructed a {lambda}ZAP cDNA library (5.8 x 105 pfu/µg of arms) from the polyadenylated RNA using a ZAP express cDNA synthesis kit and a Gigapack III Gold cloning kit (Stratagene, La Jolla, CA), in accordance with the manufacturer’s instructions.

Cloning of otoconin-22 cDNA
Degenerate primers for the original amplification of bullfrog otoconin-22 fragments were designed based on the PLA2-like protein’s N-terminal 45-amino-acid sequences (13). The following primers were commercially synthesized (Life Technologies, Inc.): PLA2-like protein primer 1: 5'-CA(A/G)TT(T/C)GA(T/C)GA(A/G)ATGAT(A/C/T)AA-3', PLA2-like protein primer 2: 5'-ACCCA(A/G/T)AT(A/C/G/T)GC(A/G)TC(A/C/G/T)AC(A/C/G/T)GG-3'.

We performed PCR using the cDNA prepared from the bullfrog PVLS cDNA library in 25 µl Ex-taq buffer containing 0.2 mM of each deoxynucleotide triphosphate and 50 pmol of each of the primer 1 and 2 with 0.5 U Ex-taq polymerase (Takara), basically as described previously (14). The procedure of PCR amplification was an initial denaturation step of 95 C for 5 min followed by denaturation (94 C, 90 sec), annealing (50 C, 90 sec), and extension (72 C, 150 sec) for 30 cycles in a thermal cycler (ASTEC, Fukuoka, Japan). Amplified fragments were cloned into pGEM-3Z vector (Promega Corp., Madison, WI).

We synthesized DNA probes, obtained from the PCR products as described previously, using a digoxigenin (DIG)-High Prime kit (Roche Molecular Biochemicals, Meylan, France) and used them to screen the cDNA library of the bullfrog PVLS, in accordance with the manufacturer’s instructions. The membrane was hybridized with DIG-labeled cDNA probes at 68 C overnight and washed twice in 1x saline-sodium citrate (SSC)/0.1% sodium dodecyl sulfate (SDS) for 1 h at 50 C. After blocking, the membrane was incubated with alkaline phosphatase- conjugated sheep anti-DIG Fab antibody (Roche), reacted with 25 mM CSPD [disodium 3-(4-methoxyspiro[1, 2-dioxetane-3, 2'-(5'-chloro)tricyclo[3.3.1.13.7]decan]-4-yl)phenyl phosphate] chemiluminescent substrate (Tropix, Inc., PE Applied Biosystems, Foster City, CA) and then exposed on Hyperfilm-ECL (Amersham Pharmacia Biotech, Buckinghamshire, UK).

DNA sequence analysis of otoconin-22 cDNA
The cDNAs were sequenced using an ABI PRISM BigDye Terminator cycle sequencing kit (PE Applied Biosystems). The sequencing reactions were analyzed by DNA sequencer (model 377, PE Applied Biosystems).

Northern blot analysis of otoconin-22 expression
Total RNA was isolated from 100–200 mg various bullfrog tissues (namely, the ELS adhering to the brain and pituitary gland, PVLSs, sacculus, utriculus, pars distalis, pars neurointermedia, hypothalamus, brain, liver, lung, spleen, pancreas, kidney, stomach, small intestine, colon, bladder, testis, ovary, tongue, skeletal muscle, skin, and heart) using TRIZOL reagent. Ten micrograms of the total RNA from each tissue were electrophoresed on a denatured gel containing 1% agarose and 2 M formaldehyde and blotted onto a nylon membrane (Roche). The RNAs were fixed on the membrane by UV cross-linking.

The membrane was prehybridized for 1 h at 55 C in prehybridization solution. Hybridization with DIG-labeled cDNA probe was performed for 15 h at 55 C, with the probe added to the prehybridization solution. The DIG-labeled cDNA probe was prepared from the full coding region of the cDNAs using of a DIG-High Prime kit, in accordance with the manufacturer’s instructions (Roche). The membrane was washed once in 2x SSC containing 0.1% SDS at room temperature and twice in 0.1x SSC containing 0.1% SDS for 30 min at 65 C. After a blocking step, the membrane was incubated with alkaline phosphatase-conjugated sheep anti-DIG Fab antibody (Roche), reacted with CSPD, and then exposed on Hyperfilm-ECL (Amersham).

Cloning of cDNA encoding calcitonin receptor-like protein
Degenerate primers for the original amplification of calcitonin receptor (CTR)-like protein were designed based on the conserved region of cDNAs from other species. The following primers were commercially synthesized (Life Technologies, Inc.): CTR-like protein primer 1: GCAAY(C/T)CGN(A/C/G/T)ACB(C/G/T)TGGGAY(C/T)GG, CTR-like protein primer 2: CCY(C/T)TCR(A/G)CAS(C/T)AGCATCCAGAA. Using the cDNA prepared from the cDNA library of bullfrog PVLS, we performed PCR, screened, and then sequenced according to the methods described above.

CTR-like protein expression in various tissues of the bullfrog
The tissue expression of CTR-like protein mRNA was analyzed with RT-PCR. Total RNA was prepared using the TRIZOL reagent from the bullfrog tissues (ELS, thigh bone, brain, pituitary gland, inner ear, liver, heart, lung, spleen, kidney, stomach, intestine, testis, ovary, skin, and skeletal muscle). After treatment with 5 µg total RNA was reverse transcribed in 20 µl reaction buffer containing 1 mM of each deoxynucleotide triphosphate, 9.9 U RAV-2 reverse transcriptase (Takara), 20 U RNase inhibitor (Toyobo), 7.5 mM of oligo-dT(19) primer (Life Technologies, Inc.), at 42 C for 1 h, and then at 52 C for 30 min. RT-PCR was performed by the same method, basically as described above, using the following primers: CTR-like protein sense primer: AGGGAAGTTGGTTTCAGCACCCCG, and CTR-like protein antisense primer: TTTCACCAGGTCCAAATCTGGGAC. ß-Actin primers were used as a control for the RT-PCR: ß-actin sense primer: CATCCTTCTTGGGTATGGAATCA, and ß-actin antisense primer: TGGCATACAGGTCCTTACGGATA.

The RT-PCR products were analyzed on a 2% agarose gel containing ethidium bromide (0.5 µg/ml) with Marker 6 ({lambda}/Sty 1 digest, Wako Pure Chemicals, Osaka, Japan) for molecular weight markers.

Experimental protocol for ultimobranchialectomy and calcitonin replacement
Before the experiment, the extent of developmental of the PVLS was observed under a soft x-ray (Sofron Co., Ltd., Tokyo, Japan), and individual animals with a well-developed sac were used in the following experiment.

To examine the effect of ultimobranchialectomy (UBX) and calcitonin on the expression of otoconin-22 mRNA in the PVLS, ultimobranchial glands were removed from 11 bullfrogs, and five bullfrogs were subjected to a sham operation under anesthesia using 0.1% MS-222, in the month of August. Two weeks after the operation, synthetic salmon calcitonin (25 IU, Bechem AG, Bubendorf, Switzerland) was injected into the abdominal lymph sac of the UBX bullfrogs (UBX+CT group) for 3 successive days. The calcitonin was dissolved in 0.5 IU/µl 0.6% sodium chloride containing 0.1% gelatin (pH 4.6) (15). The sham-operated and UBX bullfrogs were injected with 50 µl saline. One day after the final injection, PVLSs were collected from the bullfrogs for Northern blot analysis. The total RNA was isolated from 100 mg PVLSs of each bullfrog using RNeasy mini kit (QIAGEN, Hilden, Germany).

Northern blot analysis was performed for sequential expression analysis. An aliquot (2.5 µg) of the total RNA from each sample was electrophoresed. To perform the sequential expression analysis on the same membrane, after the first hybridization with the otoconin-22 probe, the membrane was rehybridized with the bullfrog ß-actin probe (cloned in our laboratory; DDBJ/EMBL/Gene Bank accession no. AB094353). The membrane was incubated in 50 mM Tris-HCl (pH 8.0) containing 50% formamide and 0.1% SDS for 1 h at 68 C to strip off the previously hybridized cDNA probe.

The dried films were image scanned, and the signal intensity was quantified with a computer image analyzer (NIH Image, version 1.62). The relative density was expressed as the ratio of the signal intensity of the otoconin-22 to the ß-actin band to normalize any variation in RNA loading and transfer.

Statistical analysis
All data are presented as the means ± SEM. For statistical analysis, t test was employed.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
cDNA cloning of the bullfrog otoconin-22
We amplified one major fragment from the bullfrog PVLS by the first PCR using primer 1 and primer 2. We obtained a 116-bp fragment as a candidate for the putative bullfrog PLA2-like protein. The amino acid sequence deduced from this fragment showed a higher homology to Xenopus otoconin-22 (6), suggesting that this fragment encodes a portion of the bullfrog otoconin-22. Therefore, we used this cDNA fragment as otoconin-22 probe for cDNA library screening. From the approximately 2 x 104 plaques screened, 4 of 15 positive clones for otoconin-22 were identified, isolated, and sequenced. These four clones have identical open reading frames with the same 3'-untranslational regions (Fig. 1Go). This clone contained a cDNA insert 1874 bp long that had an open reading frame of 441 bp. The cleavage site for the signal peptide was inferred by comparison with the data obtained from N-terminal sequencing of the bullfrog PLA2-like protein (13). When a signal sequence of 20 amino acids was located, the proposed mature bullfrog otoconin-22 began with threonin and consisted of 127 amino acids. Putative N-linked glycosylation sites were located at Asn-20 and Asn-113 from the N terminus of the predicted mature peptide. Figure 2Go shows the alignment of amino acid sequences of bullfrog otoconin-22, Xenopus otoconin-22, mammalian otoconin, and secretory PLA2 from various vertebrates. The putative two N-linked glycosylation sites of bullfrog otoconin-22 were completely consistent with those of Xenopus otoconin-22. All the 12 cysteine residues were conserved among Xenopus otoconin-22, mouse otoconin-90, and other vertebrate secretory PLA2 (Fig. 2Go). The homology between the bullfrog otoconin-22 and Xenopus otoconin-22, mouse otoconin-90 domain 1, mouse otoconin-90 domain 2, human pancreatic PLA2 (group IA) (16), human synovial PLA2 (group IIA) (17), mouse testicular PLA2 (group IIC) (18), rat testicular PLA2 (group V) (19), human fetal lung PLA2 (group X) (20), ß-bungarotoxin (21), caudoxin (group II) (22), and myotoxin (group I) (23) was 82.7, 28.1, 29.1, 37.0, 31.1, 30.5, 32.8, 30.5, 35.2, and 31.3%, respectively.



View larger version (70K):
[in this window]
[in a new window]
 
FIG. 1. Nucleotide and amino acid sequences of bullfrog otoconin-22 cDNA. The predicted amino acid is shown below the nucleotide sequence (DDBJ/EMBL/Gene Bank accession no. AB091830). The underlined letters indicate the amino acids comprising the signal sequence; the asterisk, the termination codon; the gray box, primer 1 and primer 2; and triangles, putative N-glycosylation sites. Polyadenylation signal region is boxed.

 


View larger version (94K):
[in this window]
[in a new window]
 
FIG. 2. Comparison of the predicted amino acid sequence of the bullfrog otoconin-22 with other otoconins and secreted PLA2. The amino acid residues that match those of the bullfrog otoconin-22 are indicated by an asterisk. Gaps, indicated by dashes, have been used to obtain maximum homology. The 12 cysteine residues conserved are shadowed. The calcium-binding domain and catalytic domain are indicated by a solid line box and dotted box, respectively. Putative N-glycosylation sites in the sequences of the otoconin-22 are boxed and are indicated by a triangle.

 
Northern analyses of otoconin-22 expression in various tissues
To determine the expression levels of the bullfrog otoconin-22 mRNA in various tissues including the ELS adhering to the brain and pituitary gland, PVLS, sacculus, and utriculus, we performed Northern blot analysis using a cDNA encoding the full length of the otoconin-22. Otoconin-22 mRNA was approximately 1.9 kb in length. This transcript size correlated well with that of the otoconin-22 cDNA. Otoconin-22 transcript was detected only in the mRNA from the ELS adhering the brain and pituitary, PVLS, sacculus, and utriculus; no signals were detected in the mRNA from other tissues or organs such as the pars distalis, pars neurointermedia, hypothalamus, brain, liver, lung, spleen, kidney, stomach, pancreas, small intestine, colon, bladder, testis, ovary, tongue, skeletal muscle, skin, or heart (Fig. 3Go).



View larger version (35K):
[in this window]
[in a new window]
 
FIG. 3. Northern blot analysis of the bullfrog otoconin-22 mRNA. Expression of otoconin-22 mRNA in various organs. Total RNA (10 µg) extracted from various organs was electrophoresed in 1% agarose gel containing 2 M formaldehyde. Expression of otoconin-22 mRNA is seen at 1.9 kb. PD, Pars distalis; NIL, pars neurointermediate.

 
Cloning of the bullfrog CTR-like protein cDNA
We amplified one fragment from the bullfrog PVLS by the PCR using primer 1 and primer 2. We obtained a 508-bp fragment, as a candidate, from the putative bullfrog CTR-like protein. The amino acid sequence deduced from this fragment showed a higher homology to mammalian CTR. From the approximately 6 x 105 plaques screened, two positive clones for CTR-like protein were identified, isolated, and sequenced. These two clones have identical open reading frames with different lengths of the 5'-untranslational regions, 367 bp and 137 bp in length. The clone of the long size contained a cDNA insert 1786 bp long that had an open reading frame of 1413 bp (Fig. 4Go). Because a polyadenylation signal was not recognized in the 3'-untranslation region of the clone, we considered that this cDNA might not be the full length of CTR-like protein mRNA. However, this cDNA clone has a putative stop coden. Therefore, we proposed the bullfrog CTR-like protein is composed of 470 amino acids. Figure 5Go shows the alignment of amino acid sequences of CTRs from various mammals. Putative N-linked gylcosylation sites were located at Asn-73, Asn-90, Asn-125, and Asn-130 from the N terminus of the predicted protein. Twelve cysteines were present in the bullfrog CTR-like protein that are conserved in mammalian CTRs and teleost CTRs. A hydropathy plot of the bullfrog CTR-like protein was consistent with the presence of seven hydrophobic regions flanked by charged residues, which could form transmembrane-spanning helixes, as proposed for many other G protein-coupled receptors (24, 25). In mammalian CTR, the cytosolic loop of the 19-amino-acid stretch between the fifth and sixth transmembrane domains indicated by dots in Fig. 5Go is thought to couple a G protein (26). The 19-amino-acid stretch of the bullfrog CTR-like protein conserved 12 amino acid residues toward mammalian CTRs.



View larger version (62K):
[in this window]
[in a new window]
 
FIG. 4. Nucleotide and amino acid sequences of bullfrog CTR-like protein cDNA. The predicted amino acid is shown below the nucleotide sequence (DDBJ/EMBL/Gene Bank accession no. AB103474). The underlined letters indicate the amino acids comprising the signal sequence. The asterisk indicates the termination codon; the gray box, primer 1 and primer 2; and the triangles, putative N-glycosylation sites.

 


View larger version (104K):
[in this window]
[in a new window]
 
FIG. 5. Comparison of the predicted amino acid sequence of the bullfrog CTR-like protein with calcitonin receptors in other animals. The amino acid residues that match those of the bullfrog CTR-like protein are indicated by an asterisk. Gaps, indicated by dashes, have been used to obtain maximum homology. The boxes indicate putative transmembrane domains I-VII; the dot underline, the cytosolic loop of the 19 amino acid stretch between the V and VI transmembrane domains; the squares, putative N-glycosylation sites; the triangles, the conserved cysteine residues.

 
The bullfrog CTR-like protein had high homology to the human CTR (72%) (27, 28, 29, 30), rat CTR (69%) (31, 32), mouse CTR (69%) (26), guinea pig CTR (69%) (33), pig CTR (70%) (34), rabbit CTR (70%) (35), flounder CTR (53%) (36), and salmon CTR (56%) (37).

Tissue distribution of CTR-like protein
To investigate tissue distribution of bullfrog CTR-like protein mRNA expressions, RT-PCR was performed using total RNA from various tissues (Fig. 6Go). CTR-like protein mRNA was observed in the ELS, thigh bone, brain, pituitary gland, heart, stomach, intestine, testis, ovary, and skin; no signal was detected in the mRNA from other tissues or organs such as the inner ear, liver, lung, spleen, kidney, and skeletal muscle. This RT-PCR result was confirmed by Southern blot analysis.



View larger version (26K):
[in this window]
[in a new window]
 
FIG. 6. Tissue expression of the bullfrog CTR-like protein mRNA by RT-PCR. The PCR products were separated on a 2% agarose gel and stained with ethidium bromide. These bands were confirmed by Southern blot analysis. Arrowheads indicate CTR-like protein cDNA (296 bp) and ß-actin cDNA (96 bp).

 
Effect of ultimobranchialectomy and replacement of calcitonin on the expression of otoconin-22 mRNA in the PVLSs
To elucidate a functional relationship between the expression of otoconin-22 mRNA and the ultimobranchial gland, we examined the effect of UBX on the otoconin-22 mRNA levels in the PVLS using Northern blot analysis. The removal of the ultimobranchial gland induced a decrease in the size of the PVLSs, compared with that in the sham-operated bullfrogs (Fig. 7Go). Typical Northern blot analysis profiles of the otoconin-22 and ß-actin mRNAs from the PVLS of sham-operated, UBX, and UBX- and calcitonin-injected specimens are shown in Fig. 8AGo. The 1.9-kb mRNA levels, corresponding to bullfrog otoconin-22, decreased by 0.47-fold (P < 0.005) 2 wk after UBX. When UBX bullfrogs were injected with calcitonin every day for 3 d, otoconin-22 mRNA levels in the PVLS increased by 1.47- (P < 0.05) and 2.33- (P < 0.001) fold, compared with those in the lime sac from the sham-operated and the UBX bullfrogs, respectively (Fig. 8BGo).



View larger version (125K):
[in this window]
[in a new window]
 
FIG. 7. Photograph of the PVLS of the bullfrogs 2 wk after sham-operation (A) or ultimobranchialectomy (B). The PVLS, compared with the sham-operated bullfrog (arrowheads). Bar, 1 cm.

 


View larger version (27K):
[in this window]
[in a new window]
 
FIG. 8. Northern blot analysis of the otoconin-22 mRNA in the PVLS from sham-operated, ultimobranchialectomized and ultimobranchialectomized, and calcitonin-injected bullfrog. A, Representative Northern analysis profiles. UBX, Ultimobranchial specimen. UBX + CT, Administration of calcitonin to ultimobrantialectomied specimen. B, The data obtained from the densitometry of the Northern blot shown in A. The densitometry intensity was normalized with ß-actin mRNA levels and expressed relative to the values for the sham-operated specimen. Each column and vertical bar represent a mean and SEM of five or six determinations, respectively. The number of individuals used in each group is indicated in parentheses. The asterisk indicates a significant difference from the control at the 5% level (t test).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The present study describes the full sequence of mRNA-encoding bullfrog otoconin-22, which corresponds to Xenopus otoconin-22 belonging to secretory PLA2. The bullfrog otoconin-22 is structurally characterized by the 12 cysteine residues, and this structure is considered to play important roles in maintaining the molecular conformation (6, 38). The bullfrog otoconin-22 has two putative N-glycosylation sites, implying the presence of glycosylation forms in this protein. Indeed, the N-glycosylation sites appear to be used in vivo because digestion with peptide-N-glycosidase F of the extracts of bullfrog ELS or calcium carbonate crystals was able to reduce the apparent molecular mass by 20.4 kDa in our previous biochemical analysis (5). It has been suggested that some of the residues are essential for calcium binding (Tyr-28, Gly-30, Gly-32, and Asp49 in Fig. 2Go) (39, 40) and catalytic activity (His-48, Tyr-52, Tyr-73, and Asp-99) (39). However, they are replaced by other amino acid residues in bullfrog otoconin-22 as well as in Xenopus otoconin-22 and mouse otoconin-90. Therefore, it is assumed that these domains function neither for calcium binding nor as catalytic domains. Also, Pote et al. (6) indicated that Xenopus otoconin-22 has no ability to bind calcium, according to biochemical studies, although otoconin-22 is believed to play important roles in creating the condition that favor nucleation and then controlling the crystal growth of the calcium carbonate lattice in otoconia.

Most vertebrate animals have ear stones composed of crystalline calcium carbonate. The ear stone of the fishes is composed of one large aragonite (otoliths), whereas in vertebrates higher than amphibians, the ear stone is made of a large number of tiny crystals (otoconia). These stones have been classified into three groups according to their crystalline form: vaterite, aragonite, and calcite. Furthermore, each type occurs in distinct groups of animals: calcite in birds and mammals, calcite in the utricle and aragonite in the saccule in amphibians, aragonite (otoliths) in most fishes, and vaterite in chondrostean fishes (4, 41, 42). The crystals also contain a small amount of organic matrices including proteins, which promote the formation of the crystal. Therefore, it is of interest to determine a functional relationship among these proteins. Four proteins have been identified: otolith matrix protein-1 in rainbow trout otolith (43), otolin-1 in chum salmon otolith (44), otoconin-22 in Xenopus aragonite (6), and otoconin-90 in mouse calcite (7, 8). The deduced amino acid sequences of bullfrog otoconin-22 showed higher homology to Xenopus otoconin-22 and less homology to mammalian otoconin-90. The amino acid sequences of otolith matrix protein-1 and otolin-1 is completely different from those of otoconin. The morphological diversity of crystals may be due to differences in properties of the protein found in the crystals, as mentioned above.

In this study, we investigated the expression of bullfrog otoconin-22 using the currently cloned cDNA probe. Northern blot analysis revealed that otoconin-22 is expressed specifically in the ELSs including PVLS and inner ear (sacculus and utriculus) and also showed that only one mRNA for this protein is present. The tissue distribution of the mRNA was consistent with the previous immunocytochemical study showing that immunolabelings are seen in the epithelial cells of the ELS adhering the brain and pituitary, PVLS, and inner ear (5, 45).

Calcitonin is a peptide hormone that regulates the balance of serum calcium, which is secreted primarily from ultimobranchial glands in anuran amphibians (46, 47). Several studies have also suggested that calcitonin is involved in regulating the formation of calcium carbonate crystals in anuran amphibians (11, 12, 48, 49, 50).

In general, calcitonin regulates calcium homeostasis by binding to specific receptor in the osteoclast and the kidney. CTR is seven-transmembrane surface receptors on the target cells and uses a cAMP second messenger (51, 52). In the present study, we obtained a candidate for the putative bullfrog CTR from the cDNA library of the bullfrog PVLS. The cDNA encodes a protein of 470 amino acids, showing a high homology with mammalian CTRs. The bullfrog CTR-like protein was distributed widely over several tissues including the ELS and the brain, which is nearly consistent with that of the flounder and salmon CTRs (36, 37). In the present study, however, we did not detect the bullfrog CTR-like protein mRNA expression in the kidney and inner ear (see Fig. 6Go). The lack of the kidney is in good agreement with the quantitative autoradiography study on calcitonin-binding sites, indicating that CTR is not detected in the amphibian kidneys (53). Furthermore, no existence of the CTR-like protein in the inner ear implied that otoconin-22 in the inner ear is not regulated by calcitonin.

In the present study, we examined the effect of UBX on the otoconin-22 mRNA levels in the PVLS using Northern blot analysis. The present study demonstrated that UBX causes a significant decrease in otoconin-22 mRNA levels, but administration of calcitonin to UBX-bullfrogs raises the mRNA levels. Our previous immunoelectron microscopic study demonstrated that otoconin-22 protein localizes in secretory granules in the epithelial cells of ELS (5). Accordingly, otoconin-22 protein is considered to be secreted from the apical plasma membrane of the epithelial cells into the lumen of the ELS, where the crystals are formed. The decline in otoconin-22 mRNA levels after UBX observed in this study was consistent with a series of observations by Robertson (10, 48) that in R. pipiens, UBX caused a decrease in secretory activity of the epithelial cells and a reduction in quantity of crystals in the ELS. On the other hand, several studies indicated that calcitonin increases the quantity of calcium carbonate crystal in anuran amphibians (11, 12, 50). Considering the results of the present study, it is conceivable that calcitonin secreted from the ultimobranchial glands regulates the amount of the crystals by stimulating the synthesis of otoconin-22 in bullfrogs. However, it is still unclear how otoconin-22 protein is involved in the formation of deposition of calcium ions in the lumen of the ELS.

Taken together, these findings suggest that calcitonin secreted from the ultimobrachial glands, regulates otoconin-22 mRNA expression via CTR-like protein on ELS cells, thereby stimulating the formation of calcium carbonate crystals in the lumen of the ELS.


    Footnotes
 
This work was supported in part by a Grant-in-Aid for Scientific Research from the Ministry of Education, Culture, Sports, Science, and Technology of Japan (to S.T.).

Abbreviations: CTR, Calcitonin receptor; DIG, digoxigenin; ELS, endolymphatic sac; PLA2, phospholipase A2; PVLS, paravertebral lime sac; SSC, saline-sodium citrate; UBX, ultimobranchialectomy.

Received December 23, 2002.

Accepted for publication March 31, 2003.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Simkiss K 1967 Endolymphatic sacs. In: Simkiss K, ed. Calcium in reproductive physiology. Modern biological studies. London: Chapman, Hall; 83–93
  2. Dempster WT 1930 The morphology of the amphibian endolymphatic organ. J Morphol 50:71–126[CrossRef]
  3. Schlumberger HG, Burk DH 1953 Comparative study of the reaction to injury. II. Hypervitaminosis D in the frog with special reference to the lime sacs. AMA Arch Pathol 56:103–124
  4. Carlstrom D 1963 A crystallographic study of vertebrate otoliths. Biol Bull 125:441–463
  5. Yaoi Y, Kikuyama S, Hayashi H, Hanaoka Y, Sakai M, Tanaka S 2001 Immunocytochemical localization of secretory phospholipase A2-like protein in the pituitary gland and surrounding tissue of the bullfrog, Rana catesbeiana. J Histochem Cytochem 49:631–637[Abstract/Free Full Text]
  6. Pote KG, Hauer CRI, Michel H, Shabanowitz J, Hunt DF, Kretsinger RH 1993 Otoconin-22, the major protein of aragonitic frog otoconia, is a homolog of phospholipase A2. Biochemistry 32:5017–5024[CrossRef][Medline]
  7. Wang Y, Kowalski PE, Thalmann I, Ornitz DM, Mager DL, Thalmann R 1998 Otoconin-90, the mammalian otoconial matrix protein, contains two domains of homology to secretory phospholipase A2. Proc Natl Acad Sci USA 95:15345–15350[Abstract/Free Full Text]
  8. Verpy E, Leibovici M, Petit C 1999 Characterization of otoconin-95, the major protein of murine otoconia, provides insights into the formation of these inner ear biominerals. Proc Natl Acad Sci USA 96:529–534[Abstract/Free Full Text]
  9. Kawamata S 1990 Fine structural changes in the endolymphatic sac induced by calcium loading in the tree frog, Hyla arborea japonica. Arch Histol Cytol 53:397–404[Medline]
  10. Robertson DR 1969 The ultimobranchial body of Rana pipiens. VIII. Effects of extirpation upon calcium distribution and bone cell types. Gen Comp Endocrinol 12:479–490[CrossRef][Medline]
  11. Oguro C, Fujimori M, Sasayama Y 1984 Changes in the distribution of calcium in the frog, Rana nigromaculata, following ultimobranchialectomy and calcitonin administration. Zool Sci 1:82–88
  12. Srivastav AK, Rani L 1989 Influence of calcitonin administration of serum calcium and inorganic phosphate level of the frog, Rana tigrina. Gen Comp Endocrinol 74:14–17[CrossRef][Medline]
  13. Sakai M 1992 Amphibian thyroid-stimulating hormone: purification, characterization and biological activity. Thesis, Waseda University, Tokyo, Japan
  14. Saito A, Kano Y, Suzuki M, Tomura H, Takeda J, Tanaka S 2002 Sequence analysis and expressional regulation of mRNAs encoding ß-subunits of follicle-stimulating hormone and luteinizing hormone in the red-bellied newt, Cynops pyrrhogaster. Biol Reprod 66:1299–1309[Abstract/Free Full Text]
  15. Sasayama Y 1978 Effects of implantation of the ultimobranchial glands and the administration of synthetic salmon calcitonin on serum Ca concentrations in ultimobranchialectomized bullfrog tadpoles. Gen Comp Endocrinol 34: 229–233
  16. Seilhamer JJ, Randall TL, Yamanaka M, Johnson LK 1986 Pancreatic phospholipase A2: isolation of the human gene and cDNAs from porcine pancreas and human lung. DNA 5:519–527[Medline]
  17. Seilhamer JJ, Pruzanski W, Vadas P, Plant S, Miller JA, Kloss J, Johnson LK 1989 Cloning and recombinant expression of phospholipase A2 present in rheumatoid arthritic synovial fluid. J Bio Chem 264:5335–5338[Abstract/Free Full Text]
  18. Chen J, Shao C, Lazar V, Srivastava CH, Lee WH, Tischfield JA 1997 Localization of group IIc low molecular weight phospholipase A2 mRNA to meiotic cells in the mouse. J Cell Biochem 64:369–375[CrossRef][Medline]
  19. Chen J, Engle SJ, Seilhamer JJ, Tischfield JA 1994 Cloning and characterization of novel rat and mouse low molecular weight Ca2+ dependent phospholipase A2s containing 16 cysteines. J Biol Chem 269:23018–23024[Abstract/Free Full Text]
  20. Cupillard L, Koumanov K, Mattei MG, Lazdunski M, Lambeau G 1997 Cloning, chromosomal mapping, and expression of a novel human secretory phospholipase A2. J Biol Chem 272:15745–15752[Abstract/Free Full Text]
  21. Kondo K, Narita K, Lee CY 1978 Amino acid sequences of the two polypeptide chains in ß1-bungarotoxin from the venom of Bungarus multicinctus. J Biochem (Tokyo) 83:101–115[Abstract/Free Full Text]
  22. Viljoen CC, Botes DP, Kruger H 1982 Isolation and amino acid sequence of caudoxin, a presynaptic acting toxic phospholipase A2 from the venom of the horned puff adder (Bitis caudalis). Toxicon 20:715–737[Medline]
  23. Lind P, Eaker D 1981 Amino acid sequence of a lethal myotoxic phospholipase A2 from the venom of the common sea snake (Enhydrina schistosa). Toxicon 19:11–24[Medline]
  24. Dohlman HG, Thorner J, Caron MG, Lefkowitz RJ 1991 Model systems for the study of seven-transmembrane-segment receptors. Annu Rev Biochem 60:653–688[CrossRef][Medline]
  25. Strosberg AD 1991 Structure/function relationship of proteins belonging to the family of receptors coupled to GTP-binding proteins. Eur J Biochem 196:1–10[Medline]
  26. Yamin M, Gorn AH, Flannery MR, Jenkins NA, Gilbert DJ, Copeland NG, Tapp DR, Krane SM, Goldring SR 1994 Cloning and characterization of a mouse brain calcitonin receptor complementary deoxyribonucleic acid and mapping of the calcitonin receptor gene. Endocrinology 135:2635–2643[Abstract]
  27. Gorn AH, Lin HY, Yamin M, Auron PE, Flannery MR, Tapp DR, Manning CA, Lodish HF, Krane SM, Goldring SR 1992 Cloning, characterization, and expression of a human calcitonin receptor from an ovarian carcinoma cell line. J Clin Invest 90:1726–1735
  28. Goldring SR, Gorn AH, Yamin M, Krane SM, Wang JT 1993 Characterization of the structural and functional properties of cloned calcitonin receptor cDNAs. Horm Metab Res 25:477–480[Medline]
  29. Kuestner RE, Elrod RD, Grant FJ, Hagen FS, Kuijper JL, Matthewes SL, O’Hara PJ, Sheppard PO, Stroop SD, Thompson DL, Whitmore TE, Findlay DM, Houssami S, Sexton PM, Moore EE 1994 Cloning and characterization of an abundant subtype of the human calcitonin receptor. Mol Pharmacol 46:246–255[Abstract]
  30. Albrandt K, Brady EM, Moore CX, Mull E, Sierzega ME, Beaumont K 1995 Molecular cloning and functional expression of a third isoform of the human calcitonin receptor and partial characterization of the calcitonin receptor gene. Endocrinology 136:5377–5384[Abstract]
  31. Albrandt K, Mull E, Brady EM, Herich J, Moore CX, Beaumont K 1993 Molecular cloning of two receptors from rat brain with high affinity for salmon calcitonin. FEBS Lett 325:225–232[CrossRef][Medline]
  32. Sexton PM, Houssami S, Hilton JM, O’Keeffe LM, Center RJ, Gillespie MT, Darcy P, Findlay DM 1993 Identification of brain isoforms of the rat calcitonin receptor. Mol Endocrinol 7:815–821[Abstract/Free Full Text]
  33. Sarkar A, Dickerson IM 1997 Cloning, characterization, and expression of a calcitonin receptor from guinea pig brain. J Neurochem 69:455–464[Medline]
  34. Zolnierowicz S, Cron P, Solinas-Toldo S, Fries R, Lin HY, Hemmings BA 1994 Isolation, characterization, and chromosomal localization of the porcine calcitonin receptor gene. Identification of two variants of the receptor generated by alternative splicing. J Biol Chem 269:19530–19538[Abstract/Free Full Text]
  35. Shyu JF, Inoue D, Baron R, Horne WC 1996 The deletion of 14 amino acids in the seventh transmembrane domain of a naturally occurring calcitonin receptor isoform alters ligand binding and selectively abolishes coupling to phospholipase C. J Biol Chem 271:31127–31134[Abstract/Free Full Text]
  36. Suzuki N, Suzuki T, Kurokawa T 2000 Cloning of a calcitonin gene-related peptide receptor and a novel calcitonin receptor-like receptor from the gill of flounder, Paralichthys olivaceus. Gene 244:81–88[CrossRef][Medline]
  37. Pidoux E, Cressent M 2002 Sequencing of a calcitonin receptor-like receptor in salmon Oncorhynchus gorbuscha. Functional studies using the human receptor activity-modifying proteins. Gene 298:203–210[CrossRef][Medline]
  38. Zhu H, Dupureur CM, Zhang X, Tsai MD 1995 Phospholipase A2 engineering. The roles of disulfide bonds in structure, conformational stability, and catalytic function. Biochemistry 34:15307–15314[CrossRef][Medline]
  39. Renetseder R, Brunie S, Dijkstra BW, Drenth J, Sigler PB 1985 A comparison of the crystal structures of phospholipase A2 from bovine pancreas and Crotalus atrox venom. J Biol Chem 260:11627–11634[Abstract/Free Full Text]
  40. Davidson FF, Dennis EA 1990 Evolutionary relationships and implications for the regulation of phospholipase A2 from snake venom to human secreted forms. J Mol Evol 31:228–238[CrossRef][Medline]
  41. Marmo F, Balsamo G, Franco E 1983 Calcite in the statoconia of amphibians: a detailed analysis in the frog Rana esculenta. Cell Tissue Res 233:35–43[Medline]
  42. Pote KG, Ross MD 1991 Each otoconia polymorph has a protein unique to that polymorph. Comp Biochem Physiol B Biochem Mol Biol 98:287–295[CrossRef]
  43. Murayama E, Okuno A, Ohira T, Takagi Y, Nagasawa H 2000 Molecular cloning and expression of an otolith matrix protein cDNA from the rainbow trout, Oncorhynchus mykiss. Comp Biochem Physiol B Biochem Mol Biol 126:511–520[CrossRef][Medline]
  44. Murayama E, Takagi Y, Ohira T, Davis JG, Greene MI, Nagasawa H 2002 Fish otolith contains a unique structural protein, otolin-1. Eur J Biochem 269: 688–696
  45. Onda T, Yaoi Y, Suzuki M, Tanaka S 2001 Immunohistochemical investigation of otoconin-22 producing cells in the endolymphatic sac of bullfrog, Rana catesbeiana. Zool Sci 18:25 (Abstract)
  46. Sasayama Y, Oguro C, Yui R, Kambegawa A 1984 Immunohistochemical demonstration of calcitonin in ultimobranchial gland of some lower vertebrates. Zool Sci 1:755–758
  47. Stiffler DF 1993 Amphibian calcium metabolism. J Exp Biol 184:47–61[Abstract]
  48. Robertson DR 1969 The ultimobranchial body of Rana pipiens. X. Effect of glandular extirpation on fracture healing. J Exp Zool 172:425–442[CrossRef][Medline]
  49. Robertson DR 1972 Calcitonin in amphibians and the relationship of the paravertebral lime sacs with carbonic anhydrase. In: Talmage RV, Munson PL, eds. Calcium, parathyroid hormone and calcitonins. Amsterdam: Excerpta Medica; 21–28
  50. Swarup K, Krishna L 1979 Response of ultimobranchial body, parathyroid gland and paravertebral lime sacs to parahormone administration in Rana cyanophlyctis (Anura, Amphibia). Arch Biol (Liege) 90:355–364
  51. Sexton PM, Findlay DM, Martin TJ 1999 Calcitonin. Curr Med Chem 6:1067–1093[Medline]
  52. Pondel M 2000 Calcitonin and calcitonin receptors: bone and beyond. Int J Exp Pathol 81:405–422[CrossRef][Medline]
  53. Bouizar Z, Khattab M, Taboulet J, Rostene W, Milhaud G, Treilhou-Lahille F, Moukhtar MS 1989 Distribution of renal calcitonin binding sites in mammalian and nonmammalian vertebrates. Gen Comp Endocrinol 76:364–370[CrossRef][Medline]



This article has been cited by other articles:


Home page
J. Histochem. Cytochem.Home page
Y. Yaoi, T. Onda, Y. Hidaka, S. Yajima, M. Suzuki, and S. Tanaka
Developmental Expression of Otoconin-22 in the Bullfrog Endolymphatic Sac and Inner Ear
J. Histochem. Cytochem., May 1, 2004; 52(5): 663 - 670.
[Abstract] [Full Text] [PDF]


Home page
J. Histochem. Cytochem.Home page
Y. Yaoi, M. Suzuki, H. Tomura, S. Kurabuchi, Y. Sasayama, and S. Tanaka
Expression and Localization of Prohormone Convertase PC1 in the Calcitonin-producing Cells of the Bullfrog Ultimobranchial Gland
J. Histochem. Cytochem., November 1, 2003; 51(11): 1459 - 1466.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
E. Schipani
Otoconin-22 and Calcitonin: A Novel Modality of Regulating Calcium Storages in Lower Vertebrates?
Endocrinology, August 1, 2003; 144(8): 3285 - 3286.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
144/8/3287    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yaoi, Y.
Right arrow Articles by Tanaka, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yaoi, Y.
Right arrow Articles by Tanaka, S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals