help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2003-0420
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Stocco, C.
Right arrow Articles by Gibori, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Stocco, C.
Right arrow Articles by Gibori, G.
Endocrinology Vol. 144, No. 8 3301-3305
Copyright © 2003 by The Endocrine Society


BRIEF COMMUNICATION

Prostaglandin F2{alpha} (PGF2{alpha}) and Prolactin Signaling: PGF2{alpha}-Mediated Inhibition of Prolactin Receptor Expression in the Corpus Luteum

Carlos Stocco, Jean Djiane and Geula Gibori

Department of Physiology and Biophysics (C.S., G.G.), University of Illinois at Chicago, Chicago, Illinois 60612; and Unité de Biologie Cellulaire et Moléculaire (J.D.), Institut National de la Recherche Agronomique, 78352 Jouy-en-Josas Cedex, France

Address all correspondence and requests for reprints to: Geula Gibori, Department of Physiology and Biophysics (M/C 901), University of Illinois, 835 South Wolcott Avenue, Chicago, Illinois 60612. E-mail: ggibori{at}uic.edu.

Abstract

It is well established that prolactin (PRL) sustains, whereas prostaglandin F2{alpha} (PGF2{alpha}) curtails, progesterone production by the rodent corpus luteum (CL). We have previously shown that PGF2{alpha} inhibits the expression of several luteal genes stimulated by PRL, whereas it stimulates other genes inhibited by this hormone. We have also found that PGF2{alpha} stimulation of 20{alpha}-hydroxysteroid dehydrogenase (20{alpha}HSD), an enzyme that catabolizes progesterone, at the end of pregnancy is accompanied by a dramatic decrease in PRL receptor (PRL-R) expression. These findings, and the fact that the factors that inhibit PRL-R are not known, led us to examine in vivo whether the decline in PRL-R at the end of pregnancy is due to PGF2{alpha} and to also find out whether PGF2{alpha} opposes PRL action by inhibiting PRL-R expression. Using the PGF2{alpha} receptor (PGF2{alpha}-R) knockout, we examined whether the absence of the PGF2{alpha}-R prevents the decline in the expression of both the short and long forms of the PRL-R in the CL. We found that, in sharp contrast to the wild-type mice, in which both forms of the PRL-R decline to low levels between d 18–20 of pregnancy, expression of these receptors remained elevated in the PGF2{alpha}-R null mice. Furthermore, administration of PGF2{alpha} to pregnant rats inhibited PRL-R expression. Time-course analysis revealed that PGF2{alpha} treatment decreases both isoforms of PRL-R within 1 h of treatment in vivo, whereas its stimulatory effect on 20{alpha}HSD expression was further delayed. Similar results were obtained with luteinized granulosa cells in culture. To examine whether the decline in PRL-R is involved/necessary for PGF2{alpha} action, cells were transfected with a constitutively active PRL-R. The expression of this receptor did not prevent PGF2{alpha} effect on PRL-R or 20{alpha}HSD expression. Taken together, these results demonstrate that PGF2{alpha} inhibits the expression of the PRL-R and that the decline in both forms of the PRL-R that occurs at the end of pregnancy in the CL is due to PGF2{alpha}. The results further suggest that PGF2{alpha}-mediated stimulation of 20{alpha}HSD is independent from PGF2{alpha} inhibition of PRL signaling in luteal cell.

THE PROLACTIN (PRL) RECEPTOR (PRL-R) and prostaglandin F2{alpha} (PGF2{alpha}) receptor (PGF2{alpha}-R) knockout mice have clearly established the importance of PRL and PGF2{alpha} in the normal evolution of pregnancy. The main cause of infertility in the PRL-R null mice is a defect in the corpus luteum (CL) formation and absence of progesterone support for implantation and placental development (1). On the other hand, mice rendered deficient for the PGF2{alpha}-R gene do not show the normal prepartum drop in progesterone and consequently do not give birth (2). Luteal expression of 20{alpha}-hydroxysteroid dehydrogenase (20{alpha}HSD), an enzyme that catabolizes progesterone, is the best example of the contrasting effects of these two hormones on the regulation of luteal function. Whereas PRL completely inhibits 20{alpha}HSD expression (3), PGF2{alpha} massively increases it (4). Several other luteal genes are regulated in an opposite manner by PRL and PGF2{alpha} (5). We have demonstrated that the CL of PGF2{alpha}-R knockout mice fails to express 20{alpha}HSD at the end of pregnancy, resulting in sustained level of progesterone in the circulation (4). We have also found that the physiological increase in 20{alpha}HSD expression at the end of pregnancy is accompanied by a dramatic decrease in PRL-R expression (6). These findings, and the fact that the factors that inhibit PRL-R expression are not known, led us to examine whether the decline in PRL-R at the end of pregnancy is due to PGF2{alpha} and to find out whether PGF2{alpha} opposes PRL action by inhibiting PRL-R expression.

Materials and Methods

Animals and cell culture
Pregnant Sprague Dawley rats, purchased from Sasco Animal Labs (Madison, WI), were housed at 24 C on a 14-h light, 10-h dark cycle and allowed free access to Purina rat chow and water. PGF2{alpha}-R knockout mice with a mixed genetic background of 129/Ola and C57BL/6 strains were used (2). Wild-type and PGF2{alpha}-R knockout mice were maintained at 23 C under a 12-h light cycle. Virgin females (9–12 wk of age) housed overnight with males were checked the following morning for vaginal plug. The day the plug was found was counted as d 1 of pregnancy. Animal care and handling conformed to the National Institutes of Health (NIH) guidelines for animal research. The experimental protocol was approved by the Institutional Animal Care and Use Committee. Luteinized granulosa cells (LGC) were isolated and cultured as previously described (7). Briefly, LGC from pregnant mare serum gonadotropin/human chorionic gonadotropin superovulated immature rat were culture in DMEM/F12 medium plus 1% fetal bovine serum. After 3 d of culture, fetal bovine serum in the medium was reduced to 0.1%, and the cells were treated or transfected as depicted in figure legends.

RNA isolation and RT-PCR analysis
Total RNA from rat CL or mouse ovary was isolated by using Tri-Reagent (Sigma, St. Louis, MO) following the manufacturer’s instructions. For mRNA analysis by RT-PCR, 1 µg of total RNA was reverse-transcribed at 42 C by using Advantage RT-for-PCR kit (Promega, Madison, WI). The PCR mixture containing specific oligonucleotide primers (20 pmol), deoxynucleotide triphosphate (150 µM), and ExTaq DNA polymerase (0.8 U) was added to each tube containing 5 µl of reveres transcription product. Each PCR included primer for rat or mouse ribosomal protein L19 mRNA, used as internal control. Before proceeding with the semiquantitative PCR, the conditions were established such that the amplification of the products was in the exponential phase, and the assay was linear with respect to the amount of input RNA. After electrophoresis in agarose gel, data were analyzed using MDS 120 software (Kodak, Rochester, NY).

For the rat samples, PRL-R message was amplified by using a common sense primer targeted to the conserved extracellular domain present both PRL-R isoforms: ATACTGGAGTAGATGGAGCCAGGAGAGTTC. For the long form of PRL-R, the antisense primer used was CTTCCGTGAACAGAGTCACTGTCGGGATCT; and for the PRL-R short form, the primer used was CTATTTGAGTCTGCAGCTTCAGTAGTCA (8). The same approach was used for mouse PRL-R determination: common sense primer, ATACTGGAGTAGATGGGGCCAGGAGAAATC; the antisense long-form primer, CTTCCATGACCAGAGTCACTGTCAGGATCT; or the antisense short-form primer, ATATTTGAGTCTGCTGCTTCAGTAGTCAAG. When a coamplification of PRL-R short and long form and 20{alpha}HSD messages was performed, the following primers for 20{alpha}HSD were used, following a protocol previously described (4): TGTATCTCTGAGTTCCCAGG and ACTCTTCTAGGGAAGAGCAG. For the rat ribosomal protein L19, the primers used were GGACAGAGTCCAAGGGTCCGCTGCAGTC and TCCAAGGGTCCGTGCAGTC, which were included in the reaction to coamplify the message for PRL-Rs and the internal standard L19. For mouse ribosomal protein L19, the primers used were AGCGCCTCCAGGCCAAGAAGG and CCAGGCCGC TATGTACAGACACGA (4). The expected size of for each RT-PCR product was obtained. For all reactions, primers were used at a 0.6-µM concentration in a 50-µl final volume of reaction.

Statistical analysis
One-way ANOVA (ANOVA I) followed by the Tukey test was used for the statistical analysis of relative mRNA expression by using Prism software (GraphPad Software, Inc., San Diego, CA). Values were considered statistically significant at P < 0.05.

Results

PRL-R expression in PGF2{alpha}-R knockout mice at the end of pregnancy
To examine whether PGF2{alpha} is responsible for the physiological drop in luteal PRL-R expression observed at the end of pregnancy in rodents, we examined the expression of this gene on d 18, 19, and 20 of pregnancy in wild-type and PGF2{alpha}-R knockout mice. PRL-R long and short mRNAs (Fig. 1Go) were equally expressed on d 18 in both CL of wild-type and PGF2{alpha}-R knockout mice. Similarly to the rat, in which the expression of both forms of the PRL-R drops 2 d before parturition (6), a dramatic decrease in these receptors was observed in wild-type mice on d 19 and 20. This decrease did not take place in CL of PGF2{alpha}-R-deficient mice, clearly establishing the participation of PGF2{alpha} in the down-regulation of luteal PRL-R expression at the end of pregnancy.



View larger version (28K):
[in this window]
[in a new window]
 
FIG. 1. PRL-R ovarian expression at the end of pregnancy in wild-type (+/+) and PGF2{alpha}-R knockout (-/-) mice. Total RNA was subjected to RT-PCR analysis using specific primers for mouse PRL-R and L19 as internal control. Values are expressed as the mean ± SEM (n = 3 animals). ***, P < 0.001 vs. +/+.

 
In vivo administration of PGF2{alpha} inhibits PRL-R expression in the CL
To further examine whether PGF2{alpha} inhibits PRL-R expression, either PGF2{alpha} (400 ug/rat, ip) or vehicle (saline solution) was administered to rats on d 19 of pregnancy, 2 d before the physiological decrease in the luteal expression of this gene (6). Twenty-four hours later (d 20 of pregnancy), luteal RNA was isolated and used to determine PRL-R mRNA expression level by semiquantitative RT-PCR. As shown in Fig. 2Go, PGF2{alpha} caused a marked inhibition of both PRL-R long and short forms.



View larger version (44K):
[in this window]
[in a new window]
 
FIG. 2. Effect of PGF2{alpha} administration on luteal expression of the long and short form of the PRL-R. Rats were injected with either 400 µg of PGF2{alpha} ip or vehicle (V) on d 19 of pregnancy; luteal PRL-R long- and short-form mRNA levels were determined 24 h after. Bars represent the mean ± SEM (n = 3 animals). ***, P < 0.001 vs. vehicle (V).

 
Time-dependent effect of PGF2{alpha} on luteal PRL-R and 20{alpha}HSD expression
To examine the time course of PGF2{alpha}-mediated inhibition of PRL-R expression, d 19 pregnant rats were injected with PGF2{alpha} and killed 0–10 h thereafter. Total RNA was isolated and subjected to RT-PCR with primers that allow coamplification of both forms of the rat PRL-R. Because we have previously studied in detail the stimulatory effect of PGF2{alpha} on 20{alpha}HSD expression (4), we sought to examine whether the induction of 20{alpha}HSD by PGF2{alpha} may be preceded by a decrease in PRL-R expression. To accomplish this, we coamplified 20{alpha}HSD mRNA along with that of PRL-R in luteal RNA of rats treated with PGF2{alpha} for different periods of time. The results shown in Fig. 3Go reveal that PGF2{alpha} treatment causes a time-related decrease in the expression of both forms of PRL-R. A significant inhibition in the expression of the short and long forms occurred within 30 and 60 min, respectively, whereas 20{alpha}HSD expression was induced by PGF2{alpha} only 2 h after treatment. 20{alpha}HSD mRNA levels increased progressively thereafter (Fig. 3Go).



View larger version (51K):
[in this window]
[in a new window]
 
FIG. 3. Time-course inhibition of PRL-R expression by PGF2{alpha} in the rat CL. Rats on d 19 of pregnancy were treated with 400 µg PGF2{alpha} ip and killed 0–10 h thereafter. RT-PCR analysis was performed using primers that allow the coamplification of both forms of the PRL-R, 20{alpha}HSD, and L19 messages. Each point represents means ± SEM, n = 3. *, P < 0.05 vs. 0 h; thereafter, all points are significantly different.

 
Effect of PGF2{alpha} on PRL-R expression in vitro
To determine whether PGF2{alpha} decreases PRL-R expression acting on luteal cells directly, we used LGC, which were treated with different doses of PGF2{alpha}. As shown in Fig. 4AGo, treatment with a low dose of PGF2{alpha} caused maximal inhibition of PRL-R expression, yet this dose had no effect on 20{alpha}HSD expression. Higher concentrations of PGF2{alpha} in the culture medium induced 20{alpha}HSD expression. Furthermore, pretreatment of LGC with PRL did not affect PGF2{alpha} stimulation of 20{alpha}HSD (data not shown), suggesting that PGF2{alpha} stimulation of 20{alpha}HSD is dissociated from its effect on PRL-R. To examine this possibility, we transfected LGC with an expression vector for a constitutively active PRL-R (PRL-RCA). This receptor has been previously shown to activate constitutively PRL signaling and to regulate the transcription of PRL-regulated genes (9). Cells were then treated with either vehicle or PGF2{alpha}. PRL-RCA expression prevented neither the PGF2{alpha}-mediated inhibition of PRL-R expression nor the stimulation of 20{alpha}HSD (Fig. 4BGo). Nevertheless, PRL-RCA alone led to an increase in PRL-R expression, in accord with our previous finding demonstrating an up-regulation of PRL-R by PRL (5). Primers used to determine PRL-R do not amplify the mRNA transcribed from the PRL-RCA (10).



View larger version (33K):
[in this window]
[in a new window]
 
FIG. 4. Effect of PGF2{alpha} on the expression of PRL-R in LGC. A, Cells were treated with different doses of PGF2{alpha} for 12 h. B, Cells transfected with an empty plasmid or a constitutively active PRL-R (Rca) were treated with PGF2{alpha} or vehicle for 12 h. In both experiments, gene expression was determined as described in Materials and Methods. Normalized mRNA levels are graphically represented in the top panel. Bars represent means ± SEM, n = 3. *, P < 0.05; and **, P < 0.01 vs. control (0 µM or vehicle).

 
Discussion

In rodents, the CL of pregnancy is highly dependent on the action of PRL and PRL-like hormones to hypertrophy and produce progesterone needed for the maintenance of gestation. Accordingly, PRL-R increases during the differentiation from granulosa cell into luteal cell (11) and remains elevated until before parturition. Early binding studies have shown a sharp drop in PRL-R between d 21 and 22 of pregnancy (11). Telleria et al. (6) demonstrated that this loss in PRL binding is most likely due to a decrease in receptor protein subsequent to a sharp fall in mRNA for both forms of the PRL-R. This renders the CL unresponsive to PRL and PRL-like hormones of placental origin. A similar phenomenon also occurs in mice CL, in which receptor expression drops on d 19 and 20, 2 d before parturition (this investigation). However, the factor(s) that causes the drop in luteal PRL-R expression was unknown. Our present findings, obtained with PGF2{alpha}-R knockout mice as well as pregnant rats and luteal cell culture, indicate clearly that PGF2{alpha} inhibits rapidly the expression of both forms of the PRL-R and that the physiological drop in PRL-R expression seen at the end of pregnancy is due to PGF2{alpha}.

This decrease in PRL-R expression may also contribute to the decline in progesterone secretion seen at this time. The fall in progesterone before parturition depends on the expression of the enzyme 20{alpha}HSD (4). We have shown that PGF2{alpha}-induced 20{alpha}HSD expression is at the transcriptional level and is mediated by a rapid stimulation of the transcription factor Nur77. nur77 is an early gene that is rapidly induced; however, its expression is also shut down very quickly. We have observed that, despite the fact that Nur77 expression falls to undetectable levels after 6 h of PGF2{alpha} administration, 20{alpha}HSD expression keeps increasing with time (4). These results and our finding that down-regulation of PRL-R expression precedes the stimulation of 20{alpha}HSD induced by PGF2{alpha} suggested to us that PGF2{alpha} may stimulate 20{alpha}HSD by both inducing Nur77 expression and by preventing PRL signaling in the luteal cells. We thought that Nur77 may be necessary to stimulate rapidly the expression of 20{alpha}HSD but that, once Nur77 expression falls, the decrease in PRL signaling induced by PGF2{alpha} may ensure high levels of 20{alpha}HSD because PRL is a potent inhibitor of 20{alpha}HSD (3). However, our finding that overexpression of PRL-RCA does not prevent the induction of 20{alpha}HSD nor the inhibition of PRL-R expression caused by PGF2{alpha} suggests rather that the effect of PGF2{alpha} on 20{alpha}HSD expression is independent of PRL signaling in luteal cell. In support of this hypothesis is our previous finding that PGF2{alpha} activates 20{alpha}HSD promoter activity in the absence of PRL action (4).

The possibility that PGF2{alpha} may prevent the inhibitory effect of PRL on 20{alpha}HSD by affecting the intracellular signaling of PRL has been proposed (12). It has been demonstrated that an analog of PGF2{alpha}, cloprostenol, increases the expression of the suppressor of cytokine signaling 3, which in turn prevents the activation of signal transducers and activators of transcription 5 (Stat5) transcription factor by PRL. However, it is not yet clear whether Stat5 mediates the inhibitory effect of PRL on 20{alpha}HSD expression.

Although the molecular mechanism by which PGF2{alpha} stimulates 20{alpha}HSD has been investigated in detail (13), that of PGF2{alpha} inhibition of PRL-R expression is not known. PGF2{alpha} was shown to induce the expression of nur77 through a Ca2+-calmodulin-dependent mechanism. The Ca2+-calmodulin complex formed upon PGF2{alpha} treatment causes activation of ERK1/2, which phosphorylates the transcription factor JunD constitutively bound to its cognate binding site in the nur77 gene, increasing its transactivational activity. The Nur77 generated then acts to activate the 20{alpha}HSD gene expression. Whether this pathway is involved in PGF2{alpha}-mediated inhibition of PRL-R appears unlikely because both the time course and responsiveness to PGF2{alpha} differs. Because the expression PRL-R depends on active Stat5 (14), it is possible that the induction of suppressor of cytokine signaling 3 by PGF2{alpha} described by Curlewis et al. (12) causes the decrease in PRL-R expression observed in the present study.

In conclusion, the results of this investigation have revealed that PGF2{alpha} acts on luteal cells to inhibit the expression of the PRL -R and is responsible for the physiological decline in both forms of this receptor that occurs at the end of pregnancy in the CL. The results further suggest that PGF2{alpha}-mediated stimulation of 20{alpha}HSD is independent of PGF2{alpha}-induced inhibition of PRL signaling in luteal cels.

Acknowledgments

We thank Y. Sugimoto and A. Ichikawa for providing ovaries of PGF2{alpha}-R null mice.

Footnotes

This work was supported by NIH Grants HD 11119, U54 HD 40093, and HD12356.

Abbreviations: CL, Corpus luteum; 20{alpha}HSD, 20{alpha}-hydroxysteroid dehydrogenase; LGC, luteinized granulosa cells; PGF2{alpha}, prostaglandin F2{alpha}; PGF2{alpha}-R, PGF2{alpha} receptor; PRL, prolactin; PRLR, PRL receptor; PRL-RCA, constitutively active PRL-R; Stat, signal transducers and activators of transcription.

Received April 4, 2003.

Accepted for publication May 27, 2003.

References

  1. Binart N, Helloco C, Ormandy CJ, Barra J, Clement-Lacroix P, Baran N, Kelly PA 2000 Rescue of preimplantatory egg development and embryo implantation in prolactin receptor-deficient mice after progesterone administration. Endocrinology 141:2691–2697[Abstract/Free Full Text]
  2. Sugimoto Y, Yamasaki A, Segi E, Tsuboi K, Aze Y, Nishimura T, Oida H, Yoshida N, Tanaka T, Katsuyama M, Hasumoto K, Murata T, Hirata M, Ushikubi F, Negishi M, Ichikawa A, Narumiya S 1997 Failure of parturition in mice lacking the prostaglandin F receptor. Science 277:681–683[Abstract/Free Full Text]
  3. Albarracin CT, Parmer TG, Duan WR, Nelson SE, Gibori G 1994 Identification of a major prolactin-regulated protein as 20{alpha}-hydroxysteroid dehydrogenase: coordinate regulation of its activity, protein content, and messenger ribonucleic acid expression. Endocrinology 134:2453–2460[Abstract/Free Full Text]
  4. Stocco CO, Zhong L, Sugimoto Y, Ichikawa A, Lau LF, Gibori G 2000 Prostaglandin F2{alpha} induced expression of 20{alpha}-hydroxysteroid dehydrogenase involves the transcription factor NUR77. J Biol Chem 275:37202–37211[Abstract/Free Full Text]
  5. Stocco C, Calegari E, Gibori G 2001 Opposite effect of prolactin and prostaglandin F2{alpha} on the expression of luteal genes as revealed by rat cDNA expression array. Endocrinology 142:4158–4161[Abstract/Free Full Text]
  6. Telleria CM, Parmer TG, Zhong L, Clarke DL, Albarracin CT, Duan WR, Linzer DI, Gibori G 1997 The different forms of the prolactin receptor in the rat corpus luteum: developmental expression and hormonal regulation in pregnancy. Endocrinology 138:4812–4820[Abstract/Free Full Text]
  7. Zhong L, Parmer TG, Robertson MC, Gibori G 1997 Prolactin-mediated inhibition of 20{alpha}-hydroxysteroid dehydrogenase gene expression and the tyrosine kinase system. Biochem Biophys Res Commun 235:587–592[CrossRef][Medline]
  8. Russell DL, Richards JS 1999 Differentiation-dependent prolactin responsiveness and stat (signal transducers and activators of transcription) signaling in rat ovarian cells. Mol Endocrinol 13:2049–2064[Abstract/Free Full Text]
  9. Frasor J, Barkai U, Zhong L, Fazleabas AT, Gibori G 2001 PRL-induced ER{alpha} gene expression is mediated by Janus kinase 2 (Jak2) while signal transducer and activator of transcription 5b (Stat5b) phosphorylation involves Jak2 and a second tyrosine kinase. Mol Endocrinol 15:1941–1952[Abstract/Free Full Text]
  10. Gourdou I, Gabou L, Paly J, Kermabon AY, Belair L, Djiane J 1996 Development of a constitutively active mutant form of the prolactin receptor, a member of the cytokine receptor family. Mol Endocrinol 10:45–56[Abstract/Free Full Text]
  11. Richards JS, Williams JJ 1976 Luteal cell receptor content for prolactin (PRL) and luteinizing hormone (LH): regulation by LH and PRL. Endocrinology 99:1571–1581[Abstract/Free Full Text]
  12. Curlewis JD, Tam SP, Lau P, Kusters DH, Barclay JL, Anderson ST, Waters MJ 2002 A prostaglandin F {alpha} analog induces suppressors of cytokine signaling-3 expression in the corpus luteum of the pregnant rat: a potential new mechanism in luteolysis. Endocrinology 143:3984–3993[Abstract/Free Full Text]
  13. Stocco CO, Lau LF, Gibori G 2002 A calcium/calmodulin-dependent activation of ERK1/2 mediates JunD phosphorylation and induction of nur77 and 20{alpha}-hsd genes by prostaglandin F2{alpha} in ovarian cells. J Biol Chem 277:3293–3302[Abstract/Free Full Text]
  14. Galsgaard ED, Nielsen JH, Moldrup A 1999 Regulation of prolactin receptor (PRLR) gene expression in insulin-producing cells. Prolactin and growth hormone activate one of the rat prlr gene promoters via STAT5a and STAT5b. J Biol Chem 274:18686–18692[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
ReproductionHome page
B. L Dozier, K. Watanabe, and D. M Duffy
Two pathways for prostaglandin F2{alpha} synthesis by the primate periovulatory follicle
Reproduction, July 1, 2008; 136(1): 53 - 63.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
R. Gonzalez-Fernandez, E. Martinez-Galisteo, F. Gaytan, J. A. Barcena, and J. E. Sanchez-Criado
Changes in the Proteome of Functional and Regressing Corpus Luteum During Pregnancy and Lactation in the Rat
Biol Reprod, July 1, 2008; 79(1): 100 - 114.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
C. Stocco, C. Telleria, and G. Gibori
The Molecular Control of Corpus Luteum Formation, Function, and Regression
Endocr. Rev., February 1, 2007; 28(1): 117 - 149.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
M. B. Hapon, A. B Motta, M. Ezquer, M. Bonafede, and G. A Jahn
Hypothyroidism prolongs corpus luteum function in the pregnant rat
Reproduction, January 1, 2007; 133(1): 197 - 205.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
Z. Cai and C. Stocco
Expression and Regulation of Progestin Membrane Receptors in the Rat Corpus Luteum
Endocrinology, December 1, 2005; 146(12): 5522 - 5532.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
R. P. Piekorz, S. Gingras, A. Hoffmeyer, J. N. Ihle, and Y. Weinstein
Regulation of Progesterone Levels during Pregnancy and Parturition by Signal Transducer and Activator of Transcription 5 and 20{alpha}-Hydroxysteroid Dehydrogenase
Mol. Endocrinol., February 1, 2005; 19(2): 431 - 440.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Stocco, C.
Right arrow Articles by Gibori, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Stocco, C.
Right arrow Articles by Gibori, G.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals