help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology, doi:10.1210/en.2002-0118
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Xu, L.
Right arrow Articles by Dahlman-Wright, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Xu, L.
Right arrow Articles by Dahlman-Wright, K.
Endocrinology Vol. 144, No. 8 3541-3546
Copyright © 2003 by The Endocrine Society

Human Estrogen Receptor ß 548 Is Not a Common Variant in Three Distinct Populations

Li Xu, Qiang Pan-Hammarström, Asta Försti, Kari Hemminki, Lennart Hammarström, Damian Labuda, Jan-Åke Gustafsson and Karin Dahlman-Wright

Karolinska Institute (L.X., Q.P.-H., A.F., K.H., L.H., J.-Å.G., K.D.-W.), Department of Biosciences at Novum, SE-14157 Huddinge, Sweden; Centre de Recherche (D.L.), Hôpital Sainte-Justine, Département de Pédiatrie, Université de Montréal, Québec, Canada H3T 1C5; and Division of Molecular Genetic Epidemiology (K.H.), German Cancer Research Center, Heidelberg D-69120, Germany

Address all correspondence and requests for reprints to: Karin Dahlman-Wright, Center for Biotechnology, Novum, Karolinska Institute, SE-141 57 Huddinge, Sweden. E-mail: kada{at}cbt.ki.se


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Several isoforms of estrogen receptor (ER) ß (also known as NR3A2) have been reported, including variants with different N-terminal ends. In rodents, two in-frame initiation codons (ATGs) are used to produce proteins of 530 and 549 amino acids, respectively. In humans, the upstream ATG is out of frame in all clones reported, until recently, when human clones with an extra A-T base pair placing the upstream ATG in frame were reported. The authors suggested that this could represent a novel polymorphism in the ERß gene. Because human ERß548 (hERß548) and hERß530 display different functional characteristics in vitro, it is of interest to determine if this variant constitutes a polymorphism in human populations. We therefore determined the frequency of this novel isoform in several populations including African (n = 96), Caucasian (n = 100), and Asian (n = 128) subjects using denaturing HPLC. We did not detect any alleles that correspond to hERß548 in these samples or in additional samples of heterogeneous origin. It is concluded that hERß548 is not a common variant in Africans, Caucasians, or Asians.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
MOST OF THE effects of estrogen are mediated by estrogen receptors (ERs). ERs belong to the steroid hormone receptor gene superfamily of ligand-activated transcription factors.

For many years, one ER was thought to mediate all cellular effects of estrogen. This receptor is now referred to as ER{alpha} (NR3A1). However, in 1995 another ER, named ERß (NR3A2), was cloned from rat prostate (1). Several isoforms of ERß have subsequently been reported, including variants with differing N-terminal ends. The ERß gene cloned from rat prostate (1) encodes a protein of 485 amino acids. Three years later, a rat prostate ERß cDNA sequence was submitted to GenBank, which differs from the initial sequence by the addition of one nucleotide upstream of the start codon. The extra nucleotide removes the in-frame stop codon upstream of the start codon initially reported (1), resulting in a cDNA that encodes 64 additional amino acids at the N terminus (2). This form is now referred to as rERß549 and is considered to be the long form or full-length rodent ERß.

The first human ERß (hERß) cloned encompassed 477 amino acids (3). The N terminus of hERß has since then been extended. Ogawa et al. (4) cloned a longer hERß that has been considered as the full-length ERß, consisting of 530 amino acids, hERß530. There is an initiation codon (ATG) at a similar position in human clones as that encoding the full-length rodent rERß549 (Fig. 1Go, A and B). However, in all human clones originally reported, this ATG is out of frame with the rest of the coding sequence.



View larger version (21K):
[in this window]
[in a new window]
  		FIG. 1. Nucleotide and deduced amino acid sequences of the N-terminal region of hERß. The amino acids sequence is given in the one letter code. A, The sequence that encodes hERß530. The upstream ATG is out of frame with the rest of the coding region. The GenBank accession no. is AB006590. B, The sequence that encodes full-length mouse ERß549. The additional 19 amino acids that are specific to mERß549 are underlined. The GenBank accession no. is AF067422. C, The sequence that encodes hERß548. The extra A that places the upstream ATG in frame with the rest of the coding sequence is marked by *. The additional 18 amino acids that are specific to hERß548 are underlined. The GenBank accession no. is AX029400.

 
Recently, an N-terminally extended hERß variant, corresponding to hERß548, was cloned from human testis cDNA and genomic DNA (5). An additional A-T base pair shifts the out of frame ATG to be in frame (Fig 1CGo). In the following, the allele representing the extra A-T base pair and expected to encode hERß548, is referred to as the +A allele. Interestingly, hERß548 appears more robust than hERß530 with regard to transcriptional activation via an estrogen response element in response to 17ß-estradiol. Furthermore, both tamoxifen and raloxifen showed significant agonist activity via hERß548, which was not observed via hERß530. The authors suggested that this extra nucleotide might represent a polymorphism. If this is true, it is of obvious interest to determine the frequency of hERß548 in different populations.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Samples
Blood samples were taken from blood donors for the following population groups: Africans (n = 96, Gambian, from Banjul) and Asians (n = 128 Han Chinese, from Beijing). The Caucasian samples were from Finland (n = 100, which included 50 breast cancer patients).

Information for additional samples analyzed from diverse origins is shown in Table 1Go. Studies were approved by ethical committees.


View this table:
[in this window]
[in a new window]
  		TABLE 1. Wave Fragment Analysis System analysis of diverse-origin samples that were negative for hERß548

 
PCR
Primer ERß-5' untranslated region (UTR) 5': TTATACTTGCCCACGAATCTTT and primer ERß-5'UTR3': CTTGCTTCACACCAGGGACTCT were used to amplify part of hERß exon 1. PCR amplifications were performed in a total volume of 25 µl containing 250 µM deoxynucleotide triphosphates, 10–50 ng of template DNA, 0.5 µM each of primers, 1.25 U AmpliTaq Gold DNA polymerase (PE Applied Biosystems, Foster City, CA), in 1x reaction buffer [10 mM Tris HCl (pH 8.3); 50 mM KCl; and 2.5 mM MgCl2]. PCR amplification was carried out at 94 C for 10 min and then cycled 35 times at 94 C for 30 sec, 57 C for 30 sec and 72 C for 45 sec, followed by 10 min at 72 C.

Generation of an artificial hERß548 clone
A standard ERß530 plasmid contains the 5'UTR where the ATG encoding hERß548 is out of frame. An artificial hERß548 plasmid that has the reported extra nucleotide of the ERß gene that generates hERß548 (Ref. 5 ; and Fig. 2BGo) was created from the standard hERß530 plasmid using the QuikChange XL Site-Directed mutagenesis kit (Stratagene, La Jolla, CA). The sequences of these two clones were confirmed by DNA sequencing. DNA fragments amplified by PCR (using the same pair of primers as used in amplifying genomic DNA) from these plasmids served as controls throughout the experiments and are named hERß530st and hERß548art, respectively. The sequences of these PCR products were confirmed by DNA sequencing.



View larger version (33K):
[in this window]
[in a new window]
  		FIG. 2. DNA sequence flanking the artificial extra A nucleotide producing the + A allele. A, Sequence of hERß530st. B, Sequence of hERß548art, which was created by mutagenesis. The artificially inserted A (boxed) is indicated by an arrow.

 
Denaturing HPLC (DHPLC)
Samples were denatured at 95 C and then cooled to 25 C over 45 min to enable the formation of heteroduplexes. Samples were analyzed with DHPLC using a Wave Fragment Analysis System (Transgenomics, Omaha, NE) and DNASep Column as described (6) using the suggested temperature 58 C.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Generation of an artificial clone encoding hERß548
hERß530 has been considered to be the full-length hERß. The sequences of the N-terminal region of the hERß gene including that generating the recently reported hERß548 are shown in Fig. 1Go. The sequence of a plasmid encoding hERß530 is shown in Fig. 2AGo. This plasmid and subsequent PCR products generated from it are referred to as hERß530st. An artificial plasmid encoding hERß548 was generated including the extra A-T base pair as reported (5). This plasmid and subsequent PCR products generated from it are referred to as hERß548art.

Validation of DHPLC for detection of the +A allele
DHPLC is based on the differential adsorption of homo- and hetero-duplexes to a hydrophobic matrix on a chromatographic column. Amplified products with a mismatch will form hetero-duplexes that have decreased interaction with the matrix and will be eluted earlier than the normal homo-duplexes. Figure 3Go shows that the +A allele can be detected with DHPLC using the employed conditions. To detect possible homozygotes for the +A allele, PCR products from analyzed individuals were mixed with the hERß530st. To detect heterozygotes for the +A allele, samples were analyzed without mixing. The sensitivity of DHPLC in detecting the presence of an extra nucleotide was evaluated with PCR fragments derived from hERß 530st and hERß 548art, respectively. When the amounts of hERß530st and hERß548art differ less than 10-fold, the +A allele can be detected (Fig. 3Go). This shows that it is not absolutely critical for the analysis that the amounts of target and hERß530st PCR products, respectively, are identical.



View larger version (30K):
[in this window]
[in a new window]
  		FIG. 3. DHPLC profiles obtained from a wide range of ratios between ERß530st and ERß548art. When the ratio is no less than 1:10, the heteroduplex peak could be detected.

 
Screening of genomic DNA from different populations
In total, 96, 100, and 128 DNA samples from African, Caucasian, and Asian subjects, respectively, were screened by DHPLC. Figure 4AGo shows, from the top, representative DHPLC profiles obtained from analysis of genomic DNA from Caucasian (n = 100), African (n = 96), and Asian (n = 128) populations, analyzed after mixing with hERß530st. Similar profiles were obtained when samples were analyzed without prior mixing with hERß530st. No heteroduplex peak, indicative of the presence of hERß548art, could be identified in any of the samples. The presence of hERß548 would have been seen as a heterduplex as shown in Fig. 4BGo where the samples were mixed with hERß548art. This figure also shows that the hERß530 variant can be detected in these samples.



View larger version (20K):
[in this window]
[in a new window]
  		FIG. 4. A, Shows, from the top, representative DHPLC profiles obtained from analysis of genomic DNA from Caucasian (n = 100), African (n = 96) and Asian (n = 128) populations. No heteroduplex peak was found. B, Shows that the hERß530 can be detected in this assay by mixing with hERß548art. Shown is one representative analysis of 12.

 
In addition, we have also screened a number of additional samples for the hERß548 variant. These data are summarized in Table 1Go. We have analyzed genomic DNA from individuals from a very diverse geographical sampling and from individuals with syndromes related to infertility. cDNA has been analyzed from breast cancer patients and from a commercial source. We did not identify hERß548 in these samples.

From these results, we conclude that the human 548-amino-acid ERß does not represent a common allele.


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
Knowing that a single gene might generate several protein products, researchers need to address an additional level of complexity in understanding the function of any gene and its encoded protein product. The ERß gene is an example of a gene from which several protein products are derived. This occurs through alternative RNA splicing (7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19) or through the utilization of different translation start codons in the 5' flanking region, generating several N-terminally variable ERß proteins. In this report, we focus on the frequency of the recently reported hERß 548 isoform (5). We developed a DHPLC assay for screening of the +A allele and showed that it was robust with regard to detection of samples heterozygous and homozygous for the +A allele. This report focuses on the screening of samples from 128 Asian, 96 African, and 100 Caucasian individuals for the +A allele encoding hERß 548. Notably and surprisingly, we did not identify any single allele corresponding to the +A allele. Moreover, analysis of further samples of different origin did not reveal a single + A allele. The reason why we did not detect hERß548 in human testis Marathon-ready cDNA (CLONTECH Laboratories, Inc., Palo Alto, CA), where it was identified in Ref. 5 , is presently unclear. The lot number is not indicated in Ref. 5 . Without knowledge about the lot number, CLONTECH Laboratories, Inc. cannot track if the lots are derived from identical RNA sources (information from CLONTECH Laboratories, Inc.).

In this paper, we demonstrate that a potential polymorphic ERß variant encoding hERß548 is, if it at all exists, a rare variant in African, Caucasian, and Asian populations. However, there is still the interesting possibility that this allele could exist in special populations and/or that it could be specifically associated with certain syndromes.


   Acknowledgments
 
We greatly appreciate the contributions of Xiaolei Zhou at the Centre for Molecular Medicine, Karolinska Institute, for technical support and advice on DHPLC. We thank Shujing Dai, Maria Nilsson, Yaofeng Zhao, and Chunyan Zhao at the Department of Biosciences, Karolinska Institute, for technical support and suggestions.


   Footnotes
 
Abbreviations: DHPLC, Denaturing HPLC; hERß, human ERß; UTR, untranslated region.

Received December 9, 2002.

Accepted for publication April 14, 2003.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Kuiper GG, Enmark E, Pelto-Huikko M, Nilsson S, Gustafsson JA 1996 Cloning of a novel receptor expressed in rat prostate and ovary. Proc Natl Acad Sci USA 93:5925–5930[Abstract/Free Full Text]
  2. Leygue E, Dotzlaw H, Lu B, Glor C, Watson PH, Murphy LC 1998 Estrogen receptor ß: mine is longer than yours? J Clin Endocrinol Metab 83:3754–3755[Free Full Text]
  3. Mosselman S, Polman J, Dijkema R 1996 ER ß: identification and characterization of a novel human estrogen receptor. FEBS Lett 392:49–53[CrossRef][Medline]
  4. Ogawa S, Inoue S, Watanabe T, Hiroi H, Orimo A, Hosoi T, Ouchi Y, Muramatsu M 1998 The complete primary structure of human estrogen receptor ß (hER ß) and its heterodimerization with ER {alpha} in vivo and in vitro. Biochem Biophys Res Commun 243:122–126[CrossRef][Medline]
  5. Wilkinson HA, Dahllund J, Liu H, Yudkovitz J, Cai SJ, Nilsson S, Schaeffer JM, Mitra SW 2002 Identification and characterization of a functionally distinct form of human estrogen receptor ß. Endocrinology 143:1558–1561[Abstract]
  6. Kuklin A, Davis AP, Hecker KH, Gjerde DT, Taylor PD 1999 A novel technique for rapid automated genotyping of DNA polymorphisms in the mouse. Mol Cell Probes 13:239–242[CrossRef][Medline]
  7. Moore JT, McKee DD, Slentz-Kesler K, Moore LB, Jones SA, Horne EL, Su JL, Kliewer SA, Lehmann JM, Willson TM 1998 Cloning and characterization of human estrogen receptor ß isoforms. Biochem Biophys Res Commun 247:75–78[CrossRef][Medline]
  8. Shupnik MA, Pitt LK, Soh AY, Anderson A, Lopes MB, Laws Jr ER 1998 Selective expression of estrogen receptor {alpha} and ß isoforms in human pituitary tumors. J Clin Endocrinol Metab 83:3965–3972[Abstract/Free Full Text]
  9. Lu B, Leygue E, Dotzlaw H, Murphy LJ, Murphy LC, Watson PH 1998 Estrogen receptor-ß mRNA variants in human and murine tissues. Mol Cell Endocrinol 138:199–203[CrossRef][Medline]
  10. Campbell-Thompson M, Lynch IJ, Bhardwaj B 2001 Expression of estrogen receptor (ER) subtypes and ERß isoforms in colon cancer. Cancer Res 61:632–640[Abstract/Free Full Text]
  11. Chu S, Fuller PJ 1997 Identification of a splice variant of the rat estrogen receptor ß gene. Mol Cell Endocrinol 132:195–199[CrossRef][Medline]
  12. Hanstein B, Liu H, Yancisin MC, Brown M 1999 Functional analysis of a novel estrogen receptor-ß isoform. Mol Endocrinol 13:129–137[Abstract/Free Full Text]
  13. Lu B, Leygue E, Dotzlaw H, Murphy LJ, Murphy LC 2000 Functional characteristics of a novel murine estrogen receptor-ß isoform, estrogen receptor-ß 2. J Mol Endocrinol 25:229–242[Abstract]
  14. Leygue E, Dotzlaw H, Watson PH, Murphy LC 1999 Expression of estrogen receptor ß1, ß2, and ß5 messenger RNAs in human breast tissue. Cancer Res 59:1175–1179[Abstract/Free Full Text]
  15. Inoue S, Ogawa S, Horie K, Hoshino S, Goto W, Hosoi T, Tsutsumi O, Muramatsu M, Ouchi Y 2000 An estrogen receptor ß isoform that lacks exon 5 has dominant negative activity on both ER{alpha} and ERß. Biochem Biophys Res Commun 279:814–819[CrossRef][Medline]
  16. Iwao K, Miyoshi Y, Egawa C, Ikeda N, Noguchi S 2000 Quantitative analysis of estrogen receptor-ß mRNA and its variants in human breast cancers. Int J Cancer 88:733–736[CrossRef][Medline]
  17. Speirs V, Adams IP, Walton DS, Atkin SL 2000 Identification of wild-type and exon 5 deletion variants of estrogen receptor ß in normal human mammary gland. J Clin Endocrinol Metab 85:1601–1605[Abstract/Free Full Text]
  18. Price Jr RH, Handa RJ 2000 Expression of estrogen receptor-ß protein and mRNA in the cerebellum of the rat. Neurosci Lett 288:115–118[CrossRef][Medline]
  19. Fujimura T, Takahashi S, Urano T, Ogawa S, Ouchi Y, Kitamura T, Muramatsu M, Inoue S 2001 Differential expression of estrogen receptor ß (ERß) and its C-terminal truncated splice variant ERßcx as prognostic predictors in human prostatic cancer. Biochem Biophys Res Commun 289:692–699[CrossRef][Medline]



This article has been cited by other articles:


Home page
 Endocr Relat CancerHome page
S. Rice and S. A Whitehead
Phytoestrogens and breast cancer -promoters or protectors?
Endocr. Relat. Cancer, December 1, 2006; 13(4): 995 - 1015.
[Abstract] [Full Text] [PDF]

Home page
 Pharmacol. Rev.Home page
K. Dahlman-Wright, V. Cavailles, S. A. Fuqua, V. C. Jordan, J. A. Katzenellenbogen, K. S. Korach, A. Maggi, M. Muramatsu, M. G. Parker, and J.-A. Gustafsson
International Union of Pharmacology. LXIV. Estrogen Receptors
Pharmacol. Rev., December 1, 2006; 58(4): 773 - 781.
[Full Text] [PDF]

Home page
 EndocrinologyHome page
T. L. Ramsey, K. E. Risinger, S. C. Jernigan, K. A. Mattingly, and C. M. Klinge
Estrogen Receptor {beta} Isoforms Exhibit Differences in Ligand-Activated Transcriptional Activity in an Estrogen Response Element Sequence-Dependent Manner
Endocrinology, January 1, 2004; 145(1): 149 - 160.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Interv.Home page
J. Matthews and J.-A. Gustafsson
Estrogen Signaling: A Subtle Balance Between ER{alpha} and ER{beta}
Mol. Interv., August 1, 2003; 3(5): 281 - 292.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Xu, L.
Right arrow Articles by Dahlman-Wright, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Xu, L.
Right arrow Articles by Dahlman-Wright, K.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals