| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Cedars-Sinai Medical Center-University of California, Los Angeles School of Medicine, Los Angeles, California 90048
Address all correspondence and requests for reprints to: Vera Chesnokova, Ph.D., Department of Medicine, Division of Endocrinology, Davis Building, Room 3019, Cedars-Sinai Medical Center, 8700 Beverly Boulevard, Los Angeles, California 90048. E-mail: chesnokovav{at}cshs.org.
| Abstract |
|---|
|
|
|---|
, IL-1ß, and IL-6 activation observed in the hypothalamus and pituitary of these animals. Our results suggest that increased central proinflammatory cytokine expression can compensate for the impaired HPA axis function and activates inflammatory ACTH and corticosterone responses in mice-deficient in both CRH and LIF. | Introduction |
|---|
|
|
|---|
Almost all proinflammatory cytokines stimulate the HPA axis in vivo (3) and proopiomelanocortin (POMC) expression in vitro (4). HPA stimulation occurs either at the hypothalamic level (IL-1ß, TNF
), inducing CRH gene expression and CRH release, or at the level of pituitary corticotrophs. IL-2, interferons, and the gp130 cytokine family participate in ACTH regulation and mediate the immunoneuroendocrine interface (3, 5, 6). In addition to CRH, inflammatory cytokines also trigger central ACTH secretagogues such as noradrenaline (7), pituitary adenylate cyclase-activating polypeptide (PACAP) (8), vasopressin (9), and other cytokines (10). Proinflammatory cytokines may impair feedback regulation of the HPA axis by attenuating glucocorticoid receptor function (11, 12, 13). By stimulating the HPA axis and release of antiinflammatory glucocorticoids, cytokines can antagonize their own proinflammatory action.
Pituitary corticotroph POMC gene expression is regulated by CRH as well as gp130 receptor cytokine family comprised of IL-6, leukemia inhibitory factor (LIF), oncostatin M, IL-11, ciliary neurotrophic factor, and cardiotropin 1 (2, 5, 6). Although CRH action is mediated by a cAMP-dependent pathway, effects of gp130 cytokines are mediated by the Janus kinase (Jak)-signal transducer and activator of transcription (STAT) signaling cascade. Synergistic cross-talk of different signaling cascades enables the HPA axis to respond rapidly to inflammatory and stress stimuli (14, 15). gp 130 cytokines activate the HPA axis even in the absence of CRH. Mice deficient in CRH (CRHKO) demonstrate impaired glucocorticoid production in response to psychological and metabolic challenges but have near-normal responses to stressors that activate the immune system (16, 17). gp130 Cytokine IL-6 produced by adrenals was found to compensate for CRH deficiency in the inflammatory response (18) and food intake (19) in these animals.
Another gp130 cytokine, LIF, has diverse pleiotropic actions regulating metabolism, growth, differentiation (20, 21), and neuronal responses to injury (10), and LIF administration prevents oligodendrocyte death in animal models of multiple sclerosis (22). LIF and LIF receptors are constitutively expressed in human pituitary cells (23) and in murine hypothalamus and pituitary (5). LIF regulates differentiation and development of murine pituitary corticotrophs early in ontogenesis (24), potently induces POMC gene transcription and ACTH secretion (14, 23, 25) and potentiates CRH induction of POMC gene expression (26, 27). In vivo, LIF is highly induced in the hypothalamus and pituitary in response to inflammation (28, 29, 30). LIF-deficient mice (LIFKO) demonstrate low pituitary POMC mRNA levels and low induction of ACTH and corticosterone responses to stress (29, 31, 32). Thus, LIF, along with CRH, enhances POMC expression and ACTH secretion in response to psychological and inflammatory challenge (32, 33).
To further demarcate specific roles for both CRH and LIF in mediating the HPA axis function, double-knockout mice (CRH/LIFKO) were generated by breeding null mutants for each respective single gene. The goal of the present study was to unravel central molecular and physiological mechanisms substituting for the impaired HPA axis inflammatory response in CRH- and LIF-deficient mice. The ip injection of low doses of lipopolysaccharide (LPS) (1 µg/mouse) to double CRH/LIF-deficient animals elicits pituitary POMC induction similar to those observed in wild-type (WT) mice and markedly higher than in single null animals (P < 0.0.01). Double-knockout mice also demonstrate robust corticosterone responses to inflammatory challenge. The results suggest that high POMC mRNA levels may be a consequence of abundant TNF
, IL-1ß, and IL-6 activation observed in the hypothalamus and pituitary of these animals. Increased central proinflammatory cytokine expression could therefore substitute for the impaired HPA axis function and activate inflammatory ACTH and corticosterone responses in mice deficient in both CRH and LIF.
| Materials and Methods |
|---|
|
|
|---|
CRH knockout animals were a gift from Dr. Joseph Majzoub (Childrens Hospital, Boston, MA). These animals were originally created on B6129Sv genetic background. Before using these mice, they were backcrossed twice onto parental C57Bl/6 genotype. As a result of this backcross, animals carried approximately 87.5% of C57Bl/6 genotype.
CRH knockout females and LIF knockout males were then crossbred to generate CRH+/-LIF+/- mice, which were used as parents for future breeding. All mice used in the present studies: CRH-/-LIF-/- (CRH/LIFKO), CRH-/-LIF+/+ (CRHKO), and CRH+/+LIF-/- (LIFKO) and CRH+/+LIF+/+ (WT) were obtained by breeding CRH+/- LIF+/- females and males and had the same genetic background. The ratios of double-knockout mice in embryogenesis corresponded to expected Mendelian ratios; however, the percentage of surviving newborn pups was lower (1.5 vs. 6.25%). The double-knockout pups are frail and often cannibalized by mothers at birth. After PCR analysis of tail tissue, CRHKO, LIFKO, and CRH/LIFKO animals were sex and age matched with WT littermates. Females aged 814 wk were used for study. All experimental procedures were approved by the Institutional Animal Care and Use Committee.
LPS treatment
Inflammation was induced by ip injection of 1 µg LPS (from Escherichia coli, Sigma, St. Louis, MO) in 200 µl normal saline. Animals were killed 4 h after injection.
Blood collection
Whole blood was obtained immediately after decapitation and plasma collected in ice-chilled tubes containing 0.1% EDTA, separated, and stored at -70 C until assayed. Plasma ACTH (Nichols Institute Diagnostics, San Juan Capistrano, CA) and plasma corticosterone (ICN Biomedicals, Inc., Costa Mesa, CA) were measured by commercially available RIAs. Sensitivity of ACTH and corticosterone assay is 10 pg/ml and 25 ng/ml, respectively. Inter- and intraassay variability for ACTH was 7.3 and 3.1%, respectively; inter- and intraassay variability for corticosterone was 4.4 and 6.5%, respectively.
IL-6 was assayed by mouse ELISA kit (Assay Designs, Inc., Ann Arbor, MI) according to the manufacturers protocol.
Tissue dissection and RNA isolation
Mice were decapitated, pituitary and hypothalamus dissected, and tissue immediately frozen on dry ice and kept at -70 C until RNA extraction. Total tissue RNA was extracted with Trizol reagent (GIBCO BRL, Gaithersburg, MD) according to manufacturer instructions, in which 5100 mg frozen tissue were immersed in 1 ml Trizol solution and homogenized with a Polytron homogenizer, dissolved in diethylpyrocarbonated water, and RNA concentration spectrometrically quantitated and quality checked by gel electrophoresis.
Quantitative RT-PCR
Before processing, RNA samples were treated with DNase I (DNA-free DNase treatment and removal reagents, Ambion, Austin, TX) to eliminate possible genomic DNA contamination. Total RNA (2.5 µg) was reverse transcribed into first-strand cDNA using SuperScript preamplification system (Life Technologies, Inc., Gaithersburg, MD) and random hexamers according to the manufacturers protocol. For each new batch of cDNA, a control sample containing no reverse transcriptase was performed (-RT control). Subsequent PCRs were performed using thermal iCycler with optical module (Bio-Rad Laboratories, Hercules, CA). Fluorescent reporter dye SYBR Green I (Molecular Probes, Eugene, OR) was used to monitor the PCR in real time. SYBR Green I has a high sensitivity for detecting double-strand DNA; however, it does not discriminate between specific PCR product and nonspecific double-strand DNA. To control for this problem, several steps were performed: 1) For each primer pair, optimal concentrations of MgCl2 and optimal annealing temperatures were first obtained; 2) the PCR product size was checked by gel electrophoresis; 3) PCR product melting temperature (Tm) was empirically determined; 4) reading fluorescence was performed for 25 sec at 2 C below the Tm of the corresponding PCR product. At this temperature all primer dimers and all shorter nonspecific products are melted and hence do not contribute to fluorescence.
Primers used in this study were: 18S forward, AAACGGCTACCACATCCAAG, 18S reverse, CCTCCAATGGATCCTGGTTA (amplicon size 155 bp, Tm 88 C); IL-1ß forward, CAACCAACAAGTGATATTCTCCATG, IL-1ß reverse, GATCCACACTCTCCAGCTGCA [amplicon size 152 bp, Tm 87 C, (33)]; IL-6 forward, GGAGAGGAGACTTCACAG, IL-6 reverse, GCCATTGCACAACTCTTTTC (amplicon size 125 bp, Tm 85 C); TNF
forward, CATCTTCTCAAAATTCGAGTGACAA, TNF
reverse, TGGGAGTAGACAAGGTACAACCC [amplicon size 175 bp, Tm 91 C (33)]; and POMC forward, CATTAGGCTTGGAGCAGGTC, POMC reverse, TCTTGATGATGGCGTTCTTG (amplicon size 174 bp, Tm 87 C).
PCRs were performed in 25 µl volume: 0.4 µM of each gene-specific primer, MgCl2 (1.54.5 mM), 0.2 mM of dNTP mix, 1.25U of HotStar Taq Polymerase (Qiagen, Valencia, CA), 11.5 x SYBR Green I and 5 µl of diluted cDNA or standards. Experimental samples were run in quadruplicate or triplicate. In addition, for each experimental plate standard, -RT and (-)cDNA were run in triplicate. For POMC, TNF
, IL-1ß, IL-6, standards were generated using serial dilutions of purified DNA amplicon. Ten-fold serial dilutions of control cDNA were used for 18S standard curves. Slopes of all standard curves ranged between -3.49 and -2.80. The relative quantification of each gene in experimental samples was determined from the corresponding standard curve and normalized to 18S. Levels of each gene mRNA are presented as arbitrary units relative to WT untreated control taken as one.
Northern blot analysis
Northern analysis of pituitary LIF and suppressor of cytokine signaling (SOCS) 3 expression was performed as described (29, 30) using 20 µg total pituitary RNA/lane.
Statistical analysis
Data were analyzed using ANOVA followed by nonparametric t test (Mann-Whitney U test) or t test. All data are presented as mean ± SE. P < 0.05 was considered significant.
| Results |
|---|
|
|
|---|
Pituitary POMC expression showed that baseline POMC levels were lower in all untreated single and double-knockout animals (P < 0.05), compared with WT littermates. Four hours after LPS injection, POMC expression was induced 2-fold in WT animals (P < 0.05). In LIFKO and CRHKO mice, no changes in POMC abundance were observed, whereas in double CRH/LIFKO animals, POMC mRNA levels increased about 4-fold from the baseline (P < 0.01) (Fig. 1
). These results show that simultaneous CRH /LIF deficiency results in reinforced pituitary POMC induction in response to inflammation.
|
|
Hypothalamic cytokines
Hypothalamus and pituitary proinflammatory cytokines induced in the course of inflammation may trigger HPA axis inflammatory responses. Hypothalamic TNF
, IL-1ß and IL-6 gene expression were analyzed by real-time PCR after endotoxin inoculation. No genotype differences were observed in baseline hypothalamic TNF
expression. After LPS stimulation TNF
mRNA levels were induced in all experimental animals: up to 4 ± 0.3 in WT, 5 ± 0.9 in LIFKO, and 3 ± 0.3 in CRHKO with highest levels (14 ± 0.22) in double CRH/LIFKO mice. Baseline IL-1ß mRNA levels were lower in CRHKO and double CRH/LIFKO animals, compared with WT and LIFKO mice. These genotypes have a higher degree of IL-1ß stimulation: In CRHKO mice IL-1ß was induced up to 10 ± 1.9 (P < 0.05 vs. WT and LIFKO), whereas in double-KO animals, this cytokine expression reached 124 ± 19.5 (P < 0.001 vs. other genotypes). IL-6 baseline levels were about 10 times higher in CRHKO mice, compared with other groups. Although stimulated IL-6 levels were also highest in this group, the net increase of IL-6 (from 10 ± 1.6 to 31 ± 1.53) was lower than in WT (from 1 ± 0.07 to 13 ± 0.55) and did not differ from that observed in LIFKO and double CRH/LIFKO mice (Fig. 3
).
|
expression was elevated in all single and double null genotypes (P < 0.05) and was further up-regulated by LPS treatment, with highest levels observed in LIFKO (25 ± 4.9) and double CRH/LIFKO (35 ± 1.8) animals (for both, P < 0.01 vs. WT and CRHKO). Pituitary baseline IL-1ß expression did not differ in four genotypes and was induced after inflammatory challenge. Double CRH/LIFKO mice showed the highest increase in IL-1ß mRNA levels during inflammation (from 0.9 ± 0.3 to 40 ± 4.3, P < 0.001). Baseline IL-6 expression was elevated in comparison with WT in LIFKO (6 ± 0.4) and CRHKO (4 ± 0.6) (P < 0.05 for both), with highest levels observed in double CRH/LIFKO animals (30 ± 10.3, P < 0.01). LPS caused marked IL-6 mRNA increases in all genotypes, although in knockout animals this increase was more pronounced. All null groups differed significantly from WT animals (P < 0.01) (Fig. 4
|
|
|
| Discussion |
|---|
|
|
|---|
LIFKO, CRHKO, and double CRH/LIFKO mice all exhibited a decreased baseline pituitary POMC mRNA levels. No significant differences in pituitary POMC mRNA levels were previously observed between CRHKO and WT mice (34). The contrast between these results may be attributed to more sensitive real-time PCR technique used in this study. Low baseline plasma ACTH and corticosterone levels in all mutant mice mirror decreased pituitary POMC expression in these animals.
Along with CRH, hypothalamic arginine vasopressin (AVP) is a potent inducer of pituitary POMC expression and ACTH release. Recent findings (35, 36) demonstrated that AVP might be stimulated by cytokines and LPS treatment. It was shown that excessive AVP expression was partly responsible for the increased susceptibility to inflammation in Lewis rats (37). However, we did not observe any differences in hypothalamic AVP mRNA levels in both intact and LPS injected mice of all genotypes studied (data not shown). Also, no differences were found between genotypes in the expression of hypothalamic PACAP, another potent ACTH secretagogue (data not shown). Thus, neither AVP nor PACAP could substitute for CRH and LIF deficiency in double-knockout mice.
Proinflammatory cytokines are proved to be strong activators of the HPA axis (2, 3). Therefore, we investigated pattern of proinflammatory cytokine expression in hypothalamus and pituitary of CRH/LIFKO mice. In all studied genotypes, hypothalamic TNF
and IL-1ß mRNA levels were up-regulated in response to inflammatory stress with strongest induction observed in double CRH/LIFKO (P < 0.01). In contrast, the IL-6 increase was higher in WT and CRHKO mice. In CRH-deficient animals, both baseline and stimulated hypothalamic IL-6 mRNA levels were elevated, in agreement with observed compensatory increase of plasma IL-6 in these mice (18, 19). However, in our experiments the fold-induction of hypothalamic IL-6 in CRHKO animals was lower than in WT mice and did not differ from other knockout genotypes.
Very high levels of TNF
and IL-1ß mRNA were observed in the pituitary of double-knockout mice in response to LPS treatment. Signal transduction pathways for both TNF
and IL-1ß include activation of transcription factor nuclear factor
B (NF
B) (38). It is reasonable to assume that in pituicytes of double-knockout animals, NF
B-dependent transcription is stimulated to the larger extent than in single mutants or WT mice. The results suggest that excessive hypothalamic and pituitary TNF
and IL-1ß production might affect pituitary POMC expression. In addition, pituitary IL-6 is highly elevated in all knockout genotypes. Corticotroph cell signaling pathway for the IL-6 cytokine family involves heterodimerization between cytokine receptor and gp130 receptor subunits with subsequent Jak/STAT pathway activation (5, 6), stimulation of POMC transcription (39), and induction of SOCS 3 (39, 40, 41). Earlier we demonstrated that pituitary SOCS 3 was triggered by gp130 proinflammatory cytokines in vivo (29, 30, 42). Thus, SOCS 3 represents a reliable indicator of Jak/STAT pathway activity. The highest level of SOCS 3 expression in double-knockout animals mirrors the highest net activation of Jak/Stat signaling pathway stimulated by IL-6 and other gp130 cytokines.
The specific roles for CRH and LIF in regulating the HPA axis are under investigation. Recent studies demonstrated that central CRH appeared to be more critical in mediating ACTH release in response to shock or alcohol than to LPS treatment (43). Data showing that CRHKO animals have nearly normal HPA axis reaction to inflammatory challenge support this hypothesis (18). At the same time, animals with LIF deficiency have markedly lower POMC and ACTH responses to inflammation induced by turpentine (29) and high dose of LPS (50 µg/mouse) (30), and exogenous LIF injection restores pituitary POMC expression in LIFKO animals (29). In vitro studies show that LIF greatly potentiates the effects of CRH on POMC transcription (26). Although CRH is indispensable for rapid increase of pituitary POMC expression and ACTH release in response to any nonspecific stressful challenge, LIF plays an important role in maintaining a sustained activation of the HPA axis during inflammatory process. Thus, we expected CRH/LIF-deficient animals to demonstrate even lower HPA activity than was observed in single mutant mice. The fact that these animals still have a robust POMC, ACTH, and corticosterone responses to inflammation indicate that in the absence of both CRH and LIF, other mechanisms are coming to play. Despite less potency in stimulating the HPA axis inflammatory response, CRH may still restrict inflammatory process. Blocking peripheral CRHR1 and CRHR2 enhances TNF
and IL-6 release after LPS injection (43), indicating the suppressive effects of CRH on cytokine synthesis. It is conceivable that hypothalamic CRH may have the same effect on central cytokine expression inhibiting TNF-dependent NF
B signaling pathway. Thus, CRH deficiency may trigger central cytokine production. During inflammation TNF
is first induced (44) and then turns on IL-1ß (45, 46) and IL-6 (47). In turn, LIF stimulated by the inflammatory agent inhibits TNF
expression and synthesis in vivo and in vitro (48, 49). CRH-null mice show elevated pituitary LIF mRNA levels in response to inflammation, probably compensating for lack of CRH. LIF overexpression may limit TNF
and TNF
-stimulated cytokine induction as noted in CRH knockout mice. Thus, simultaneous CRH and LIF deficiency may lead to exaggerated induction of central cytokines in these animals.
Almost all proinflammatory cytokines can stimulate POMC expression in a dose-dependent manner (3, 4). Despite increased levels of central cytokines, no pituitary POMC induction was observed in single LIF- and CRH-deficient animals, suggesting that cytokine expression did not reach a critical level of physiological significance. These results support out previous findings showing an inability of LIFKO mice to induce POMC expression in response to chronic or acute inflammation (29). Simultaneous absence of both ligands resulted in a much greater induction of TNF
and especially IL-1ß (100-fold increase in hypothalamus). CRH/LIF deficiency was accompanied by high levels of pituitary IL-6 and stimulation of Jak/STAT signaling pathway evident by SOCS 3 expression. Extremely high levels of hypothalamic-pituitary cytokines induced simultaneously might synergistically affect POMC expression in double CRH/LIFKO mice. Synergistic properties of inflammatory cytokines were demonstrated earlier in AtT20 cells (14).
Despite the controversy surrounding the entry of cytokines into the brain (13, 38, 50), multiple studies of cytokine protein and mRNA expression have indicated that many cytokines are constitutively expressed within the brain, including hypothalamus, and are induced during inflammation (1, 3, 51). Cytokines may play a neuromodulatory role inducing release and turnover of dopamine, serotonin, and norepinephrine in different brain regions (52). Hypothalamic cytokines in accord with pituitary cytokines may influence several neuroendocrine systems, the most prominent of which is activation of the HPA axis (1, 3). Here we demonstrate that these proinflammatory cytokines are highly induced in the hypothalamus and pituitary in response to a relatively weak inflammatory challenge. Cytokines may affect corticotrophs via endocrine (from the hypothalamus) and paracrine or autocrine pathways. Very high levels of TNF
, IL-1ß, and IL-6 induced in animals deficient in both CRH and LIF may contribute to a direct stimulation of corticotroph POMC expression (4). They may also act indirectly, activating hypothalamic PACAP (8) or triggering central neuroadrenergic neurons and therefore sympathetic adrenal input (53). Similar results were obtained in animals deficient in CRH-R1. These animals were able to mount a pituitary-adrenal inflammatory response via mechanisms that did not depend on either CRH or AVP (54).
Despite the variation in pituitary POMC expression, no differences were found in inflammatory ACTH responses between genotypes. These results indicate that ACTH levels may not directly correlate with pituitary POMC expression at a given experimental time point. ACTH was measured 4 h after LPS treatment. Our previous data showed that LIFKO mice had a robust ACTH response to LPS and turpentine treatment shortly after the immune challenge. Nevertheless, due to the absence of POMC induction, they could not sustain high ACTH levels for a prolong period of time (29, 30). It was also demonstrated that CRHKO mice had responses of ACTH and corticosterone similar to WT animals 4 h after turpentine injection (19). However, low POMC expression in LIFKO and CRHKO mice may not allow them to maintain a continuously high ACTH levels. At the same time, it is likely that induced POMC expression in WT and CRH/LIFKO mice may be translated into higher or more sustained ACTH secretion later in a course of inflammation. There is also a possibility that in double-knockout mice, POMC can be processed differently than in WT animals. ACTH is only a part of the POMC precursor molecule. POMC may also be processed to ß-endorphin, ß-lipotropin, MSH, and corticotropin-like intermediate lobe peptide (CLIP). Our further studies will clarify what POMC-derived peptides are predominantly synthesized in the pituitary of double CRH/LIFKO mice.
A robust corticosterone response to inflammation observed in double CRH/LIF mice may be a result of central signaling. However, adrenal corticosterone production may also be induced by peripheral IL-6 as was demonstrated (55). Circulating IL-6 was markedly elevated in response to inflammatory challenge in CRH null and double-null mice, compared with WT animals. High levels of circulating IL-6 are in agreement with results obtained in CRHKO mice during inflammation induced by T cell receptor antibody (18) and turpentine injection (19). Indeed, IL-6 has been shown to stimulate pituitary POMC expression (3, 4) and ACTH and adrenal corticosterone release in animals (6, 46, 56) and humans (57, 58). However, in the inflammatory model presented here, levels of IL-6 do not necessarily correlate with plasma corticosterone responses observed in experimental animals. Thus, WT mice despite the lowest IL-6 exhibit the highest plasma corticosterone levels in response to LPS-induced inflammation. We cannot, however, exclude that the absence of CRH signaling associated with marked IL-6 increase in CRH null and CRH/LIF null mice may contribute to adrenal corticosterone production in these animals. Nevertheless, at the pituitary level, increased circulating IL-6 did not affect low POMC expression in mice with CRH deficiency, whereas double-null mice demonstrate markedly elevated POMC levels.
These results suggest that the level of POMC expression is more likely to be regulated by central hypothalamic-pituitary cytokines. Although the pituitary is considered a peripheral part of the neuroendocrine system, this study shows that the pituitary cytokine profile is closely related to hypothalamic changes. We cannot exclude contamination of pituitary tissue with leukocytes or local entry of LPS fragments, which affect cytokine expression. However, the fact that pituitary IL-6 has a different pattern of expression from the periphery indicate tissue-specific cytokine induction and property.
In summary, the results demonstrate that mice with double CRH and LIF deficiency are able to maintain robust ACTH axis responses to inflammation. We hypothesized that exaggerated hypothalamic-pituitary proinflammatory cytokine induction could trigger pituitary POMC expression and ACTH release in these animals. Immune and stress responses form a complex network of conserved adaptive mechanisms (59, 60). Cytokines, in addition to their role in the immune system, are involved in physiological stress and behavior (4, 53, 54, 57). Neuroendocrine hormones and central cytokines form a common plastic network acting to preserve homeostasis (61, 62, 63). Our data suggest that lack of one or more POMC secretagogues during development shifts the central cytokine network so that cytokines are readily induced on demand. The central cytokine network may represent an effective backup stress system when adaptation cannot be achieved by regular physiologic responses. However, further studies are needed to prove this hypothesis.
| Footnotes |
|---|
Abbreviations: AVP, Arginine vasopressin; CRHKO, mice deficient in CRH; CRH/LIFKO, double-knockout mice; HPA, hypothalamus-pituitary-adrenal; Jak, Janus kinase; LIF, leukemia inhibitory factor; LIFKO, LIF-deficient mice; LPS, lipopolysaccharide; NF
B, nuclear factor
B; PACAP, pituitary adenylate cyclase-activating polypeptide; POMC, proopiomelanocortin; SOCS, suppressor of cytokine signaling; STAT, signal transducer and activator of transcription; Tm, melting temperature; WT, wild-type.
Received May 29, 2003.
Accepted for publication September 15, 2003.
| References |
|---|
|
|
|---|
, reduces glucocorticoid receptor translocation and function. Endocrinology 140:43594366
increases brain tryptophan concentrations and norepinephrine metabolism while activating the HPA axis in mice. Neuroimmunomodulation 6:319329[CrossRef][Medline]
This article has been cited by other articles:
![]() |
R. Jankord, J. R. Turk, J. C. Schadt, J. Casati, V. K. Ganjam, E. M. Price, D. H. Keisler, and M. H. Laughlin Sex Difference in Link between Interleukin-6 and Stress Endocrinology, August 1, 2007; 148(8): 3758 - 3764. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Daza, R. Martin-Jimenez, P. X De la Torre, E. Hernandez, and B. Murillo Improvement of ACTH response to insulin tolerance test in female patients with rheumatoid arthritis due to tumor necrosis factor inhibition Eur. J. Endocrinol., July 1, 2007; 157(1): 47 - 51. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. V. Mikhaylova, T. Kuulasmaa, J. Jaaskelainen, and R. Voutilainen Tumor Necrosis Factor-{alpha} Regulates Steroidogenesis, Apoptosis, and Cell Viability in the Human Adrenocortical Cell Line NCI-H295R Endocrinology, January 1, 2007; 148(1): 386 - 392. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. I Arroba, A. M Lechuga-Sancho, L. M Frago, J. Argente, and J. A Chowen Increased apoptosis of lactotrophs in streptozotocin-induced diabetic rats is followed by increased proliferation. J. Endocrinol., October 1, 2006; 191(1): 55 - 63. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Janoschek, L. Plum, L. Koch, H. Munzberg, S. Diano, M. Shanabrough, W. Muller, T. L. Horvath, and J. C. Bruning gp130 signaling in proopiomelanocortin neurons mediates the acute anorectic response to centrally applied ciliary neurotrophic factor PNAS, July 11, 2006; 103(28): 10707 - 10712. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Zacharowski, P. A. Zacharowski, A. Koch, A. Baban, N. Tran, R. Berkels, C. Papewalis, K. Schulze-Osthoff, P. Knuefermann, U. Zahringer, et al. Toll-like receptor 4 plays a crucial role in the immune-adrenal response to systemic inflammatory response syndrome PNAS, April 18, 2006; 103(16): 6392 - 6397. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Kariagina, S. Zonis, M. Afkhami, D. Romanenko, and V. Chesnokova Leukemia inhibitory factor regulates glucocorticoid receptor expression in the hypothalamic-pituitary-adrenal axis Am J Physiol Endocrinol Metab, November 1, 2005; 289(5): E857 - E863. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Chesnokova, K. Kovacs, A.-V. Castro, S. Zonis, and S. Melmed Pituitary Hypoplasia in Pttg-/- Mice Is Protective for Rb+/- Pituitary Tumorigenesis Mol. Endocrinol., September 1, 2005; 19(9): 2371 - 2379. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |