help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2003-0669
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kariagina, A.
Right arrow Articles by Chesnokova, V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kariagina, A.
Right arrow Articles by Chesnokova, V.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH
Endocrinology Vol. 145, No. 1 104-112
Copyright © 2004 by The Endocrine Society

Hypothalamic-Pituitary Cytokine Network

Anastasia Kariagina, Dmitry Romanenko, Song-Guang Ren and Vera Chesnokova

Cedars-Sinai Medical Center-University of California, Los Angeles School of Medicine, Los Angeles, California 90048

Address all correspondence and requests for reprints to: Vera Chesnokova, Ph.D., Department of Medicine, Division of Endocrinology, Davis Building, Room 3019, Cedars-Sinai Medical Center, 8700 Beverly Boulevard, Los Angeles, California 90048. E-mail: chesnokovav{at}cshs.org.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cytokines expressed in the brain and involved in regulating the hypothalamus-pituitary-adrenal (HPA) axis contribute to the neuroendocrine interface. Leukemia inhibitory factor (LIF) and LIF receptors are expressed in human pituitary cells and murine hypothalamus and pituitary. LIF potently induces pituitary proopiomelanocortin (POMC) gene transcription and ACTH secretion and potentiates CRH induction of POMC. In vivo, LIF, along with CRH, enhances POMC expression and ACTH secretion in response to emotional and inflammatory stress. To further elucidate specific roles for both CRH and LIF in activating the inflammatory HPA response, double-knockout mice (CRH/LIFKO) were generated by breeding the null mutants for each respective single gene. Inflammation produced by ip injection of lipopolysaccharide (1 µg/mouse) to double CRH and LIF-deficient mice elicited pituitary POMC induction similar to wild type and markedly higher than in single null animals (P < 0.0.01). Double-knockout mice also demonstrated robust corticosterone response to inflammation. High pituitary POMC mRNA levels may reflect abundant TNF{alpha}, IL-1ß, and IL-6 activation observed in the hypothalamus and pituitary of these animals. Our results suggest that increased central proinflammatory cytokine expression can compensate for the impaired HPA axis function and activates inflammatory ACTH and corticosterone responses in mice-deficient in both CRH and LIF.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
CYTOKINES ARE A DIVERSE group of pleiotropic and redundant polypeptides that are rapidly produced by immune cells in response to tissue injury, infection, or inflammation. Constitutive expression of cytokines, albeit at low levels, has been reported also on most cell types throughout the brain and in the hypothalamus-pituitary-adrenal (HPA) axis, and these often show rapid up-regulation in response to injury and inflammation. In rodent brain tissues, the highest densities of cytokine receptors occur in the hippocampus and hypothalamus (1). Cytokine receptors are also widely expressed within anterior pituitary cells (2, 3).

Almost all proinflammatory cytokines stimulate the HPA axis in vivo (3) and proopiomelanocortin (POMC) expression in vitro (4). HPA stimulation occurs either at the hypothalamic level (IL-1ß, TNF{alpha}), inducing CRH gene expression and CRH release, or at the level of pituitary corticotrophs. IL-2, interferons, and the gp130 cytokine family participate in ACTH regulation and mediate the immunoneuroendocrine interface (3, 5, 6). In addition to CRH, inflammatory cytokines also trigger central ACTH secretagogues such as noradrenaline (7), pituitary adenylate cyclase-activating polypeptide (PACAP) (8), vasopressin (9), and other cytokines (10). Proinflammatory cytokines may impair feedback regulation of the HPA axis by attenuating glucocorticoid receptor function (11, 12, 13). By stimulating the HPA axis and release of antiinflammatory glucocorticoids, cytokines can antagonize their own proinflammatory action.

Pituitary corticotroph POMC gene expression is regulated by CRH as well as gp130 receptor cytokine family comprised of IL-6, leukemia inhibitory factor (LIF), oncostatin M, IL-11, ciliary neurotrophic factor, and cardiotropin 1 (2, 5, 6). Although CRH action is mediated by a cAMP-dependent pathway, effects of gp130 cytokines are mediated by the Janus kinase (Jak)-signal transducer and activator of transcription (STAT) signaling cascade. Synergistic cross-talk of different signaling cascades enables the HPA axis to respond rapidly to inflammatory and stress stimuli (14, 15). gp 130 cytokines activate the HPA axis even in the absence of CRH. Mice deficient in CRH (CRHKO) demonstrate impaired glucocorticoid production in response to psychological and metabolic challenges but have near-normal responses to stressors that activate the immune system (16, 17). gp130 Cytokine IL-6 produced by adrenals was found to compensate for CRH deficiency in the inflammatory response (18) and food intake (19) in these animals.

Another gp130 cytokine, LIF, has diverse pleiotropic actions regulating metabolism, growth, differentiation (20, 21), and neuronal responses to injury (10), and LIF administration prevents oligodendrocyte death in animal models of multiple sclerosis (22). LIF and LIF receptors are constitutively expressed in human pituitary cells (23) and in murine hypothalamus and pituitary (5). LIF regulates differentiation and development of murine pituitary corticotrophs early in ontogenesis (24), potently induces POMC gene transcription and ACTH secretion (14, 23, 25) and potentiates CRH induction of POMC gene expression (26, 27). In vivo, LIF is highly induced in the hypothalamus and pituitary in response to inflammation (28, 29, 30). LIF-deficient mice (LIFKO) demonstrate low pituitary POMC mRNA levels and low induction of ACTH and corticosterone responses to stress (29, 31, 32). Thus, LIF, along with CRH, enhances POMC expression and ACTH secretion in response to psychological and inflammatory challenge (32, 33).

To further demarcate specific roles for both CRH and LIF in mediating the HPA axis function, double-knockout mice (CRH/LIFKO) were generated by breeding null mutants for each respective single gene. The goal of the present study was to unravel central molecular and physiological mechanisms substituting for the impaired HPA axis inflammatory response in CRH- and LIF-deficient mice. The ip injection of low doses of lipopolysaccharide (LPS) (1 µg/mouse) to double CRH/LIF-deficient animals elicits pituitary POMC induction similar to those observed in wild-type (WT) mice and markedly higher than in single null animals (P < 0.0.01). Double-knockout mice also demonstrate robust corticosterone responses to inflammatory challenge. The results suggest that high POMC mRNA levels may be a consequence of abundant TNF{alpha}, IL-1ß, and IL-6 activation observed in the hypothalamus and pituitary of these animals. Increased central proinflammatory cytokine expression could therefore substitute for the impaired HPA axis function and activate inflammatory ACTH and corticosterone responses in mice deficient in both CRH and LIF.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animals
LIF knockout mice were kindly provided by Dr. Colin Stewart (Roche Institute of Molecular Biology, Roche Research Center, Nutley, NJ). LIF knockout animals were originally created on B6D2F1 genetic background. Since then mice were backcrossed three times onto one of the parental genotypes C57BL/6 (B6). Thus, resulted LIF knockout mice carried more than 93% of C57BL/6 genotype.

CRH knockout animals were a gift from Dr. Joseph Majzoub (Children’s Hospital, Boston, MA). These animals were originally created on B6129Sv genetic background. Before using these mice, they were backcrossed twice onto parental C57Bl/6 genotype. As a result of this backcross, animals carried approximately 87.5% of C57Bl/6 genotype.

CRH knockout females and LIF knockout males were then crossbred to generate CRH+/-LIF+/- mice, which were used as parents for future breeding. All mice used in the present studies: CRH-/-LIF-/- (CRH/LIFKO), CRH-/-LIF+/+ (CRHKO), and CRH+/+LIF-/- (LIFKO) and CRH+/+LIF+/+ (WT) were obtained by breeding CRH+/- LIF+/- females and males and had the same genetic background. The ratios of double-knockout mice in embryogenesis corresponded to expected Mendelian ratios; however, the percentage of surviving newborn pups was lower (1.5 vs. 6.25%). The double-knockout pups are frail and often cannibalized by mothers at birth. After PCR analysis of tail tissue, CRHKO, LIFKO, and CRH/LIFKO animals were sex and age matched with WT littermates. Females aged 8–14 wk were used for study. All experimental procedures were approved by the Institutional Animal Care and Use Committee.

LPS treatment
Inflammation was induced by ip injection of 1 µg LPS (from Escherichia coli, Sigma, St. Louis, MO) in 200 µl normal saline. Animals were killed 4 h after injection.

Blood collection
Whole blood was obtained immediately after decapitation and plasma collected in ice-chilled tubes containing 0.1% EDTA, separated, and stored at -70 C until assayed. Plasma ACTH (Nichols Institute Diagnostics, San Juan Capistrano, CA) and plasma corticosterone (ICN Biomedicals, Inc., Costa Mesa, CA) were measured by commercially available RIAs. Sensitivity of ACTH and corticosterone assay is 10 pg/ml and 25 ng/ml, respectively. Inter- and intraassay variability for ACTH was 7.3 and 3.1%, respectively; inter- and intraassay variability for corticosterone was 4.4 and 6.5%, respectively.

IL-6 was assayed by mouse ELISA kit (Assay Designs, Inc., Ann Arbor, MI) according to the manufacturer’s protocol.

Tissue dissection and RNA isolation
Mice were decapitated, pituitary and hypothalamus dissected, and tissue immediately frozen on dry ice and kept at -70 C until RNA extraction. Total tissue RNA was extracted with Trizol reagent (GIBCO BRL, Gaithersburg, MD) according to manufacturer instructions, in which 5–100 mg frozen tissue were immersed in 1 ml Trizol solution and homogenized with a Polytron homogenizer, dissolved in diethylpyrocarbonated water, and RNA concentration spectrometrically quantitated and quality checked by gel electrophoresis.

Quantitative RT-PCR
Before processing, RNA samples were treated with DNase I (DNA-free DNase treatment and removal reagents, Ambion, Austin, TX) to eliminate possible genomic DNA contamination. Total RNA (2.5 µg) was reverse transcribed into first-strand cDNA using SuperScript preamplification system (Life Technologies, Inc., Gaithersburg, MD) and random hexamers according to the manufacturer’s protocol. For each new batch of cDNA, a control sample containing no reverse transcriptase was performed (-RT control). Subsequent PCRs were performed using thermal iCycler with optical module (Bio-Rad Laboratories, Hercules, CA). Fluorescent reporter dye SYBR Green I (Molecular Probes, Eugene, OR) was used to monitor the PCR in real time. SYBR Green I has a high sensitivity for detecting double-strand DNA; however, it does not discriminate between specific PCR product and nonspecific double-strand DNA. To control for this problem, several steps were performed: 1) For each primer pair, optimal concentrations of MgCl2 and optimal annealing temperatures were first obtained; 2) the PCR product size was checked by gel electrophoresis; 3) PCR product melting temperature (Tm) was empirically determined; 4) reading fluorescence was performed for 25 sec at 2 C below the Tm of the corresponding PCR product. At this temperature all primer dimers and all shorter nonspecific products are melted and hence do not contribute to fluorescence.

Primers used in this study were: 18S forward, AAACGGCTACCACATCCAAG, 18S reverse, CCTCCAATGGATCCTGGTTA (amplicon size 155 bp, Tm 88 C); IL-1ß forward, CAACCAACAAGTGATATTCTCCATG, IL-1ß reverse, GATCCACACTCTCCAGCTGCA [amplicon size 152 bp, Tm 87 C, (33)]; IL-6 forward, GGAGAGGAGACTTCACAG, IL-6 reverse, GCCATTGCACAACTCTTTTC (amplicon size 125 bp, Tm 85 C); TNF{alpha} forward, CATCTTCTCAAAATTCGAGTGACAA, TNF{alpha} reverse, TGGGAGTAGACAAGGTACAACCC [amplicon size 175 bp, Tm 91 C (33)]; and POMC forward, CATTAGGCTTGGAGCAGGTC, POMC reverse, TCTTGATGATGGCGTTCTTG (amplicon size 174 bp, Tm 87 C).

PCRs were performed in 25 µl volume: 0.4 µM of each gene-specific primer, MgCl2 (1.5–4.5 mM), 0.2 mM of dNTP mix, 1.25U of HotStar Taq Polymerase (Qiagen, Valencia, CA), 1–1.5 x SYBR Green I and 5 µl of diluted cDNA or standards. Experimental samples were run in quadruplicate or triplicate. In addition, for each experimental plate standard, -RT and (-)cDNA were run in triplicate. For POMC, TNF{alpha}, IL-1ß, IL-6, standards were generated using serial dilutions of purified DNA amplicon. Ten-fold serial dilutions of control cDNA were used for 18S standard curves. Slopes of all standard curves ranged between -3.49 and -2.80. The relative quantification of each gene in experimental samples was determined from the corresponding standard curve and normalized to 18S. Levels of each gene mRNA are presented as arbitrary units relative to WT untreated control taken as one.

Northern blot analysis
Northern analysis of pituitary LIF and suppressor of cytokine signaling (SOCS) 3 expression was performed as described (29, 30) using 20 µg total pituitary RNA/lane.

Statistical analysis
Data were analyzed using ANOVA followed by nonparametric t test (Mann-Whitney U test) or t test. All data are presented as mean ± SE. P < 0.05 was considered significant.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
HPA axis inflammatory response
In preliminary experiments a control group of WT mice (five to six animals per observed time point) were injected ip with normal saline. No significant alteration of pituitary POMC, corticosterone, and hypothalamic and pituitary cytokines was noted 4 h after injection (data not shown). Therefore, in further experiments untreated animals were used as controls.

Pituitary POMC expression showed that baseline POMC levels were lower in all untreated single and double-knockout animals (P < 0.05), compared with WT littermates. Four hours after LPS injection, POMC expression was induced 2-fold in WT animals (P < 0.05). In LIFKO and CRHKO mice, no changes in POMC abundance were observed, whereas in double CRH/LIFKO animals, POMC mRNA levels increased about 4-fold from the baseline (P < 0.01) (Fig. 1Go). These results show that simultaneous CRH /LIF deficiency results in reinforced pituitary POMC induction in response to inflammation.



View larger version (11K):
[in this window]
[in a new window]
 
FIG. 1. Pituitary POMC mRNA levels 4 h after ip LPS injection (1 µg/mouse). Results are expressed in arbitrary units for real-time PCR analysis. Values are mean ± SEM of at least three replicate measurements for each experimental group (n = 8–10 animals per group). *, P < 0.05, **, P < 0.01, compared with baseline. @, P < 0.05, compared with baseline levels in WT mice. #, P < 0.05, compared with LPS-induced levels in WT and CRH/LIFKO mice.

 
The baseline plasma ACTH levels were lower in LIFKO (32 ± 7) and double CRH/LIF knockout mice (19 ± 6 pg/ml) in comparison with WT animals (49 ± 9.4 pg/ml, P < 0.05), reflecting low baseline pituitary POMC expression. LPS treatment increased plasma ACTH concentration in all experimental animals. Although no differences were observed between genotypes in inflammatory-induced ACTH responses, the fold-induction of plasma ACTH levels was the highest in double CRH/LIFKO mice (11-fold), compared with WT (4.1-fold), LIFKO (4.1-fold), and CRHKO (4.6-fold) mice (Fig. 2AGo). These results show that double CRH/LIFKO mice have a powerful ACTH response to inflammation.



View larger version (22K):
[in this window]
[in a new window]
 
FIG. 2. A, Plasma ACTH levels in mice (n = 8–10 per group) 4 h after ip LPS injection (1 µg/mouse). Values are mean + SEM. B, Plasma corticosterone levels in mice (n = 8–10 per group) 4 h after ip LPS injection (1 µg/mouse). Values are mean + SEM *, P < 0.05, **, P < 0.01 compared with baseline. @, P < 0.05, compared with baseline levels in WT mice. #, P = 0.05, ##, P < 0.01, compared with LPS-induced levels in WT mice.

 
In untreated animals, corticosterone plasma levels in LIFKO (95 ± 11 ng/ml) did not differ significantly from WT mice (134 ± 18 ng/ml) and were markedly lower in CRHKO (53.4 ± 7 ng/ml) and double CRH/LIFKO mice (26 ± 6.7 ng/ml) (P < 0.05). Inflammatory provocation evoked marked plasma corticosterone elevation in all genotypes, with highest levels observed in WT animals (772 ± 65.2 ng/ml) (P < 0.01, compared with LIFKO and CRHKO mice). LPS-induced corticosterone levels in CRH/LIFKO mice was 541 ± 92 ng/ml and did not differ from levels in WT animals (P = 0.05). However, an increase from baseline levels was highest in double CRH/LIFKO mice (21-fold), compared with WT (5.8-fold), LIFKO (4-fold), and CRHKO (8-fold) animals (Fig. 2BGo). These findings indicate that despite the lack of both CRH and LIF, double-mutant mice demonstrate a robust corticosterone response to LPS.

Hypothalamic cytokines
Hypothalamus and pituitary proinflammatory cytokines induced in the course of inflammation may trigger HPA axis inflammatory responses. Hypothalamic TNF{alpha}, IL-1ß and IL-6 gene expression were analyzed by real-time PCR after endotoxin inoculation. No genotype differences were observed in baseline hypothalamic TNF{alpha} expression. After LPS stimulation TNF{alpha} mRNA levels were induced in all experimental animals: up to 4 ± 0.3 in WT, 5 ± 0.9 in LIFKO, and 3 ± 0.3 in CRHKO with highest levels (14 ± 0.22) in double CRH/LIFKO mice. Baseline IL-1ß mRNA levels were lower in CRHKO and double CRH/LIFKO animals, compared with WT and LIFKO mice. These genotypes have a higher degree of IL-1ß stimulation: In CRHKO mice IL-1ß was induced up to 10 ± 1.9 (P < 0.05 vs. WT and LIFKO), whereas in double-KO animals, this cytokine expression reached 124 ± 19.5 (P < 0.001 vs. other genotypes). IL-6 baseline levels were about 10 times higher in CRHKO mice, compared with other groups. Although stimulated IL-6 levels were also highest in this group, the net increase of IL-6 (from 10 ± 1.6 to 31 ± 1.53) was lower than in WT (from 1 ± 0.07 to 13 ± 0.55) and did not differ from that observed in LIFKO and double CRH/LIFKO mice (Fig. 3Go).



View larger version (13K):
[in this window]
[in a new window]
 
FIG. 3. Real-time PCR analysis of hypothalamic TNF{alpha} (A), IL-1ß (B), and IL-6 (C) mRNA levels 4 h after ip LPS injection (1 µg/mouse). Results are expressed in arbitrary units. Values are mean ± SEM of at least three replicate measurements for each experimental group (n = 8–10 animals per group) (A and B). *, P < 0.05, **, P < 0.01, compared with baseline. @, P < 0.05, compared with baseline levels in WT mice. Arrows indicate the differences between LPS-induced cytokine levels in CRH/LIFKO and WT, LIFKO, and CRHKO mice. C, *, P < 0.05, compared with baseline, #, P < 0.05, compared with baseline levels in CRHKO mice. @@, P < 0.01, compared with LPS-induced levels in WT mice. $, P < 0.05, compared with LPS-induced levels in LIFKO mice. Arrows indicate the differences between LPS-induced cytokine levels in CRHKO and WT, LIFKO, and CRH/LIFKO mice.

 
Pituitary cytokines
Baseline TNF{alpha} expression was elevated in all single and double null genotypes (P < 0.05) and was further up-regulated by LPS treatment, with highest levels observed in LIFKO (25 ± 4.9) and double CRH/LIFKO (35 ± 1.8) animals (for both, P < 0.01 vs. WT and CRHKO). Pituitary baseline IL-1ß expression did not differ in four genotypes and was induced after inflammatory challenge. Double CRH/LIFKO mice showed the highest increase in IL-1ß mRNA levels during inflammation (from 0.9 ± 0.3 to 40 ± 4.3, P < 0.001). Baseline IL-6 expression was elevated in comparison with WT in LIFKO (6 ± 0.4) and CRHKO (4 ± 0.6) (P < 0.05 for both), with highest levels observed in double CRH/LIFKO animals (30 ± 10.3, P < 0.01). LPS caused marked IL-6 mRNA increases in all genotypes, although in knockout animals this increase was more pronounced. All null groups differed significantly from WT animals (P < 0.01) (Fig. 4Go, A–C). In a separate set of experiments using Northern blot, LIF gene expression was analyzed in WT and CRHKO mice after LPS inoculation. LPS treatment induced LIF mRNA levels in both genotypes, although in CRH-deficient animals this induction was higher (Fig. 4DGo).



View larger version (21K):
[in this window]
[in a new window]
 
FIG. 4. Real-time PCR analysis of pituitary TNF{alpha} (A), IL-1ß (B), and IL-6 (C) mRNA levels 4 h after ip LPS injection (1 µg/mouse). Results are expressed in arbitrary units. Values are mean ± SEM of at least three replicate measurements for each experimental group (n = 8–10 animals per group). *, P < 0.05, **, P < 0.01, compared with baseline. #, P < 0.05, compared with baseline levels in WT mice. @, P < 0.05, @@, P < 0.01, compared with LPS-induced levels in CRHKO mice. A and C, Arrows indicate the differences between LPS-induced cytokine levels in WT and LPS-induced levels in LIFKO, CRHKO, and CRH/LIFKO mice. B, Arrows indicate the differences between LPS-induced levels in CRH/LIFKO and WT, LIFKO, and CRHKO mice. D, Northern blot analysis of pituitary LIF mRNA of WT and CRHKO mice 4 h after ip LPS injection (1 µg/mouse) (n = 8–10 animals per group). Representative blot is shown. 20 µg/lane total RNA was analyzed, and the experiment was repeated twice.

 
Pituitary SOCS 3
SOCS 3, a cytokine-inducible intracellular protein, is induced in murine hypothalamus and pituitary in response to inflammatory signals. The gp130 cytokines IL-6 and LIF are powerful stimulators of pituitary SOCS 3, and SOCS 3 is a reliable marker of Jak/STAT signal pathway activation (14, 30). Because of the redundancy in cytokine signaling, other cytokines of the gp130 family can contribute to SOCS 3 induction. The level of SOCS 3 induction in the pituitary thus reflects the intensity of central cytokine production. SOCS 3 expression may also be affected by circulating IL-6. Endotoxin treatment provoked synthesis and release of proinflammatory cytokines in all the experimental groups. Pituitary SOCS 3 mRNA levels were increased in all null animals, with highest levels observed in the double CRH/LIFKO mice. These results reflect strong pituitary IL-6 induction and powerful activation of Jak/STAT signaling pathway in all knockout animals and especially in mice with double CRH and LIF deficiency (Fig. 5Go).



View larger version (30K):
[in this window]
[in a new window]
 
FIG. 5. Northern blot analysis of pituitary SOCS 3 mRNA 4 h after ip LPS injection (1 µg/mouse) (n = 8–10 animals per group). Representative blot is shown. Total RNA (20 µg/lane) was analyzed, and the experiment was repeated twice.

 
Plasma IL-6 levels
Septic shock induces a release of circulating proinflammatory cytokines. LPS injection induced higher IL-6 levels in CRHKO (2096 ± 143 ng/ml) and CRH/LIFKO mice (2181 ± 115 ng/ml) than in WT animals (1263 ± 241 ng/ml) (P < 0.05 for both genotypes) (Fig. 6Go).



View larger version (11K):
[in this window]
[in a new window]
 
FIG. 6. Plasma IL-6 levels in mice (n = 8–10 per group) 4 h after ip LPS injection (1 µg/mouse). Values are mean ± SEM. *, P < 0.05, compared with LPS-induced levels in WT mice.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The findings reported here show that despite the absence of two important POMC secretagogues, CRH/LIFKO animals mount robust pituitary POMC induction and ACTH and corticosterone response to the stress of LPS. To unravel mechanisms for POMC induction in double-deficient mice, alternate pathways for ACTH axis stimulation by inflammatory challenge were analyzed.

LIFKO, CRHKO, and double CRH/LIFKO mice all exhibited a decreased baseline pituitary POMC mRNA levels. No significant differences in pituitary POMC mRNA levels were previously observed between CRHKO and WT mice (34). The contrast between these results may be attributed to more sensitive real-time PCR technique used in this study. Low baseline plasma ACTH and corticosterone levels in all mutant mice mirror decreased pituitary POMC expression in these animals.

Along with CRH, hypothalamic arginine vasopressin (AVP) is a potent inducer of pituitary POMC expression and ACTH release. Recent findings (35, 36) demonstrated that AVP might be stimulated by cytokines and LPS treatment. It was shown that excessive AVP expression was partly responsible for the increased susceptibility to inflammation in Lewis rats (37). However, we did not observe any differences in hypothalamic AVP mRNA levels in both intact and LPS injected mice of all genotypes studied (data not shown). Also, no differences were found between genotypes in the expression of hypothalamic PACAP, another potent ACTH secretagogue (data not shown). Thus, neither AVP nor PACAP could substitute for CRH and LIF deficiency in double-knockout mice.

Proinflammatory cytokines are proved to be strong activators of the HPA axis (2, 3). Therefore, we investigated pattern of proinflammatory cytokine expression in hypothalamus and pituitary of CRH/LIFKO mice. In all studied genotypes, hypothalamic TNF{alpha} and IL-1ß mRNA levels were up-regulated in response to inflammatory stress with strongest induction observed in double CRH/LIFKO (P < 0.01). In contrast, the IL-6 increase was higher in WT and CRHKO mice. In CRH-deficient animals, both baseline and stimulated hypothalamic IL-6 mRNA levels were elevated, in agreement with observed compensatory increase of plasma IL-6 in these mice (18, 19). However, in our experiments the fold-induction of hypothalamic IL-6 in CRHKO animals was lower than in WT mice and did not differ from other knockout genotypes.

Very high levels of TNF{alpha} and IL-1ß mRNA were observed in the pituitary of double-knockout mice in response to LPS treatment. Signal transduction pathways for both TNF{alpha} and IL-1ß include activation of transcription factor nuclear factor {kappa}B (NF{kappa}B) (38). It is reasonable to assume that in pituicytes of double-knockout animals, NF{kappa}B-dependent transcription is stimulated to the larger extent than in single mutants or WT mice. The results suggest that excessive hypothalamic and pituitary TNF{alpha} and IL-1ß production might affect pituitary POMC expression. In addition, pituitary IL-6 is highly elevated in all knockout genotypes. Corticotroph cell signaling pathway for the IL-6 cytokine family involves heterodimerization between cytokine receptor and gp130 receptor subunits with subsequent Jak/STAT pathway activation (5, 6), stimulation of POMC transcription (39), and induction of SOCS 3 (39, 40, 41). Earlier we demonstrated that pituitary SOCS 3 was triggered by gp130 proinflammatory cytokines in vivo (29, 30, 42). Thus, SOCS 3 represents a reliable indicator of Jak/STAT pathway activity. The highest level of SOCS 3 expression in double-knockout animals mirrors the highest net activation of Jak/Stat signaling pathway stimulated by IL-6 and other gp130 cytokines.

The specific roles for CRH and LIF in regulating the HPA axis are under investigation. Recent studies demonstrated that central CRH appeared to be more critical in mediating ACTH release in response to shock or alcohol than to LPS treatment (43). Data showing that CRHKO animals have nearly normal HPA axis reaction to inflammatory challenge support this hypothesis (18). At the same time, animals with LIF deficiency have markedly lower POMC and ACTH responses to inflammation induced by turpentine (29) and high dose of LPS (50 µg/mouse) (30), and exogenous LIF injection restores pituitary POMC expression in LIFKO animals (29). In vitro studies show that LIF greatly potentiates the effects of CRH on POMC transcription (26). Although CRH is indispensable for rapid increase of pituitary POMC expression and ACTH release in response to any nonspecific stressful challenge, LIF plays an important role in maintaining a sustained activation of the HPA axis during inflammatory process. Thus, we expected CRH/LIF-deficient animals to demonstrate even lower HPA activity than was observed in single mutant mice. The fact that these animals still have a robust POMC, ACTH, and corticosterone responses to inflammation indicate that in the absence of both CRH and LIF, other mechanisms are coming to play. Despite less potency in stimulating the HPA axis inflammatory response, CRH may still restrict inflammatory process. Blocking peripheral CRHR1 and CRHR2 enhances TNF{alpha} and IL-6 release after LPS injection (43), indicating the suppressive effects of CRH on cytokine synthesis. It is conceivable that hypothalamic CRH may have the same effect on central cytokine expression inhibiting TNF-dependent NF{kappa}B signaling pathway. Thus, CRH deficiency may trigger central cytokine production. During inflammation TNF{alpha} is first induced (44) and then turns on IL-1ß (45, 46) and IL-6 (47). In turn, LIF stimulated by the inflammatory agent inhibits TNF{alpha} expression and synthesis in vivo and in vitro (48, 49). CRH-null mice show elevated pituitary LIF mRNA levels in response to inflammation, probably compensating for lack of CRH. LIF overexpression may limit TNF{alpha} and TNF{alpha}-stimulated cytokine induction as noted in CRH knockout mice. Thus, simultaneous CRH and LIF deficiency may lead to exaggerated induction of central cytokines in these animals.

Almost all proinflammatory cytokines can stimulate POMC expression in a dose-dependent manner (3, 4). Despite increased levels of central cytokines, no pituitary POMC induction was observed in single LIF- and CRH-deficient animals, suggesting that cytokine expression did not reach a critical level of physiological significance. These results support out previous findings showing an inability of LIFKO mice to induce POMC expression in response to chronic or acute inflammation (29). Simultaneous absence of both ligands resulted in a much greater induction of TNF{alpha} and especially IL-1ß (100-fold increase in hypothalamus). CRH/LIF deficiency was accompanied by high levels of pituitary IL-6 and stimulation of Jak/STAT signaling pathway evident by SOCS 3 expression. Extremely high levels of hypothalamic-pituitary cytokines induced simultaneously might synergistically affect POMC expression in double CRH/LIFKO mice. Synergistic properties of inflammatory cytokines were demonstrated earlier in AtT20 cells (14).

Despite the controversy surrounding the entry of cytokines into the brain (13, 38, 50), multiple studies of cytokine protein and mRNA expression have indicated that many cytokines are constitutively expressed within the brain, including hypothalamus, and are induced during inflammation (1, 3, 51). Cytokines may play a neuromodulatory role inducing release and turnover of dopamine, serotonin, and norepinephrine in different brain regions (52). Hypothalamic cytokines in accord with pituitary cytokines may influence several neuroendocrine systems, the most prominent of which is activation of the HPA axis (1, 3). Here we demonstrate that these proinflammatory cytokines are highly induced in the hypothalamus and pituitary in response to a relatively weak inflammatory challenge. Cytokines may affect corticotrophs via endocrine (from the hypothalamus) and paracrine or autocrine pathways. Very high levels of TNF{alpha}, IL-1ß, and IL-6 induced in animals deficient in both CRH and LIF may contribute to a direct stimulation of corticotroph POMC expression (4). They may also act indirectly, activating hypothalamic PACAP (8) or triggering central neuroadrenergic neurons and therefore sympathetic adrenal input (53). Similar results were obtained in animals deficient in CRH-R1. These animals were able to mount a pituitary-adrenal inflammatory response via mechanisms that did not depend on either CRH or AVP (54).

Despite the variation in pituitary POMC expression, no differences were found in inflammatory ACTH responses between genotypes. These results indicate that ACTH levels may not directly correlate with pituitary POMC expression at a given experimental time point. ACTH was measured 4 h after LPS treatment. Our previous data showed that LIFKO mice had a robust ACTH response to LPS and turpentine treatment shortly after the immune challenge. Nevertheless, due to the absence of POMC induction, they could not sustain high ACTH levels for a prolong period of time (29, 30). It was also demonstrated that CRHKO mice had responses of ACTH and corticosterone similar to WT animals 4 h after turpentine injection (19). However, low POMC expression in LIFKO and CRHKO mice may not allow them to maintain a continuously high ACTH levels. At the same time, it is likely that induced POMC expression in WT and CRH/LIFKO mice may be translated into higher or more sustained ACTH secretion later in a course of inflammation. There is also a possibility that in double-knockout mice, POMC can be processed differently than in WT animals. ACTH is only a part of the POMC precursor molecule. POMC may also be processed to ß-endorphin, ß-lipotropin, MSH, and corticotropin-like intermediate lobe peptide (CLIP). Our further studies will clarify what POMC-derived peptides are predominantly synthesized in the pituitary of double CRH/LIFKO mice.

A robust corticosterone response to inflammation observed in double CRH/LIF mice may be a result of central signaling. However, adrenal corticosterone production may also be induced by peripheral IL-6 as was demonstrated (55). Circulating IL-6 was markedly elevated in response to inflammatory challenge in CRH null and double-null mice, compared with WT animals. High levels of circulating IL-6 are in agreement with results obtained in CRHKO mice during inflammation induced by T cell receptor antibody (18) and turpentine injection (19). Indeed, IL-6 has been shown to stimulate pituitary POMC expression (3, 4) and ACTH and adrenal corticosterone release in animals (6, 46, 56) and humans (57, 58). However, in the inflammatory model presented here, levels of IL-6 do not necessarily correlate with plasma corticosterone responses observed in experimental animals. Thus, WT mice despite the lowest IL-6 exhibit the highest plasma corticosterone levels in response to LPS-induced inflammation. We cannot, however, exclude that the absence of CRH signaling associated with marked IL-6 increase in CRH null and CRH/LIF null mice may contribute to adrenal corticosterone production in these animals. Nevertheless, at the pituitary level, increased circulating IL-6 did not affect low POMC expression in mice with CRH deficiency, whereas double-null mice demonstrate markedly elevated POMC levels.

These results suggest that the level of POMC expression is more likely to be regulated by central hypothalamic-pituitary cytokines. Although the pituitary is considered a peripheral part of the neuroendocrine system, this study shows that the pituitary cytokine profile is closely related to hypothalamic changes. We cannot exclude contamination of pituitary tissue with leukocytes or local entry of LPS fragments, which affect cytokine expression. However, the fact that pituitary IL-6 has a different pattern of expression from the periphery indicate tissue-specific cytokine induction and property.

In summary, the results demonstrate that mice with double CRH and LIF deficiency are able to maintain robust ACTH axis responses to inflammation. We hypothesized that exaggerated hypothalamic-pituitary proinflammatory cytokine induction could trigger pituitary POMC expression and ACTH release in these animals. Immune and stress responses form a complex network of conserved adaptive mechanisms (59, 60). Cytokines, in addition to their role in the immune system, are involved in physiological stress and behavior (4, 53, 54, 57). Neuroendocrine hormones and central cytokines form a common plastic network acting to preserve homeostasis (61, 62, 63). Our data suggest that lack of one or more POMC secretagogues during development shifts the central cytokine network so that cytokines are readily induced on demand. The central cytokine network may represent an effective backup stress system when adaptation cannot be achieved by regular physiologic responses. However, further studies are needed to prove this hypothesis.


    Footnotes
 
This work was supported by a grant from the NIH (R29-DK54862, to V.C.) and Cedars Sinai Research Institute Young Investigator Award (to V.C.).

Abbreviations: AVP, Arginine vasopressin; CRHKO, mice deficient in CRH; CRH/LIFKO, double-knockout mice; HPA, hypothalamus-pituitary-adrenal; Jak, Janus kinase; LIF, leukemia inhibitory factor; LIFKO, LIF-deficient mice; LPS, lipopolysaccharide; NF{kappa}B, nuclear factor {kappa}B; PACAP, pituitary adenylate cyclase-activating polypeptide; POMC, proopiomelanocortin; SOCS, suppressor of cytokine signaling; STAT, signal transducer and activator of transcription; Tm, melting temperature; WT, wild-type.

Received May 29, 2003.

Accepted for publication September 15, 2003.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Vitkovic L, Bockaert J, Jacque C 2000 "Inflammatory" cytokines: neuromodulators in normal brain? J Neurochem 74:457–471[CrossRef][Medline]
  2. Ray D, Melmed S 1997 Pituitary cytokine and growth factor expression and action. Endocr Rev 18:206–228[Abstract/Free Full Text]
  3. Turnbull AV, Rivier CL 1999 Regulation of the hypothalamic-pituitary-adrenal axis by cytokines: actions and mechanisms of action. Physiol Rev 79:1–71[Abstract/Free Full Text]
  4. Katahira M, Iwasaki Y, Aoki Y, Oiso Y, Saito H 1998 Cytokine regulation of the rat proopiomelanocortin gene expression in AtT20 cells. Endocrinology 139:2414–2422[Abstract/Free Full Text]
  5. Auernhammer CJ, Melmed S 2000 Leukemia-inhibitory factor-neuroimmune modulator of endocrine function. Endocr Rev 21:313–345[Abstract/Free Full Text]
  6. Arzt E 2001 The gp130 cytokine family signaling in the pituitary gland: a paradigm for cytokine-neuroendocrine pathways. J Clin Invest 108:1729–1733[CrossRef][Medline]
  7. Giovambattista A, Chisari AN, Gaillard RC, Spinedi E 2000 Modulatory role of the epinergic system in the neuroendocrine-immune system function. Neuroimmunomodulation 8:98–106[CrossRef][Medline]
  8. Hannibal J, Jessop DS, Fahrenkrug J, Harbuz MS, Larsen PJ 1999 PACAP gene expression in neurons of the rat hypothalamo-pituitary-adrenocortical axis is induced by endotoxin and interleukin-1ß. Neuroendocrinology 70:73–82[CrossRef][Medline]
  9. Chikanza IC, Petrou P, Chrousos G 2000 Perturbations of arginine vasopressin secretion during inflammatory stress. Pathophysiologic implications. Ann NY Acad Sci 917:825–834[Medline]
  10. Sugiura S, Lahav R, Han J, Kou SY, Banner LR, de Pablo F, Patterson PH 2000 Leukaemia inhibitory factor is required for normal inflammatory responses to injury in the peripheral and central nervous systems in vivo and is chemotactic for macrophages in vitro. Eur J Neurosci 12:457–466[CrossRef][Medline]
  11. Pariante CM, Pearce BD, Pisell TL, Sanchez CI, Po C, Su C, Miller AH 1999 The proinflammatory cytokine, interleukin-1{alpha}, reduces glucocorticoid receptor translocation and function. Endocrinology 140:4359–4366[Abstract/Free Full Text]
  12. Webster JC, Oakley RH, Jewell CM, Cidlowski JA 2001 Proinflammatory cytokines regulate human glucocorticoid receptor gene expression and lead to the accumulation of the dominant negative ß isoform: a mechanism for the generation of glucocorticoid resistance. Proc Natl Acad Sci USA 98:6865–6870[Abstract/Free Full Text]
  13. Chesnokova V, Melmed S 2002 Minireview: neuro-immuno-endocrine modulation of the HPA axis by gp130 signaling molecules. Endocrinology 143:1571–1574[Abstract/Free Full Text]
  14. Auernhammer CJ, Chesnokova V, Bousquet C, Melmed S 1998 Pituitary corticotroph SOCS-3: novel intracellular regulation of leukemia-inhibitory factor-mediated proopiomelanocortin gene expression and adrenocorticotropin secretion. Mol Endocrinol 12:954–961[Abstract/Free Full Text]
  15. Bousquet C, Chesnokova V, Kariagina A, Ferrand A, Melmed S 2001 cAMP neuropeptide agonists induce pituitary suppressor of cytokine signaling-3: novel negative feedback mechanism for corticotroph cytokine action. Mol Endocrinol 15:1880–1890[Abstract/Free Full Text]
  16. Muglia LJ, Jacobson L, Weninger SC, Karalis KP, Jeong K, Majzoub JA 2001 The physiology of corticotropin-releasing hormone deficiency in mice. Peptides 22:725–731[CrossRef][Medline]
  17. Venihaki M, Majzoub J 2002 Lessons from CRH knockout mice. Neuropeptides 36:96–102[CrossRef][Medline]
  18. Bethin KE, Vogt SK, Muglia LJ 2000 Interleukin-6 is an essential, corticotropin-releasing hormone-independent stimulator of the adrenal axis during immune system activation. Proc Natl Acad Sci USA 97:9317–9322[Abstract/Free Full Text]
  19. Venihaki M, Dikkes P, Carrigan A, Karalis KP 2001 Corticotropin-releasing hormone regulates IL-6 expression during inflammation. J Clin Invest 108:1159–1166[CrossRef][Medline]
  20. Metcalf D 1992 Leukemia inhibitory factor—a puzzling polyfunctional regulator. Growth Factors 7:169–173[Medline]
  21. Gearing DP 1993 The leukemia inhibitory factor and its receptor. Adv Immunol 53:31–58[Medline]
  22. Butzkueven H, Zhang JG, Soilu-Hanninen M, Hochrein H, Chionh F, Shipham KA, Emery B, Turnley AM, Petratos S, Ernst M, Bartlett PF, Kilpatrick TJ 2002 LIF receptor signaling limits immune-mediated demyelination by enhancing oligodendrocyte survival. Nat Med 8:613–619[CrossRef][Medline]
  23. Akita S, Webster J, Ren S-G, Takino H, Said J, Zand O, Melmed S 1995 Human and murine pituitary expression of leukemia inhibitory factor—novel intrapituitary regulation of adrenocorticotropin hormone synthesis and secretion. J Clin Invest 99:1288–1298
  24. Akita S, Readhead C, Stefaneanu L, Fine J, Tenpanaru-Sermesilu A, Kovacs K, Melmed S 1997 Pituitary-directed leukemia inhibitory factor transgene forms Rathke’s cleft cysts and impairs adult pituitary function. J Clin Invest 99:2462–2469[Medline]
  25. Mynard V, Guignat L, Devin-Leclerc J, Bertagna X, Catelli MG 2002 Different mechanisms for leukemia inhibitory factor-dependent activation of two proopiomelanocortin promoter regions. Endocrinology 143:3916–3924[Abstract/Free Full Text]
  26. Bousquet C, Ray DW, Melmed S 1997 A common pro-opiomelanocortin-binding element mediates leukemia inhibitory factor and corticotropin-releasing hormone transcriptional synergy. J Biol Chem 272:10551–10557[Abstract/Free Full Text]
  27. Bousquet C, Zatelli MC, Melmed S 2000 Direct regulation of pituitary proopiomelanocortin by STAT3 provides a novel mechanism for immuno-neuroendocrine interfacing. J Clin Invest 106:1417–14125[Medline]
  28. Wang Z, Ren S-G, Melmed S 1996 Hypothalamic and pituitary leukemia inhibitory factor gene expression in vivo: a novel endotoxin-inducible neuroendocrine interface. Endocrinology 137:2947–2953[Abstract]
  29. Chesnokova V, Melmed S 2000 Leukemia inhibitory factor mediates the hypothalamic pituitary adrenal axis response to inflammation. Endocrinology 141:4032–4040[Abstract/Free Full Text]
  30. Chesnokova V, Kariagina A, Melmed S 2002 Opposing effects of leukemia inhibitory factor and suppressor of cytokine signaling 3 on the ACTH axis response to inflammation. Am J Physiol Endocrinol Metab 282:E1110–E1118
  31. Chesnokova V, Auernhammer CJ, Melmed S 1998 Murine leukemia inhibitory factor (LIF) gene disruption attenuates the hypothalamo-pituitary-adrenal axis stress response. Endocrinology 139:2209–2216[Abstract/Free Full Text]
  32. Auernhammer CJ, Chesnokova V, Melmed S 1998 Leukemia inhibitory factor modulates interleukin 1-ß induced activation of the hypothalamo-pituitary-adrenal axis. Endocrinology 139:2201–2208[Abstract/Free Full Text]
  33. Overbergh L, Valckx D, Waer M, Mathieu C 1999 Quantification of murine cytokine mRNAs using real time quantitative reverse transcriptase PCR. Cytokine 11:305–312[CrossRef][Medline]
  34. Muglia LJ, Bethin KE, Jacobson L, Vogt SK, Majzoub JA 2000 Pituitary-adrenal axis regulation in CRH-deficient mice. Endocr Res 26:1057–1066[Medline]
  35. Morimoto I, Yamamoto S, Kai K, Fujihira T, Morita E, Eto S 2000 Centrally administered murine-leptin stimulates the hypothalamus-pituitary-adrenal axis through arginine-vasopressin. Neuroendocrinology 71:366–374[CrossRef][Medline]
  36. Beishuizen A, Thijs LG 2003 Endotoxin and the hypothalamo-pituitary-adrenal (HPA) axis. J Endotoxin Res 9:3–24[CrossRef]
  37. Patchev VK, Mastorakos G, Brady LS, Redwine J, Wilder RL, Chrousos GP 1993 Increased arginine vasopressin secretion may participate in the enhanced susceptibility of Lewis rats to inflammatory disease. Neuroendocrinology 58:106–110[Medline]
  38. Rivest S 2001 How circulating cytokines trigger the neural circuits that control the hypothalamic-pituitary-adrenal axis. Psychoneuroendocrinology 26:761–788[CrossRef][Medline]
  39. Bousquet C, Melmed S 1999 Critical role for STAT3 in murine pituitary ACTH leukemia inhibitory factor (LIF) signaling. J Biol Chem 274:10723–10730[Abstract/Free Full Text]
  40. Starr R, Willson TA, Viney EM, Murray LJ, Rayner JR, Jenkins BJ, Gonda TJ, Alexander WS, Metcalf D, Nicola NA, Hilton DJ 1997 A family of cytokine-inducible inhibitors of signaling. Nature 26:387:917–921
  41. Nicholson SE, De Souza D, Fabri LJ, Corbin J, Willson TA, Zhang JG, Silva A, Asimakis M, Farley A, Nash AD, Metcalf D, Hilton DJ, Nicola NA, Baca M 2000 Suppressor of cytokine signaling-3 preferentially binds to the SHP-2-binding site on the shared cytokine receptor subunit gp130. Proc Natl Acad Sci USA 97:6493–6498[Abstract/Free Full Text]
  42. Auernhammer CJ, Bousquet C, Melmed S 1999 Autoregulation of pituitary corticotroph SOCS-3 expression: characterization of the murine SOCS 3 promotor. Proc Natl Acad Sci USA 96:6964–6969[Abstract/Free Full Text]
  43. Rivier C, Grigoriadis D, Rivier J 2003 Role of corticotropin-releasing factor receptor type 1 and 2 in modulating the rat adrenocorticotropin response to stressors. Endocrinology 144:2396–2403[Abstract/Free Full Text]
  44. Perlstein RS, Whitnall MH, Abrams JS, Mougey EH, Neta R 1993 Synergistic roles of interleukin 6, interleukin 1, and tumor necrosis factor in the adrenocorticotropin response to bacterial lipopolysaccharide in vivo. Endocrinology 132:946–952[Abstract/Free Full Text]
  45. Dinarello CA, Cannon JG, Wolff SM, Bernheim HA, Beutler B, Cerami A, Figari IS, Paladino Jr MA, O’Connor LV 1986 Tumor necrosis factor (cachectin) is an endogenous pyrogen and induces of production of IL 1. J Exp Med 163:1433–1450[Abstract/Free Full Text]
  46. Fong Y, Tracey KJ, Moldawer LL, Hesse DG, Manague KB, Kenney JS, Lee AT, Kuo GC, Allison AC, Lowry SF 1989 Antibodies to cachectin/tumor necrosis factor reduce interleukin 1 and interleukin 6 appearance during lethal bacteremia. J Exp Med 170:1627–1633[Abstract/Free Full Text]
  47. De Simoni MG, Sironi M, De Luigi A, Manfredi A, Mantovani A, Chezzi P 1990 Intracerebroventricular injection of interleukin 1 induces high circulation levels of interleukin 6. J Exp Med 171:1773–1778[Abstract/Free Full Text]
  48. Ulrich TR, Fann MJ, Patterson PH, Williams JH, Barbu S, Del Castillo JD, Yin SM, Guo K, Remick DG 1994 Intratracheal injection of LPS and cytokines. V. LPS induces expression of LIF and LIF inhibits acute inflammation. Am J Physiol 267(4 Pt 1):L442–L446
  49. Zeigler-Heitbrock HW, Blumenstein M, Kofferlein E, Kieper D, Petersman I, Endres S, Flegel WA, Northoff H, Reitmuller G, Haas JG 1992 In vitro desensitization to lipopolysaccharide suppresses tumor necrosis factor, interleukin-1 and interleukin-6 gene expression in a similar fashion. Immunology 75:264–268[Medline]
  50. Licinio J, Wang ML 1999 The role of inflammatory mediators in the biology of major depression: central nervous system cytokines modulate the biological substrate of depressive symptoms, regulate stress-responsive systems, and contribute to neurotoxicity and neuroprotection. Mol Psychiatry 4:317–327[CrossRef][Medline]
  51. Allan SM, Rothwell NJ 2001 Cytokines and acute neurodegeneration. Nat Rev Neurosci 10:734–744
  52. Lacosta S, Merali Z, Anisman H 1998 Influence of interleukin-1ß on exploratory behaviors, plasma ACTH, corticosterone, and central biogenic amines in mice. Psychopharmacology (Berl) 137:351–361[CrossRef][Medline]
  53. Ando T, Dunn AJ 1999 Mouse tumor necrosis factor-{alpha} increases brain tryptophan concentrations and norepinephrine metabolism while activating the HPA axis in mice. Neuroimmunomodulation 6:319–329[CrossRef][Medline]
  54. Turnbull AV, Smith GW, Lee S, Vale WW, Lee KF, Rivier C 1999 CRF type I receptor-deficient mice exhibit a pronounced pituitary-adrenal response to local inflammation. Endocrinology 140:1013–1017[Abstract/Free Full Text]
  55. Willenberg HS, Path G, Vogeli TA, Scherbaum WA, Bornstein SR 2002 Role of interleukin-6 in stress response in normal and tumorous adrenal cells and during chronic inflammation. Ann NY Acad Sci 2002 966:304–314[Medline]
  56. Lyson K, McCann SM 1991 The effect of interleukin-6 on pituitary hormone release in vivo and in vitro. Neuroendocrinology 54:262–266[Medline]
  57. Mastorakos G, Chrousos GP, Weber JS 1993 Recombinant interleukin 6 activates the hypothalamic-pituitary-adrenal axis in humans. J Clin Endocrinol Metab 77:1690–1694[Abstract]
  58. Baker DG, Ekhator NN, Kasckow JW, Hill KK, Zoumakis E, Dashevsky BA, Chrousos GP, Geracioti Jr TD 2001 Plasma and cerebrospinal fluid interleukin-6 concentrations in posttraumatic stress disorder. Neuroimmunomodulation 9:209–217[CrossRef][Medline]
  59. Ottaviani E, Franceschi C 1998 A new theory on the common evolutionary origin of natural immunity, inflammation and stress response: the invertebrate phagocytic immunocyte as an eye-witness. Domest Anim Endocrinol 15:291–296[CrossRef][Medline]
  60. Murray SE, Lallman HR, Heard AD, Rittenberg MB, Stenzel-Poore MP 2001 A genetic model of stress displays decreased lymphocytes and impaired antibody responses without altered susceptibility to Streptococcus pneumonia. J Immunol 167:691–698[Abstract/Free Full Text]
  61. Melmed S 2001 Series introduction. The immuno-neuroendocrine interface. J Clin Invest 108:1563–1566[CrossRef][Medline]
  62. Chrousos GP 2000 The stress response and immune function: clinical implications. The 1999 Novera H. Spector Lecture. Ann NY Acad Sci 917:38–67[Medline]
  63. Dantzer R, Wollman EE, Vitkovic L, Yirmiya R 1999 Cytokines, stress, and depression. Conclusions and perspectives. Adv Exp Med Biol 461:317–329[Medline]



This article has been cited by other articles:


Home page
EndocrinologyHome page
R. Jankord, J. R. Turk, J. C. Schadt, J. Casati, V. K. Ganjam, E. M. Price, D. H. Keisler, and M. H. Laughlin
Sex Difference in Link between Interleukin-6 and Stress
Endocrinology, August 1, 2007; 148(8): 3758 - 3764.
[Abstract] [Full Text] [PDF]


Home page
Eur J EndocrinolHome page
L. Daza, R. Martin-Jimenez, P. X De la Torre, E. Hernandez, and B. Murillo
Improvement of ACTH response to insulin tolerance test in female patients with rheumatoid arthritis due to tumor necrosis factor inhibition
Eur. J. Endocrinol., July 1, 2007; 157(1): 47 - 51.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
I. V. Mikhaylova, T. Kuulasmaa, J. Jaaskelainen, and R. Voutilainen
Tumor Necrosis Factor-{alpha} Regulates Steroidogenesis, Apoptosis, and Cell Viability in the Human Adrenocortical Cell Line NCI-H295R
Endocrinology, January 1, 2007; 148(1): 386 - 392.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
A. I Arroba, A. M Lechuga-Sancho, L. M Frago, J. Argente, and J. A Chowen
Increased apoptosis of lactotrophs in streptozotocin-induced diabetic rats is followed by increased proliferation.
J. Endocrinol., October 1, 2006; 191(1): 55 - 63.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
R. Janoschek, L. Plum, L. Koch, H. Munzberg, S. Diano, M. Shanabrough, W. Muller, T. L. Horvath, and J. C. Bruning
gp130 signaling in proopiomelanocortin neurons mediates the acute anorectic response to centrally applied ciliary neurotrophic factor
PNAS, July 11, 2006; 103(28): 10707 - 10712.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
K. Zacharowski, P. A. Zacharowski, A. Koch, A. Baban, N. Tran, R. Berkels, C. Papewalis, K. Schulze-Osthoff, P. Knuefermann, U. Zahringer, et al.
Toll-like receptor 4 plays a crucial role in the immune-adrenal response to systemic inflammatory response syndrome
PNAS, April 18, 2006; 103(16): 6392 - 6397.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
A. Kariagina, S. Zonis, M. Afkhami, D. Romanenko, and V. Chesnokova
Leukemia inhibitory factor regulates glucocorticoid receptor expression in the hypothalamic-pituitary-adrenal axis
Am J Physiol Endocrinol Metab, November 1, 2005; 289(5): E857 - E863.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
V. Chesnokova, K. Kovacs, A.-V. Castro, S. Zonis, and S. Melmed
Pituitary Hypoplasia in Pttg-/- Mice Is Protective for Rb+/- Pituitary Tumorigenesis
Mol. Endocrinol., September 1, 2005; 19(9): 2371 - 2379.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kariagina, A.
Right arrow Articles by Chesnokova, V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kariagina, A.
Right arrow Articles by Chesnokova, V.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals