| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Division of Pharmaceutical Sciences, College of Pharmacy, University of Kentucky, Lexington, Kentucky 40536-0082
Address all correspondence and requests for reprints to: Lisa A. Cassis, Ph.D., Room 434, College of Pharmacy, University of Kentucky, Lexington, Kentucky 40536-0082. E-mail: lcassis{at}uky.edu.
| Abstract |
|---|
|
|
|---|
-methyl-p-tyrosine on catecholamine turnover and plasma leptin concentration in saline- and AngII (175 ng/kg·min)-infused rats. Infusion of AngII increased catecholamine turnover in adipose tissue. Moreover, sympathetic blockade eliminated differences in plasma leptin concentration between saline- and AngII-infused rats. These results indicate that locally produced AngII directly increases leptin release from adipocytes; however, with elevations in systemic AngII, sympathetic activation counterbalances effects from locally produced AngII. | Introduction |
|---|
|
|
|---|
The ability of adipocytes to synthesize and secrete angiotensinogen has spurred a variety of studies aimed at determining the functional significance of adipose angiotensinogen and angiotensin production. Previous studies demonstrated that exogenous AngII increased leptin gene expression and secretion from cultured and human adipocytes (17), suggesting a link between AngII and leptin in the control of adipocyte function. Mechanisms for AngII regulation of leptin were not determined; however, AngII regulation of leptin secretion did not involve intermediary prostaglandins. In contrast, previous studies in our laboratory demonstrated that chronic infusion of pressor doses of AngII to rats reduced adipose tissue mass and the circulating leptin concentration (18). These results suggest differences between elevations in circulating vs. locally produced AngII in the modulation of leptin release from the adipocyte. Understanding mechanisms contributing to regulation of leptin by angiotensin is of significance due to the important role of adipose-derived leptin and/or AngII in a variety of disorders of the metabolic syndrome.
The purpose of this study was to determine the role of locally produced vs. elevated systemic AngII in the regulation of leptin release by adipocytes. Measurement of leptin and angiotensin peptide concentrations released from adipocytes of control and captopril-treated rats was performed to determine the relationship between locally produced AngII and leptin release. Incubation of adipocytes with exogenous AngII was examined to directly establish AngII-regulation of leptin release. To mimic disorders of the metabolic syndrome with elevations in systemic AngII, rats were infused chronically with AngII and plasma leptin concentration and adipocyte leptin release determined. Finally, the role of the sympathetic nervous system in AngII regulation of plasma leptin concentration was examined. Our findings demonstrate that locally produced AngII stimulates leptin release from adipocytes. With chronic elevations in systemic AngII, findings suggest that stimulation of leptin release from adipocytes by AngII is counterbalanced by chronic sympathetic activation to adipose tissue with resultant reductions in circulating leptin.
| Materials and Methods |
|---|
|
|
|---|
Measurement of plasma leptin concentration, leptin mRNA expression, and release from isolated adipocytes
The plasma concentration of leptin was measured in duplicate in 100-µl aliquots of plasma from rats (fasted overnight) using a commercial RIA kit (Linco Research, Inc., St. Charles, MO) with a rat leptin antibody. Leptin release from isolated adipocytes was measured in the media (100 µl) from incubated cells and normalized to the cell protein content. The sensitivity of the kit for rat leptin was 0.5 ng/ml and the intra- and interassay variability were 2.5 and 4.5%, respectively. Adipocyte leptin release ranged from 0.5 to 4 ng/ml, within the standard curve for the assay.
For measurement of leptin mRNA expression, total RNA was extracted from adipocytes using the Trizol kit (Invitrogen, Carlsbad, CA) according to the manufacturers instructions. Total RNA (0.4 µg) was reverse transcribed with the following components: random decamers, 10x reverse transcription buffer, deoxynucleotide triphosphate mix, ribonuclease inhibitor reverse transcriptase [Retroscript (Ambion, TX)]. Relative quantification of gene expression was performed with the iCycler system (Bio-Rad Laboratories, Hercules, CA) using the standard curve method. SYBR Green PCR core reagents (Applied Biosystems, Foster City, CA) were used at the following concentration in a total volume of 50 µl: SYBR Green mix (1x), MgCl2 (3 mM), deoxynucleotide triphosphate mix (1.25 mM), fluorescein (0.01 µM), primers (0.5 µM), and AmpliTaq gold (2.5 µ). The 18s rRNA was used as the endogenous control gene. Primers were designed using Primer 3 software and were the following: 1) leptin: forward primer: 5'TGACACCAAAACCCTCATCA, reverse primer: 5'ATGAAGTCCAAACCGGTGAC yielding a 102-bp size product; and 2) 18s rRNA: forward primer: 5'CGCGGTTCTATTTTGTTGGT3', reverse primer: 5'AGTCGGCATCGTTTATGGTC3' yielding a 219-bp size product. The real-time PCR conditions for both genes were 5 min at 94 C, 40 cycles with 1 min at 94 C, 1 min at 64 C, 1 min at 72 C, and a final elongation step for 10 min at 72 C. The threshold cycle (first cycle for a given sample at which fluorescence rises above background) was used to quantify mRNA expression, with a maximum of 40 cycles for very low level mRNA expression.
Measurement of angiotensin peptide concentrations released from isolated adipocytes
An inhibitor cocktail (100 µl; pepstatin 146 mM, 1,10 phenanthrolene 20 mM, neomycin sulfate 2 mg/ml, EDTA 125 mM; drugs dissolved initially in a small volume of dimethylsulfoxide) was added to the media (800 µl) from incubated adipocytes to protect the angiotensin peptides and prevent further angiotensin formation during extraction. The media were partially purified by Sep Pak C18 column (Waters, Milford, MA) chromatography (8). Columns were preequilibrated with 4 ml methanol, followed by 4 ml of 0.1% trifluoroacetic acid (TFA). Samples were acidified (1:1) with 0.6% TFA and applied to the columns with gentle pressure. Angiotensin peptides were eluted from the columns with 2 ml acetonitrile/water/TFA (90/10/0.1), followed by 2 ml of methanol/acetonitrile/TFA (67/33/0.1). The eluate was dried in a Speed Vac concentrator, reconstituted in 100 µl of mobile phase buffer A, and centrifuged over a 0.45-µm filter at 3000 x g for 15 min. The HPLC system consisted of a Beckman binary gradient pump, a UV detector, a chart recorder, and a fraction collector. For separation of angiotensin peptides, the mobile phase consisted of 25 mM phosphate with 5% acetonitrile (buffer A) and 25 mM phosphate with 33% acetonitrile (buffer B) over a C18 analytical column (Beckman, Fullerton, CA). Gradient elution (from 2490% buffer B) was achieved over 33 min at a flow rate of 1 ml/min. Fractions from the HPLC column were collected at 1 ml/min, evaporated overnight, and reconstituted. Individual angiotensin peptide standards [AngII, Angiotensin III (AngIII), Angiotensin IV (AngIV), Angiotensin 48 (Ang48), Angiotensin 58] were prepared and injected onto the HPLC daily for determination of retention times. Immunoreactive angiotensin peptides in individual HPLC fractions from unknowns and standards were then quantified by RIA. The recovery of AngII through the extraction process was approximately 80%, and the cross-reactivity of the AngII antibody in the RIA was 100% for AngIII, AIV, and Ang48, and less than 5% for Angiotensin 58.
Administration of drugs
Male Sprague Dawley rats (350400 g; Harlan Laboratories, Indianapolis, IN) were used in all studies. All rats were housed two per cage in an approved animal facility for 1 wk before use under a 12, 12 h-h light, 12 h-dark cycle and were given free access to food and water. All studies were reviewed and approved by the Institutional Animal Care and Use Committee.
For captopril and losartan treatment, rats were administered captopril (100 mg/kg·d) or losartan (10 mg/kg·d) in the drinking water for 3 d (n = 5/group). Daily body weight, food intake, and water intake were determined during drug treatment.
For AngII infusion, rats were anesthetized, shaved in the interscapular region, and osmotic minipumps (model 2001 for 7-d infusion; Alza Corp., Mountain View, CA) were implanted sc. Minipumps contained either AngII (175 ng/kg·min; Sigma, St. Louis, MO) or sterile saline (sham-surgery) and were primed according to the manufacturers instructions preceding implantation to assure immediate sc delivery of AngII. The skin overlaying the minipump was closed with surgical staples, and the rats were allowed to recover on warmed heating pads.
Assessment of sympathetic activity by measurement of norepinephrine (NE) turnover after blockade of the sympathetic nervous system
Measurement of NE turnover in tissues was according to previously published methods (19, 20). Rats designated to control (saline-infused) or AngII (175 ng/kg·min) groups were injected (ip) with either vehicle or the tyrosine hydroxylase inhibitor,
-methyl-p-tyrosine methyl ester (AMPT, 300 mg/kg; Sigma) on the final day of the study. Rats in each group (saline, AngII) were euthanatized immediately (time 0 group) or at 4 and 8 h after administration of AMPT. Epididymal white fat (EF) and kidney were removed and frozen. The NE concentration in tissues was determined using HPLC with electrochemical detection by previously published methods (21). For plasma or tissue NE concentration, the entire organ or 1 ml of plasma was removed and processed through alumina extraction with an internal standard (dihydroxybenzylamine) to correct for recovery (>90%). An aliquot of the alumina extract was injected onto the HPLC using electrochemical detection to quantify catecholamines (NE concentration normalized to the tissue wet weight). Linear regression of the log[NE] vs. time relationship was performed using individual data points obtained at 0, 4, and 8 h after AMPT. The slope (m) and SE of the regression coefficient were computed by covariance matrix analysis. Between-group comparison of slopes was performed using covariance matrix analysis. The rate constant for NE disappearance (defined as m/0.434) was calculated as described by Brodie et al. (19).
Statistics
All data are reported as mean ± SEM. P values < 0.05 were considered statistically significant. ANOVA was used to determine between-group differences in measured parameters. Post hoc analysis was performed using Tukeys multiple comparison test with significance at P < 0.05. For the NE turnover data, the slope of the decline in NE concentration between groups was determined using covariance matrix analysis.
| Results |
|---|
|
|
|---|
|
|
|
|
Plasma leptin concentration was significantly decreased in AngII-infused rats, compared with saline controls (Fig. 5
, time 0). After sympathetic blockade with AMPT, the plasma concentration of leptin increased significantly in each group. However, differences in plasma leptin between saline- and AngII-infused rats were no longer evident in rats treated with AMPT (4 and 8 h; Fig. 5
).
|
| Discussion |
|---|
|
|
|---|
A variety of evidence demonstrates the localization of components of the renin-angiotensin system to rodent and human adipose tissue (for review, see Ref.13). Angiotensinogen, the only known precursor to AngII, is expressed at a high level in rat adipose tissue (1, 2, 3) and isolated or cultured adipocytes (22). Although previous studies (4) in our laboratory suggested that the renin gene was not expressed in rat brown adipose tissue, several investigators (6, 13) have demonstrated renin-like activity in white adipocytes and adipose tissue homogenates. ACE has been localized to adipose tissue (5, 6), thereby completing the enzymatic requirements for synthesis of AngII. Finally, both the angiotensin II type 1 (AT1) and the type 2 receptor have been localized to adipocytes and preadipocytes (10, 11, 23, 24). Therefore, a variety of evidence supports the presence of components necessary for AngII production in adipose tissue (for review see Ref.13). In contrast, relatively few studies have focused on angiotensin peptide formation and release from adipocytes. Our results demonstrate that rat adipocytes release primarily AngII, with easily detectable levels of AngII present within 1 h of incubation of primary isolates of white adipocytes. Angiotensin III and AngIV were also detected in the media from incubated adipocytes; however, levels of these angiotensin peptides were minimal (<2% of total angiotensins), compared with AngII. These results are in agreement with recent findings demonstrating the release of predominately AngII from human preadipocytes and adipocytes (9).
In this study systemic inhibition of ACE with captopril resulted in a marked reduction in adipocyte AngII release, demonstrating that ACE contributes to adipocyte AngII production. In cultured 3T3-F442A adipocytes, Saye et al. (7) demonstrated cell-dependent production of AngII, which was not influenced by inhibition of ACE. In adipose tissue extracts, Harp and DiGirolamo (24) demonstrated ACE activity that was inhibited in the presence of captopril. We did not examine the effect of in vitro captopril on adipocyte AngII release; therefore, it is conceivable that reductions in adipocyte AngII release in captopril-treated rats in this study resulted from a reduced level of systemic AngII peptides taken up and stored in adipocytes. However, given that the release of AngII into the media of incubated adipocytes increased with the duration of incubation, results from this study suggest that AngII in the media from incubated adipocytes represents locally produced peptide formed through enzymatic conversion by ACE.
In adipocytes exhibiting reductions in AngII release from captopril treatment, parallel reductions in adipocyte leptin release and plasma leptin concentration were demonstrated. Inhibition of ACE can alter several bioactive peptides; thus, we determined that a selective AT1 receptor antagonist resulted in a similar decline in plasma leptin concentration. These results demonstrate that endogenous AngII regulates leptin release through effects at the AT1 receptor. To confirm a direct effect of AngII to regulate leptin, we incubated adipocytes with exogenous AngII and demonstrated high potency AngII-induced increases in leptin release from adipocytes. The sensitivity of adipocytes to AngII (subnanomolar) for regulation of leptin release, coupled with the finding that adipocytes release AngII, suggests that AngII regulation of leptin is physiologically relevant. Finally, elevations in leptin mRNA expression by AngII suggest that rather than alter mechanisms for release of leptin, AngII stimulates leptin gene expression. Our results are in agreement with previous findings demonstrating high potency of exogenous AngII to elicit the release of leptin from human and 3T3-L1 adipocytes (17). In addition, these results extend previous findings by demonstrating that reductions in endogenously produced AngII modulate leptin release from adipocytes.
Many disease states associated with the metabolic syndrome exhibit alterations in leptin and/or AngII, including obesity, hypertension, and atherosclerosis. Thus, we determined whether systemic infusion of AngII, to mimic activation of the renin-angiotensin system, resulted in similar effects on adipocyte leptin release. Similar to initial findings, basal and AngII-stimulated release of leptin from isolated adipocytes prepared from AngII-infused rats was initially enhanced (1 d). However, with chronic AngII exposure, both basal and AngII-stimulated leptin release progressively declined and was paralleled by reductions in circulating leptin. A well-known effect of AngII is facilitation of the sympathetic nervous system, which contributes to the control of blood pressure (25). A variety of evidence demonstrates that the sympathetic nervous system negatively regulates leptin synthesis and secretion from adipose tissue (26, 27, 28, 29). For example, reductions in sympathetic drive (through ganglionic blockade or inhibition of NE synthesis) increase leptin gene expression and production (27, 29). Alternatively, in states of high sympathetic drive, such as cold exposure, leptin gene expression in adipose tissue is reduced (30). We sought to determine whether sympathetic stimulation to adipose tissue from chronic AngII exposure contributes to the observed reductions in leptin. Our approach was to examine declines in adipose tissue NE concentration and plasma leptin concentration after AMPT, which inhibits NE synthesis and thereby produces sympathetic blockade. An interesting finding from the present study is that AngII infusion increased the rate of NE decline (catecholamine turnover) in white adipose tissue, but not in kidney, demonstrating the sensitivity of AngII-induced sympathetic activation to adipose tissue.
Previous studies demonstrated that AMPT administration to normal rats increased plasma leptin concentration, leptin gene expression in adipose tissue, and complex tissue and subtype-specific modulation of adipose uncoupling protein mRNA expression (27). However, adipose tissue catecholamine content was not measured in previous studies. In agreement with previous findings, results from this study demonstrate an increase in plasma leptin concentration after AMPT administration to saline-infused rats. These results support the previously defined inhibitory role of the sympathetic nervous system in the regulation of leptin. Importantly, in rats infused with AngII, sympathetic blockade with AMPT eliminated differences in plasma leptin concentration between saline- and AngII-infused rats. Taken together with results demonstrating increased adipose catecholamine turnover in AngII-infused rats, these results suggest that chronic elevations in systemic AngII increased sympathetic drive to adipose tissue, thereby decreasing adipocyte leptin synthesis and release.
In summary, results from this study demonstrate that rat white adipocytes release AngII, which is reduced by in vivo inhibition of angiotensin converting enzyme. Reductions in locally released AngII through inhibition of angiotensin converting enzyme were associated with parallel reductions in adipocyte leptin release and plasma leptin concentration. Moreover, exogenously applied AngII directly increased leptin mRNA expression and release from adipocytes. These results demonstrate that under basal conditions, adipocyte-derived AngII stimulates leptin release. However, when AngII is elevated systemically, negative regulation of leptin through sympathetic stimulation overwhelms the direct stimulatory effect of AngII. Future studies will determine the impact of interactions between these factors in diseases of the metabolic syndrome.
| Footnotes |
|---|
Abbreviations: ACE, Angiotensin-converting enzyme; AMPT,
-methyl-p-tyrosine methyl ester; AngII, Angiotensin II; AngIII, Angiotensin III; AngIV, Angiotensin IV; Ang48, Angiotensin 48; AT1, AngII type 1; EF, epididymal white fat; NE, norepinephrine; TFA, trifluoroacetic acid.
Received June 19, 2003.
Accepted for publication September 15, 2003.
| References |
|---|
|
|
|---|
-methyl-p-tyrosine. FEBS Lett 429:395398[CrossRef][Medline]
This article has been cited by other articles:
![]() |
K. K. Koh, S. M. Park, and M. J. Quon Leptin and Cardiovascular Disease: Response to Therapeutic Interventions Circulation, June 24, 2008; 117(25): 3238 - 3249. [Full Text] [PDF] |
||||
![]() |
A. T. Lely, J. A. Krikken, S. J. L. Bakker, F. Boomsma, R. P. F. Dullaart, B. H. R. Wolffenbuttel, and G. Navis Low Dietary Sodium and Exogenous Angiotensin II Infusion Decrease Plasma Adiponectin Concentrations in Healthy Men J. Clin. Endocrinol. Metab., May 1, 2007; 92(5): 1821 - 1826. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Lu, C. M. Boustany-Kari, A. Daugherty, and L. A. Cassis Angiotensin II increases adipose angiotensinogen expression Am J Physiol Endocrinol Metab, May 1, 2007; 292(5): E1280 - E1287. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Paul, A. Poyan Mehr, and R. Kreutz Physiology of local Renin-Angiotensin systems. Physiol Rev, July 1, 2006; 86(3): 747 - 803. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Zeidan, D. M. Purdham, V. Rajapurohitam, S. Javadov, S. Chakrabarti, and M. Karmazyn Leptin Induces Vascular Smooth Muscle Cell Hypertrophy through Angiotensin II- and Endothelin-1-Dependent Mechanisms and Mediates Stretch-Induced Hypertrophy J. Pharmacol. Exp. Ther., December 1, 2005; 315(3): 1075 - 1084. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Kouyama, T. Suganami, J. Nishida, M. Tanaka, T. Toyoda, M. Kiso, T. Chiwata, Y. Miyamoto, Y. Yoshimasa, A. Fukamizu, et al. Attenuation of Diet-Induced Weight Gain and Adiposity through Increased Energy Expenditure in Mice Lacking Angiotensin II Type 1a Receptor Endocrinology, August 1, 2005; 146(8): 3481 - 3489. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Cabassi, P. Coghi, P. Govoni, E. Barouhiel, E. Speroni, S. Cavazzini, A. M. Cantoni, R. Scandroglio, and E. Fiaccadori Sympathetic Modulation by Carvedilol and Losartan Reduces Angiotensin II-Mediated Lipolysis in Subcutaneous and Visceral Fat J. Clin. Endocrinol. Metab., May 1, 2005; 90(5): 2888 - 2897. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. S. Gopalakrishnan, D. S. Gardner, S. M. Rhind, M. T. Rae, C. E. Kyle, A. N. Brooks, R. M. Walker, M. M. Ramsay, D. H. Keisler, T. Stephenson, et al. Programming of adult cardiovascular function after early maternal undernutrition in sheep Am J Physiol Regulatory Integrative Comp Physiol, July 1, 2004; 287(1): R12 - R20. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |