help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2003-0767
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
145/1/169    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cassis, L. A.
Right arrow Articles by Boustany, C. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cassis, L. A.
Right arrow Articles by Boustany, C. M.
Endocrinology Vol. 145, No. 1 169-174
Copyright © 2004 by The Endocrine Society

Differential Effects of Local Versus Systemic Angiotensin II in the Regulation of Leptin Release from Adipocytes

Lisa A. Cassis, Victoria L. English, Kalyani Bharadwaj and Carine M. Boustany

Division of Pharmaceutical Sciences, College of Pharmacy, University of Kentucky, Lexington, Kentucky 40536-0082

Address all correspondence and requests for reprints to: Lisa A. Cassis, Ph.D., Room 434, College of Pharmacy, University of Kentucky, Lexington, Kentucky 40536-0082. E-mail: lcassis{at}uky.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Adipocytes secrete a variety of factors, including angiotensinogen, the only known precursor to Angiotensin II (AngII). Recent studies suggest that adipocyte-derived angiotensinogen can contribute to circulating angiotensinogen concentrations and modulate blood pressure; however, an autocrine role for adipocyte-derived angiotensinogen and/or AngII has not been well defined. We sought to determine whether locally produced AngII influences the release of leptin from adipocytes and thus circulating leptin concentrations. In adipocytes from rats treated for 3 d with captopril demonstrating reductions in AngII release, leptin release and plasma leptin concentration were decreased. Incubation of adipocytes with AngII resulted in an increase in leptin mRNA expression and leptin release. To determine the effect of elevated systemic AngII on leptin, rats were infused with AngII (175 ng/kg·min) or saline for 1, 2, or 7 d. Plasma leptin concentration progressively declined with duration of AngII exposure. Basal and AngII-stimulated release of leptin from isolated adipocytes was initially (d 1) increased in AngII-infused rats; thereafter leptin release declined to levels less than control. To define mechanisms for declines in leptin in AngII-infused rats, we examined the effect of {alpha}-methyl-p-tyrosine on catecholamine turnover and plasma leptin concentration in saline- and AngII (175 ng/kg·min)-infused rats. Infusion of AngII increased catecholamine turnover in adipose tissue. Moreover, sympathetic blockade eliminated differences in plasma leptin concentration between saline- and AngII-infused rats. These results indicate that locally produced AngII directly increases leptin release from adipocytes; however, with elevations in systemic AngII, sympathetic activation counterbalances effects from locally produced AngII.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
INCREASING EVIDENCE INDICATES that adipose tissue is an important source of adipokines and endocrine factors that have a broad array of physiologic effects. Angiotensinogen, the only known precursor to Angiotensin II (AngII), is synthesized and secreted by brown and white adipocytes (1, 2, 3). In addition to angiotensinogen, previous studies demonstrated renin-like activity (4), angiotensin-converting enzyme (ACE) activity (5, 6), immunoreactive AngII (4, 7, 8, 9), and AngII receptor localization (10, 11) in adipocytes. Moreover, various components of the renin-angiotensin system have been localized to human adipose tissue (12, 13). A growing body of evidence supports the concept that alterations in adipocyte production of components of the renin-angiotensin system may contribute to disorders of the metabolic syndrome, including obesity and obesity-related hypertension, diabetes, and atherosclerosis (14, 15). For example, recent results from genetically engineered mice overexpressing the angiotensinogen gene in adipose tissue support the concept that adipocyte-derived angiotensinogen can contribute to the circulating angiotensinogen concentration and modulate blood pressure (16).

The ability of adipocytes to synthesize and secrete angiotensinogen has spurred a variety of studies aimed at determining the functional significance of adipose angiotensinogen and angiotensin production. Previous studies demonstrated that exogenous AngII increased leptin gene expression and secretion from cultured and human adipocytes (17), suggesting a link between AngII and leptin in the control of adipocyte function. Mechanisms for AngII regulation of leptin were not determined; however, AngII regulation of leptin secretion did not involve intermediary prostaglandins. In contrast, previous studies in our laboratory demonstrated that chronic infusion of pressor doses of AngII to rats reduced adipose tissue mass and the circulating leptin concentration (18). These results suggest differences between elevations in circulating vs. locally produced AngII in the modulation of leptin release from the adipocyte. Understanding mechanisms contributing to regulation of leptin by angiotensin is of significance due to the important role of adipose-derived leptin and/or AngII in a variety of disorders of the metabolic syndrome.

The purpose of this study was to determine the role of locally produced vs. elevated systemic AngII in the regulation of leptin release by adipocytes. Measurement of leptin and angiotensin peptide concentrations released from adipocytes of control and captopril-treated rats was performed to determine the relationship between locally produced AngII and leptin release. Incubation of adipocytes with exogenous AngII was examined to directly establish AngII-regulation of leptin release. To mimic disorders of the metabolic syndrome with elevations in systemic AngII, rats were infused chronically with AngII and plasma leptin concentration and adipocyte leptin release determined. Finally, the role of the sympathetic nervous system in AngII regulation of plasma leptin concentration was examined. Our findings demonstrate that locally produced AngII stimulates leptin release from adipocytes. With chronic elevations in systemic AngII, findings suggest that stimulation of leptin release from adipocytes by AngII is counterbalanced by chronic sympathetic activation to adipose tissue with resultant reductions in circulating leptin.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Isolation of epididymal adipocytes
White adipocytes were prepared from the epididymal fat pad by previously established methodologies using collagenase digestion (4). Briefly, the epididymal fat pad was minced in Kreb’s bicarbonate buffer (pH 7.4) containing 1% fatty acid free albumin. Adipocytes were isolated by digestion with collagenase (1 mg/ml; Worthington, Freehold, NJ) for 60 min at 37 C with vigorous shaking. Digested material was filtered through a 500-µm nylon mesh and the adipocytes were allowed to float to the surface. The infranatant was removed and adipocytes were washed two times in fresh buffer and then an additional three times in buffer without albumin. Isolated adipocytes (300 µl aliquot) were incubated with Kreb’s buffer (total volume of 1 ml) containing 10 mM HEPES, 2 mM L-glutamine, and 0.5% fetal bovine serum in a CO2 incubator for 60 min at 37 C. At the end of the incubation, the media were removed for measurement of angiotensin peptides and/or leptin. The cell suspension was lysed with 1N NaOH for protein measurement.

Measurement of plasma leptin concentration, leptin mRNA expression, and release from isolated adipocytes
The plasma concentration of leptin was measured in duplicate in 100-µl aliquots of plasma from rats (fasted overnight) using a commercial RIA kit (Linco Research, Inc., St. Charles, MO) with a rat leptin antibody. Leptin release from isolated adipocytes was measured in the media (100 µl) from incubated cells and normalized to the cell protein content. The sensitivity of the kit for rat leptin was 0.5 ng/ml and the intra- and interassay variability were 2.5 and 4.5%, respectively. Adipocyte leptin release ranged from 0.5 to 4 ng/ml, within the standard curve for the assay.

For measurement of leptin mRNA expression, total RNA was extracted from adipocytes using the Trizol kit (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions. Total RNA (0.4 µg) was reverse transcribed with the following components: random decamers, 10x reverse transcription buffer, deoxynucleotide triphosphate mix, ribonuclease inhibitor reverse transcriptase [Retroscript (Ambion, TX)]. Relative quantification of gene expression was performed with the iCycler system (Bio-Rad Laboratories, Hercules, CA) using the standard curve method. SYBR Green PCR core reagents (Applied Biosystems, Foster City, CA) were used at the following concentration in a total volume of 50 µl: SYBR Green mix (1x), MgCl2 (3 mM), deoxynucleotide triphosphate mix (1.25 mM), fluorescein (0.01 µM), primers (0.5 µM), and AmpliTaq gold (2.5 µ). The 18s rRNA was used as the endogenous control gene. Primers were designed using Primer 3 software and were the following: 1) leptin: forward primer: 5'TGACACCAAAACCCTCATCA, reverse primer: 5'ATGAAGTCCAAACCGGTGAC yielding a 102-bp size product; and 2) 18s rRNA: forward primer: 5'CGCGGTTCTATTTTGTTGGT3', reverse primer: 5'AGTCGGCATCGTTTATGGTC3' yielding a 219-bp size product. The real-time PCR conditions for both genes were 5 min at 94 C, 40 cycles with 1 min at 94 C, 1 min at 64 C, 1 min at 72 C, and a final elongation step for 10 min at 72 C. The threshold cycle (first cycle for a given sample at which fluorescence rises above background) was used to quantify mRNA expression, with a maximum of 40 cycles for very low level mRNA expression.

Measurement of angiotensin peptide concentrations released from isolated adipocytes
An inhibitor cocktail (100 µl; pepstatin 146 mM, 1,10 phenanthrolene 20 mM, neomycin sulfate 2 mg/ml, EDTA 125 mM; drugs dissolved initially in a small volume of dimethylsulfoxide) was added to the media (800 µl) from incubated adipocytes to protect the angiotensin peptides and prevent further angiotensin formation during extraction. The media were partially purified by Sep Pak C18 column (Waters, Milford, MA) chromatography (8). Columns were preequilibrated with 4 ml methanol, followed by 4 ml of 0.1% trifluoroacetic acid (TFA). Samples were acidified (1:1) with 0.6% TFA and applied to the columns with gentle pressure. Angiotensin peptides were eluted from the columns with 2 ml acetonitrile/water/TFA (90/10/0.1), followed by 2 ml of methanol/acetonitrile/TFA (67/33/0.1). The eluate was dried in a Speed Vac concentrator, reconstituted in 100 µl of mobile phase buffer A, and centrifuged over a 0.45-µm filter at 3000 x g for 15 min. The HPLC system consisted of a Beckman binary gradient pump, a UV detector, a chart recorder, and a fraction collector. For separation of angiotensin peptides, the mobile phase consisted of 25 mM phosphate with 5% acetonitrile (buffer A) and 25 mM phosphate with 33% acetonitrile (buffer B) over a C18 analytical column (Beckman, Fullerton, CA). Gradient elution (from 24–90% buffer B) was achieved over 33 min at a flow rate of 1 ml/min. Fractions from the HPLC column were collected at 1 ml/min, evaporated overnight, and reconstituted. Individual angiotensin peptide standards [AngII, Angiotensin III (AngIII), Angiotensin IV (AngIV), Angiotensin 4–8 (Ang4–8), Angiotensin 5–8] were prepared and injected onto the HPLC daily for determination of retention times. Immunoreactive angiotensin peptides in individual HPLC fractions from unknowns and standards were then quantified by RIA. The recovery of AngII through the extraction process was approximately 80%, and the cross-reactivity of the AngII antibody in the RIA was 100% for AngIII, AIV, and Ang4–8, and less than 5% for Angiotensin 5–8.

Administration of drugs
Male Sprague Dawley rats (350–400 g; Harlan Laboratories, Indianapolis, IN) were used in all studies. All rats were housed two per cage in an approved animal facility for 1 wk before use under a 12, 12 h-h light, 12 h-dark cycle and were given free access to food and water. All studies were reviewed and approved by the Institutional Animal Care and Use Committee.

For captopril and losartan treatment, rats were administered captopril (100 mg/kg·d) or losartan (10 mg/kg·d) in the drinking water for 3 d (n = 5/group). Daily body weight, food intake, and water intake were determined during drug treatment.

For AngII infusion, rats were anesthetized, shaved in the interscapular region, and osmotic minipumps (model 2001 for 7-d infusion; Alza Corp., Mountain View, CA) were implanted sc. Minipumps contained either AngII (175 ng/kg·min; Sigma, St. Louis, MO) or sterile saline (sham-surgery) and were primed according to the manufacturer’s instructions preceding implantation to assure immediate sc delivery of AngII. The skin overlaying the minipump was closed with surgical staples, and the rats were allowed to recover on warmed heating pads.

Assessment of sympathetic activity by measurement of norepinephrine (NE) turnover after blockade of the sympathetic nervous system
Measurement of NE turnover in tissues was according to previously published methods (19, 20). Rats designated to control (saline-infused) or AngII (175 ng/kg·min) groups were injected (ip) with either vehicle or the tyrosine hydroxylase inhibitor, {alpha}-methyl-p-tyrosine methyl ester (AMPT, 300 mg/kg; Sigma) on the final day of the study. Rats in each group (saline, AngII) were euthanatized immediately (time 0 group) or at 4 and 8 h after administration of AMPT. Epididymal white fat (EF) and kidney were removed and frozen. The NE concentration in tissues was determined using HPLC with electrochemical detection by previously published methods (21). For plasma or tissue NE concentration, the entire organ or 1 ml of plasma was removed and processed through alumina extraction with an internal standard (dihydroxybenzylamine) to correct for recovery (>90%). An aliquot of the alumina extract was injected onto the HPLC using electrochemical detection to quantify catecholamines (NE concentration normalized to the tissue wet weight). Linear regression of the log[NE] vs. time relationship was performed using individual data points obtained at 0, 4, and 8 h after AMPT. The slope (m) and SE of the regression coefficient were computed by covariance matrix analysis. Between-group comparison of slopes was performed using covariance matrix analysis. The rate constant for NE disappearance (defined as m/0.434) was calculated as described by Brodie et al. (19).

Statistics
All data are reported as mean ± SEM. P values < 0.05 were considered statistically significant. ANOVA was used to determine between-group differences in measured parameters. Post hoc analysis was performed using Tukey’s multiple comparison test with significance at P < 0.05. For the NE turnover data, the slope of the decline in NE concentration between groups was determined using covariance matrix analysis.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Effect of angiotensin on leptin mRNA expression and release
Initial studies characterized the time course for release of total immunoreactive angiotensin peptides and leptin from isolated white adipocytes. Angiotensin peptide and leptin release increased over a 20-h period of incubation and were detectable within 1 h of incubation (data not shown); therefore, all subsequent studies with isolated adipocytes were performed using a 60-min incubation. The predominant angiotensin peptide released from adipocytes was AngII (>98% of total angiotensin peptide concentration), with very small detectable levels of AngIII, AngIV, and Ang4–8. To determine whether AngII regulated leptin release from adipocytes, groups of rats were treated for 3 d with captopril or losartan. Neither drug influenced food intake, water intake, or body weight of rats (data not shown). Plasma leptin concentrations were significantly reduced in captopril- or losartan-treated rats, compared with control (control: 3.40 ± 0.44; captopril: 2.37 ± 0.34 ng/ml; losartan: 2.59 ± 0.28; P = 0.017). Treatment of rats for 3 d with captopril resulted in a significant reduction (by 84%) in AngII release from white adipocytes (Fig. 1AGo). Coincident with reductions in AngII release from adipocytes, leptin release was also significantly decreased (Fig. 1BGo). In separate studies, we examined the effect of exogenous AngII on leptin mRNA expression and release from adipocytes (n = 5 rats). AngII resulted in a concentration-dependent increase in leptin release from adipocytes with an EC50 of 0.16 ± 0.04 nM (Fig. 2Go). Furthermore, incubation with AngII (1 µM) resulted in a significant increase in leptin mRNA expression (ratio of leptin/18S mRNA expression: control, 0.83 ± 0.04; AngII: 1.01 ± 0.06; P = 0.04).



View larger version (13K):
[in this window]
[in a new window]
 
FIG. 1. AngII (A) and leptin (B) release from isolated white adipocytes of control and captopril-treated rats. Adipocytes were prepared from control and captopril-treated rats and AngII and leptin concentrations in the media (60-min incubation) were determined as described in Materials and Methods. A, Adipocytes released AngII, which was significantly decreased in adipocytes prepared from captopril-treated rats. B, Leptin release into the media from the same adipocytes as in A, above, was decreased in captopril-treated rats. Data are mean ± SEM from n = 5 rats/treatment group. *, Significantly different from control (P < 0.05).

 


View larger version (10K):
[in this window]
[in a new window]
 
FIG. 2. Exogenous AngII increases leptin release from rat adipocytes in a concentration-dependent manner. Adipocytes were prepared from rats, and the leptin concentration in the media (60 min incubation) was determined as described in Materials and Methods. AngII resulted in a concentration-dependent increase in leptin release from adipocytes with an EC50 of 0.16 ± 0.04 nM. Data are mean ± SEM from n = 5 rats.

 
Effect of chronic infusion of AngII on plasma leptin and adipocyte leptin release
We determined the time-dependent effect of infusion of saline or AngII (175 ng/kg·min for 1, 2, or 7 d) on plasma leptin concentration and adipocyte leptin release. Plasma leptin concentration was significantly decreased by d 2 of AngII infusion, compared with control (Fig. 3Go). Isolated adipocytes were prepared from rats in each group (saline, AngII) and at each time point (1, 2, or 7 d). Basal leptin release from adipocytes of rats infused with AngII for 1 d was significantly increased, compared with control (Fig. 4Go). Thereafter, leptin release from adipocytes of AngII-infused rats progressively decreased and was significantly reduced, compared with saline-infused controls on d 7 (Fig. 4Go). Moreover, adipocytes from AngII-infused rats exhibited a progressive reduction in AngII (100 nM)-mediated leptin release (Fig. 4Go).



View larger version (30K):
[in this window]
[in a new window]
 
FIG. 3. Chronic infusion of AngII decreases plasma leptin concentration. Rats were infused with saline or AngII (175 ng/kg·min) for 1, 2, or 7 d. Plasma leptin concentration decreased over the time course of AngII infusion and was significantly decreased, compared with saline on d 2 and 7. Data are mean ± SEM from n = 5 rats/time point per group. *, Significantly different from saline (P < 0.05).

 


View larger version (18K):
[in this window]
[in a new window]
 
FIG. 4. Chronic infusion of AngII alters leptin release from isolated white adipocytes. Rats were infused with saline or AngII (175 ng/kg·min) for 1, 2, or 7 d. Epididymal adipocytes were prepared as described in Materials and Methods and incubated in the absence (0) or presence of AngII (100 nM) for 60 min, and leptin release into the media was determined by RIA. In adipocytes from 1 d AngII-infused rats, basal leptin release was significantly increased. With more chronic AngII exposure, basal leptin release diminished and was significantly decreased, compared with saline on d 7 of AngII infusion. Incubation of adipocytes with exogenous AngII resulted in an increase in leptin release in saline and 1 d AngII-infused rats. The ability of AngII to stimulate leptin release was significantly decreased, compared with saline control on d 2 and 7 of AngII infusion. Data are mean ± SEM from n = 5 rats/time point per group. *, Significantly different from saline (P < 0.05).

 
To define mechanisms contributing to reductions in plasma leptin concentration and AngII-induced leptin release, we determined the effect of sympathetic blockade with AMPT on adipose tissue NE turnover and plasma leptin concentration in saline and AngII-infused rats (175 ng/kg·min for 7 d; n = 15 rats/group, saline vs. AngII). Infusion of AngII for 7 d resulted in an increase in systolic blood pressure, compared with baseline values (data not shown) and compared with saline and pair-fed controls (saline: 135 ± 5; pair-fed: 142 ± 5; AngII: 176 ± 9 mm Hg, P < 0.05). Organ weights (kidney, heart, liver, EF), compared in terms of absolute wet weight or as a percentage of body weight, were not different between groups (data not shown). The concentration of NE in plasma was increased following 7 d of AngII infusion (saline, 131 ± 26; AngII, 228 ± 15 pg/ml; P < 0.05). The NE concentration in EF was not altered by 7 d of AngII infusion, compared with saline controls (saline, 11 ± 2; AngII, 13 ± 1 pg/mg). After blockade of NE synthesis with AMPT, the tissue NE concentration declined exponentially with time as evidenced by a linear decrease in log[NE] vs. time (correlation coefficient > 0.90; data not shown). The slope of this relationship, indicating the rate of NE disappearance, was significantly greater in EF from AngII-infused rats, compared with saline (saline, 0.088 ± 0.022; AngII, 0.134 ± 0.05; P < 0.05). In contrast, in the kidney there was no difference in the rate of NE disappearance between saline and AngII-infused rats (saline, 0.16 ± 0.03; AngII, 0.15 ± 0.05).

Plasma leptin concentration was significantly decreased in AngII-infused rats, compared with saline controls (Fig. 5Go, time 0). After sympathetic blockade with AMPT, the plasma concentration of leptin increased significantly in each group. However, differences in plasma leptin between saline- and AngII-infused rats were no longer evident in rats treated with AMPT (4 and 8 h; Fig. 5Go).



View larger version (13K):
[in this window]
[in a new window]
 
FIG. 5. The effect of sympathetic blockade with AMPT on plasma leptin concentration in saline and AngII-infused rats. Rats were infused with saline or AngII (175 ng/kg·min) for 7 d. On d 7, rats in each group were subdivided and administered either saline (0) or AMPT and killed at 4 and 8 h. Chronic infusion of AngII significantly decreased plasma leptin concentration (time 0). Sympathetic blockade with AMPT resulted in an increase in plasma leptin concentration over time in each group. Moreover, sympathetic blockade with AMPT eliminated differences in plasma leptin concentration between saline and AngII-infused rats. Data are mean ± SEM from n = 5 rats/group per time point after AMPT. *, Significantly different from saline at time 0 (P < 0.05); **, Significantly different from time 0 within group.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In this study we found that inhibition of AngII synthesis and release from adipocytes by treatment with an ACE inhibitor decreases leptin release from rat epididymal adipocytes. Moreover, exogenously applied AngII stimulates leptin release from isolated adipocytes and increases leptin mRNA expression. Collectively, these results suggest that endogenously produced AngII directly stimulates leptin release from adipocytes. To define the effect of elevated systemic AngII on leptin, we infused rats with AngII for various times and determined that initial elevations in basal and AngII-stimulated adipocyte leptin release were followed by declines. Coincident with declines in adipocyte and plasma leptin concentrations, catecholamine turnover in adipose tissue was increased by AngII. Moreover, blockade of the sympathetic nervous system in AngII-infused rats eliminated differences in plasma leptin concentration between saline- and AngII-infused rats. These results suggest that under normal conditions, endogenously produced AngII stimulates leptin. With pathophysiologies associated with elevated systemic AngII, the predominant effect is reductions in leptin through AngII-induced sympathetic stimulation.

A variety of evidence demonstrates the localization of components of the renin-angiotensin system to rodent and human adipose tissue (for review, see Ref.13). Angiotensinogen, the only known precursor to AngII, is expressed at a high level in rat adipose tissue (1, 2, 3) and isolated or cultured adipocytes (22). Although previous studies (4) in our laboratory suggested that the renin gene was not expressed in rat brown adipose tissue, several investigators (6, 13) have demonstrated renin-like activity in white adipocytes and adipose tissue homogenates. ACE has been localized to adipose tissue (5, 6), thereby completing the enzymatic requirements for synthesis of AngII. Finally, both the angiotensin II type 1 (AT1) and the type 2 receptor have been localized to adipocytes and preadipocytes (10, 11, 23, 24). Therefore, a variety of evidence supports the presence of components necessary for AngII production in adipose tissue (for review see Ref.13). In contrast, relatively few studies have focused on angiotensin peptide formation and release from adipocytes. Our results demonstrate that rat adipocytes release primarily AngII, with easily detectable levels of AngII present within 1 h of incubation of primary isolates of white adipocytes. Angiotensin III and AngIV were also detected in the media from incubated adipocytes; however, levels of these angiotensin peptides were minimal (<2% of total angiotensins), compared with AngII. These results are in agreement with recent findings demonstrating the release of predominately AngII from human preadipocytes and adipocytes (9).

In this study systemic inhibition of ACE with captopril resulted in a marked reduction in adipocyte AngII release, demonstrating that ACE contributes to adipocyte AngII production. In cultured 3T3-F442A adipocytes, Saye et al. (7) demonstrated cell-dependent production of AngII, which was not influenced by inhibition of ACE. In adipose tissue extracts, Harp and DiGirolamo (24) demonstrated ACE activity that was inhibited in the presence of captopril. We did not examine the effect of in vitro captopril on adipocyte AngII release; therefore, it is conceivable that reductions in adipocyte AngII release in captopril-treated rats in this study resulted from a reduced level of systemic AngII peptides taken up and stored in adipocytes. However, given that the release of AngII into the media of incubated adipocytes increased with the duration of incubation, results from this study suggest that AngII in the media from incubated adipocytes represents locally produced peptide formed through enzymatic conversion by ACE.

In adipocytes exhibiting reductions in AngII release from captopril treatment, parallel reductions in adipocyte leptin release and plasma leptin concentration were demonstrated. Inhibition of ACE can alter several bioactive peptides; thus, we determined that a selective AT1 receptor antagonist resulted in a similar decline in plasma leptin concentration. These results demonstrate that endogenous AngII regulates leptin release through effects at the AT1 receptor. To confirm a direct effect of AngII to regulate leptin, we incubated adipocytes with exogenous AngII and demonstrated high potency AngII-induced increases in leptin release from adipocytes. The sensitivity of adipocytes to AngII (subnanomolar) for regulation of leptin release, coupled with the finding that adipocytes release AngII, suggests that AngII regulation of leptin is physiologically relevant. Finally, elevations in leptin mRNA expression by AngII suggest that rather than alter mechanisms for release of leptin, AngII stimulates leptin gene expression. Our results are in agreement with previous findings demonstrating high potency of exogenous AngII to elicit the release of leptin from human and 3T3-L1 adipocytes (17). In addition, these results extend previous findings by demonstrating that reductions in endogenously produced AngII modulate leptin release from adipocytes.

Many disease states associated with the metabolic syndrome exhibit alterations in leptin and/or AngII, including obesity, hypertension, and atherosclerosis. Thus, we determined whether systemic infusion of AngII, to mimic activation of the renin-angiotensin system, resulted in similar effects on adipocyte leptin release. Similar to initial findings, basal and AngII-stimulated release of leptin from isolated adipocytes prepared from AngII-infused rats was initially enhanced (1 d). However, with chronic AngII exposure, both basal and AngII-stimulated leptin release progressively declined and was paralleled by reductions in circulating leptin. A well-known effect of AngII is facilitation of the sympathetic nervous system, which contributes to the control of blood pressure (25). A variety of evidence demonstrates that the sympathetic nervous system negatively regulates leptin synthesis and secretion from adipose tissue (26, 27, 28, 29). For example, reductions in sympathetic drive (through ganglionic blockade or inhibition of NE synthesis) increase leptin gene expression and production (27, 29). Alternatively, in states of high sympathetic drive, such as cold exposure, leptin gene expression in adipose tissue is reduced (30). We sought to determine whether sympathetic stimulation to adipose tissue from chronic AngII exposure contributes to the observed reductions in leptin. Our approach was to examine declines in adipose tissue NE concentration and plasma leptin concentration after AMPT, which inhibits NE synthesis and thereby produces sympathetic blockade. An interesting finding from the present study is that AngII infusion increased the rate of NE decline (catecholamine turnover) in white adipose tissue, but not in kidney, demonstrating the sensitivity of AngII-induced sympathetic activation to adipose tissue.

Previous studies demonstrated that AMPT administration to normal rats increased plasma leptin concentration, leptin gene expression in adipose tissue, and complex tissue and subtype-specific modulation of adipose uncoupling protein mRNA expression (27). However, adipose tissue catecholamine content was not measured in previous studies. In agreement with previous findings, results from this study demonstrate an increase in plasma leptin concentration after AMPT administration to saline-infused rats. These results support the previously defined inhibitory role of the sympathetic nervous system in the regulation of leptin. Importantly, in rats infused with AngII, sympathetic blockade with AMPT eliminated differences in plasma leptin concentration between saline- and AngII-infused rats. Taken together with results demonstrating increased adipose catecholamine turnover in AngII-infused rats, these results suggest that chronic elevations in systemic AngII increased sympathetic drive to adipose tissue, thereby decreasing adipocyte leptin synthesis and release.

In summary, results from this study demonstrate that rat white adipocytes release AngII, which is reduced by in vivo inhibition of angiotensin converting enzyme. Reductions in locally released AngII through inhibition of angiotensin converting enzyme were associated with parallel reductions in adipocyte leptin release and plasma leptin concentration. Moreover, exogenously applied AngII directly increased leptin mRNA expression and release from adipocytes. These results demonstrate that under basal conditions, adipocyte-derived AngII stimulates leptin release. However, when AngII is elevated systemically, negative regulation of leptin through sympathetic stimulation overwhelms the direct stimulatory effect of AngII. Future studies will determine the impact of interactions between these factors in diseases of the metabolic syndrome.


    Footnotes
 
This work was supported by NIH Grants HL52987 and HL64121.

Abbreviations: ACE, Angiotensin-converting enzyme; AMPT, {alpha}-methyl-p-tyrosine methyl ester; AngII, Angiotensin II; AngIII, Angiotensin III; AngIV, Angiotensin IV; Ang4–8, Angiotensin 4–8; AT1, AngII type 1; EF, epididymal white fat; NE, norepinephrine; TFA, trifluoroacetic acid.

Received June 19, 2003.

Accepted for publication September 15, 2003.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Campbell DJ, Habener JF 1987 Cellular localization of angiotensinogen gene expression in brown adipose tissue and mesentery: quantification of messenger ribonucleic acid abundance using hybridization in situ. Endocrinology 121:1616–1626[Abstract]
  2. Cassis LA, Lynch KR, Peach MJ 1988 Localization of angiotensinogen messenger RNA in rat aorta. Circ Res 62:1259–1262[Abstract/Free Full Text]
  3. Cassis LA, Saye J, Peach MJ 1988 Location and regulation of rat angiotensinogen messenger RNA. Hypertension 11:591–596[Abstract/Free Full Text]
  4. Shenoy U, Cassis L 1997 Characterization of renin activity in brown adipose tissue. Am J Physiol 272:C989–C999
  5. Campbell DJ, Kladis A, Duncan AM 1994 Effects of converting enzyme inhibitors on angiotensin and bradykinin peptides. Hypertension 23:439–449[Abstract/Free Full Text]
  6. Pinterova L, Krizanova O, Zorad S 2000 Rat epididymal fat tissue express all components of the renin-angiotensin system. Gen Physiol Biophys 19:329–334[Medline]
  7. Saye JA, Ragsdale NV, Carey RM, Peach MJ 1993 Localization of angiotensin peptide-forming enzymes of 3T3–F442A adipocytes. Am J Physiol 26:C1570–C1576
  8. Cassis LA 1994 Angiotensin II in brown adipose tissue from young and adult Zucker obese and lean rats. Am J Physiol 266:E454–E458
  9. Schling P, Schafer T 2002 Human adipose tissue cells keep tight control on the angiotensin II level in their vicinity. J Biol Chem 277:48066–48075[Abstract/Free Full Text]
  10. Crandall DL, Herzlinger HE, Saunders BD, Armellino DC, Kral JG 1994 Distribution of angiotensin II receptors in rat and human adipocytes. J Lipid Res 35:1378–1385[Abstract]
  11. Cassis LA, Fettinger MJ, Roe AL, Shenoy UR, Howard G 1996 Characterization and regulation of angiotensin II receptors in rat adipose tissue. Angiotensin receptors in adipose tissue. Adv Exp Med Biol 396:39–47[Medline]
  12. Engeli S, Gorzelhiak K, Kreutz R, Runkel N, Distler A, Sharma AM 1999 Co-expression of renin-angiotensin system genes in human adipose tissue. J Hypertens 17:555–560[CrossRef][Medline]
  13. Engeli S, Negrel R, Sharma AM 2000 Physiology and pathophysiology of the adipose tissue renin-angiotensin system. Hypertension 35:1270–1277[Abstract/Free Full Text]
  14. Goossens GH, Blaak EE, van Baak MA 2003 Possible involvement of the adipose tissue renin-angiotensin system in the pathophysiology of obesity and obesity-related disorders. Obes Rev 4:43–55[CrossRef][Medline]
  15. Engeli S, Schling P, Gorzelniak K, Boschmann M, Janke J, Ailhaud G, Teboul M, Massiera F, Sharma AM 2003 The adipose-tissue renin-angiotensin-aldosterone system: role in the metabolic syndrome? Int J Biochem Cell Biol 35:807–825[CrossRef][Medline]
  16. Massiera F, Bloch-Faure M, Ceiler D, Murakami K, Fukamizu A, Gasc JM, Quignard-Boulange A, Negrel R, Ailhaud G, Seydoux J, Meneton P, Teboul M 2001 Adipose angiotensinogen is involved in adipose tissue growth and blood pressure regulation. FASEB J 15:2727–2729[Free Full Text]
  17. Kim S, Whelan J, Claycombe K, Reath BD, Moustaid-Moussa N 2002 Angiotensin II increases leptin secretion by 3T3–L1 and human adipocytes via a prostaglandin-independent mechanism. J Nutr 132:1135–1140[Abstract/Free Full Text]
  18. Cassis LA, Marshall DE, Fettinger MJ, Rosenbluth B, Lodder RA 1998 Mechanisms contributing to angiotensin II regulation of body weight. Am J Physiol 274:E867–E876
  19. Brodie BB, Costa E, Dlabac A, Neff NH, Smookler HH 1966 Application of steady state kinetics to the estimation of synthesis rate and turnover time of tissue catecholamines. J Pharmacol Exp Ther 154:493–498[Abstract/Free Full Text]
  20. Cassis LA, Stitzel RE, Head RJ 1988 Influence of cold-induced increases in sympathetic nerve activity on norepinephrine content in the vasculature of the spontaneously hypertensive rat. Blood Vessels 25:82–88[Medline]
  21. King VL, Dwoskin LP, Cassis LA 1999 Cold exposure regulates the norepinephrine uptake transporter in rat brown adipose tissue. Am J Physiol 276:R143–R151
  22. Saye JA, Cassis LA, Sturgill TW, Lynch KR, Peach MJ 1989 Angiotensinogen gene expression in 3T3–L1 cells. Am J Physiol 256:C448–C451
  23. Mallow H, Trindl A, Loffler G 2000 Production of angiotensin II receptor type one (AT1) and type two (AT2) during the differentiation of 3T3–L1 preadipocytes. Horm Metab Res 32:500–503[Medline]
  24. Harp JB, DiGirolamo M 1995 Components of the renin-angiotensin system in adipose tissue: changes with maturation and adipose mass enlargement. J Gerontol A Biol Sci Med Sci 50:B270–B276
  25. English V, Cassis L 1999 Facilitation of sympathetic neurotransmission contributes to angiotensin II regulation of body weight. J Neural Transm 106:631–644[CrossRef]
  26. Rayner DV, Trayhurn P 2001 Regulation of leptin production: sympathetic nervous system interactions. J Mol Med 79:8–20[CrossRef][Medline]
  27. Sivitz WI, Fink BD, Morgan DA, Fox JM, Donohoue PA, Haynes WG 1999 Sympathetic inhibition, leptin and uncoupling protein subtype expression in normal fasting rats. Am J Physiol 277:E668–E677
  28. Mark AL, Rahmouni K, Correia M, Haynes WG 2003 A leptin-sympathetic-leptin feedback loop: potential implications for regulation of arterial pressure and body fat. Acta Physiol Scand 177:345–349[CrossRef][Medline]
  29. Rayner DV, Simon E, Duncan JS, Trayhurn P 1998 Hyperleptinemia in mice induced by administration of the tyrosine hydroxylase inhibitor {alpha}-methyl-p-tyrosine. FEBS Lett 429:395–398[CrossRef][Medline]
  30. Puerta M, Abelenda M, Rocha M, Trayhurn P 2002 Effect of acute cold exposure on the expression of the adiponectin, resistin, and leptin genes in rat white and brown adipose tissues. Horm Metab Res 34:629–634[CrossRef][Medline]



This article has been cited by other articles:


Home page
CirculationHome page
K. K. Koh, S. M. Park, and M. J. Quon
Leptin and Cardiovascular Disease: Response to Therapeutic Interventions
Circulation, June 24, 2008; 117(25): 3238 - 3249.
[Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
A. T. Lely, J. A. Krikken, S. J. L. Bakker, F. Boomsma, R. P. F. Dullaart, B. H. R. Wolffenbuttel, and G. Navis
Low Dietary Sodium and Exogenous Angiotensin II Infusion Decrease Plasma Adiponectin Concentrations in Healthy Men
J. Clin. Endocrinol. Metab., May 1, 2007; 92(5): 1821 - 1826.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
H. Lu, C. M. Boustany-Kari, A. Daugherty, and L. A. Cassis
Angiotensin II increases adipose angiotensinogen expression
Am J Physiol Endocrinol Metab, May 1, 2007; 292(5): E1280 - E1287.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
M. Paul, A. Poyan Mehr, and R. Kreutz
Physiology of local Renin-Angiotensin systems.
Physiol Rev, July 1, 2006; 86(3): 747 - 803.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
A. Zeidan, D. M. Purdham, V. Rajapurohitam, S. Javadov, S. Chakrabarti, and M. Karmazyn
Leptin Induces Vascular Smooth Muscle Cell Hypertrophy through Angiotensin II- and Endothelin-1-Dependent Mechanisms and Mediates Stretch-Induced Hypertrophy
J. Pharmacol. Exp. Ther., December 1, 2005; 315(3): 1075 - 1084.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
R. Kouyama, T. Suganami, J. Nishida, M. Tanaka, T. Toyoda, M. Kiso, T. Chiwata, Y. Miyamoto, Y. Yoshimasa, A. Fukamizu, et al.
Attenuation of Diet-Induced Weight Gain and Adiposity through Increased Energy Expenditure in Mice Lacking Angiotensin II Type 1a Receptor
Endocrinology, August 1, 2005; 146(8): 3481 - 3489.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
A. Cabassi, P. Coghi, P. Govoni, E. Barouhiel, E. Speroni, S. Cavazzini, A. M. Cantoni, R. Scandroglio, and E. Fiaccadori
Sympathetic Modulation by Carvedilol and Losartan Reduces Angiotensin II-Mediated Lipolysis in Subcutaneous and Visceral Fat
J. Clin. Endocrinol. Metab., May 1, 2005; 90(5): 2888 - 2897.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
G. S. Gopalakrishnan, D. S. Gardner, S. M. Rhind, M. T. Rae, C. E. Kyle, A. N. Brooks, R. M. Walker, M. M. Ramsay, D. H. Keisler, T. Stephenson, et al.
Programming of adult cardiovascular function after early maternal undernutrition in sheep
Am J Physiol Regulatory Integrative Comp Physiol, July 1, 2004; 287(1): R12 - R20.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
145/1/169    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cassis, L. A.
Right arrow Articles by Boustany, C. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cassis, L. A.
Right arrow Articles by Boustany, C. M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals